Influence of WFIKKN1 on BMP1-Mediated Activation of Latent

Immunoglobulin, KunitzKunitz 1, and 2 NTR domains; Follistatin, WAP, containing proteins WFIKKN2 multidomain – and WFIKKN1 domains; WAP,FollistatinImmunoglobulin andWFIKKN1terminal protein,containing its of half This article is protected by co by isprotected article This Accepted10.1111/febs.13938 and the Version version this between differences through the copyediting, typesetting, paginati been not has but review peer full undergone and publication for accepted been has article This PMSF –phenylmethylsulfonyl fluoride; TGF myostatin; latent terminal half WFIKKN1of protein, containing its Kunitz 1, Kunitz 2 andNTR domains; LM Act RIIB Abbreviations: WFIKKN1; myostatin; myostatin; BMP1; latent heparin; Keywords: Article type Paper : Regular Article Influence of WFIKKN1 on BMP1-mediated activation of latent myostatin myostatin latent of activation BMP1-mediated on WFIKKN1 of Influence Instituteof Enzymology, Research Centre for Natural Sciences, HungarianAcademy ofSciences, − activin receptor IIB; BMP1 receptor activin Running WFIKKN1 andtitle: BMP1-activation of latent myostatin MSTN György Szláma, Viktor Vásárhelyi, Mária Trexler, László Patthy Correspondingauthor: László Patthy, Tel: (361) 382 6751

− myostatin gene; PCPE-1 Budapest, P.O. Box286, H-1519, Hungary pyright. All rights reserved. reserved. rights All pyright. e-mail: [email protected] − bone morphogenetic protein 1; KKN1 – The C- The – KKN1 1; protein morphogenetic bone on and proofreading process,which may lead to − transforminggrowth factor; WFI1 – The N-

of Record. Please cite this article as doi: asdoi: article this cite Please Record. of − Procollagen C-Proteinase Enhancer-1; −

This article is protected by co by isprotected article This In viewofits unclear. remained interactions prodomainregions of promyostatin andmyostatinlatent but the biologicalsignificance these of TheNTRWFIKKN1domain of protein has beento have shown significantaffinity for the Abstract BMP1, bone morphogentic proteinor1 procollagen C-endopeptidase: EC3.4.24.19 furin: EC 3.4.21.75; Enzymes: Accepted reactan ofthe concentrations increase thelocal latent myostatin andhaveaffinity BMP1 forheparin andthese interactionsheparin with pres the in superstimulated is KKN1 of activity cleavage sites more accessible to BMP1. On the other hand, the observation that the enhancer the making form, toamore open homodimer the of circular structure myostatin the closed from latent of equilibrium aconformational shifts it is that fragment KKN1 the of activity enhancer accessible toBMP1.In view of observation this most the plausibleexplanationfor the BMP1- readily not and sites areburied BMP1-cleavage the that revealed myostatin latent homodimeric the observed enhancer activity. Analysis of a proTGF- to significantly most contributes WFIKKN1 of by BMP1-cleavage generated fragment KKN1 the that shown have studies our and BMP1 by cleaved was also WFIKKN1 Unexpectedly, by heparin. was superstimulated activity enhancer this WFIKKN1 and of presence myostatin by BMP1 oflatent cleavage rate of bythe furin, promyostatin processing of on effect have no WFIKKN1to found was myostatin. ArticleassumptionWFIKKN1 that the inhibits release of pyright. All rights reserved. rights All pyright. role as a myostatin anta as amyostatin role , however, was enhancedsignificantly in the ts thereby facilitating the action of BMP1. ofBMP1. action facilitating the ts thereby ence of heparin is explained by the fact KKN1, byKKN1, the fact is explained ofheparin ence myostatin from promyostatin and/or latent latent and/or promyostatin from myostatin β -based homologymodel of

gonist we tested the This article is protected by co by isprotected article This 1. Introduction non-covalent myostatin/prodomain complex is referred to as latent myostatin [12, 13]. 13]. [12, myostatin latent as referred is to complex myostatin/prodomain non-covalent the RIIB, Act receptor, myostatin the to bind not does complex myostatin/prodomain the Since factor domains remain associated, forming a non-covalent myostatin/prodomain complex [12]. themyostatinmyostatin: to therelease active of lead not does however, promyostatin, of Furin cleavage [11]. strength muscle lower and obesity rate the increases significantly that promyostatin is underlinedby observation the that the commonK153R polymorphism of human terminal growth factor domain. The importance of cleave both chains of precursor the at boundary the the ofN-terminal prodomainand the C- released from promyostatin by proteolytic processing.First, furin type proprotein convertases myostatin(corresponding the covalently to homodimericlinked, growthfactor domain) is linked through asingle disulfidebond present C-terminal inthe growth factor domain.Active prodomainand a C-terminalgrowth factor domainIn [10]. promyostatin two moleculesare [8-9]. reduced tissue adipose size significantly is development, myostatin isalso involved re in human and dog cattle, mice, in hypermuscularity cause to shown also were myostatin mature of formation the with interfere gene that Mutations muscle by a masscharacterized increase insignificant skeletal of [1]. the myostatin

Accepted Article Myostatinmyostatin growth: are muscle mice skeletal of is anegative regulator lacking Myostatin is synthesized as an inactive precursor protein, containing an N-terminal N-terminal an containing protein, precursor an inactive as synthesized is Myostatin pyright. All rights reserved. rights All pyright. prodomains and disulfide-bonded the growth gulation of adipose tissue: mice Mstn-/- in of proteolysis its isassociatedfurin with by this stepinthecontrol ofmyostatinthis activity [2-7]. In[2-7]. role to addition inmuscle its

This article is protected by co by isprotected article This Acceptedwild type animals [20, 21]. to compared muscles larger have protein WFIKKN2 overexpressing mice transgenic that and mass muscle in increase 30% approx. an in resulted mice of muscles the into gene WFIKKN2 as a key regulator myostatinof activity is supported by the observation that delivery of protein WFIKKN2 of significance physiological The [19]. protein FLST3/FLRG or follistatin WFIKKN2and havehigher specificity formyos genes were also shown have to affinity high myostatin for [17-18].Significantly, WFIKKN1 gene, FLRG). related another inhibitory binding protein,FSTL3/FLRG the protein (the product of the follistatin- Hill Furthermore, [12]. Article ofmyostatin inhibitor fol that to show the first were McPherron Lee and mass[15]. muscle in increase significantmyostatin exhibit rendersmutation prodomain the carrying that a BMP1-resistant myostatin for of the release mature myostatin myostatin/prodomain complex [14].key The importance of BMP1-mediated cleavage of latent family that cleave the prodomainmyostatin, of thereby disrupting the non-covalent Two other follistatin-related proteins, theproducts ofthe Several myostatin exist antagonists that ma Active myostatinmy from latent isreleased pyright. All rights reserved. rights All pyright. et al. is supported is byobservation the micethat listatin, an activin antagonist, is also a potent alsoa is antagonist, anactivin listatin, tatin (and the closely related GDF-11) than GDF-11) related closely tatin (and the [16]myostatinhave shown bound that is to ycontrol theactivity myostatin.mature of ostatin by proteases of the BMP1/Tolloid

WFIKKN1 and WFIKKN2

This article is protected by co by isprotected article This W proteins these of names The 23]. [22, domain domain, containWAP domain, an Immunoglobulin domain, two Kunitzdomains and an NTR Acceptedaffinityfor these proteins, suggestingthe NTR/prodomain that interaction mediates the whereasWFIKKN1 affinity has forboth promyostatin andmyostatin, latentWFIKKN2 had no myostatin: latent and promyostatin with interactions intheir WFIKKN2 is also reflected significant affinity formyostatin prodomain 26]. [18, This WFIKKN1between difference and [25]. domain Kunitz-type second to was assigned their WFIKKN proteins of activity plasminogen activator, furin and BMP1 [24].At the domain level, the trypsin inhibitory activities of bovine elastase, chymotrypsin, tissue-type plasminogen activator, urokinase-type inhibit the proteolytic activity bovine of trypsin but they had no effect on the peptidolytic to werefound WFIKKN proteins Full-length [22-24]. inhibitors asprotease function also might proteins WFIKKN of domains corresponding the that hypothesized wehave proteases types of Article types. domain other ofthe function the about known primarily the myostatin responsible for activity is antagonist 24], 19, [18, butrelatively little protein. WFIKKN1 the of architecture domain the of representation schematic a we show AP, F WFIKKN1 and WFIKKN2 are closely related proteins that, in addition Follistatin to a addition in that, proteins related areclosely WFIKKN2 and WFIKKN1 Interestingly, NTRdomainthe WFIKKN1 of not(butWFIKKN2) of was found tohave SinceWAP, Kunitz and NTR domains have been implicated ininhibition of various are domains Follistatin their that revealed have WFIKKN proteins these on studies Our ollistatin, ollistatin, I mmunoglobulin, pyright. All rights reserved. rights All pyright. K unitz, unitz, K unitz and refer tothelinearrefer sequenc

N TR domains[22, 23].In e oftheirconstituente Figure 1

the presence of WFIKKN1 of the presence when Unexpectedly, heparin. by superstimulated of the presence in enhanced significantly cleavage of promyostatin. The rate cleavage of of latentmyostatin by BMP1, however, was myostatin. latent of cleavage BMP1 and/or promyostatin of cleavage furin inhibit might prodomain myostatin the with WFIKKN1 This article is protected by co by isprotected article This Accepted myostatin [24]. e.g.may it interfere with the releasematuregrowth of factor from promyostatin and/or latent function, antimyostatic an serve also might myostatin latent and promyostatin with WFIKKN1 ArticleWFI and WFIKKN1 with myostatin propeptide, promyostatinlatent myostatin. and Inrole view oftheof WFIKKN1. binds subdomain C-terminal the whereas myostatin, mature prodomainconsists of two functionally distinct subdomains: the N-terminal subdomain binds in thematureinteraction prodomain ofthe with subdomain of myostatin prodomain, but not the N- C-terminal the WFIKKN1 binds that revealed interaction WFIKKN1-prodomain the of analysis Detailed 26]. [18, myostatin latent and promyostatin with WFIKKN1 of interaction Our studies have shown that WFIKKN1 has no influence on the rate of furin-mediated furin-mediated of rate the on influence no has WFIKKN1 that shown have studies Our The goal of our present work was toinvest goalThe present our of WFIKKN1 of interaction the of biological significance the is known about Very little KKN2 asmyostatin antagonists we havespeculated that the interactionof − pyright. All rights reserved. rights All pyright. concomitant with the cleavage of latent myostatin myostatin latent of cleavage the with concomitant WFIKKN1 and this this WFIKKN1 was enhancerand activity myostatin [26]. It thus appears that myostatinItappears thusmyostatin that [26]. latent myostatinlatent was with incubated BMP1 in terminal subdomain that playsa critical role igate the assumption that assumption the igate

the interactionof the − WFIKKN1 WFIKKN1 This article is protected by co by isprotected article This K the WFIKKN1 exceeded of concentration the and promyostatin, promyostatin and increase inthe amountofmyostatin prodomain. intact of the amount in decrease rateof the on influence any had WFIKKN2 nor WFIKKN1 analyzedSDSasPAGE described by inMaterials andMethods. Asin shown was composition their and points time various at withdrawn were samples proteins, WFIKKN2 interaction promyostatin-WFIKKN1 the by not affected is furin by promyostatin of cleavage of Rate 2.1. andDiscussion 2. Results myostatin. myostatin fromlatent thus promote theliberationofactive they synergistic that inthe sense latent of Cleavages activity. enhancer observed generated byWFIKKN1 BMP1-cleavage proteinmost of contributes significantly to the ( BMP1 by cleaved also was Accepted precursor. the site of furin-cleavage the shield not does promyostatin of prodomain the with WFIKKN1 of NTR-domain the of interaction precursor WFIKKN1/pis not in impaired the that theaccessibility suggests cleavage furin rate of the on influence WFIKKN1’s of lack the [26], interaction WFIKKN1/promyostatin Article Since in these experiments we employed a molar excess of WFIKKN1 over over WFIKKN1 of excess molar a employed we theseSince experiments in and WFIKKN1 of absence and presence in the furin with wasdigested Promyostatin pyright. All rights reserved. rights All pyright. Figure 1 Figure ). Our studies have shown that the KKN1 fragment myostatinWFIKKN1 and protein by areBMP1 of the furin-cleavage site of the myostatin the of site of thefurin-cleavage romyostatin complex. In other words, the

d Figure 2 value of the , neither This article is protected by co by isprotected article This ( myostatin prodomainwas byBMP1 significan PAGE as describedMaterialsin Methods. and As shown in concentrations (0.5-4 WFIKKN1 of with cleavage concomitant WFIKKN1 of 2.2. Rate of cleavageoflatent myostatin by BMP1 issignificantly enhanced in presence the BMP1-cleavage. by generated fragment(s) WFIKKN the of or WFIKKN1 full-length cleavageis not clear butit whethertheenhancer prodomainmyostatin [ oflatent is slightly, but significantly (P <0.01, Student’s t test) enhanced in the presence of heparin. BMP1 by WFIKKN1 of cleavage of rate the that shown has gels the of evaluation Quantitative band withan apparentMr of~30kDa appeared ( a diffuse by~ BMP1 60kDa) (Mr WFIKKN1 of cleavage of aresult as by BMP1: cleaved also ofheparin. the presence ~0.5 by achieved ( mixture reaction the in included also Accepted ArticlepanelFigureB 3, Latent myostatin was digested with BMP1 These data indicate that theThese interacti that data indicate wasmyostatinWFIKKN1cleavage prodomain, withthe of Surprisingly, concomitant μ ), and this rate-enhancement was much more pronounced when heparin was M of WFIKKN1 in the absence of heparin and by ~1 and by ofheparin absence Min WFIKKN1 the of μ M) of WFIKKN1 protein and the samples were analyzed by SDS- by analyzed were samples the and WFIKKN1 protein M) of pyright. All rights reserved. rights All pyright. 18, 26] increases the susceptib 18, 26]increasesthe Figure 3, panel C on ofNTR-domain the WFIKKN1 of with the tly enhanced in the presence of WFIKKN1 WFIKKN1 of the presence in tly enhanced activity ismediated bythe NTR-domain of in the absence and presence of increasing ofincreasing presence in the and absence Figure 3, ). Half-maximal enhancer activity was activity enhancer ). Half-maximal

Figure 3, ility prodomain ofthe toBMP1- last two lanes in lanes in two last the rate of cleavage of of cleavage of rate the μ M of WFIKKN1 in in WFIKKN1 M of panel A panel ). This article is protected by co by isprotected article This (25 WFIKKN1 of bond Arg287-Asp288 the cleaves BMP1 2.3. C-terminal His-tag of the WFIKKN1 protein [18] was isolated by affinity chromatography on a on chromatography affinity by was isolated [18] WFIKKN1 protein the of His-tag C-terminal and digestioncontinued was for a 16ho total of 50 50 mM CaCl Acceptedaspartic acid in the P1’ position [27]. well S1’ fits in basic residue this of presence the pocket;S1’ the in (Arg176) arginine an is there ofBMP1 structure crystal Inthe position. P1’ the in Asp-residues for BMP1 of preference strict the with harmony in WFIKKN1 is of halves a protein. of C-terminal the and theN-terminal to corresponding respectively) generatesWFI1 andKKN1 fragments (calculated molecular masses: 28845 and 29181Da, Kunitz-domains of WFIKKN1 ( generatedby cleavagethe Arg287-Asp-288 of peptide bond. Article ofhuman 288-303 residues to corresponding DAAPSIPAPAEXLPDV acid sequence yielded amino the fragment kDa C-terminal μ μ l Ni-NTA Sepharose column and by SDS-PAGE. N-terminal sequence analysis of the ~30 ~30 the of analysis sequence N-terminal SDS-PAGE. by and column Sepharose l Ni-NTA g) with 2,5 To characterize the BMP1-cleavage site of WFIKKN1 we have incubated the protein protein the incubated have we WFIKKN1 of site BMP1-cleavage the characterize To Residues Arg287-Asp-288 are located between the Immunoglobulin and the first residue an aspartic of bond peptide N-terminal the cleaves BMP1 that observation The 2 , 1 μ M ZnCl μ g BMP1 in 100 2 , pH 7.5 at 37 pyright. All rights reserved. rights All pyright. Figure 1 Figure μ l of buffer containing 25 mM Tris-HCl, 150 mM NaCl, 5 o C for 6hours. Addition of BMP1 (2,5 ),thuscleavage this peptide of bond by BMP1 WFIKKN1 indicating that the fragment was was the fragment that indicating WFIKKN1 withthe known specificity ofBMP1 foran urs then the C-terminal fragment carrying the the carrying fragment C-terminal the then urs

μ g) was repeated g) wasrepeated This article is protected by co by isprotected article This TARNAAGLLRADFPLSVVQREPA 274-298, (residues region low-complexity a flexible in is WFIKKN1 determining whet bonds plays rolein animportant protein substrates ( of sites the cleavage adjoining at positions residues for preference little BMP1position, has by BMP1 ( by itssubstitution alfactsupported that the by Accepted by increasing unaffected practically was prodomain myostatin of cleavage theof rate B), (panel Figure 4 Asp288 residue with alanine torender theprotein resistant to BMP1-cleavage.As shown in WFIKKN1ofheparin inthe absence mutant D288A the by enhanced not is byBMP1 latent myostatin of ofcleavage Rate 2.4. BMP1. for accessible and isexposed WFIKKN1 protein of protein our data suggest that the linker region connectingN-terminal the and C-terminal halves about the position of the various regions inglobular-like the structure of thismultidomain cleavage. solutionst Although thelow-resolution keyplays roleinth region a disordered linker this of flexibility the that assume to plausible Itis WFIKKN1. of Kunitz-domain first the and Article It isnoteworthy respect in this the that cleavage BMP1 site Arg287-Asp288at of is to BMP1-cleavage susceptibility its for WFIKKN1 of Asp288 of The importance To decide whetherWFIKKN1 full-length has ra Figure 4, 4, Figure Table 1 whenlatent myostatin was digested BMP1 with intheabsence of heparin, last two lanes in twolanes in last and Figure 4 in [28]), suggesting that accessibilityFigure suggesting and 4in ofXaa-Asp that [28]), pyright. All rights reserved. rights All pyright. RD panel A AAPSIPAPAE) that connects Immunoglobulinthe anine rendered the protein resistant to cleavage resistant theprotein anine rendered e susceptibility thispeptidebond of toBMP1- ructure of WFIKKN1 [29] tells usvery [29] tells little WFIKKN1 ructureof ). Aside from its Asp-specificity at the P1’ the at Asp-specificity its from ). Aside her they serve as BMP1-cleavage sites [28]. [28]. sites asBMP1-cleavage serve they her te-enhancing activity we substituted the we substituted te-enhancing activity

This article is protected by co by isprotected article This mixture (compare enhancer activity KKN1 was of more pronounced when heparin was included inthe reaction ( activity enhancer has detectable also protein WFIKKN1 NTR-domainand favoring interaction its myostatinprodomain. with KKN1fromliberates the fragment myostatin prodomain.Accordingexplanation, to this cleavage WFIKKN1 of by BMP1 NTR- the render interactions inter-domain [29] WFIKKN1 of structure globular-like compact the in that is fragment KKN1 the than enhancer KKN1tested. of concentration lowest the KKN1, BMP1 inthe absence of heparin, recombinant KKN1 protein (0.5-4 full-length protein.In harmony with conclusion, this when myostatin latent was digested with heparin (see of absence the in WFIKKN1 protein type wild case the the of in observed rate enhancement concentrations (0.5-4 Accepted Article 0.5 by even achieved was activity enhancer maximal that fact the by isillustrated KKN1 enhancedrate thecleavage of ofmyostatin prodomain( It should be noted, however, that in the presence of heparin, the D288A mutant mutant D288A the heparin, of the presence that in however, noted, be It should an as active isless WFIKKN1 that observation the for explanation plausible most The Figurepanel B 3, panels B panels μ M) of D288A mutantWFIKKN1 protein, suggesting that the marked and pyright. All rights reserved. rights All pyright. ) is caused by the BMP1-cleavage product KKN1 and not the not and KKN1 product BMP1-cleavage the by caused ) is C of these interactions thereby increasing the accessibilitythe the of thereby increasing these interactions Figure 5). domain less accessible for interaction the with domain for less accessible

Figurepanel 5, B

Figure 4, panelC ). The efficiency of efficiency ). The μ M) significantly M) significantly ). Similarly, the). Similarly, μ M This article is protected by co by isprotected article This ( of homodimeric pro-TGF- cleavagesites of homodimericmyostatin laten [11]. the of BMP1- characteristics structural the we have analyzed myostatin latent cleavage of myostatin. 2.5. Molecular the enhancer basis of activityBMP1-activation of on KKN1 latent of [18,26]loosens ‘bowtie’, the shifting conformationalthe equilibrium fromcircular the prodomains myostatin of subdomains C-terminal the KKN1to of domain the NTR of binding isthat KKN1 of activity enhancer the for explanation plausible most The BMP1. by cleavage ( homodimer disk-like center the of a‘bowtie’. in precursor homodimeric β a four-stranded whereas chain, the same of monomer polypeptide the by buried and strands A four-stranded regions. structural three distinct that connectthetwo prodomains inthe homodimeric precursor.The‘arm domains’ consistof of theC-terminalhomodimer, parts whereas the of monomer growth-factor each shields and encircles that ‘straitjacket’ the provide Figure 6. Accepted5 and Article In the homologyof model homodimeric latent myostatin (based on thecrystal structure Toget aninsight into the molecular basis The loops containing BMP1-cleavage the of sites latent myostatin areburied inthe β 7 strands)and 7

). N-terminal parts of the two prodomains, consisting of the the consisting prodomains, of partsof two the N-terminal ). β α -strands β 2, 2, 1 [30]), themonomers two form a disk-like circular structure pyright. All rights reserved. rights All pyright. α 3 and Figure 6. Figure β 8 and 8 α 4 helices) isinclose4growth proximity helices) theof factor ), suggesting that they are not readily accessible to to accessible readily not are they that suggesting ), β 9 extend to link the two arm domains of the the of domains arm two the link to 9 extend the two prodomains provide the ‘arm domains’ of the enhancer activity of KKN1 on BMP1- on KKN1 of activity enhancer the of β -sheet (consisting of of (consisting -sheet

β -sheet (consisting of of (consisting -sheet β α 1, 1 and 1 and β 3, β α 6 and 2 helices, helices, 2 β 2, β β 10 4, D288A mutantWFIKKN1 ( This article is protected by co by isprotected article This proteins also have significant affinityforheparin. As shownin [32] haveaffinity for heparin andin the present work we have foundevidence WFIKKN1 that action of BMP1on latentmyostatin. It iswell are all bound toheparin and the increased local substrate.A key aspectmodel of this isthat BMP1, latent myostatinWFIKKN1 and proteins as myostatin latent with proteins, KKN1 and WFIKKN1_D288A of activity BMP1-enhancer [31]. c local the interactions increase III. Since procollagen via well as as PCPE-1 1/procollagen complex binds to heparin-likeglycosaminoglycans via the NTR domain of PCPE- this and affinity with high III C-propeptides procollagen the substrate to binds (PCPE-1). According to the model proposed Bekhouche by dependence ofthe BMP1-enhanceractivity Procollagenof C-Proteinase Enhancer-1 protein mediated activation of latent myostatin 2.6. Heparin-dependence of activitythe ofWFIKKN1 proteins as enhancers of BMP1- enzyme. the to accessible more sites cleavage BMP1 the making myostatin latent of form open more a toward structure Accepted for affinity higher has KKN1 Interestingly, heparin. immobilized for affinity KKN1 have Article We assume anthat analogousmodel mightexplain the heparin-dependence the of The heparin-dependence of the BMP1-enhancer activityWFIKKN1of ( Figure 4 Figure pyright. All rights reserved. rights All pyright. oncentrations of the reactants facilitating the actionof BMP1 facilitating reactants the oncentrations of ) and KKN1 ( KKN1 and ) established thatlatent established concentration of the re BMP1 also interacts with heparin, these Figure 5 Figure

et al. ) is reminiscent of the heparin- the of reminiscent ) is Figure 7, [31] the enhancer PCPE-1 myostatin [12] and BMP1 actants facilitates the facilitates actants both WFIKKN1 and WFIKKN1 and both Figure 3 Figure ), This article is protected by co by isprotected article This Acceptedprotein expression. propagation during DNA manipulation steps, and Germany). Duren, kit (Macherey-Nagel, purification DNA Extract Nucleospin with waspurified USA). DNA Clara,CA Santa Inc. Technologies, (Agilent kit mutagenesis Quickchange with wasperformed reaction mutagenesis The strains proteins, primers, bacterialPCR enzymes, 3.1. Reagents, 3. Materials andMethods fromlatent myostatin complex. Articlemyostatinin thesense that thussynergistic are latent and protein WFIKKN1 of BMP1-cleavage myostatin. latent of BMP1-activation KKN1 isapotent heparin-dependent offragment generatingenhancer that theC-terminal myostatin prodomain, alsobut by increasingtheheparin affinitytheenhancer. of enhancer complex, not onlyincreasingby the of formation the WFIKKN1 favors of BMP1-cleavage that seems likely it findings these Inview of site. the heparin-binding bury may partially protein WFIKKN1 globular compact the of interactions intramolecular that suggesting protein, full-length the than heparin IA, USA). (Coralville, Integrated Technologies DNA were from Mutagenesis primers by BMP1 is cleaved WFIKKN1 that shown have we work present the in Insummary, pyright. All rights reserved. rights All pyright. the accessibility of theNTR-domain for the theypromote theliberation ofmyostatin active E. coli

E. coli E. BL21(DE3) strain was used for JM109 was usedfor DNA This article is protected by co by isprotected article This Accepted S2 pMT/BiP/WFIKKN1_D288A was used to produce stable transfected plasmid the and sequencing DNA by was confirmed mutation the of presence The protein. C changeat position 863of the humanWFIKKN1 cDNA causing theD288A mutationinthe protein [18] was the template in the mutagenesisreaction. Themutagenesis introduced anA to Drosophila 5’GGATGCTGGGGGCTGCGGCCCTGGCCGGCTC method with Mutagenesis Site-Directed QuikChange with Mutagenesis wasperformed senseand the5’CGAGAGCCGGCCAGGGCCGCAGCCCCCAGCATCC3’ cells 3.2. Production of humanD288Aof mutant S2 the WFIKKN1inDrosophila melanogaster Article and protein expressionwere fromInvitrogen/ThermoFisher Scientific. Theculture media and fetal bovine serum used fo Hungary). (Budapest, Sciences Life Healthcare GE from Louis,MO, USA), were commercial products. HiTrap Heparin HP columns were obtained St (Sigma-Aldrich, heparin and Germany) Darmstadt, Millipore, I (Merck Inhibitor Furin produced as described previously [18, 19, 26]. cells. cells. FUGENE HD transfection reagent was purchased from Promega (Madison, WI, USA). Recombinantfurin, recombinant BMP1, were WFIKKN2 and WFIKKN1 human human promyostatin, human Recombinant expression vector pMT/BiP/V5/His A containing theof cDNA humanWFIKKN1 pyright. All rights reserved. rights All pyright. (R&D Systems, Minneapolis, MN,Minneapolis, (R&D Systems, USA), r Drosophila S2cell maintenance, selection TCG 3’antisense primers. The The primers. TCG 3’antisense

Drosophila melanogaster

formation was allowed for 10 minutes then minutes 10 for allowed was formation 250 pCoHygroselection vector were mixed ina 19:1ratio and 5 inactivatedbovine fetal serum.The expression plasmidpMT/BiP/WFIKKN1_D288A and Bloomington,IN) were transformedSchneider in Drosophila Mediumcontaining 10%heat mM Tris-HCl buffer, pH 7.9, containing 500 mM NaCl and 5 mM imidazole then with 5 20 of volumes column 10 with washed was column The column. Sepharose aNi-NTA onto centrifugedandmedium the was dialyzed against 50mMTris-HCl buffer,pH7.5, and applied This article is protected by co by isprotected article This by adding CuSO serum-free insectmedium cell toa density 2–3x10 of pr recombinant of purification and Expression five Express in grown were transfectants Stable [18]. previously as described essentially of selection. weeks after 5 established were lines polyclonal transformed stably and day third every repeated initiated 96hours posttransfecti %fetal bovine 10Medium se supplementedwith mixturewas removedand the cells were suspended in5ml of fresh SchneiderDrosophila melanogaster S2 Acceptedcollected fromgrowing S2cells anf300 containing70%Schneider fresh of by medium ml of 5 medium the replaced was and for hours 72 grown cells were The medium. Article μ l OPTIMEMl mediumthen 15 D. melanogaster S2 4 cells in 5 ml medium. 24 hours later the media containing the transfection at300 μ M final concentration. After 1 week of induction, the culture was the culture ofinduction, 1week After M final concentration. cells (Drosophila Genomics Resource Center, Indiana University, University, Indiana Center, Resource Genomics (Drosophila cells pyright. All rights reserved. rights All pyright. on by the addition of 300 Drosophila μ l FUGENE HD transfection reagent was added. Complex added. Complex was reagent transfection FUGENEHD l μ g/ml hygromycin B was added. These steps were the plasmidwas solution added 10 to1x Medium and 30%of conditioned medium rum. Selection of stable transfectants was transfectants stable of Selection rum. 6 oteins secreted by S2 cells was performed S2 cellswas performed secreted by oteins /ml, and protein expression was induced

μ g/ml hygromycin B to the culture culture the to B hygromycin g/ml μ g ofmixture the dissolved was in 6

D. furin (1 furin mediated cleavage of promyostatin, human promyostatin (0.5 (0.5 promyostatin human ofpromyostatin, cleavage mediated WFIKKN proteins of absence and presence the in furin with promyostatin of digestion Proteolytic 3.4. protein was purified from themedia as described above. KKN1 and 4.2 in section described the protocol using pMT/BiP/KKN1 theplasmid with This article is protected by co by isprotected article This enzymes. same the with digested plasmid enzymes AgeI and BglII with were digested amplimers The primers. antisense 5`GGAACCGGTGTCCTGGAAGCGGTTGAGCAGC3` and 5`GGAAGATCTGACGCAGCCCCCAGCATCCCA3`sense with amplified was (KKN1) domain NTR the and domains Kunitz two the containing fragment the of cDNA The astemplate. cDNA WFIKKN1 Phusion with amplified were protein WFIKKN1 of fragments for coding The cDNA highfidelity polymerase (New England Biolabs) using the plasmidcontaining thefull-length melanogaster of WFIKKN1proteinin Drosophila fragment Production theKKN1 3.3. of ammonium bicarbonate buffer, pH 8.0. devices andchromatographed a on Superdex 300 column equilibrated with100 mM filter centrifugal Ultra-15 Amicon on concentrated was protein eluted The mMimidazole. 300 containing 7.9 pH buffer, mMTris-HCl 20 with was eluted protein bound the and imidazole, column volumes ofTris-HCl 20mM buffer,containing 7.9, pH 500mMNaCl andmM 30 Accepted Article To monitor the influence of WFIKKN1 (1.5 (1.5 WFIKKN1 of influence the monitor To μ g/ml) inmM 100 Tris-HCl, 150 mM NaCl, 1mM CaCl pyright. All rights reserved. rights All pyright. Drosophila melanogaster and ligated into pMT/BiP/V5/HisA expressionand ligated into pMT/BiP/V5/HisA μ M)WFIKKN2 and (1.5

μ M) was digested with human human with digested M) was 2 , 100

S2 cells were transfected transfected were cells μ M PMSF buffer, pH buffer, M PMSF μ M) on furin- M) on in 100 mM150 Tris-HCl, mM 1 mMNaCl, CaCl extinction coefficients: promyostatin monomer: 55 640 M 640 55 monomer: promyostatin coefficients: extinction 3.6. Protein analyses heparin. This article is protected by co by isprotected article This 28 at 8.0 of WFIKKN1 protein absence and the presence BMP1 in human with oflatent myostatin Proteolyticdigestion 3.5. SDS-PAGE. by analyzed samples was the of composition the and h) 24 4h, 1h, minutes, analyzed by SDS-PAGE. The experiments were also performed in the presence of 5 of presence the in performed also were experiments The SDS-PAGE. analyzed by cleavage of by latentmyostatin myostatin (0.5 latent SDS-PAGE, (http://web.expasy.org/protparam/). (http://web.expasy.org/protparam/). PROTPARAM. tool analysis protein online the with calculated 20 24 hours. The digestion was arrested with 1 ZnCl WFIKKN2, 57 470 M 470 57 WFIKKN2, AcceptedBMP1(50nM) in25mMHEPES buffer, pHcontaining 7.5 mMNaCl,mM5 150CaCl Article o C. C. 2 and 1 The concentrations of the recombinant prot the of recombinant The concentrations Latent myostatinwasproduced by digestingpromyosatin (1 To monitor the influence of WFIKKN1 protein (0.5 (0.5 protein WFIKKN1 of influence the monitor To o C. AliquotsC. wereremoved at various time(0 pointsminute, 5minutes, 15minutes, 30 μ M Furin Inhibitor I at 37 I at Inhibitor Furin M -1 cm -1 pyright. All rights reserved. rights All pyright. ; KKN1, 32 065 M ; 065 32 KKN1, o C for and 16h the compositionC of the samples was μ M FurinM Inhibitor I; samples werestored at – 2 , 100 eins weredetermined using thefollowing -1 cm μ

-1 M PMSF buffer, pH 8.0 at 28 -1 ; the extinction coefficients were coefficients extinction the ; μ cm M, 1 -1 ; WFIKKN1,; 64440 M μ μ M) wasdigested with M, 2 M, 2 μ M) with 3.5 μ M, 4 M, 4 μ M) on BMP1 BMP1 on M) μ μ g/ml g/ml g/ml furin furin g/ml 2 , 1 -1 o C for cm μ M -1 ; werewashed with 5ml of buffer containing 50mM Tris-HCl, 150 mMNaCl,pH 7.5 andthe columns The columns. Sepharose Heparin Hitrap 1ml on applied were 7.5 pH buffer, NaCl This article is protected by co by isprotected article This Accepted 1 ml aliquotsWFIKKN1 of (5 3.7. Hitrap HeparinSepharose chromatography protein sequencer withan online ABI 120A phenyltiohydantoin (PTH) Analyser. N-terminal sequencing of proteins was performed on an Applied Biosystems 471A triplicate. in wereperformed experiments prodomain.All myostatin prodomain as wellas the fragmentstwo generated by the BMP1-cleavage of monitored the we case in this that except way similar compared ina WFIKKNwere proteins of absence and myostatin presence inthe latent of cleavage BMP1-mediated ratesof The furin-cleavage. of asaresult formed prodomain myostatin of intensity band the in changes the monitored we ArticleWFIKKN proteins of absence times. evaluation of protein compositionof six quantitative electropherogram each was repeated softwareofBiochemLabSolutions (UniversityCalifornia, of Francisco San UCSF).In case the Leandro, CA, USA)theintensities and of the protein bands were quantifiedwith GelQuant.Net scanned with the ChemiImager 5500 gel documentation instrument (Alpha Innotech, For quantitative evaluation BlueG-250. Brilliant and non-reducing unless conditions; otherwise indicated,gelsthewere with stained Coomassie To compare the rates of furin-mediated cleavage of promyostatin in the presence and and presence the in promyostatin of cleavage furin-mediated of rates the compare To Thecomposition of protein samples was analyzed by SDS-PAGE underboth reducing pyright. All rights reserved. rights All pyright. μ M) or KKN1 (5 (5 KKN1 M) or changes in of bandthe un-cleaved intensities of proteingels the compositions, stained were

μ M) in 50mM Tris-HCl, 150 mM

San This article is protected by co by isprotected article This a new TGF-beta superfamily member. massmuscle in mice ofskeletal by Regulation Lee SJAM & (1997) Lawler, AC, 1. McPherron References LP. the paper: Wrote LP. MTGS, and VV, MT.the data: Analyzed Conceived and designed the experiments: MT and LP. Performed the experiments: GS, VV and Author contributions of Hungary(OTKA). This workgrants was supported byand 72125108630 of theNational Scientific ResearchFund Acknowledgements (http://swissmodel.expasy.org) asdescribed [11]. previously 8.05 Version SWISS-MODEL server homology-modelling structure modeling Protein 3.8. 7.5)and buffer(50mM B Tris-HCl, 1.5 M NaCl, pH 7.4). proteins were eluted with a 10gradient ml of buffer A (50mM Tris-HCl, 150 mM NaCl,pH Accepted Article The homologymodel of promyostatin was generated with the automated protein pyright. All rights reserved. rights All pyright. Nature 387, 83–90. 387,

This article is protected by co by isprotected article This J Med LeeMyostatingross(2004) SJ a mutationchild. associated with hypertrophy in muscle 7. SchuelkeWagnerM, KR,LE, Stolz Hubner .,Riebel T, KömenW, Braun T, Tobin JF & dogs. heterozygote in performance EA (2007)in mutation themyostatin geneA musclemass increases enhances and racing Ostrander & HG Parker CS, NB,Mellersh Sutter CD, P,Bustamante Quignon DS, Mosher 6. gene. 5. McPherronLee & AC SJ (1997) Doublemuscling cattle inmutations duetheinto myostatin mice. in mutation hypermuscular (Cmpt) compact causes the gene myostatin inthe Adeletion L M Varga (1998) L,Soller & Patthy G, Müller G, G, Dallmann Szabó2. double-muscled Belgian Blue and Piedmontese cattle. cattle. Piedmontese Blue and Belgian double-muscled (1997) M,&4. KambadurSharma Mutationsin Smith BassJJ myostatin TP in (GDF8) R, myostatingene double-muscledcauses the cattle. phenotypein S,Menissier F,Massabanda FriesJ, Hanset R, R& Georges M (1997) A deletion in the bovine A, Dunner J,Schoeberlein Riquet B, Brouwers D, D, Pirottin LJ,Poncelet L, Martin Grobet 3. 9, 671-672. Accepted Article Proc Natl Acad USA Sci 350, 2682–2688. pyright. All rights reserved. rights All pyright. 94, 12457–12461. PLoS Genet 2007 May 25;3(5):e79. 25;3(5):e79. May 2007 Genome Res

Nat Genet 7, 910–916. 17, 71–74. 17, Mamm Genome N Engl . Wright J., Zhao L, Sebald SM, Greenspan DS SM, Greenspan L, Sebald Zhao Wright J., KN, Tomkinson K, Song MV, WN, Davies Pappano AC, McPherron NM, Wolfman 14. GDF-8 receptor binding. inhibitingbindsantagonizes(2001) activity biological andpropeptide by toGDF-8 GDF-8 NM Wolfman QA & Shakey AA, KN, Pearson Tomkinson MV, Davies T, RS,Chen Thies 13. AcadNatl SciUSA Regulation AC (2001) McPherron Lee & SJ 12. promyo of rate the increases 11. Szláma G, Trexler M, BudayL &Patthy L (2015) K153R polymorphism myostatinin gene extracellular pro-myostatin in skeletal muscle. in skeletal pro-myostatin extracellular 10. Anderson SB, GoldbergWhitman AL& M (2008) Identification of a novel pool of This article is protected by co by isprotected article This Lin9. J, Arnold HB, Della-FeraMA, Azain MJ, Hartzell DL & mice. deficient 8. McPherron AC & Lee SJ (2002)Suppression of bodyfat accumulation in myostatin- by family BMP-1/tolloid the Commun. adipogenesis. decreases and myogenesis increases mice in knockout Accepted Article

291, 701–706. J Clin Invest. J Clin 98, 9306–9311. Growth Factors. Growth statin activation by furin. by furin. activation statin of metalloproteinases. 109, 595–601. pyright. All rights reserved. rights All pyright. 18, 251–259 J Biol Chem J Biol

& LeeSJ (2003) Activation oflatent myostatin of myostatin activity and muscle growth.muscle myostatin and activity of Proc Natl Acad Sci USA FEBS Lett. Lett. FEBS

. 283,7027-7035. 589, 295-301.

Baile (2002) CA Myostatin Biochem Biophys Res 100, 15842–15846 Proc Proc 105, 4318-4322. and strength by single gene administration of inhibitors. myostatin mass muscle ofskeletal enhancement JR Sahenk Long-term &Mendell Kaspar Z, BK (2008) PT, Martin D, C, Boue Shilling A, Eagle P, Umapathi C, Handy L, Rizo AM, Haidet 20. 277, 5040-5050. TGF factors growth 19. Szláma Kondás G, K, Trexler M L &WFIKKN1WFIKKN2 Patthy (2010) andbind 11. 8 and factors differentiation and growth for high affinity 18. KondásK, Szláma G, TrexlerMPatthy & L(2008) WFIKKN1 Both WFIKKN2 and have domains.andinhibitor follistatin growth and differentiation factor-associated serum protein-1: a novel protein with protease myostatin by invivo Wolfman(2003) Regulation of &NM RM Y, Hewick JJ,Qiu 17. Hill This article is protected by co by isprotected article This Accepted Articlemyostatinnormal serum. in The myostatin propeptide and thefollistatin-rela (2002) Y & Qiu NM Wolfman RM, Hewick Wang JH, AA, Pearson MV, Davies JJ, Hill 16. myostatin. of latent activation in the ofproteolysis role the of analysis Genetic Lee SJ(2008) 15.

PLoS One PLoS β 1, BMP2 and BMP4 but do not inhibit their signalling activity. signalling inhibittheir do not but and BMP4 1, BMP2 . 3, e1628 J. Biol. Chem. 2 Chem. Biol. J. pyright. All rights reserved. rights All pyright.

Mol Endocrinol. 77, 40735–40741 17, 1144-1154 ted gene are inhibitory binding proteins of proteins binding gene are inhibitory ted

J Biol Chem J Biol Proc Natl AcadSci U S A . 23677-23684. 283, FEBS J . . This article is protected by co by isprotected article This phenotype. V (2012) UbiquitousGasp1 overexpressionmice in leadsmainly to a hypermuscular 21.Monestier O, BrunHeuK, C, Passet B,Malhouroux M, MagnolL, Vilotte& JL Blanquet proteins containing multiple types of protease-inhibitorymodules. human related two of pattern expression Distinct L (2002) &Patthy L Bányai M, Trexler 23. modules. protease-inhibitory L(2001) & Patthy L M,Bányai Trexler 22. Accepted 3839. WFIKKN2. by than WFIKKN1 by efficiently more iscontrolled activity myostatin activity andLatent L hassignificant M this & (2013) Patthy 26. G,Trexler Szláma 270, 2101–2107 protein WFIKKN human the of domain inhibitor protease Kunitz-type second ofthe characterization and purification Expression, L(2003) M& Patthy A, 25. Trexler Nagy Trans. WAP domain-containingmultidomainWFIKKN1WFIKKN2. proteins and 24. Kondás K, Szláma G, Nagy A, Trexler M & PatthyL (2011) Biological functions of the Article 201139,1416-20.

Biol Chem FEBS J. FEBS . 383, 223-228. Eur. J. Biochem Biochem Soc 280,3822- . This article is protected by co by isprotected article This 30. Shi M, Zhu J, Wang R, Chen X, Miprotein (GASP) familyantagonism myostatin.of L, Walz T &Springer Alternative bindingmodes for growth identified TA (2011)Walker29. RG, AngermanLatentKattamuri EB, Lee C, YS,Lee &SJ Thompson TB (2015) TGF- like metalloproteinases. 28.Hopkins DR1, KelesS& GreenspanDS(2007) The bone morphogenetic protein 1/Tolloid- morphogenetic protein1/tolloid-like metalloproteases. Logel&GerhartzC B (2008) Structural basis for the substrate specificitybone of P, Erbel U, A, Bodendorf Hein A, Bernardi D, S, Vinzenz Gil-Parrado A, Sweeney Mac 27. Accepted242, 1528-1534. WangEA (1988)Novel regulators of boneformation: molecular clonesand activities. Wozney&Hewick32. WhittersKriz RM V,Celeste Mitsock MJ, RW, JM, LM, Rosen AJ, Chem Biol domain of procollagenC-proteinase enhancer-1 the controlmetalloproteinase in of activity Murphy G,Hulmes H, E, Colige A, Nagase 31. Bekhouche M, Kronenberg D, Vadon-Le Goff S, BijakowskiLim C, NH, FontKessler B, structure and activation. Article

. 285, 15950-15959. Matrix Biol. Matrix Nature pyright. All rights reserved. rights All pyright. 474,343-349 26, 508-523. DJ & MoaliDJ C(2010) Role of netrin-like the J Biol Chem J Biol and differentiation factor-associated serum serum factor-associated differentiation and J Mol Biol. JMol

. 290, 7506-7516. 384, 228-239. Science, J β

olgnapa1X)can Aa Aa Gn Aa Gn Gu Pro Glu Gln Ala Gln Ala Ala collagenalpha-2(V) chain Gln collagenalpha-1(XI) chain Gly collagen alpha-3(V) chain Ser Phe Gln Gln Ala Gln Gln Ala Gln Gln Phe Ser Arg Asp Leu Gln Leu chain alpha-3(V) collagen Gln His collagen alpha-2(XI) chain Thr Ala Asn chain alpha-1(V) collagen collagenalpha-1(V) chain Met olgnapa1II hi r y y Gly Tyr Ala Tyr Arg Pro Ala Met Arg Tyr Tyr Tyr collagenalpha-1(III) chain Ala collagenalpha-1(II) chain Asn collagenalpha-1(I) chain Arg olgnapa2I peusr Pe Tr Ag Ala Arg Tyr Phe Ala Arg Tyr Ala Met Ser Arg Tyr Tyr Tyr collagenalpha2(I) precursor Gly collagen alpha 1(VII) precursor Ala precursor 1(II) alpha collagen Asn collagenalpha1(I) precursor Arg chordin chordin Glu precursor Pro Met Gln Ala chordin precursor Arg Ser Tyr Ser Ser Tyr Ser Arg precursor chordin Ala heparan sulfate proteoglycan Ser Gly Gly Asn Asn Gly Gly Ser biglycan Gly proteoglycan sulfate heparan Leu Met Met Asn apolipoprotein Gly A-I Phe Trp Gln Gln This article is protected by co by isprotected article This Accepted P3' Arg P2' Ala P1' Pro P1 Glu P2 Article P3 P4 alpha-2-macroglobulin Pro WFIKKN1 Phe P4' Substrate Tyr substratesBMP1 of Table 1. Comparisonof the BMP1-cleavage site of WFIKKN with those known of Glu Ser Pro pyright. All rights reserved. rights All pyright. Glu Phe Thr Glu Glu Thr Phe Pro Pro Gln Asn Gln Gln Pro Pro Gln Gln Asn Gln Gln Ser Gln Asp Pro Pro Asp Gln Ser Gln

Ala Ala Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Gln Asn Gly Glu Pro Pro Glu Gln Asp Gln Pro Pro Gln Thr Glu Asp Gy Pro Gly Ag Gly Arg Gu Glu Glu Glu Pro Pro Glu Vl Met Val Ala Ala Ala Pro Pro Ala Ala Ala Ala Ala Ala Ala

Leu Leu Somatotropin Gly Asn Ser His Asn rlsloiae Gy Mt Vl Gly Gly Val Val Met Ala Gly Val prolysyloxidase-like 1 Tyr prolysyloxidase Tyr rlsloiae Ag Mt Vl Gly Val Met Arg prolysyloxidase Ser Prolactin Ala Leu Gln Met Ala rbgya h e e Asn Met Met Phe probiglycan Ile osteoglycin osteoglycin Lysyl Gly Gln oxidase-like 1 Leu Val Gln Arg Lys Ser Ser yy xds-ie1 Vl Aa Vl Gly Val Ala Val Lysyloxidase-like 1 Gly yy xds ooo e l y Gly Cys Ile Leu Lysyl oxidase homolog 3 Leu beta-binding beta-binding latent-transforming growth factor Lys protein 1 Tyr Phe Ile Gln beta-binding beta-binding latent-transforming growth factor protein 1 Ile laminin subunit gamma-2 Cys Tyr Ser Gly Gly Ser Tyr Cys Asp Thr Ser Gln Ser Glu gamma-2 subunit laminin Tyr Thr Ser 3 protein factor-binding growth insulin-like Ser Gln protein factor-binding growth insulin-like Gln growth/differentiation factor 8 precursor Asp Val Gln Gln Val Gly Asp Gln 8 precursor factor growth/differentiation Gln Phe Asp precursor 11 factor growth/differentiation Leu gldn gldn Asn gliomedin Val Ile Pro Asn DSPP600 Glu Ser Met Gln Gly This article is protected by co by isprotected article This Accepted bold. Residues identical with those in the P4-P4’positions ofWFIKKN1’s cleavage site are highlighted in compiled from the MEROPS database; http://merops.sanger.ac.uk/cgi-bin/substrates?id=M12.005. Information on known peptide substrates of BMP1 (peptidase M12.005: procollagen C-peptidase) was Article Ser Gln Met Gly dentinmatrix acidic phosphoprotein 1 Ser decorin precursor Phe Met Leu Glu Pro Pro

Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Arg Asp Asp Asp Asp Asp Asp Ser Thr Thr Ser Asp Pro Pro Asp Gu Glu Glu Gu Val Glu Ser Thr Thr Ser Asp Trp Trp Asp Ag Phe Arg Gn Glu Gln Gu Asn Glu

Ap Thr Asp Asp Pro Pro Asp Asp Pro Pro Asp Glu Asp Asp Pro Glu Glu

Ala Asp Ala Leu Leu Asp Pro Pro Ala Ala

bondthat iscleaved by BMP1. peptide the of position the indicates arrow The domain. NTR and domains inhibitory protease This article is protected by co by isprotected article This acronym that refers to its co its to refers that acronym protein. WFIKKN1 of architecture Domain Figure 1. Accepted Article nstituent WAP-, Follistatin- WAP-, nstituent , pyright. All rights reserved. rights All pyright.

The name of this protein is an is protein of this name The

Immunoglobulin-, Kunitz-type Kunitz-type Immunoglobulin-,

W1 W2WFIKKN1; promyostatin; – WFIKKN2. – error of the mean, n=3). Abbreviations: M –myostatin; PD –myostatin prodomain; PM – the rate of increase in the amountmyostatin prodomain (the error barsindicate the standard on influence any WFIKKN2 had nor WFIKKN1 neither that indicating data, the of evaluation absence of furin no cleavage of promyostatin occurred. WFIKKN2. containing samples shows lane 3 and WFIKKN1 containing samples shows 2 lane WFIKKN2, or WFIKKN1 lacking samples control shows 1 lane time-point At each G-250. Blue Coomassie Brilliant gels with stained were the analysis; SDS-PAGE by analyzed samples were This article is protected by co by isprotected article This at 28 pH8.0 buffer, 100 mM TRIS-HCl, mM150 NaCl, 1mM CaCl2, 100 mM phenylmethanesulphonylfluoride WFIKKN2. or WFIKKN1 of presence the by affected not is promyostatin of Furin-cleavage 2. Figure Accepted ArticleB ) in the presence or absence of WFIKKN1 (1.5 (1.5 WFIKKN1 of absence or presence the ) in Promyostatin(500 nM)wasincubated with recombinant human furin (1 Panel B Panel o C for 0 min, for 0 min,min,C 5 15 min, 30 4h 1h, ( also shows the results of control experiments, indicating that in the in that indicating experiments, control of results shows the also pyright. All rights reserved. rights All pyright. μ M) or WFIKKN2 (1.5 (1.5 WFIKKN2 M) or

Panel C Panel panel A panel showsthe quantitative μ ) and 24 hours ( 24 hours ) and M) and non-reduced non-reduced M) and μ g/ml) in in g/ml) panel panel This article is protected by co by isprotected article This 150 mMNaCl, 5mM CaCl2,mM 1 ZnCl2and 1 mMFurin InhibitorI at37 (LM, 500 nM) was digested with 50nM BMP1mMin 25 HEPES buffer, pHcontaining 7.5 WFIKKN1. of cleavage with concomitant WFIKKN1 of presence Figure 3.Rate ofcleavage oflatentmyostatin byBMP1 significantly is enhanced the in cleaved prodomain (PD) and increaseamount inthe of C-terminal (PD_CT) and N-terminal un- of amount the of decrease the from assessed as prodomains of cleavage BMP1 of progress gels were stained with Coomassie Brilliant Blue G-250 ( the analysis; SDS-PAGE by wereanalyzed samples Non-reduced heparin. absence or presence μ (5 heparin of presence or absence the in WFIKKN1, of concentrations increasing of presence

panel A ). ). Panels B B Panels Latent human myostatin o C for 16h in the in 16h C for and and C show the

This article is protected by co by isprotected article This Accepted fragment of myosatin W1prodomain; –WFIKKN1. Article N-terminal – PD_NT prodomain; myostatin of fragment C-terminal – PD_CT prodomain; two lanesin intact ( intheab whereas complete, (PD)is practically 2-4 and heparin of presence the in that note significantlyhigher inthe presence of 0.5-4 standard error ofmean, the n =3. Note that the amounts of PD_NT and PD_CT are the indicate bars error the prodomain; the of BMP1-cleavage from resulting fragments (PD_NT) panel C panel panel A panel ). Note that heparin also increases the rate of cleavage of WFIKKN1 (seelast WFIKKN1 of of cleavage the rate increases also heparin that ). Note ). Abbreviations: LM – latent myostatin; M – myostatin; PD–myostatinmyostatin; LM myostatin; M– –latent ). Abbreviations: pyright. All rights reserved. rights All pyright. μ μ M WFIKKN1 than in its absence( in than M WFIKKN1 MWFIKKN1 cleavagemyostatin of prodomain sence of WFIKKN1 the majority of PD is still PD isstill WFIKKN1 majority the of sence of

panel B ). Also ). Also resulting from BMP1-cleavage of the prodomain; the error bars indicatethe fragments (PD_NT) N-terminal and (PD_CT) C-terminal of amount the in increase and (PD) cleavageof prodomains as assessed from the decrease of the amount of un-cleaved prodomain This article is protected by co by isprotected article This with CoomassieBrilliant Blue G-250 ( μ concentrations of the D288A mutantWFIKKN1, in the absence or presence heparin of (5 CaCl2, 1mMmM ZnCl21 andFurin Inhibitor Iat 37 digestedHEPESmM with50BMP1 nM in25 buffer, pH containing 7.5 NaCl,mM 150mM 5 heparin. of the absence in mutant WFIKKN1 Figure 4. Rate ofcleavage oflatentmyostatin is not byBMP1 enhancedby the D288A

Acceptedgels stained the were analysis; SDS-PAGE by analyzed were samples Non-reduced g/ml). Article pyright. All rights reserved. rights All pyright. panel A panel ). Panels B Panels Latent humanmyostatin (LM, 500 nM)was o C for 16h in the presence of increasing increasing presence of the in 16h C for

and and C show progress the of BMP1

fragmentmyosatin of prodomain;W1_D288A –D288AWFIKKN1. mutant N-terminal – PD_NT prodomain; myostatin of fragment C-terminal – PD_CT prodomain; prodomain ( myostatin of cleavage the enhanced WFIKKN1 mutant D288A the of heparin presence This article is protected by co by isprotected article This cleavage latent effecton the myostatinWFIKKN1 ( had of little mutant D288A the heparin, of theabsence in that Note n=3. mean, the of error standard Accepted Furin mM 1 and ZnCl2 mM 1 5 mMCaCl2, NaCl, mM 150 containing 7.5 pH buffer, HEPES KKN1. Figure 5. Rate ofcleavage ofmyostatin latent by BMP1 is significantly enhancedby Article Latent human myostatin human (LM,Latent 500 was nM) panel C panel ). Abbreviations: LM – latent myostatin;MLMlatent – PD–myostatin –myostatin; Abbreviations: ). pyright. All rights reserved. rights All pyright. digested with 50 nM BMP1 in 25mM

panel B panel ), whereas in the the in whereas ),

WFIKKN1. of fragment KKN the – W1_KKN fragment of myostatin prodomain;PD_NTN-terminal – fragmentmyosatin of prodomain; LM – latentmyostatin; M – myostatin; PD myostatin both theabsence in ( latent of cleavage the enhanced KKN1 that Note =3. n mean, the of error standard the indicate BMP1 from resulting fragments (PD_NT) N-terminal amount ofun-cleaved prodomain (PD) and increase inthe amount of C-terminal (PD_CT)and C with gelsanalysis; werestained the This article is protected by co by isprotected article This InhibitorI at 37 absence or presence of heparin (5 heparin of presence absence or Accepted Article show the progress of BMP1 cleavage prodomains of as assessed from the decrease of the o C for 16h in the presence of increasing concentrations of KKN1, in the in KKN1, of concentrations increasing of presence the in 16h C for pyright. All rights reserved. rights All pyright. panel B panel μ g/ml). Non-reduced samples were analyzed by SDS-PAGE SDS-PAGE by analyzed were samples Non-reduced g/ml). CoomassieBrilliant Blue G-250 ( ) and presence heparin of ( – myostatin prodomain; PD_CT – C-terminal

-cleavage of the prodomain; the error bars prodomain; bars theerror of -cleavage the

panel C panel panel A ). Abbreviations: ). Panels B Panels and

This article is protected by co by isprotected article This by 90 generated was panel right-hand the in figure The red. in arehighlighted Asp-99 and position of thecleavage BMP1 sitesresidues between Arg-98-Asp-99.positions of The Arg-98 the indicate arrows black The enzyme. the to more accessible sites cleavage BMP1 the making conformationalequlibrium from the circular structure to a more open form of latent myostatin terminal subdomainsmyostatinof prodomains loosens‘bowtie’, the shiftingthe to cleavage by BMP1.Our data suggest that binding of theNTR domain of KKN1 tothe C- homodimer, disk-like the of center the in buried are myostatin latent of sites BMP1-cleavage the containing loops The ‘bowtie’. a in precursor pink) provide the ‘arm domains’ that connect the two prodomains in the homodimeric blue (light homodimer the of monomer growth-factor each shields and encircles that ‘straitjacket’ the provide yellow (pale prodomains two the of parts N-terminal structure. circular disk-like myostatin. Figure 6. BMP1-cleavage The sites are intheburied center ofthe homodimer oflatent Accepted y-axis. the around homodimer the of rotation clockwise Article In the homology model of homodimeric latent myostatin the two monomers forma − yellow), whereas the C-terminal parts of the two prodomains (green (green prodomains two the of parts C-terminal the whereas yellow), pyright. All rights reserved. rights All pyright. suggesting that they are not readily accessible accessible not readily are that they suggesting

− light gray) light − o

This article is protected by co by isprotected article This WFIKKN1 (5 (5 WFIKKN1 Figure 7. WFIKKN1 and KKN1proteins have affinity for heparin. Accepted WFIKKN1. than full-length mM Tris-HCl,pHM NaCl,7.4). 1.5 Note that KKN1 isolated higher has affinityfor heparin with a 10 ml gradient of buffer A (50 mM Tris-HCl, 150 mM NaCl, pH 7.5) and buffer B (50 ml of buffercontaining 50 mM Tris-HCl, 150 mM 7.5 were applied on 1ml Hitrap Heparin Sepharose columns. The columnswere washed with 5 Article μ M) or KKN1 (5 (5 M) KKN1 or pyright. All rights reserved. rights All pyright. μ M)dissolved in50 mM Tris-HCl,mM 150buffer, NaCl pH

NaCl, pH 7.5 and the proteins were eluted

1 ml 1 aliquots of