DOCSLIB.ORG

High Temperature Sensitivity Is Intrinsic to Voltage-Gated Potassium Channels

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
High Temperature Sensitivity Is Intrinsic to Voltage-Gated Potassium Channels 1 2 High Temperature Sensitivity Is Intrinsic to Voltage-Gated Potassium Channels 3 4 Fan Yang and Jie Zheng¶ 5 Department of Physiology and Membrane Biology, University of California, Davis, CA 6 95616 7 8 9 10 11 12 13 ¶To whom correspondence should be addressed: 14 Jie Zheng 15 Department of Physiology and Membrane Biology 16 University of California at Davis School of Medicine 17 One Shields Ave 18 Davis, CA 95616 19 USA 20 Tel. 530-752-1241 21 FAX 530-752-5423 22 [email protected] 23 24 Keywords: TRP channels | potassium channels | temperature sensing | gating | 25 conformational changes | allosteric coupling 1 26 Abstract 27 Temperature-sensitive transient receptor potential (TRP) ion channels are members of the 28 large tetrameric cation channels superfamily but are considered to be uniquely sensitive 29 to heat, which has been presumed to be due to the existence of an unidentified 30 temperature-sensing domain. Here we report that the homologous voltage-gated 31 potassium (Kv) channels also exhibit high temperature sensitivity comparable to that of 32 TRPV1, which is detectable under specific conditions when the voltage sensor is 33 functionally decoupled from the activation gate through either intrinsic mechanisms or 34 mutations. Interestingly, mutations could tune Shaker channel to be either heat-activated 35 or heat-deactivated. Therefore, high temperature sensitivity is intrinsic to both TRP and 36 Kv channels. Our findings suggest important physiological roles of heat-induced 37 variation in Kv channel activities. Mechanistically our findings indicate that 38 temperature-sensing TRP channels may not contain a specialized heat-sensor domain; 39 instead, non-obligatory allosteric gating permits the intrinsic heat sensitivity to drive 40 channel activation, allowing temperature-sensitive TRP channels to function as 41 polymodal nociceptors. 42 2 43 Introduction 44 Sensitive detection and discrimination of temperature cues are fundamental to the 45 survival and prosperity of humans and animals. While Hodgkin and Huxley showed 46 more than sixty years ago that temperature could profoundly influence membrane 47 excitability (1), it is in general not well understood how heat affects membrane 48 excitability and how temperature-dependent changes in neuronal activity contribute to 49 physiology. Neuronal action potentials are generated and modulated by a precise 50 combination of ionic currents produced by the activity of ion channels. Activation of ion 51 channels in turn is the result of complex conformational rearrangements in channel 52 protein controlled by specific physical or chemical stimuli (2). Heat contributes to 53 activation energy for channel conformational changes, through which it regulates channel 54 activity and the shape of action potential (3, 4). For most ion channels, thermal energy 55 affects the rate of conformational transitions by 2-to-5 folds per 10 °C (4, 5). Within the 56 physiological temperature range, thermal energy alone was found to be generally 57 insufficient to initiate channel activation. Among the exceptions are a group of transient 58 receptor potential (TRP) channels including TRPV1-4, TRPM8, TRPM3, TRPM4, 59 TRPM5, TRPC5, and TRPA1. These channels are potently activated by heat in the 60 absence of another stimulus and hence serve as key cellular temperature sensors (6, 7). 61 How these TRP channels respond to heat with exquisite sensitivity, however, remains 62 mysterious. 63 64 To understand the molecular mechanism underlying high temperature sensitivity of the 65 TRP channels, we conducted a comparative investigation of the voltage-gated potassium 3 66 (Kv) channels. As members of the tetrameric cation channel superfamily, TRP channels 67 and Kv channels are structurally similar. They all have six transmembrane segments, 68 with the S1 to S4 segments forming an isolated peripheral domain surrounding the ion- 69 permeating pore composed of S5, S6, and the loop between them. Comparison of the 70 crystal structures of Kv channels (8, 9) and the cryo-EM structures of TRPV1 (10, 11) 71 further shows that detailed structural features of these two types of channels are also very 72 similar. However, the two types of channels are functionally distinct. Kv channels are 73 activated by membrane depolarization with a steep voltage dependence (12), while TRP 74 channels are only weakly activated at highly depolarized voltages (7). More importantly, 75 unlike the temperature-sensitive TRP channels, Kv channels cannot be directly activated 76 by changes in temperature, and the activity of Kv channels are generally considered to be 77 not very heat-sensitive (4, 13). The differences lead to the widely accepted assumption 78 that through evolution some TRP channels have acquired specific protein structures that 79 serve as a “heat sensor”. In the present study we tested this hypothesis by examining the 80 temperature response of Kv channels. 81 82 Results 83 TRPV1 is an archetypical temperature-sensitive TRP channel (14). Heat strongly 84 activates the channel, which could be observed at a broad voltage range using a ramp 85 protocol (Fig. 1A, upper panel). A common way to characterize temperature sensitivity 86 is the Q10 value (defined as the folds increase in current amplitude upon a 10 °C increase 87 in temperature). For TRPV1, the Q10 value is above 20 over a more than 200 mV voltage 88 range (Fig. 1A, lower panel) (15), reflecting outstanding sensitivity of channel activation 4 89 to heat. Having high temperature sensitivity at a wide voltage range is crucial for the 90 channel’s physiological role as a temperature sensor—it allows TRPV1-expressing 91 sensory neurons to detect heat no matter the neurons are in the resting state or excited 92 state. 93 94 Activity of Shaker potassium channel, in contrast, exhibited much lower temperature 95 sensitivity (Fig. 1B, upper panel). As a voltage-gated channel, Shaker activates upon 96 depolarization to about -60 mV (Fig. 1C). The threshold voltage for activation was only 97 slightly shifted by raising temperature. The average Q10 value remained low, at below 4 98 (Fig. 1B, lower panel). Low temperature sensitivity is anticipated for Shaker and many 99 other Kv channels, because opening and closing of the ion permeation pore in these 100 channels is obligatorily coupled to movement of the voltage-sensor controlled by the 101 membrane potential (12). At hyperpolarized voltages, the channel is locked in the initial 102 closed state (C, Fig. 1B), in which the voltage-sensor is kept in the down conformation. 103 A strongly voltage-dependent transition, involving the movement of ~13 e0 gating 104 charges across the transmembrane electric field (16-18), moves the channel to another 105 closed state, C’, from which it can transition to the open state, O, with little voltage 106 dependence. Since thermal energy is insufficient to supply the activation energy for 107 voltage-sensor to overcome transmembrane voltage, opening of the channel is dictated by 108 the membrane potential. The high fidelity of Shaker and other voltage-gated channels in 109 reporting changes in membrane potential at variable environmental conditions is the basis 110 for reliable electrical signaling of the nervous system. 111 5 112 A closer inspection of the Shaker channel Q10 measurement, however, revealed that it did 113 increase modestly around -80 to -60 mV (arrow in Fig. 1B, lower panel), approaching 10 114 at its peak. It is intriguing that this is the voltage range at which the voltage-sensor starts 115 to move, permitting the CC’ transition. This can be seen in the voltage dependence of 116 gating charge movement (Q-V curve, Fig. 1C). Since it has been previously suggested 117 that the voltage-dependent transition in TRPV1 is highly temperature-sensitive (19), we 118 wondered whether the transient Q10 increase in Shaker might reflect temperature 119 sensitivity of the voltage-sensor movement. To test this possibility, we conducted similar 120 measurements with the voltage-gated Ca2+-modulated BK potassium channel, because for 121 this channel the separation between the G-V curve and the Q-V curve can be 122 conveniently controlled by intracellular Ca2+. 123 124 We observed that, like Shaker, BK in the presence of intracellular Ca2+ also exhibited a 125 transient Q10 increase at the voltage range where voltage-sensor started to be activated by 126 depolarization, around -80 mV (Fig. 2A). Removing Ca2+ shifts the voltage range for 127 channel activation, substantially increasing the separation between G-V and Q-V curves 128 (20). The change is achieved mainly through a dual-allosteric coupling between the 129 C’O transition and the Ca2+ and voltage induced transitions (20). We observed two 2+ 130 interesting effects of Ca removal on the transient Q10 increase. First, it substantially 131 shifted the voltage range at which the transient Q10 increase occurred, to around +100 mV 132 (Fig. 2B). This large shift mirrored the substantial shift of the G-V curve. More 2+ 133 importantly, in the absence of Ca the extent of the Q10 increase was enhanced 134 dramatically even though the total gating charge movement remained unchanged (20) 6 135 (Fig. 2B). These observations suggest that the Q10 increase may not be associated with 136 the voltage-sensor movement (as reflected by the Q-V curve) but rather associated with 137 the activation gate opening (as reflected by the G-V curve), that is, instead of the CC’ 138 transition, it seemed to be the C’O transition that yielded the Q10 increase. 139 140 The possibility of a voltage-sensor associated Q10 increase was further ruled out when we 141 tested additional Kv channels. We found that both Kv2.1 and Kv4.3 exhibited a 142 surprisingly prominent Q10 transient increase that peaked in the 20-to-30 range (Fig. 3), a 143 level comparable to that of TRPV1.
Load more

Recommended publications
  • Genetic Analysis of the Shaker Gene Complex of Drosophila Melanogaster
    Copyright 0 1990 by the Genetics Society of America Genetic Analysisof the Shaker Gene Complexof Drosophila melanogaster A. Ferriis,* S. LLamazares,* J. L. de la Pornpa,* M. A. Tanouye? and0. Pongs* *Institute Cajal, CSIC, 28006 Madrid, Spain, +California Instituteof Technology, Pasadena, California 91 125, and 'Ruhr Universitat,Bochum, Federal Republic of Germany Manuscript received May 10, 1989 Accepted for publication March 3, 1990 ABSTRACT The Shaker complex (ShC) spans over 350 kb in the 16F region of the X chromosome. It can be dissected by means of aneuploids into three main sections: the maternal effect (ME), the viable (V) and the haplolethal (HL) regions. The mutational analysis of ShC shows a high density of antimorphic mutations among 12 lethal complementation groupsin addition to 14 viable alleles. The complex is the structural locus of a family of potassium channels as well as a number of functions relevant to the biology of the nervous system. The constituents of ShC seem to be linked by functional relationships in view of the similarity of the phenotypes, antimorphic nature of their mutations and the behavior in transheterozygotes. We discuss the relationship between the genetic organization of ShC and the functional coupling of potassium currents with the other functions encodedin the complex. HAKER was the first behavioral mutant detected do not appear tohave the capability of generating, by S in Drosophila melanogaster (CATSCH1944). It was themselves, gated ionic channels. named after another mutantwith a similar phenotype K+ currents are known to be themost diverse class isolated earlier in Drosophila funebris (LUERS 1936). of ionic currents in terms of kinetics, pharmacology The original phenotype was described as the trem- and sensitivity (HILLE 1984; RUDY 1988).Also, these bling of appendagesin the anesthetized fly.
    [Show full text]
  • Expression Profiling of Ion Channel Genes Predicts Clinical Outcome in Breast Cancer
    UCSF UC San Francisco Previously Published Works Title Expression profiling of ion channel genes predicts clinical outcome in breast cancer Permalink https://escholarship.org/uc/item/1zq9j4nw Journal Molecular Cancer, 12(1) ISSN 1476-4598 Authors Ko, Jae-Hong Ko, Eun A Gu, Wanjun et al. Publication Date 2013-09-22 DOI http://dx.doi.org/10.1186/1476-4598-12-106 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Ko et al. Molecular Cancer 2013, 12:106 http://www.molecular-cancer.com/content/12/1/106 RESEARCH Open Access Expression profiling of ion channel genes predicts clinical outcome in breast cancer Jae-Hong Ko1, Eun A Ko2, Wanjun Gu3, Inja Lim1, Hyoweon Bang1* and Tong Zhou4,5* Abstract Background: Ion channels play a critical role in a wide variety of biological processes, including the development of human cancer. However, the overall impact of ion channels on tumorigenicity in breast cancer remains controversial. Methods: We conduct microarray meta-analysis on 280 ion channel genes. We identify candidate ion channels that are implicated in breast cancer based on gene expression profiling. We test the relationship between the expression of ion channel genes and p53 mutation status, ER status, and histological tumor grade in the discovery cohort. A molecular signature consisting of ion channel genes (IC30) is identified by Spearman’s rank correlation test conducted between tumor grade and gene expression. A risk scoring system is developed based on IC30. We test the prognostic power of IC30 in the discovery and seven validation cohorts by both Cox proportional hazard regression and log-rank test.
    [Show full text]
  • Mapping Protein Interactions of Sodium Channel Nav1.7 Using 2 Epitope-Tagged Gene Targeted Mice
    bioRxiv preprint doi: https://doi.org/10.1101/118497; this version posted March 20, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Mapping protein interactions of sodium channel NaV1.7 using 2 epitope-tagged gene targeted mice 3 Alexandros H. Kanellopoulos1†, Jennifer Koenig1, Honglei Huang2, Martina Pyrski3, 4 Queensta Millet1, Stephane Lolignier1, Toru Morohashi1, Samuel J. Gossage1, Maude 5 Jay1, John Linley1, Georgios Baskozos4, Benedikt Kessler2, James J. Cox1, Frank 6 Zufall3, John N. Wood1* and Jing Zhao1†** 7 1Molecular Nociception Group, WIBR, University College London, Gower Street, 8 London WC1E 6BT, UK. 9 2Mass Spectrometry Laboratory, Target Discovery Institute, University of Oxford, The 10 Old Road Campus, Oxford, OX3 7FZ, UK. 11 3Center for Integrative Physiology and Molecular Medicine, Saarland University, 12 Kirrbergerstrasse, Bldg. 48, 66421 Homburg, Germany. 13 4Division of Bioscience, University College London, Gower Street, London WC1E 6BT, UK.14 15 †These authors contributed equally to directing this work. 16 *Correspondence author. Tel: +44 207 6796 954; E-mail: [email protected] 17 **Corresponding author: Tel: +44 207 6790 959; E-mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/118497; this version posted March 20, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 18 Abstract 19 The voltage-gated sodium channel NaV1.7 plays a critical role in pain pathways. 20 Besides action potential propagation, NaV1.7 regulates neurotransmitter release, 21 integrates depolarizing inputs over long periods and regulates transcription.
    [Show full text]
  • Allosteric Features of KCNQ1 Gating Revealed by Alanine Scanning Mutagenesis
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biophysical Journal Volume 100 February 2011 885–894 885 Allosteric Features of KCNQ1 Gating Revealed by Alanine Scanning Mutagenesis Li-Juan Ma, Iris Ohmert, and Vitya Vardanyan* Institut fu¨r Neurale Signalverarbeitung, Zentrum fu¨r Molekulare Neurobiologie, Universita¨t Hamburg, Hamburg, Germany ABSTRACT Controlled opening and closing of an ion-selective pathway in response to changes of membrane potential is a fundamental feature of voltage-gated ion channels. In recent decades, various details of this process have been revealed with unprecedented precision based on studies of prototypic potassium channels. Though current scientific efforts are focused more on a thorough description of voltage-sensor movement, much less is known about the similarities and differences of the gating mechanisms among potassium channels. Here, we describe the peculiarities of the KCNQ1 gating process in parallel comparison to Shaker. We applied alanine scanning mutagenesis to the S4-S5 linker and pore region and followed the regular- ities of gating perturbations in KCNQ1. We found a fractional constitutive conductance for wild-type KCNQ1. This component increased significantly in mutants with considerably leftward-shifted steady-state activation curves. In contrast to Shaker,no correlation between V1/2 and Z parameters was observed for the voltage-dependent fraction of KCNQ1. Our experimental find- ings are explained by a simple allosteric gating scheme with voltage-driven and voltage-independent transitions. Allosteric features are discussed in the context of extreme gating adaptability of KCNQ1 upon interaction with KCNE b-subunits.
    [Show full text]
  • Engineering Biosynthetic Excitable Tissues from Unexcitable Cells for Electrophysiological and Cell Therapy Studies
    ARTICLE Received 11 Nov 2010 | Accepted 5 Apr 2011 | Published 10 May 2011 DOI: 10.1038/ncomms1302 Engineering biosynthetic excitable tissues from unexcitable cells for electrophysiological and cell therapy studies Robert D. Kirkton1 & Nenad Bursac1 Patch-clamp recordings in single-cell expression systems have been traditionally used to study the function of ion channels. However, this experimental setting does not enable assessment of tissue-level function such as action potential (AP) conduction. Here we introduce a biosynthetic system that permits studies of both channel activity in single cells and electrical conduction in multicellular networks. We convert unexcitable somatic cells into an autonomous source of electrically excitable and conducting cells by stably expressing only three membrane channels. The specific roles that these expressed channels have on AP shape and conduction are revealed by different pharmacological and pacing protocols. Furthermore, we demonstrate that biosynthetic excitable cells and tissues can repair large conduction defects within primary 2- and 3-dimensional cardiac cell cultures. This approach enables novel studies of ion channel function in a reproducible tissue-level setting and may stimulate the development of new cell-based therapies for excitable tissue repair. 1 Department of Biomedical Engineering, Duke University, Durham, North Carolina 27708, USA. Correspondence and requests for materials should be addressed to N.B. (email: [email protected]). NatURE COMMUNicatiONS | 2:300 | DOI: 10.1038/ncomms1302 | www.nature.com/naturecommunications © 2011 Macmillan Publishers Limited. All rights reserved. ARTICLE NatUre cOMMUNicatiONS | DOI: 10.1038/ncomms1302 ll cells express ion channels in their membranes, but cells a b with a significantly polarized membrane that can undergo e 0 a transient all-or-none membrane depolarization (action A 1 potential, AP) are classified as ‘excitable cells’ .
    [Show full text]
  • Role of Voltage-Gated Sodium Channel Isoforms in Electrophysiological Properties of Neurons Innervating the Viscera in Mice
    Role of Voltage-gated Sodium Channel Isoforms in Electrophysiological Properties of Neurons Innervating the Viscera in Mice Andelain Kristiseter Erickson School of Medicine Discipline of Medicine The University of Adelaide Thesis submitted for the degree of Doctor of Philosophy 17th May 2019 Table of Contents Citation listing ........................................................................................................................................ vi Abstract .................................................................................................................................................. vii Declaration of originality ..................................................................................................................... viii Acknowledgments .................................................................................................................................. ix Abbreviations .......................................................................................................................................... x Chapter 1 Visceral Pain .......................................................................................................................... 2 1.1 Abstract ......................................................................................................................................................... 2 1.2 Introduction ...................................................................................................................................................
    [Show full text]
  • Cold Sensing by Nav1.8-Positive and Nav1.8-Negative Sensory Neurons
    Cold sensing by NaV1.8-positive and NaV1.8-negative sensory neurons A. P. Luiza, D. I. MacDonalda, S. Santana-Varelaa, Q. Milleta, S. Sikandara, J. N. Wooda,1, and E. C. Emerya,1 aMolecular Nociception Group, Wolfson Institute for Biomedical Research, University College London, London WC1E 6BT, United Kingdom Edited by Peter McNaughton, King’s College London, London, United Kingdom, and accepted by Editorial Board Member David E. Clapham January 8, 2019 (received for review August 23, 2018) The ability to detect environmental cold serves as an important define the distribution and identity of cold-sensitive DRG neurons, survival tool. The sodium channels NaV1.8 and NaV1.9, as well as in live mice, using in vivo imaging. the TRP channel Trpm8, have been shown to contribute to cold sensation in mice. Surprisingly, transcriptional profiling shows that Results NaV1.8/NaV1.9 and Trpm8 are expressed in nonoverlapping neuro- Distribution of DRG Sensory Neurons Responsive to Noxious Cold, in nal populations. Here we have used in vivo GCaMP3 imaging to Vivo. To identify cold-sensitive neurons in vivo, we used a pre- identify cold-sensing populations of sensory neurons in live mice. viously developed in vivo imaging technique to study the responses We find that ∼80% of neurons responsive to cold down to 1 °C do of individual DRG neurons in situ (8). Mice coexpressing Pirt- not express NaV1.8, and that the genetic deletion of NaV1.8 does GCaMP3 (which enables pan-DRG GCaMP3 expression), not affect the relative number, distribution, or maximal response NaV1.8 Cre, and a Cre-dependent reporter (tdTomato) were of cold-sensitive neurons.
    [Show full text]
  • BK Channel Inhibition by Strong Extracellular Acidification
    bioRxiv preprint doi: https://doi.org/10.1101/317339; this version posted May 8, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. BK channel inhibition by strong extracellular acidification Yu Zhou, Xiao-Ming Xia and Christopher J. Lingle Department of Anesthesiology, Washington University School of Medicine, St. Louis, Missouri 63110 Address for correspondence: Yu Zhou Washington University School of Medicine Dept. Anesthesiology, Box 8054 St. Louis MO 63110 email: [email protected] Christopher J. Lingle Washington University School of Medicine Dept. Anesthesiology, Box 8054 St. Louis MO 63110 phone: 314-362-8558 FAX: 314-362-8571 email: [email protected] Running title: BK channel inhibition by extracellular H+ Keywords: extracellular H+, K+ channels, channel inhibition, BK channels, Slo1 channels 1Abbreviations used in this paper: BK, large conductance Ca2+-activated K+ channel 1 bioRxiv preprint doi: https://doi.org/10.1101/317339; this version posted May 8, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract BK-type voltage- and Ca2+-dependent K+ channels are found in a wide range of cells and intracellular organelles. Among different loci, the composition of the extracellular microenvironment, including pH, may differ substantially. For example, it has been reported that BK channels are expressed in lysosomes with their extracellular side facing the strongly acidified lysosomal lumen (pH ~ 4.5).
    [Show full text]
  • Study of Short Forms of P/Q-Type Voltage-Gated Calcium Channels
    Study of Short Forms of P/Q-Type Voltage-Gated Calcium Channels Qiao Feng Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2017 © 2017 Qiao Feng All rights reserved ABSTRACT Study of Short Forms of P/Q-Type Voltage-Gated Calcium Channels Qiao Feng P/Q-type voltage-gated calcium channels (CaV2.1) are expressed in both central and peripheral nervous systems, where they play a critical role in neurotransmitter release. Mutations in the pore-forming 1 subunit of CaV2.1 can cause neurological disorders such as episodic ataxia type 2, familial hemiplegic migraine type 1 and spinocerebellar ataxia type 6. Interestingly, a 190-kDa fragment of CaV2.1 was found in mouse brain tissue and cultured mouse cortical neurons, but not in heterologous systems expressing full-length CaV2.1. In the brain, the 190-kDa species is the predominant form of CaV2.1, while in cultured cortical neurons the amount of the 190-kDa species is comparable to that of the full-length channel. The 190-kDa fragment contains part of the II-III loop, repeat III, repeat IV and the C-terminal tail. A putative complementary fragment of 80-90 kDa was found along with the 190-kDa form. Moreover, preliminary data show that the abundance of the 190-kDa species and the 80-90-kDa species relative to the full-length channel is upregulated by increased intracellular Ca2+ concentration. Truncation mutations in the P/Q-type calcium channel have been found to cause the neurological disease episodic ataxia type 2.
    [Show full text]
  • (KCND3) (NM 004980) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC222757 Kv4.3 (KCND3) (NM_004980) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Kv4.3 (KCND3) (NM_004980) Human Tagged ORF Clone Tag: Myc-DDK Symbol: KCND3 Synonyms: BRGDA9; KCND3L; KCND3S; KSHIVB; KV4.3; SCA19; SCA22 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Kv4.3 (KCND3) (NM_004980) Human Tagged ORF Clone – RC222757 ORF Nucleotide >RC222757 representing NM_004980 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCCGGAGTTGCGGCCTGGCTGCCTTTTGCCCGGGCTGCGGCCATCGGGTGGATGCCGGTGGCCA ACTGCCCCATGCCCCTGGCCCCGGCCGACAAGAACAAGCGGCAGGATGAGCTGATTGTCCTCAACGTGAG TGGGCGGAGGTTCCAGACCTGGAGGACCACGCTGGAGCGCTACCCGGACACCCTGCTGGGCAGCACGGAG AAGGAGTTCTTCTTCAACGAGGACACCAAGGAGTACTTCTTCGACCGGGACCCCGAGGTGTTCCGCTGCG TGCTCAACTTCTACCGCACGGGGAAGCTGCACTACCCGCGCTACGAGTGCATCTCTGCCTACGACGACGA GCTGGCCTTCTACGGCATCCTCCCGGAGATCATCGGGGACTGCTGCTACGAGGAGTACAAGGACCGCAAG AGGGAGAACGCCGAGCGGCTCATGGACGACAACGACTCGGAGAACAACCAGGAGTCCATGCCCTCGCTCA GCTTCCGCCAGACCATGTGGCGGGCCTTCGAGAACCCCCACACCAGCACGCTGGCCCTGGTCTTCTACTA
    [Show full text]
  • The Nav1.7 Sodium Channel: from Molecule to Man
    REVIEWS The NaV1.7 sodium channel: from molecule to man Sulayman D. Dib-Hajj1,2, Yang Yang1,2, Joel A. Black1,2 and Stephen G. Waxman1,2 Abstract | The voltage-gated sodium channel NaV1.7 is preferentially expressed in peripheral somatic and visceral sensory neurons, olfactory sensory neurons and sympathetic ganglion neurons. NaV1.7 accumulates at nerve fibre endings and amplifies small subthreshold depolarizations, poising it to act as a threshold channel that regulates excitability. Genetic and functional studies have added to the evidence that NaV1.7 is a major contributor to pain signalling in humans, and homology modelling based on crystal structures of ion channels suggests an atomic-level structural basis for the altered gating of mutant NaV1.7 that causes pain. Neuropathic pain Voltage-gated sodium channels are essential for electro- that are not seen when these channels are expressed in 11 Pain resulting from lesions or genesis in excitable cells. Nine pore-forming α‑subunits HEK 293 cells . Methods are now available that allow the diseases of the somatosensory of such channels (referred to as channels hereinafter), expression and functional profiling of sodium channels in system. 1 NaV1.1–NaV1.9, have been identified in mammals . peripheral neurons, which more closely mimic the in vivo These isoforms share a common overall structural environment of such channels12. motif (FIG. 1). They are each composed of a long poly- In humans, gain‑of‑function mutations in SCN9A, neuropathic pain peptide (1,700–2,000 amino acids) that folds into four which encodes NaV1.7, lead to severe , homologous domains (DI–DIV) that are linked by three whereas loss‑of‑function mutations in this gene lead to loops (L1–L3), with each domain having six transmem- an indifference to pain13.
    [Show full text]
  • Roderick Mackinnon
    POTASSIUM CHANNELS AND THE ATOMIC BASIS OF SELECTIVE ION CONDUCTION Nobel Lecture, December 8, 2003 by Roderick MacKinnon Howard Hughes Medical Institute, Laboratory of Molecular Neurobiology and Biophysics, Rockefeller University, 1230 York Avenue, New York, NY 10021, USA. INTRODUCTION All living cells are surrounded by a thin, approximately 40 Å thick lipid bilay- er called the cell membrane. The cell membrane holds the contents of a cell in one place so that the chemistry of life can occur, but it is a barrier to the movement of certain essential ingredients including the ions Na+, K+, Ca2+ and Cl-. The barrier to ion flow across the membrane – known as the dielec- tric barrier – can be understood at an intuitive level: the cell membrane inte- rior is an oily substance and ions are more stable in water than in oil. The en- ergetic preference of an ion for water arises from the electric field around the ion and its interaction with neighboring molecules. Water is an electrically polarizable substance, which means that its molecules rearrange in an ion’s electric field, pointing negative oxygen atoms in the direction of cations and positive hydrogen atoms toward anions. These electrically stabilizing interac- tions are much weaker in a less polarizable substance such as oil. Thus, an ion will tend to stay in the water on either side of a cell membrane rather than en- ter and cross the membrane. And yet numerous cellular processes, ranging from electrolyte transport across epithelia to electrical signal production in neurons, depend on the flow of ions across the membrane.
    [Show full text]