Ser475, Glu272, Asp276, Asp327, and Asp360 Are Involved in Catalytic Activity of Human Tripeptidyl-Peptidase I

FEBS 29292 FEBS Letters 579 (2005) 1383–1388

Ser475, Glu272, Asp276, Asp327, and Asp360 are involved in catalytic activity of human tripeptidyl-peptidase I

Mariusz Walus, Elizabeth Kida, Krystyna E. Wisniewski, Adam A. Golabek* Department of Developmental Neurobiology, The New York State Institute for Basic Research in Developmental Disabilities, 1050 Forest Hill Road, Staten Island, NY 10314, USA

Received 7 January 2005; accepted 19 January 2005

Available online 29 January 2005

Edited by Hans Eklund

and aspartic acid in the active site. Hence, this group of en- Abstract Tripeptidyl-peptidase I (TPP I) is a lysosomal aminopeptidase that sequentially removes tripeptides from small poly- zymes was recently assigned to the subtilisin clan SB as a ser- peptides and also shows a minor endoprotease activity. ine-carboxyl proteinase (SCP) or sedolisin family of peptidases Mutations in TPP I are associated with a fatal lysosomal stor- (MEROPS classification: family S53). age disorder – the classic late-infantile form of neuronal ceroid Tripeptidyl-peptidase I (TPP I, CLN2 protein) (EC 3.4.14.9) lipofuscinoses. In the present study, we analyzed the catalytic is the only peptidase identified in humans and numerous mam- mechanism of the human enzyme by using a site-directed muta- mals that shows significant homology to the SCP family of genesis. We demonstrate that apart from previously identified prokaryotes and lower eukaryotes. Naturally occurring muta- 475 360 272 276 327 Ser and Asp , also Glu , Asp , and Asp are important tions in this lysosomal enzyme are associated with the fatal for catalytic activity of the enzyme. Involvement of serine, glu- neurodegenerative lysosomal storage disorder – late-infantile tamic acid, and aspartic acid in the catalytic reaction validates neuronal ceroid lipofuscinosis [10,11]. the idea, formulated on the basis of significant amino acid sequence homology and inhibition studies, that TPP I is the first The idea that TPP I may belong to a family of PCPs was for- mammalian representative of a growing family of serine-car- mulated by Sleat and colleagues [10] on the basis of inhibition boxyl peptidases. studies and significant sequence similarities of TPP I with 2005 Federation of European Biochemical Societies. Published PSCP and XSCP. Although initially TPP I was classified as by Elsevier B.V. All rights reserved. a serine protease [12], inhibition studies provided rather incon- sistent data regarding the effect of serine protease inhibitors on Keywords: Tripeptidyl-peptidase I; CLN2 protein; Active site; the activity of TPP I. In some reports, relatively high concen- Mutagenesis; Serine-carboxyl peptidase; Sedolisin trations of serine protease inhibitors were required to produce inhibition, e.g., 10 mM diisopropylfluorophosphate (DFP) or 1 mM diethylpyrocarbonate (DEPC) produced 75% inhibition according to Page et al. [12]. In some other studies, TPP I was either resistant to DFP [13–15], or the enzyme was inhibited 1. Introduction very efficiently by DFP, but at a high concentration [16]. Another serine protease inhibitor, 3,4-dichloroisocoumarin, The first carboxyl proteinases that were identified as being was either shown to relatively efficiently inhibit TPP I [16], insensitive to classic inhibitors of aspartyl proteases such as or reported to produce only 28% inhibition at 1 mM [12]. diazoacetyl-DL-norleucine methyl ester, 1,2-epoxy-3-(p-nitro- Phenylmethylsulfonyl fluoride did not inhibit TPP I activity phenoxy)propane, and pepstatin were isolated from Scytali- [13–15,17] or showed only minor inhibition at millimolar con- dium lignicolum, a wood-destroying fungus, in 1972 [1]. Since centration [12]. These discrepancies could result partially from then, numerous other pepstatin-insensitive carboxyl proteases the different assay conditions used. Nevertheless, the fact that (PCPs), mostly from bacteria and fungi, have been identified only high concentrations of inhibitors were effective also sug- and characterized. These enzymes have acidic pH optima gested that the catalytic mechanism of TPP I may differ signif- and usually broad substrate specificity [2–6]. Structure-based icantly from that of typical serine proteases. alignment of the amino acid sequences showed that some PCPs Most serine proteases contain a catalytic triad of essential such as peptidases from Pseudomonas sp. 101 (PSCP) and Xan- amino acids – serine, histidine, and aspartic acid [18]. Inhibi- thomonas sp. T-22 (XSCP), kumamolisin from Bacillus no- tion of TPP I with DEPC, which specifically modifies histidine vosp. MN-32 (KSCP), proteinase J-4 from Bacillus residues, suggested that histidine can be involved in the cata- coagulans, ScpA from Alicyclobacillus sendaiensis, or LYS45 lytic activity of the enzyme [12,14,17]. However, although a re- and LYS60 from Amoeba proteus share significant homology cent study showed that Ser475 is the active-site nucleophile of [7, review]. Resolution of the crystal structure of two PCPs – TPP I [16], the same report also demonstrated that Asp360 PSCP, recently renamed sedolisin [8], and KSCP [9] – revealed and Asp517, not conserved His236, are involved in the catalytic their topological similarity with subtilisin and a unique cata- activity of human TPP I. The potential participation of Glu in lytic triad with a nucleophilic serine residue, and glutamic acid the active site, like in other members of the SCP family, was not addressed by these authors. On the other hand, recent *Corresponding author. Fax: +1 718 982 6346. computer modeling and analysis of the high-resolution crystal- E-mail address: [email protected] (A.A. Golabek). lographic structures of KSCP and PSCP [7–9] suggested that

0014-5793/$30.00 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2005.01.035 1384 M. Walus et al. / FEBS Letters 579 (2005) 1383–1388 apart from Ser475 and Asp360, two other highly conserved ami- were sub-cultured two days after transfection and maintained in selec- no acid residues – Glu272 and Asp276 – could be involved in the tion medium supplemented by hygromycin B (200 lg/ml). Single colo- catalytic mechanism of human TPP I. nies were picked up, expanded, and tested for TPP I by using Western blotting. Cell lines showing the highest TPP I expression were used for Because TPP I is extensively glycosylated [19,20], our efforts further experiments. aimed at elucidating its catalytic mechanism on the basis of To obtain a high level of TPP I expression for further purification, we crystal structure have been unsuccessful to date. Thus, in an at- used stably transfected CHO cells deficient in dihydrofolate reductase neg tempt to clarify existing discrepancies regarding the identity of (CHO-DHFR ). These cells were transfected with plasmids encoding wtTPP I and Glu272, Asp276, Asp327, Asp360, and Ser475 mutant proteins the catalytically active amino acid residues of TPP I, we em- and then they were selected first with hygromycin B and then with ployed site-directed mutagenesis analyses. Here, we show that increasing concentrations of methotrexate, as described earlier [19]. apart from Ser475 and Asp360 identified by Lin et al. [16], also 272 276 327 Glu , Asp , and Asp are involved in the catalytic activity 2.4. SDS–PAGE and Western blotting of human TPP I. Cells were lysed in a buffer containing 50 mM Tris, pH 7.4, 1% Tri- ton X-100, and protease inhibitor mixture (Complete). Protein concentration was determined by using BCA assay and BSA as a standard. Twenty lg protein of cell lysate or 10 ll of conditioned medium per 2. Materials and methods lane was loaded onto 10% Tris/Tricine PAGE. Before running on SDS–PAGE, conditioned media were cleared by centrifugation at 2.1. Materials 14000 · g for 5 min. Electrophoretically separated proteins were Cell culture media and reagents were purchased from Invitrogen. En- immunoblotted, as described [19]. hanced Chemiluminescence (ECL) Kit reagents were from Amersham Biosciences. The bicinchoninic acid (BCA) kit was from Pierce. The 2.5. Immunofluorescence microscopy pcDNA3.1Hygro vector was from Invitrogen. The protease inhibitor For double-immunostaining, cells were fixed with methanol for mixture (Complete) and the Lipofectamine transfection reagent were 20 min at 4 C. Non-specific binding sites were blocked with 10% from Roche Molecular Biochemicals. Restriction enzymes and T4 li- FCS in phosphate-buffered saline (PBS) for 1 h. After incubation with gase were from New England Biolabs. All other chemicals were from primary antibodies diluted in 10% FCS in PBS overnight at 4 C, cells Sigma. Monoclonal (mAbs 8C4) and affinity-purified polyclonal anti- were washed with PBS and incubated for 1 h at room temperature with bodies (pAbs) to TPP I were described previously [19,21]. mAbs to lyso- species-specific secondary antibodies conjugated with fluorescent dyes: some-associated membrane protein (LAMP I), hamster-specific, were Alexa Fluor 488 (for TPP I; green fluorescence) and either Cy3 or from the Developmental Studies Hybridoma Bank, University of Iowa, Alexa Fluor 555 (for LAMP I and calreticulin; red fluorescence) and and pAbs against calreticulin were from Affinity Bioreagents. Peroxi- then viewed with a Nikon Eclipse E600 laser-scanning confocal micro- dase-conjugated secondary antibodies for ECL were from Amersham scope. Omission of the primary antibodies was used as a control of the Biosciences. Secondary antibodies conjugated to Alexa Fluor 488 and method. Alexa Fluor 555 were from Molecular Probes, and secondary antibodies conjugated to Cy3 were from Jackson ImmunoResearch. 2.6. TPP I activity measurement and kinetic analysis 2.2. Site-directed mutagenesis Measurements of specific TPP I activity were done, as described [19]. l The cDNA encoding wild-type (wt) human TPP I cloned into the In brief, 5 g protein of cell lysate pre-incubated for 1 h at pH 3.5 was KpnI/NotI site of pcDNA3.1Hygro was described earlier [19]. Mutated incubated in the reaction mixture containing 0.1 mM substrate Ala- cDNAs were generated using the overlap PCR technique according to Ala-Phe-7-amino-4-methylcoumarin (AAF-AMC), 100 mM NaCl and 0.1% Triton X-100 in a total volume of 100 ll of 0.1 M sodium Ho et al. [22] and wtTPP I-encoding plasmid as a template. The codons acetate, for 20 min at 37 C. The reaction was terminated by the addi- for Glu272, Asp276, Asp327, Asp360, and Asp517 were converted to l an Ala codon. The Ser475 codon was replaced by a Leu codon, as in tion of 50 l of 10% SDS. Liberated AMC was measured fluorometri- the naturally occurring mutation in CLN2 [11,19]. The Ser477 codon cally on CytoFluor (Applied Biosystems) (excitation 360 nm, emission l was replaced by a Phe codon to increase the probability of obtaining 460 nm), after alkalizing the solution by adding 50 l of 1 M Tris–HCl, an incorrectly folded TPP I mutant. pH 9.0. The following primers were used: Kinetic analysis was performed at 37 C in 0.1 M sodium acetate buffer, pH 5.0, 0.1% Triton X-100 also using AAF-AMC as a sub- Glu272(77)Ala: F – 50 cgggccgggattgcggccagtctagatgtgc 30 and R – 50 gcacatctagactggccgcaatcccggcccg 30; Asp276(81)Ala: F – 50 gag- strate, essentially as described [23]. Briefly, pre-warmed, serially diluted gccagtctagctgtgcagtacctgatgag 30 and R – 50 ctcatcaggtactgcacagcta- substrate was mixed with TPP I, incubated for 10 min at 37 C and the K gactggcctc 30; Asp327(132)Ala: F – 50 ctgtgagctatggagctgatgaggactccc reaction was terminated, as above. The m values were calculated by 30 and R – 50 gggagtcctcatctagctccatagctcaca 30; Asp360(165)Ala: F non-linear regression fit of initial velocity versus substrate to Michae- –50 cttcgcctcaggtgccagtggggccggg 30 and R – 50 cccggccccactggcacct- lis–Menten equation with the help of GraphPad Prism software. The k values were derived from the equation: V = k [E], where [E] gaggcgaag 30; Ser475(280)Leu: F – 50 ggtgtccggaaccttggcctctactccagt cat max cat is the enzyme concentration. 30 and R – 50 cactggagtagaggccaaggttccggacac 30; Ser477(282)Phe: F –50 ccggaacctcggcctttactccagtgtttggg 30 and R – 50 cccaaacactggag- taaaggccgaggttccgg 30; Asp517(322)Ala: F – 50 ggggcaggactctttgctg- 2.7. Purification of TPP I taacccgtggctgc and R – 50 gcagccacgggttacagcaaagagtcctgcccc 30. The Processed, mature TPP I polypeptide was purified from ten 35 cm numbering of the mutated amino acid residues shown above corre- Petri dishes of confluent CHO-DHFRneg cells overexpressing either sponds to the full-length cDNA of TPP I and is as used in this manu- wtTPP I or Glu272, Asp276, Asp327, Asp360, and Ser475 mutant proteins. script. The numbering corresponding to the mature enzyme is shown in The cells were lysed in 50 mM sodium acetate, pH 5.0, 1% Triton parentheses. Full-length TPP I cDNAs containing desired mutation(s) X-100 and protease inhibitor cocktail. TPP I was purified from cell ly- were subcloned into the KpnI/NotI site of pcDNA3.1Hygro. The struc- sates by a combination of SP-Sepharose (cation-exchange) chromatog- tural integrity of each mutated cDNA was verified by the PCR-medi- raphy, heparin-agarose affinity chromatography, and concanavalin ated dideoxy sequencing of the entire insert. A-affinity chromatography, essentially as described [12,14,17]. The overall yield was 5–20 lg of purified protein. 2.3. Cell culture and transfection Chinese hamster-ovary (CHO) cells were maintained in F-12 medium supplemented by 10% fetal calf serum (FCS), 2 mM glutamine, 3. Results and discussion and antibiotics at 37 C in a humidified atmosphere with 5% CO2. Cells were transfected either transiently (Asp517Ala mutant) or stably (all other mutant proteins) by using the Lipofectamine, according to A comparison of amino acid sequence of TPP I with that of the manufacturerÕs recommendation. To obtain stable cell lines, cells the three members of the sedolisin family of peptidases, namely M. Walus et al. / FEBS Letters 579 (2005) 1383–1388 1385

PSCP, XSCP, and KSCP as demonstrated in Fig. 1, and analysis of the high-resolution crystallographic structures of KSCP and PSCP [8,9] suggested that apart from Ser475 and Asp360, two other highly conserved amino acid residues – Glu272 and Asp276 – could be involved in the catalytic mechanism of human TPP I [7,24], whereas Asp327 could be involved in substrate binding [9]. To test this possibility, we substituted each amino acid residue potentially involved in the catalytic mechanism of the enzyme and stably expressed cDNAs encoding mutated TPP I in CHO cells. As a control, we used cells stably expressing wtTPP I, TPP I with point mutation introduced at 477 non-conservative Ser , and mock transfected cells. Fig. 2. Western blotting of wtTPP I and TPP I mutants stably Human TPP I is synthesized as a pre-proenzyme that con- expressed in CHO cells. Ten lg protein of cell lysate (upper panel) and tains 19 amino acid signal peptide cleaved off co-translation- 10 ll serum-free medium conditioned for 24 h (lower panel) were ally, and a 176 – amino acid propeptide removed during the immunoblotted with mAb 8C4. maturation process to yield a mature enzyme of 368 amino acid residues [10,16,25]. By SDS–PAGE analysis, the apparent judged by the co-localization study with LAMP I, a lysosomal molecular mass (Mw) of the proenzyme is 66–68 kDa, and that marker. Ser477Phe mutant protein did not co-localize with of the mature enzyme is 46–48 kDa [16,17,19,26]. LAMP I (Fig. 3), but showed subcellular distribution similar To determine the effect of introduced mutations on TPP I to calreticulin, an ER marker we used (not shown), confirming maturation and secretion, sub-confluent cells were transferred its ER-retention. Thus, except for Ser477Phe, none of the for 24 h to serum-free medium, and then both cell lysates and mutations introduced affected maturation or intracellular secretions were harvested and analyzed by immunoblotting localization of TPP I. with mAbs to TPP I. As demonstrated in Fig. 2 (upper panel), TPP I acts as a lysosomal aminopeptidase that sequentially Ser475Leu, Glu272Ala, Asp276Ala, Asp327Ala, and As- removes tripeptides from small polypeptides with unsubsti- p360Ala mutant proteins displayed polypeptide patterns simi- tuted N-terminus [12,14,15,17] and also shows a minor endo- lar to that of wtTPP I, with most of the cellular TPP I being in protease activity [15]. Similar to various other proteases, a 48-kDa, mature form. In contrast, Ser477Phe mutant was ex- TPP I proenzyme is able to autoactivate at acidic pH in vitro pressed at a low level and exclusively as a 68-kDa polypeptide [16,28]. This process leads to removal of the prodomain, gen- (Fig. 2, upper panel, lane 6). Proenzyme of Ser475Leu, eration of the 48-kDa species, and acquisition of the enzymatic Glu272Ala, Asp276Ala, Asp327Ala, and Asp360Ala mutant activity toward a reporter substrate. If TPP I maturation in proteins was secreted into the cell culture medium, thus similar vivo proceeded through autoactivation, proteolytic processing to wtTPP I (Fig. 2, lower panel), whereas Ser477Phe mutant of TPP I with catalytically important amino acids substituted protein was absent in cell secretions (Fig. 2, lower panel, lane should not have been possible, which, as we showed above 6). These data indicated that mutations at Ser475, Glu272, (Fig. 2), was not the case. However, we demonstrated earlier Asp276, Asp327, and Asp360 do not affect the normal processing that in vivo, an as yet unidentified lysosomal serine protease of human TPP I expressed in CHO cells. Low cellular levels of assists in the processing of TPP I proenzyme into the mature Ser477Phe mutant protein, lack of its maturation and secretion form [19]. Thus, to assess the ability of mutated polypeptides suggested that TPP I bearing this mutation was incorrectly to autoprocess in vitro, secreted mutant proenzymes were acti- folded, and like most misfolded proteins, underwent the endo- vated at pH 3.5 for 1 h in the absence and presence of inhibi- plasmic reticulum-associated degradation [27]. Given our ear- tors of the major classes of proteases (Complete) and then lier observation that TPP I matures in lysosomes, this analyzed by SDS–PAGE and Western blots. As visualized in finding also suggested that Ser475Leu, Glu272Ala, Asp276Ala, Fig. 4 (upper and lower panel), wtTPP I proenzyme was very Asp327Ala, and Asp360Ala mutant proteins were correctly efficiently autoprocessed in vitro in both the absence and the targeted to lysosomes. presence of protease inhibitors; hence, it was cleaved auto-cat- To verify this assumption, we analyzed intracellular distribu- alytically. Secreted proenzymes of TPP I mutants were par- tion of each mutated protein by double-immunolabeling and tially processed into the mature, 48-kDa species in the laser-scanning confocal microscopy analysis. wtTPP I, and absence of Complete (Fig. 4, upper panel). However, the pres- Ser475Leu, Glu272Ala, Asp276Ala, and Asp360Ala mutant ence of protease inhibitor cocktail led to the almost complete proteins (Fig. 3) as well as Asp327Ala mutant (not shown) ex- inhibition of autoprocessing of mutant proteins, except for pressed in CHO cells were mostly localized to lysosomes, as Asp327Ala mutant, as depicted in Fig. 4, lower panel. These

Fig. 1. Alignment of amino acid sequence of some bacterial SCPs and human TPP I encompassing fragments with highly conserved amino acid residues. The components of the catalytic machinery are underlined. Identical or conserved amino acid sequences are in bold. Amino acid numbering is based on full-length cDNAs. The following NCBI Accession Nos. were used: BAA07188 (PSCP precursor from Pseudomonas sp. 101), BAA12093 (XSCP precursor from Xanthomonas sp. T-22), BAB85637 (KSCP precursor from Bacillus novosp. MN-32), and AAH14863 (human TPP I precursor). 1386 M. Walus et al. / FEBS Letters 579 (2005) 1383–1388

Fig. 4. In vitro autoprocessing of wtTPP I and mutant proteins. Aliquots of serum-free medium conditioned for 24 h were preincu- bated at room temperature in the absence or the presence of protease inhibitors (Complete) (at 4· ﬁnal concentration recommended by the manufacturer) for 20 min; then media were adjusted to pH 3.5 with acetic acid and incubated for 1 h at 37 C. Afterwards, proteins were precipitated with 15% trichloroacetic acid on ice for 30 min, centri- fuged, washed in ice-cold 70% ethanol, air-dried, dissolved in gel loading buﬀer and analyzed by Western blotting.

alytic efficiency (kcat/Km) showed Ser475Leu mutant protein (0.4% of wtTPP I), thus confirming the observation of Lin et al. [16] that Ser475 is a primary catalytic residue in the TPP I active site. The residues Glu272 and Asp276 in TPP I are structural homologues of Glu78/Asp82 and Glu80/Asp84 of KSCP and PSCP, respectively. These residues in KSCP and PSCP were believed to play the role of proton shuttles, Glu residue being the first proton acceptor [8,9]. Accordingly, our data indicate that replacement of Glu272 has more profound effect on catalytic activity of TPP I than substitution of Asp276. However, we cannot exclude the possibility, which is rather less likely, that the contamination of Asp276Ala mutant prep- aration by endogenous, hamster TPP I could be responsible for the lower catalytic deficiency of this mutant protein. Computer modeling suggested that protonated Asp360 could help stabilize the electronegative oxygen atom of nucleophilic Ser475 during the formation of tetrahedral intermediate [8]. Indeed, the catalytic efficiency of Asp360 mutant was greatly reduced in comparison with wtTPP I, being comparable to that of Glu272 mutant. Thus, the inability of mutated TPP I with Ser475, Asp360, Glu272, and Asp276 substituted to auto-process, Fig. 3. Intracellular localization of wtTPP I and mutant proteins together with loss of proteolytic activity of these polypeptides stably expressed in CHO cells. Laser-scanning confocal-microscopy in spite of their normal folding, intracellular localization and analysis of CHO cells stably expressing wtTPP I and TPP I mutants secretion, corroborate the involvement of these amino acid res- immunostained with pAbs to TPP I (green fluorescence of secondary antibody labeled with Alexa Fluor 488) and mAbs to LAMP I, a idues in the catalytic mechanism of TPP I. lysosomal marker (red fluorescence of Cy3-conjugated secondary Unlike other sedolisins that show endopeptidase activity, antibody). Yellow color on merged images shows colocalization. TPP I acts as an exopeptidase that sequentially removes tripep- Original magnification: 1000·. tides from polypeptides with unsubstituted N-terminus, dem- onstrating only minor endoprotease activity. It was proposed that Asp327 of TPP I provides a structural basis for tripept- findings demonstrated that Glu272Ala, Asp276Ala, Asp360A- idyl-peptidase activity of TPP I [9]. However, as we evidenced la, and Ser475Leu mutant proenzymes were unable to auto- here, although the catalytic efficiency of Asp327Ala mutant process in vitro, which suggested that the catalytic machinery protein was greatly reduced in comparison with wtTPP I, the of these mutant proteins was compromised. affinity of this mutant protein for the tripeptidyl substrate To further explore this issue, we analyzed kinetic parameters (Km) was only slightly decreased (the Km was increased by of mutant proteins. To this end, Ser475Leu, Glu272Ala, As- 67%). Furthermore, Asp327Ala mutant did not demonstrate p276Ala, Asp327Ala, and Asp360Ala mutant proteins as well any activity toward the tripeptidyl substrate with the substi- as wtTPP I were purified from overexpressing CHO-DHFRneg tuted N-terminus (Boc-S-F-L-AMC, data not shown). Hence, cell lysates to near homogeneity. As demonstrated in Table 1, our data suggest either that Asp327 is not responsible for the all these mutant proteins had significantly reduced hydrolytic tripeptidyl-peptidase activity of TPP I or that it is not the sole activity in comparison with wtTPP I. The greatest loss of cat- structural determinant of this specificity. At the same time, M. Walus et al. / FEBS Letters 579 (2005) 1383–1388 1387

Table 1 Kinetic constants for wtTPP I and mutant proteins a 1 a 1 1 Mutant Km (mM) kcat (s ) kcat/Km (s mM ) Relative kcat/Km (%) wt TPP I 0.098 41.66 425.10 100 Glu272Ala 0.118 1.54 13.05 3 Asp276Ala 0.105 9.36 89.14 21 Asp327Ala 0.164 4.22 25.73 6 Asp360Ala 0.111 1.52 12.69 3 Ser475Leu 0.076 0.12 1.58 0.4 aKinetic values were obtained by averaging results from two independent experiments, each in three replicates.

Asp327Ala mutant proenzyme was capable of autoactivation data question the hypothetical role of calcium in TPP I struc- in vitro. Thus, although Asp327 is not a catalytic residue of ture and suggest that in vitro calcium affects neither TPP I the active site, a dramatic effect of Asp327 substitution on activity or activation nor its thermal stability. Taking into ac- TPP I activity suggests that it plays an important role(s) in count that Asp517Ala mutant protein shows predominantly the catalytic mechanism of TPP I, which may include hydrogen ER localization (Fig. 5, upper panel), profoundly hampered bonding with the substrate or orienting another catalytic maturation (Fig. 5, lower panel), and no enzymatic activity group in the active site. Further studies are needed to elucidate (not shown), we propose that Asp517 is important for folding this issue. and not for the catalytic mechanism of TPP I. Finally, we tested the role of Asp517 in the catalytic machin- In summary, our experiments allow us to conclude that ery of TPP I given that Lin et al. [16] have found that this res- apart from Ser475 and Asp360, also Glu272, Asp276, and idue is crucial for TPP I activity. According to homology Asp327 participate in the catalytic mechanism of human TPP searches, Asp517 aligns well with Asp316 in KSCP and Asp328 I. The involvement of serine, glutamic acid, and aspartic acid in PSCP (amino acid numbering of mature enzymes). Substitu- in the catalytic reaction validates the idea that TPP I is the first tion of these amino acids by mutagenesis led to the loss of mammalian representative of a growing family of SCPs. autoprocessing and catalytic activity of KSCP and PSCP [29]. Analysis of the crystal structure of PSCP and KSCP sug- Acknowledgments: This research was supported by the New York State gested that these aspartates may play a critical role in calcium- Office of Mental Retardation and Developmental Disabilities and NIH Grant NS047335. The authors thank Ms. Maureen Stoddard Marlow binding [8,9]. However, our recent, unpublished, experimental for copy-editing the manuscript.

References

[1] Murao, S., Oda, K. and Matsushita, Y. (1972) New acid proteases from Scytalidium lignicolum M-133. Agric. Biol. Chem. 36, 1647– 1650. [2] Oda, K., Sugitani, M., Fukuhara, K. and Murao, S. (1987) Purification and properties of a pepstatin-insensitive carboxyl proteinase from a gram-negative bacterium. Biochim. Biophys. Acta 923, 463–469. [3] Murao, S., Ohkuni, K., Nagao, M., Hirayama, K., Fukuhara, K., Oda, K., Oyama, H. and Shin, T. (1993) Purification and characterization of kumamolysin, a novel thermostable pepstatin-insensitive carboxyl proteinase from Bacillus novosp. MN-32. J. Biol. Chem. 268, 349–355. [4] Toogood, H.S., Prescott, M. and Daniel, R.M. (1995) A pepstatin-insensitive aspartic proteinase from a thermophilic Bacillus sp. Biochem. J. 307, 783–789. [5] Shibata, M., Dunn, B.M. and Oda, K. (1998) Substrate specificity of pepstatin-insensitive carboxyl proteinase from Bacillus coagulans J-4. J. Biochem. 124, 642–647. [6] Kwon, H.K., Kim, H. and Ahn, T.I. (1999) Pepstatin-insensitive carboxyl proteinase: a biochemical marker for late lysosomes in Amoeba proteus. Korean J. Biol. Sci. 3, 221–228. [7] Wlodawer, A., Li, M., Gustchina, A., Oyama, H., Dunn, B.M. and Oda, K. (2003) Structural and enzymatic properties of the Fig. 5. Maturation and intracellular localization of Asp517Ala mutant sedolisin family of serine-carboxyl peptidases. Acta Biochim. Pol. protein in transiently transfected CHO cells. Upper panel: Laser- 50, 81–102. scanning confocal microscopy analysis of cells immunostained with [8] Wlodawer, A., Li, M., Dauter, Z., Gustchina, A., Uchida, K., mAb 8C4 and secondary antibody conjugated with Alexa 488 (a, green Oyama, H., Dunn, B.M. and Oda, K. (2001) Carboxyl proteinase fluorescence) and calreticulin, an ER marker, and secondary antibody from Pseudomonas defines a novel family of subtilisin-like conjugated with Alexa 555 (b, red fluorescence) shows colocalization enzymes. Nat. Struct. Biol. 8, 442–446. on a composite image (c, yellow color). Original magnification: 1000·. [9] Comellas-Bigler, M., Fuentes-Prior, P., Maskos, K., Huber, R., Lower panel: Cells transfected with vector only (lane 1), wtTPP I (lane Oyama, H., Uchida, K., Dunn, B.M., Oda, K. and Bode, W. 2), and Asp517Ala mutant protein (lane 3) were analyzed 30 h after (2002) The 1.4 A˚ crystal structure of kumamolysin: a thermosta- transfection by immunoblotting with mAb 8C4. 20 lg protein per lane. ble serine carboxyl type proteinase. Structure 10, 865–876. 1388 M. Walus et al. / FEBS Letters 579 (2005) 1383–1388

[10] Sleat, D.E., Donnelly, R.J., Lackland, H., Liu, C.G., Sohar, I., [20] Wujek, P., Kida, E., Walus, M., Wisniewski, K.E. and Golabek, Pullarkat, R.K. and Lobel, P. (1997) Association of mutations in A.A. (2004) N-glycosylation is crucial for folding, trafficking, and a lysosomal protein with classical late-infantile neuronal ceroid stability of human tripeptidyl-peptidase I. J. Biol. Chem. 279, lipofuscinosis. Science 277, 1802–1805. 12827–12839. [11] Sleat, D.E., Gin, R.M., Sohar, I., Wisniewski, K.E., Sklower [21] Kida, E., Golabek, A.A., Walus, M., Wujek, P., Kaczmarski, W. Brooks, S., Pullarkat, R., Palmer, D.N., Lerner, T.J., Boustany, and Wisniewski, K.E. (2001) Distribution of tripeptidyl peptidase R.M., Uldall, P., Siakotos, A.N., Donnelly, R.J. and Lobel, P. I in human tissues under normal and pathological conditions. J. (1999) Am. J. Hum. Genet. 64, 1511–1523. Neuropathol. Exp. Neurol. 60, 280–292. [12] Page, A.E., Fuller, K., Chambers, T.J. and Warburton, M.J. [22] Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K. and Pease, (1993) Purification and characterization of a tripeptidyl peptidase L.R. (1989) Site-directed mutagenesis by overlap extension using I from human osteoclastomas: evidence for its role in bone the polymerase chain reaction. Gene 77, 51–59. resorption. Arch. Biochem. Biophys. 307, 354–359. [23] Golabek, A.A., Walus, M., Wisniewski, K.E. and Kida, E. (2004) [13] Watanabe, Y., Kumagai, Y. and Fujimoto, Y. (1992) Acidic Glycosaminoglycans modulate activation, activity, and stability tripeptidyl aminopeptidase in rat liver tritosomes: partial purifi- of tripeptidyl-peptidase I in vitro and in vivo. J. Biol. Chem. Dec 6 cation and determination of its primary substrate specificity. [Epub ahead of print]. Biochem. Int. 27, 869–877. [24] Wlodawer, A., Durell, S.R., Li, M., Oyama, H., Oda, K. and [14] Vines, D. and Warburton, M.J. (1998) Purification and charac- Dunn, B.M. (2003) A model of tripeptidyl-peptidase I (CLN2), a terisation of a tripeptidyl aminopeptidase I from rat spleen. ubiquitous and highly conserved member of the sedolisin family Biochim. Biophys. Acta 1384, 233–242. of serine-carboxyl peptidases. BMC Struct. Biol. 3, 8. [15] Ezaki, J., Takeda-Ezaki, M., Oda, K. and Kominami, E. (2000) [25] Liu, C.-G., Sleat, D.E., Donnelly, R.J. and Lobel, P. (1998) Characterization of endopeptidase activity of tripeptidyl pepti- Structural organization and sequence of CLN2, the defective gene dase-I/CLN2 protein which is deficient in classical late infantile in classical late infantile neuronal ceroid lipofuscinosis. Genomics neuronal ceroid lipofuscinosis. Biochem. Biophys. Res. Commun. 50, 206–212. 268, 904–908. [26] Ezaki, J., Tanida, I., Kanehagi, N. and Kominami, E. (1999) A [16] Lin, L., Sohar, I., Lackland, H. and Lobel, P. (2001) The human lysosomal proteinase, the late infantile neuronal ceroid lipofusci- CLN2 protein/tripeptidyl-peptidase I is a serine protease that nosis gene (CLN2) product, is essential for degradation of a autoactivates at acidic pH. J. Biol. Chem. 276, 2249–2255. hydrophobic protein, the subunit c of ATP synthase. J. Neuro- [17] Junaid, M.A., Wu, G. and Pullarkat, R.K. (2000) Purification chem. 72, 2573–2582. and characterization of bovine brain lysosomal pepstatin-insen- [27] Tsai, B., Ye, Y. and Rapoport, T.A. (2002) Retro-translocation of sitive proteinase, the gene product deficient in the human late- proteins from the endoplasmic reticulum into the cytosol. Nat. infantile neuronal ceroid lipofuscinosis. J. Neurochem. 74, 287– Rev. Mol. Cell Biol. 3, 246–255. 294. [28] Golabek, A.A., Wujek, P., Walus, M., Bieler, S., Soto, C., [18] Rawlings, N.D. and Barrett, A.J. (1994) Families of serine Wisniewski, K.E. and Kida, E. (2004) Maturation of human peptidases. Meth. Enzymol. 244, 19–61. tripeptidyl-peptidase I in vitro. J. Biol. Chem. 279, 31058–31067. [19] Golabek, A.A., Kida, E., Walus, M., Wujek, P., Mehta, P. and [29] Oyama, H., Abe, S., Ushiyama, S., Takahashi, S. and Oda, K. Wisniewski, K.E. (2003) Biosynthesis, glycosylation, and enzy- (1999) Identification of catalytic residues of pepstatin-insensitive matic processing in vivo of human tripeptidyl-peptidase I. J. Biol. carboxyl proteinases from prokaryotes by site-directed mutagen- Chem. 278, 7135–7145. esis. J. Biol. Chem. 274, 27815–27822.