Role of Mir-383 and Mir-146B in Different Propensities to Obesity in Male Mice

234 2

s-f xia, x-m duan and others Role of microRNA on thyroid 234:2 201–216 Research hormone action in obesity

Role of miR-383 and miR-146b in different propensities to obesity in male mice

Shu-Fang Xia1,2,*, Xiao-Mei Duan2,3,*, Xiang-Rong Cheng2, Li-Mei Chen1, Yan-Jun Kang1, Peng Wang4, Xue Tang2, Yong-Hui Shi2 and Guo-Wei Le2

1Wuxi School of Medicine, Jiangnan University, Wuxi, China 2State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, Wuxi, China Correspondence 3Shandong Sport Training Center, Jinan, China should be addressed 4COFCO Corporation Oilseeds Processing Division, Beijing, China to G-W Le *(S-F Xia and X-M Duan contributed equally to this work) Email [email protected]

Abstract

The study was designed to investigate the possible mechanisms of hepatic microRNAs Key Words (miRs) in regulating local thyroid hormone (TH) action and ultimately different ff obesity-prone propensities to high-fat diet (HFD)-induced obesity. When obesity-prone (OP) and ff obesity-resistant obesity-resistant (OR) mice were fed HFD for 7 weeks, OP mice showed apparent f

Endocrinology f microRNA

of hepatic steatosis, with significantly higher body weight and lower hepatic TH receptor ff type 1 deiodinase b (TRb) expression and type 1 deiodinase (DIO1) activity than OR mice. Next-generation ff TRb sequencing technology revealed that 13 miRs in liver were dysregulated between the Journal two phenotypes, of which 8 miRs were predicted to target on Dio1 or TRb. When mice were fed for 17 weeks, OR mice had mild hepatic steatosis and increased Dio1 and TRb expression than OP mice, with downregulation of T3 target genes (including Srebp1c, Acc1, Scd1 and Fasn) and upregulation of Cpt1α, Atp5c1, Cox7c and Cyp7a1. A stem- loop qRT-PCR analysis confirmed that the levels of miR-383, miR-34a and miR-146b were inversely correlated with those of DIO1 or TRb. Down-regulated expression of miR-383 or miR-146b by miR-383 inhibitor (anti-miR-383) or miR-146b inhibitor (anti-miR-146b) in free fatty acid-treated primary mouse hepatocytes led to increased DIO1 and TRb expressions, respectively, and subsequently decreased cellular lipid accumulation, while miR-34a inhibitor (anti-miR-34a) transfection had on effects on TRb expression. Luciferase reporter assay illustrated that miR-146b could directly target TRb 3′untranslated region (3′UTR). These findings suggested that miR-383 and miR-146b might play critical roles in Journal of Endocrinology different propensities to diet-induced obesity via targeting on Dio1 and TRb, respectively. (2017) 234, 201–216

Introduction

Obesity, resulting from imbalance between energy intake metabolic diseases (Haslam & James 2005, Puhl & Heuer and expenditure, is a major metabolic and nutritional 2009), such as atherosclerosis, type 2 diabetes, hyperten disorder worldwide, and represents one of the most sion and liver dysfunction (Dixon et al. 2001). High-fat diet prevalent risk factors for the occurrence of chronic (HFD), especially the saturated fat and monounsaturated

10.1530/JOE-17-0044 Research s-f xia, x-m duan and others Role of microRNA on thyroid 234:2 202 hormone action in obesity

fat, could be responsible for the epidemic. In the past few MicroRNAs (miRs) are small non-coding RNAs of decades, researchers have been intrigued by the fact that 19–24 nucleotides that can cause degradation of the target some people maintain a normal weight during their whole mRNA or translation block to regulate crucial biological lifetime despite living in an obesogenic environment that processes, such as metabolism, cell growth and apoptosis promotes weight gain. Epidemiological investigation has (Bartel 2004). Emerging results revealed that various miRs confirmed that weight regulatory system is biased toward were involved in the function of the TH (Nishi et al. obesity, which means that not everyone gains weight 2011, Boguslawska et al. 2014) and have come in the when consuming the high-fat rich diet (Schwartz et al. spotlight of research in obesity and metabolic syndrome 2003). Some individuals tend to increase body weight (Chartoumpekis et al. 2012). It has been proved that miR- on a HFD (illustrated as obesity-prone, OP), while others 21, miR-146a, miR-181a and miR-221 could react with the resist the development of obesity (obesity-resistant, OR) TRb directly (Jazdzewski et al. 2011). miR-224 and miR- (Cornier et al. 2009). Animal studies also verified that 383 have also been demonstrated to target on Dio1 3′UTR animals on the same genetic background had different (Boguslawska et al. 2011). Considering the important susceptibilities to HFD-induced obesity (Harrold et al. roles of TH in regulating hepatic energy homeostasis, 2000, Huang et al. 2003). Generally, OR animals either and the potential importance of miRs in regulating genes may eat less or elevate energy expenditure compared coding for proteins critical in these function, we sought to OP animals (Jackman et al. 2010a). On account of to test the hypothesis that miRs might play a critical role the multi-etiologic nature of obesity and the diverse in TH action by targeting Dio1 or TRb, and consequently metabolic perturbations in obese individuals, identifying induced different propensities to obesity. the causative factors is very difficult. Thyroid hormones (THs) play critical roles in the regulation of anabolic function, energy expenditure and Materials and methods lipid homeostasis in mammals via direct and indirect Animals regulation in its target genes (Sinha et al. 2014). The liver

Endocrinology might serve as an alternative depot for lipid storage when Male C57BL/6J mice (80, four-week-old) were purchased of adipose capacity is exceeded as in obesity (Agarwal & from Model Animal Research Center of Nanjing University Garg 2006), as well as an important target organ of T3 (Nanjing, Jiangsu, China) and housed in plastic cages under (3,5,3-triiodi-l-thyronine) (Pihlajamaki et al. 2009). It a controlled environment (a 12-/12-h light/darkness cycle, Journal has been estimated that nearly 8% of the hepatic genes 08:00–20:00 h, temperature: 23 ± 2°C, humidity: 60 ± 5%). are regulated by TH in vivo (Oppenheimer et al. 1987). After acclimatization for one week on standard laboratory These TH responsive genes can be both positively and chow, the mice were randomly divided into a control negatively regulated by TH through thyroid hormone group (Con, n = 16; fed a standard diet with energy density receptor b (TRb) in liver. It has been suggested that the 3.85 kcal/g, 10, 20 and 70% energy from fat, protein, and top-ranking gene set related to obesity was a set of genes carbohydrate, respectively) and a HFD group (n = 64; fed positively regulated by T3, such as Atp5c1 and Cox7c a HFD with energy density 4.73 kcal/g, 45, 20 and 35% (Pihlajamaki et al. 2009). Although there is no consensus energy from fat, protein and carbohydrate, respectively). with regard to the serum profiles of TH in obesity, it is Diets were provided by Research Diets (New Brunswick, NJ, widely accepted that iodothyronine deiodinases in USA). All mice had free access to the test diets and purified central and peripheral tissues determine tissue-specific water during the whole experiment. In the 7th week, HFD TH levels and TH primarily exerts their actions through mice were classified by body weight into OP and OR mice, interaction with TRs, and finally affecting TH-dependent based on the method described previously (Enriori et al. physiological activities. Our laboratory has found that 2007). Mice, whose body weights were ranging between different propensities to obesity might be related to the average ± 3 s.d. of the body weight of Con group, were HPT axis function and deiodinases activities (Xia et al. designated as OR mice (n = 16, 27.34 ± 0.42 g) and kept 2015). Hence, the regulation of steps involved in type 1 on HFD feeding. Whereas the mice that body weight was iodothyronine deiodinase (DIO1) and TRb action in liver 1.3-fold higher than that of the Con mice were selected, are expected to play major roles in adjusting metabolic of which 16 mice were randomly chosen and defined as rate and substrate partitioning under conditions of OP (n = 16, 34.98 ± 0.39 g). Interestingly, the frequency surplus energy supply. However, the mechanism is not of OR and OP mice per cage was normally distributed. well understood. Furthermore, initial body weight of mice significantly

correlated to final weight and was the only factor that Next-generation sequencing and bioinformatics analysis predicted OR vs OP, which was in accordance with previous Total RNA was isolated from liver samples (n = 3) research (Enriori et al. 2007). In the 7th week, half of mice that were randomly selected from OP and OR mice were randomly selected from each group and sacrificed using Trizol (Invitrogen). Then, each RNA sample was to assess the effects of short-term HFD consumption on processed to generate a cDNA library that was used the differentiation between OP and OR phenotypes. The for small RNA sequencing. Briefly, a small RNA library remaining mice were kept on feeding and sacrificed in the was generated from the samples using Illumina Truseq 17th week. Body weight and food intake were measured Small RNA Preparation kit (Illumina, San Diego, CA, weekly. The study was carried out in accordance with the USA). The quality and size of the library were evaluated recommendations of the Guide for the Care and Use of by Agilent 2100 Bioanalyzer. The purified cDNA library Laboratory Animals of the Institutional Animal Care and was used for cluster generation with Illumina TruSeq Use Committee of Jiangnan University (JN no. 16 2015). Rapid SR Cluster Kit-HS using Illumina HiSeq 2500. The small RNA sequencing data were first cleaned by Indirect calorimetry analysis executing small RNA sequencing data cleaning pipeline. Next, the clean sequence data were aligned to miRBase One week before the end of their respective dietary version 20 (v20) to detect and estimate the expression of manipulation, all mice were placed in the Comprehensive microRNAs. Because variances did not vary systematically Laboratory Animal Monitoring System (C.L.A.M.S; by group, the t-test (unpaired, two-tailed with equal Columbus Instruments, Columbus, OH, USA) to variance) was used to identify the altered expressions evaluate oxygen consumption (VO ), carbon dioxide 2 of miRNAs between groups, miRNAs satisfying P < 0.05 production (VCO2), respiratory exchange ratio (RER), were recorded. energy expenditure (EE = (3.815 + 1.232 × RER) × VO2) and Analysis of miRs predicted targets was performed ambulatory activity. Animals were allowed to acclimatize using the following three algorithms: TargetScan in each individual metabolic cage for one day, and then (Lewis et al. 2003) (http://www.targetscan.org/), PicTar Endocrinology the data of the second day were used for further analysis. (Krek et al. 2005) (http://pictar.mdc-berlin.de/) and of Ambulatory activity was assessed in both horizontal and miRanda (John et al. 2004) (http://www.microrna.org/ vertical directions using infrared beams to count the beam microrna/getMirnaForm.do).

Journal breaks during the study.

Primary hepatocyte isolation and transient transfection Tissue samples preparation and serum Primary hepatocytes were isolated from male parameters measurement C57BL/6J mice and cultured as previously described At each period, the mice were fasted overnight and slightly (Sharma et al. 2011). The miR-34a, miR-383 and anesthetized by intraperitoneal injection of pentobarbital miR-146b mimics and inhibitors were synthesized (50 mg/kg). Blood was collected, and then liver and by GenePharma Co. Ltd (Shanghai, China) white adipose tissues (including perirenal, epididymal, with the following sequences: miR-383 mimic and mesenteric fat) were thoroughly removed, weighed, (5′-AGAUCAGAAGGUGACUGUGGCU-3′), miR-34a frozen with nitrogen liquid and stored at −80°C. The mimic (5′-UGGCAGUGUCUUAGCUGGUUGU-3′), miR- experiments were proceeded between 08:00 and 10:00 to 146b mimic (5′-UGAGAACUGAAUUCCAUAGGCU-3′), minimize possible circadian mRNA expression variation. anti-miR-383 (5′-AGCCACAGUCACCUUCUGAUCU-3′, Serum total T4 (TT4) and total T3 (TT3) concentrations 2′Ome modification), anti-miR-34a were measured by radioimmunoassay kits (Diagnostic (5′ -ACAACCAGCUAAGACACUGCCA-3′ , Products, Los Angeles, CA, USA) with the modifications 2′Ome modification) and anti-miR-146b described elsewhere to optimize the assay for mouse serum (5′-AGCCUAUGGAAUUCAGUUCUCA-3′, 2′Ome (Weiss et al. 1998). The detection limits were 1 μg/dL and modification). Hepatocytes were transfected with 0.02 μg/dL for total T4 and total T3, respectively. Serum 50 nM mimic or 100 nM inhibitor using X-tremeGene triglycerides (TG) and total cholesterol (TC) were also siRNA transfection reagent (Roche Diagnostics). To determined using commercial kits (Wako Pure Chemical induce lipid accumulation, primary mouse hepatocytes Industries). were incubated with or without 0.5 mM or 1 mM FFAs

(2:1 oleate/palmitate, Sigma), 6 h after miRs transfections. Western blot analysis Hepatocytes were harvested at 24-h post transfection Western blot analysis was performed as previously for RNA extraction and 48-h post transfection for described. Protein extracted from mouse liver and protein extraction. hepatocytes was separated with 12% SDS-PAGE and transferred to PVDF (polyvinylidene fluoride) membranes Quantitative RT-PCR analysis (Millipore). After being blocked with 5% nonfat milk for 1 h, the membranes were incubated using the Total RNA was isolated from liver and primary mouse primary antibodies (anti-DIO1, Proteintech, Wuhan, hepatocytes using Trizol reagent (Invitrogen). Quantitative China; anti-TRb, Santa Cruz Biotechnology; anti- RT-PCR was performed with an ABI PRISM 7500 Sequence GAPDH, Abcam) at 4°C overnight. After washing with Detection System (Applied Biosystems) using SYBR Green TBST, bolts were incubated with HRP-labeled secondary Real-time PCR Master Mix (Bioneer, Daegu, Korea). The antibodies. Detection was accomplished using enhanced relative amount of each transcript was normalized to chemiluminescence reagents (Immobilon Western cyclophilin A. microRNA PCRs were performed using a Detection Reagents, Millipore) and exposure to film. microRNA-specific qPCR kit (Qiagen) and U6 was used for normalization. The relative expression was calculated

with the comparative ΔΔCT method, the data were DIO1 activity determination expressed as 2−ΔΔCT. The primers used in the current study were illustrated in Table 1. All reactions were conducted DIO1 activity in liver and primary hepatocytes was in triplicate. measured based on previously published literature (Araujo et al. 2010). A specific DIO1 inhibitor (PTU) and excess T4 were used to confirm that type 2 deiodinase could not be detectable. Briefly, 25 mg of liver samples Table 1 Primers used for real-time PCR. (n = 8) was used for homogenization. Triplicates of Direction Sequence (5′–3′)

Endocrinology homogenates (5 μg protein) were incubated with rT3 125 of Dio1 Forward GGT GCA ACA TTT GGG AGT TTA TG (1 μM) and [ I] rT3 (PerkinElmer Life Sciences) that Reverse CAA TAA GCC TCT TGA ACT GGT CA were previously purified using Sephadex LH-20 (Sigma TRb Forward AAA TCT CCA TCC ATC CTA TTC C Chemical) and potassium phosphate buffer (containing Journal Reverse CTT CCA AGT CAA CCT TTC CA Srebp1c Forward ATC GGC GCG GAA GCT GTC GGG DTT and EDTA). DIO1 activity was expressed as GTA GCG TC picomoles of rT3 deiodinated per minute per milligram Reverse ACT GTC TTG GTT GTT GAT GAG CTG GAG CAT of protein. Acc1 Forward ATT GGG CAC CCC AGA GCT A Reverse CCC GCT CCT TCA ACT TGC T Scd1 Forward TGG GTT GGC TGC TTG TG Histological analysis Reverse GCG TGG GCA GGA TGA AG Fasn Forward TTC TAC GGC TCC ACG CTC TTC C After the liver was weighed, small part of the liver Reverse GAA GAG TCT TCG TCA GCCAGG A from the same position (n = 4) was embedded in OCT Cpt1α Forward GCG AAG TGT CGG CAG ACC TA Reverse TGT TCC GAT TCG TCC AAC GT compound (Sakura Finetech, Tokyo, Japan) and then Lpl Forward TGG AGA AGC CAT CCG TGT G stained with Oil Red O (Baso, Taiwan, China) for Reverse TCA TGC GAG CAC TTC ACC AG lipid deposition. Histological evaluation of tissue Fabp Forward GTG GTC CGC AAT GAG TTC AC Reverse GTA TTG GTG ATT GTG TCT CC morphology was conducted under an Olympus light Atp5c1 Forward GCC AAC ATC ATC TAC TAC TCT C microscope (Olympus). Reverse TCC TTC TTT ACC TCT TGT CTG Cox7c Forward CCA CCT ATC ATA TTT GCC ACA C Reverse CGG TAA AGC ATT TGG TCA GG Cyp7a1 Forward CATCTCAAGCAAACACCATTCC Triglyceride determination Reverse TCACTTCTTCAGAGGCTGGTTTC Ldlr Forward GGA AAA GCA TCG CTA GCA AGT Hepatic and intracellular lipids were extracted with the Reverse ATT GGA CTG ACA GGT GAC AGA CA mixed solvents of methanol: chloroform (vol/vol = 1:2) Cyclophilin A Forward AGA CAA GGT CCC AAA GACAGC (Folch 1957) from livers and cell lysates. The resulting AGA extract was re-suspended in water for TG determination Reverse TGT GAA GTC ACC ACC CTG ACA CAT using commercial kit (Wako Pure Chemical Industries).

Luciferase reporter assay No significance on energy intake was observed between OR and Con mice during the first 9 weeks, and in the To generate a 3′ untranslated region (3′UTR) luciferase subsequent 8 weeks, OR mice consumed significantly reporter construct, the full length of the 3′UTR from increased calorie compared to Con mice (Fig. 1B and C), TRb containing putative miR-146b-binding sites was indicating that increased body weight of OR mice might subcloned into a pmirGLO Dual-Luciferase miRNA Target be partly attributed to increased energy intake. Expression Vector (Promega Corporation) located 3′ to Analysis of tissue indexes revealed that the difference the firefly luciferase translational stop codon. Site-directed on liver and visceral fat (perirenal, epididymal and mutagenesis in the seed regions of the putative miR- mesenteric fat) pad mass indexes between OR and Con 146b-binding sites in the TRb 3′UTR was generated using mice was not significant in the 7th week and reached overlap-extension PCR with mutagen primer pairs (TRb- statistical significance in the 17th week (Fig. 1D, E, F and 3′UTR-MUT1-PF and TRb-3′UTR-MUT1-PR, TRb-3′UTR- G). OP mice demonstrated significantly higher liver and MUT2-PF and TRb-3′UTR-MUT2-PR). For the luciferase visceral fat pad mass indexes, as well as increased TG levels reporter assay, HEK293T cells were placed in 24-well plates than Con mice in both periods (Fig. 1H). OR mice showed and co-transfected with pmirGLO-3′UTR-WT1 (TRb-WT1) no significant difference on TG and TC levels relative or pmirGLO-3′UTR-MUT1 (TRb-MUT1), and pmirGLO- to Con mice in the 7th week, but exhibited remarkably 3′UTR-WT2 (TRb-WT2) or pmirGLO-3′UTR-MUT2 (TRb- higher TC levels in the 17th week (Fig. 1I). MUT2), respectively, and miR-146b mimic or negative control with Lipofectamine 2000 (Invitrogen). Assays were conducted 24 h after transfection with the Dual- Differences in RER, energy expenditure and ambulatory Luciferase Reporter Assay System (Promega). Transfections activities between OR and OP mice were performed three times in independent experiments. Determination of RER over a 24-h period displayed that OP mice showed remarkably lower RER values than Con Statistical analysis group both in the 7th and 17th week (Supplementary

Endocrinology Fig. 1A, B, C and D, see section on supplementary data Data were presented as mean s.e.m. Statistical analysis of ± given at the end of this article), indicating a shift in was performed using SPSS 20.0. Significant differences metabolism toward an increase in the utilization of lipids were determined either by two-tailed Student t-test or

Journal as substrate. Although OR mice had significantly lower one-way ANOVA followed by post hoc Duncan’s test for energy expenditure than Con mice in the daytime in both group comparisons. P < 0.05 was considered statistically periods, the significance disappeared in the nighttime significant. (Supplementary Fig. 1E, F, G and H). In the whole day of both periods, OR mice had significantly higher energy expenditure than OP mice, suggesting that lean Results phenotype of OR mice might be partially attributed to High-fat diet-induced OP and OR phenotypes elevated energy expenditure. In the 7th week, OR mice had more ambulatory When the experiment started, average body weight of activities than Con and OP mice both in the light and mice that fed a standard diet or a HFD was not significantly darkness cycles (P < 0.05), which might be one factor different. Gradually, HFD-fed mice gained body weight for differentiation of lean and obese phenotypes at a faster rate than Con group. However, part of mice (Supplementary Fig. 1J). In the nighttime of the 17th week, from HFD group had similar and even lower body weight OP mice were 214% and 34% more active than Con and gain compared to the Con mice. In the 7th week, OP and OR mice, respectively. OR mice were 134% more active OR mice were selected. Over a period of 17 weeks, the than Con mice (Supplementary Fig. 1L). OP group became 67.24% heavier than the Con group. In the first 13 weeks, OR mice had similar body weight compared to Con group. In the subsequent 4 weeks, OR Differences in serum thyroid hormones and hepatic DIO1 mice increased body weight at a higher rate and became activity between OR and OP mice 21.68% heavier than Con mice (Fig. 1A). Finally, OP mice consumed significantly higher calorie than Con mice, As illustrated in Fig. 2, although no significance on serum which was also remarkably higher than those of OR mice. TT4 levels was observed among the three groups in the

http://joe.endocrinology-journals.org © 2017 Society for Endocrinology Published by Bioscientifica Ltd. DOI: 10.1530/JOE-17-0044 Printed in Great Britain Downloaded from Bioscientifica.com at 10/02/2021 04:17:10AM via free access Research s-f xia, x-m duan and others Role of microRNA on thyroid 234:2 206 hormone action in obesity Endocrinology Figure 1 of Phenotypes and lipid profiles of OP and OR mice fed HFD. (A) Body weight profiles. Mice were weighed weekly for 17 weeks throughout the Journal experiment. (B) Cumulative food intake, (C) cumulative energy consumption, (D) liver mass index, (E) perirenal fat pad mass index, (F) epididymal fat pad mass index, (G) mesenteric fat pad mass index, (H) serum triglycerides and (I) serum total cholesterol in Con, OP and OR mice in the 7th week and 17th week. Samples for body weight were 16 in the first 7 weeks and 8 in the subsequent 10 weeks. Samples for food intake were 4. Samples for all other parameters were 8. Data were presented as mean ± s.e.m. Con, control; OP, obesity-prone; OR, obesity-resistant. *P < 0.05 vs Con; #P < 0.05 vs OP.

7th week (Fig. 2A), OP mice showed remarkably lower cellular T3 level in liver. No significant difference was T4 levels compared to Con mice in the 17th week, as observed in DIO1 activity between OR mice and Con mice well as significantly decreased T3 levels in both periods in the 7th week and reached statistical significance in the (Fig. 2B). However, during the whole experiments, OR 17th week (P < 0.05). mice demonstrated similar TT4 and TT3 levels compared to Con and OP mice. Considering the importance of Differential miRs expression in livers of OR mice vs OP peripheral deiodinases activities in deciding circulating mice and putative gene targets TH levels, hepatic DIO1 activity was further measured. The results showed that compared to Con and OR mice, OP To investigate the potential role of miRs in different mice showed significantly decreased DIO1 activity in liver propensities to HFD-induced obesity, next-generation in both periods, suggesting the possibility of a decreased sequencing was used in livers of OP and OR mice in

Table 2 Differentially expressed microRNAs in livers of OR mice compared with those of OP mice.

Fold ID change P value TargetScan PicTar miRanda mmu-miR-144 0.54 1.04E–03 – – – mmu-miR-200b 0.68 8.12E–03 – – – mmu-miR-223 2.30 1.05E–02 – – – mmu-miR-34a 0.67 1.20E–02 TRb (+) – – mmu-miR-142-3p 0.66 1.80E–02 – – – mmu-miR-383 0.61 3.02E–02 Dio1 (+) Dio1 Dio1 (+) (+) mmu-miR-1247 1.87 3.12E–02 Dio1 (+) – – mmu-miR-146b 0.56 3.13E–02 TRb (+) – – mmu-miR-720 1.39 3.49E–02 – – – mmu-miR-139-5p 1.33 3.59E–02 – – TRb (+) mmu-miR-541 0.67 3.66E–02 TRb (+) – – mmu-miR-592 0.54 4.10E–02 TRb (+) – – mmu-miR-100 1.30 5.03E–02 Dio1 (+) – –

TargetScan, PicTar and miRanda were used to screen the differentially expressed miRs whose putative targets included Dio1 or TRb. (–) meant that miRs did not target on Dio1 or TRb, while (+) meant that miRs targeted on Dio1 or TRb.

of miR-383 predicted by TargetScan, PicTar and miRanda. Additionally, miR-1247 and miR-100 were also revealed to target on Dio1 only predicted by TargetScan. With the same algorithm, miR-34a, miR-146b, miR-541 and miR-592 were illustrated to target on TRb. Furthermore, Endocrinology

of miR-139-5p was also shown to possibly target on TRb by miRanda. Journal

Differential expressions of DIO1 and its possible upstream miRs in livers between OR and OP mice

As shown in Fig. 3, Dio1 mRNA and protein expression in livers of OP mice was significantly downregulated

Figure 2 than that of Con mice in both periods. OR mice showed Differences of (A) serum T4, (B) serum T3 and (C) hepatic DIO1 activity significantly increased Dio1 levels than the other two among Con, OP and OR mice. Data were presented as mean ± s.e.m. (n = 8). groups in the 7th week and significantly lower level Con, control; OP, obesity-prone; OR, obesity-resistant. *P < 0.05 vs Con; # than Con mice in the 17th week (Fig. 3A and B). Based P < 0.05 vs OP. on predicting results by TargetScan, PicTar and miRanda, the 7th week, respectively. As displayed in Table 2, the in order to investigate the possible miRs that might be expression levels of 13 miRNAs in livers of OR mice were involved in deciding Dio1 expression, a stem-loop qRT- significantly different from those of OP mice, including PCR assay was used to preliminarily reveal the putative 8 downregulated miRNAs (miR-144, miR-200b, miR-34a, miRs expression. Compared to Con mice, the relative miR-142-3p, miR-383, miR-146b, miR-541 and miR-592) expression of hepatic miR-383 was significantly increased and 5 upregulated miRNAs (miR-223, miR-1247, miR-720, in OP mice in both periods. OR mice showed significantly miR-139-5p and miR-100). lower miR-383 relative expression than OP and Con mice The computer-based algorithms (PicTar, TargetScan in the 7th week and remarkably higher miR-383 expression and miRanda) were used to get a list of the miRNAs whose than Con mice in the end, which was lower than OP mice predicted target genes included Dio1 or TRb or both. As (Fig. 3C). The levels of miR-383 were inversely correlated illustrated in Table 2, Dio1 was one of the putative targets with Dio1 mRNA and protein expression, suggesting the

Figure 3 Differences of hepatic Dio1 expression and its upstream miRNA expression. (A) Dio1 mRNA expression, (B) DIO1 protein expression, (C) miR-383, (D) miR-100 and (E) miR-1247 expression Endocrinology in Con, OP and OR mice in the 7th week and of 17th week. Data were presented as mean ± s.e.m. (n = 8). Con, control; OP, obesity-prone; OR, obesity-resistant. *P < 0.05 vs Con; #P < 0.05 vs OP. Journal

possible role of miR-383 in controlling DIO1 expression. OP mice showed significantly lower TRb expression than Additionally, in the 7th week, OP mice demonstrated Con mice, while OR mice demonstrated significantly lower significantly lower expression of miR-100 and miR-1247 TRb expression than Con mice, which was significantly than Con mice, while OR mice showed remarkably higher higher than that of OP mice (Fig. 4A and B). miR-100 expression than the other two groups and higher Results from qRT-PCR showed that OR mice miR-1247 expression than OP mice. In the 17th week, demonstrated a significant downregulation of miR-34a and OP mice displayed significantly higher expression of miR-146b compared to Con and OP mice in the 7th week, miR-100 and miR-1247 than Con mice, OR mice showed but showed significantly higher miR-34a and miR-146b remarkably lower expression of miR-100 and miR-1247 expression than Con mice in the 17th week, which was than OP mice (Fig. 3D and E). remarkably lower than that of OP mice (Fig. 4C and D). No significance on miR-541 relative expression was observed in the 7th week, and OP mice displayed a significant Differential expressions of TRb and its possible upregulation of miR-541 in relative to Con mice in the upstream miRs in livers between OR and OP mice 17th week (Fig. 4E). OR mice demonstrated a significant In the 7th week, OP mice showed significantly increased decrease in miR-592 relative expression compared to Con TRb mRNA and protein expression compared to Con mice in the 7th week (Fig. 4F). No significance on miR- mice, while OR mice displayed remarkably higher TRb 139-5p expression was observed among the three groups expression than the other two groups. In the 17th week, both in the 7th week and 17th week (Fig. 4G).

Figure 4 Differences of hepatic TRb expression and its upstream miRNA expression. (A) TRb mRNA expression, (B) TRb protein expression, (C) miR-34a, (D) miR-146b, (E) miR-541, (F) miR-592 expression and (G) miR-139-5p in Con, OP, and OR mice in the 7th week and 17th week. Data were presented as mean ± s.e.m. (n = 8). Con, control; OP, obesity-prone; OR, obesity-resistant. *P < 0.05 vs Con; #P < 0.05 vs OP.

Different hepatic steatosis possibly regulated by TH (Fig. 5B). Though, no significance was found in OR mice between OR and OP mice in the 7th week. Only in the 17th week, OR mice showed observable hepatic steatosis relative to Con mice. In the 7th week, hepatic TG levels of OP mice were Here, we further investigated part of TH responsive increased significantly compared to those of Con and genes that involved in lipogenesis (Srebp1c, Acc1, Scd1 OR mice (Fig. 5A). When the mice were fed for a longer and Fasn), lipid mobilization and fatty acid oxidation time, OP mice showed significantly higher hepatic TG genes (Cpt1α, Lpl and Fabp), energy metabolism (Atp5c1 levels than the other two groups, while OR mice also and Cox7c) and cholesterol metabolism (Cyp7a1 and Ldlr) showed a remarkably increased TG levels compared (Fig. 5C and D). In the 7th week, OP mice had significantly to Con mice. Additionally, Oil Red O staining of liver increased expressions of genes involved in lipogenesis sections of mice confirmed that there was a progressively (about 3.47 fold of Srebp1c, 1.79 fold of Acc1, 6.87 fold of severe steatosis seen in OP mice compared with Con mice

Endocrinology Figure 5 of Differences of hepatic lipids, histology and T3 target genes expressions among Con, OP and OR mice. (A) Hepatic TG (n = 8), (B) Oil Red O staining of liver samples from Con, OP and OR mice that were fed for 7 and 17 weeks (n = 4). Scale bars indicated 100 μm. Alterations of T3 responsive genes expression of mice when they were fed for 7 weeks (C) and 17 weeks (D), respectively (n = 8). Data were presented as mean ± s.e.m. Con, control; OP, obesity-prone; # Journal OR, obesity-resistant. *P < 0.05 vs Con; P < 0.05 vs OP.

Scd1 and 13.47 fold of Fasn), lipid mobilization and fatty as well as decreased expressions of Lpl, Atp5c1 and Cox7c acid oxidation (2.58 fold of Cpt1α, 3.89 fold of Lpl and compared to Con mice (Fig. 5D). 6.20 fold of Fabp) and cholesterol metabolism (1.98 fold of Ldlr), as well as decreased expressions of genes involved MicroRNAs are robustly induced in free fatty acid in energy metabolism (57% of Atp5c1 and 52% of Cox7c) treated mouse hepatocytes when compared to control mice, while OR mice showed significantly higher expressions of some genes (2.38 fold Hepatocytes are the major cells that control lipid metabo of Scd1, 3.54 fold of Cpt1α, 2.29 fold of Lpl and 2.48 fold lism and the primary location of lipid accumulation in of Fabp, 4.35 fold of Cyp7a1) than Con mice (Fig. 5C). NAFLD (Ng et al. 2014). We used primary mouse hepatocytes In the 17th week, OP mice demonstrated significantly and found that free fatty acids (0.5 mM and 1 mM) higher expression of genes involved in lipogenesis (about increased intracellular TG concentrations (Supplementary 4.69 fold of Srebp1c, 5.81 fold of Acc1, 12.21 fold of Scd1 Fig. 2A), upregulated the expression of miR-383, miR-34a and 17.38 fold of Fasn) and remarkably lower expression and miR-146b expression, and downregulated TRb and of genes involved in lipid mobilization and fatty acid Dio1 relative expression (Supplementary Fig. 2B), as well oxidation (46% of Cpt1α, 68% of Lpl and 79% of Fabp), as protein levels (Supplementary Fig. 2C). Additionally, energy metabolism (38% of Atp5c1 and 31% of Cox7c), lipogenensis genes (including Srebp1c, Acc1, Scd1, Fasn) and cholesterol metabolism (40% of Cyp7a1 and 57% were all upregulated, while Cpt1α, Lpl, Cyp7a1 and Ldlr Ldlr) when compared to control mice, whereas OR mice expressions were downregulated in 1.0 mM FFA-treated showed increased expressions of Scd1, Fasn and Cyp7a1, hepatocytes (Supplementary Fig. 2D).

microRNAs participate in the regulation of DIO1 and We further explored the roles of miR-34a and miR- TRb expression 146b targeting TRb in lipid accumulation of hepatocytes. Enforced expression of miR-34a (Supplementary Fig. 3A The introduction of miR-383 mimic into hepatocytes and B) and miR-146b (Fig. 7A and B) both resulted in an decreased the amount of Dio1 mRNA (downregulation obvious reduction of TRb mRNA and protein levels. In of 51.3%, P < 0.05) (Fig. 6A) and protein contrast, knockdown of miR-34a and miR-146b resulted (downregulation of 41.0%, P < 0.05) (Fig. 6B), while in an increase in TRb mRNA and protein levels. However, anti-miR-383 increased Dio1 mRNA and protein levels. knockdown of miR-34a failed to significantly increase TRb Next, we incubated hepatocytes with anti-miR-383 and mRNA and protein levels (Supplementary Fig. 3C and D) further used FFA treatment to induce hepatocytes lipid and decrease intracellular lipid content (Supplementary accumulation. The results showed that anti-miR-383 Fig. 3E) upon FFA treatment. On the contrary, knockdown upregulated Dio1 expression (Fig. 6C), increased of miR-146b attenuated the decrease in TRb mRNA DIO1 level (Fig. 6D) and activity (Fig. 6E), as well as and protein levels (Fig. 7C and D) and reduced the TG upregulating of expression of TH responsive genes content (Fig. 7E) upon FFA treatment. Expressions of lipid involved in lipid metabolism, including Srebp1c, Acc1, metabolism genes were also altered accordingly, including Scd1, Fasn, Cpt1α, Lpl, Fabp, Atp5c1, Cox7c, Cyp7a1 and upregulation of Srebp1c, Acc1, Scd1, Fasn, Cpt1α, Lpl, Fabp, Ldlr (Fig. 6F), and ultimately decreased intracellular TG Atp5c1, Cox7c, Cyp7a1 and Ldlr (Fig. 7F). Thus, it seemed contents (Fig. 6G). Endocrinology of Journal

Figure 6 miR-383 regulated DIO1 expression and lipid metabolism in primary hepatocytes. (A) miR-383 and Dio1 mRNA levels, and (B) DIO1 protein levels were detected in primary hepatocytes transfected with miR-383 mimic or mimic negative control (mimic-NC) and the miR-383 inhibitor (anti-miR-383) or inhibitor negative control (inhibitor-NC). (C) miR-383 and Dio1 mRNA levels, (D) DIO1 protein levels, (E) DIO1 activity, (F) lipid metabolism-related TH responsive genes expression, and (G) intracellular TG contents in free fatty acid-treated primary hepatocytes transfected with anti-miR-383. mRNA levels were detected in primary hepatocytes 24 h after transfection, while protein levels were detected by Western blotting 48 h after transfection. Mean ± s.e.m. shown were representative of at least three independent in vitro experiments. *P < 0.05 vs mimic-NC; #P < 0.05 vs inhibitor-NC.

Figure 7 Journal miR-146b regulated TRb expression and lipid metabolism in primary hepatocytes. (A) miR-146b and TRb mRNA levels, (B) TRb protein levels were detected in primary hepatocytes transfected with miR-146b mimic or mimic negative control (mimic-NC) and the miR-146b inhibitor (anti-miR-146b) or inhibitor negative control (inhibitor-NC). (C) miR-146b and TRb mRNA levels, (D) TRb protein levels, (E) intracellular TG contents and (F) lipid metabolism- related TH responsive genes expression in free fatty acid-treated primary hepatocytes transfected with anti-miR-146b. mRNA levels were detected in primary hepatocytes 24 h after transfection, while protein levels were detected by Western blotting 48 h after transfection. Mean ± s.e.m. shown were representative of at least three independent in vitro experiments. *P < 0.05 vs mimic-NC; #P < 0.05 vs inhibitor-NC.

that miR-146b could specifically regulate TRb expression 7-base substitutions within the second putative miR-146b and T3-TR-dependent genes expressions, and thereof seed-matched sequence in 4050–4056 bp) and transfected regulate hepatic lipid metabolism. into HEK293 cells. miR-146b mimics had no effects on the activity of pmirGLO-TRb-3′UTR-WT1 and pmirGLO- TRb-3′UTR-MUT1 (Fig. 8B), but significantly inhibited the activity of pmirGLO-TRb-3 UTR-WT2, and had no The 3′UTR of TRb is a direct target for miR-146b ′ apparent inhibitory effect on pmirGLO-TRb-3′UTR-MUT2 To understand whether miR-146b directly target TRb (Fig. 8C). These results demonstrated that the second 3′UTR, TargetScan7.1 online prediction was used. The binding site of miR-146b (4050–4056 bp) in the TRb prediction showed that 2 putative miR-146b-binding sites 3′UTR existed. (3111–3117 bp and 4050–4056 bp) were present in the TRb 3′UTR (Fig. 8A). To confirm the relationship between miR- 146b and TRb, two mutated TRb 3′UTR dual-luciferase Discussion reporter vectors were constructed (pmirGLO-TRb-3′UTR- MUT1 contained 7-base substitutions within the first The main findings of the present study were that different putative miR-TRb seed-matched sequence in 3111– propensities to high-fat diet-induced obesity might be 3117 bp, and pmirGLO-TRb-3′UTR-MUT2 contained related to hepatic TH action, which might be regulated

However, the involved possible mechanism is largely unknown. Most genetic studies in the field of human obesity have been focused on genes and polymorphisms associated with an obese phenotype (Soulage et al. 2008). Considerably, less attention has been paid to the understanding of the reason why certain people remain thin, and do not develop obesity even in excess nutritional environment. It is still not clear whether the OR phenotype individuals can resist HFD-induced obesity forever. In our previous study, mice were fed 7 and 27 weeks to explore short- and long-term HFD consumption on the different susceptibilities to obesity, and the results showed that the ability of OR mice to resist obesity was impaired in the 27th week (Xia et al. 2015). We speculated that this impairment might happen earlier and in the present study, we ended the experiment in the 17th week. Normally, the increase in adiposity is the outcome of a positive energy balance as a result of less energy expenditure as compared with energy intake (Huang et al. 2004). In the present study, compared with the OP phenotype, OR mice showed higher energy expenditure both in the 7th week and 17th week, and also had significantly lower calorie intake, which might contribute to the obesity-resistant phenotype. Additionally, OR mice were more active than

Endocrinology Con mice during the nighttime of the 17th week possibly of because of the imbalance between calorie intake and energy expenditure. However, OP mice was less active than OR mice in the 7th week but more active than OR Journal Figure 8 mice in the 17th week. We speculated that the difference TRb is a target gene of miR-146b. (A) Two binding sites for miR-146b in on energy expenditure between the two phenotypes in the TRb 3 UTR were predicted using TargetScan 7.1. (B) Relative luciferase ′ the 7th week was relatively small, which became larger activity of HEK293T cells after co-transfection with pmirGLO-TRb-WT1 or pmirGLO-TRb-MUT1 and miR-146b mimic or the negative control (C) or in the 17th week, so OP mice tried to consume more after co-transfection with pmirGLO-TRb-WT2 or pmirGLO-TRb-MUT2 and calories by means of elevating ambulatory activities. It miR-146b mimic or the negative control. **P 0.01. < is well known that locomotion is typically regulated by by miR-383 and miR-146b via directly targeting Dio1 the dopamine system, particularly the nucleus accumbens and TRb, respectively. The results of this study provided (Ikemoto & Panksepp 1999). In the current study, it is hard insight into the roles of miRs in mediating the actions to elucidate the reason for these changes, and thorough of TH on liver function. Additionally, the ability of OR research studies should be conducted in the future. mice to resist obesity was impaired, possibly due to the THs play a central role in lipid and glucose metabolism impairment of hepatic DIO1 and TRb action caused by and possibly regulation of body weight through direct and upregulation of miR-383 and miR-146b, and subsequent indirect regulation of expression in target genes (Boelaert alteration of TH target gene expressions. & Franklyn 2005). The liver plays a critical role in energy Obesity is a major health concern worldwide which metabolism and lipid regulation and is a major target is related to elevated risk of chronic diseases, including organ of TH. Previous studies have demonstrated that metabolic syndrome, cardiovascular disease and cancer TH regulated the expressions of genes involved in these (Wright & Aronne 2012). Previous research studies found physiological processes (Pihlajamäki et al. 2009). Although that despite living in an obesogenic environment, some no consensus has been found as to the circulating TH individuals maintain a thin phenotype compared to the levels in obesity, it is clear that TH perform its function majority who are at risk for weight gain and obesity. through deiodination pathways (DIO1 in liver) that are

inside the target cells and could not be deduced in the that there might be much more important regulators view of plasma concentrations (Bianco 2011). Besides, that control TRb expression in FFA-treated cell model, TH primarily exerts their actions through interaction such as miR-146b. However, anti-miR-383 increased Dio1 with TR, which initiates or blocks target gene expression expression, while anti-miR-146b elevated TRb expression, by binding to TH response elements (TREs) in the gene as well as TH-responsive genes expressions in FFA-treated promoter regions. Therefore, hepatic DIO1 and TRb might hepatocytes. Luciferase reporter assay also confirmed that be involved in different propensities to obesity, and the miR-146b could directly target on TRb. All these findings factors that affecting these steps need to be clarified. suggested that miR-383 and miR-146b played important MicroRNAs are emerging as critical, although poorly roles in hepatic lipid metabolism through acting on characterized, gene-regulatory elements that have been Dio1 and TRb. implicated in disease processes including obesity. The It has been proved that OP rats had a greater tendency function of miRs is highly dependent on their target genes to store dietary fat, whereas the OR rats exhibited via suppressing translation and enhancing degradation greater dietary fat oxidation (Jackman et al. 2010b). of target gene transcripts by binding to comprehensive In the 7th week, hepatic TH target genes that involved regions within the target transcripts (Hobert 2004). in lipogenesis (Srebp1c, Acc1, Scd1 and Fasn), lipid However, very little is known about the role of miRs in mobilization and fatty acid oxidation (Cpt1α, Lpl and mediating the action of TH. Although previous research Fabp), and cholesterol metabolism (Ldlr) were upregulated has explored the role of miRs in governing TH response in OP mice. Atp5c1 and Cox7c, two genes from the energy (Dong et al. 2010), so far no research has focused on miRs metabolism subset of the TH responsive gene set correlated when exploring the different propensities to obesity. We with liver lipid content, were downregulated in OP mice. speculated that miRs might also play important roles in OR mice showed significantly upregulated Scd1, Cpt1α, TH action through regulating expressions of some genes, Lpl, Fabp, Cyp7a1 expression, indicating the possibility such as Dio1 and TRb and thereafter to influence hepatic that OR mice had higher degree of fatty acid oxidation DIO1 and TRb levels and ultimately decide the different than lipogenesis and a better control of cholesterol

Endocrinology propensities to obesity. Results from next-generation homeostasis. These results showed that the ability of OP of sequencing and bioinformatics algorithms indicated mice to be responsive to THs might be impaired after that expressions of miR-34a, miR-383, miR-100, miR- short-term HFD feeding, while OR mice might be still 1247, miR-146b, miR-541 and miR-592 were significantly sensitive to THs and could maintain energy homeostasis Journal different between OP and OR mice and might target on and thereof keep a thin phenotype. However, when the Dio1 or TRb. Among these miRs, miR-383, miR-34a and experiment lasted for a longer time, the two phenotypes miR-146b were inversely correlated with DIO1 or TRb. both failed to keep energy balance, indicating that both miR-383 has been confirmed to bind to DIO1 ′3 UTR in OR and OP mice could not be effective to respond to THs HeLa cell line (Boguslawska et al. 2011), indicating that and the ability of OR mice to resist obesity was impaired. miR-383 could directly regulating DIO1 expression. We believed that in addition to THs, there might be other Hepatic miR-34a levels were shown to be highly increased factors (such as insulin, leptin, etc.) that might interact in both dietary and ob/ob mice (Lee & Kemper 2010), and with THs to influence lipid metabolism, which needs miR-34a was the most highly elevated miR in dietary and intensive study. ob/ob mice (Trajkovski et al. 2011). Another research also In conclusion, different propensities to obesity indicated that the mRNA level of the TRb was regulated might be related to hepatic-altered deiodination and by some miRs, including miR-146 (Jazdzewski et al. TRb action, which possibly be directly regulated by 2011), but the experimental results from them provided miR-383 and miR-146b, respectively. In the early phase no direct evidence that whether miR-34a or miR-146b of HFD consumption, OP mice had elevated miR-383 directly target TRb. In the present study, overexpression expression, as well as decreased miR-146b expression, by miRs mimics successfully upregulated miRs expression, which might lead to decrease of Dio1 and increase of which led to downregulation of Dio1 or TRb mRNA and TRb expression, in attempt to normalize the TH target protein levels, while inhibitors had the opposite effects. genes expression, while OR mice resisted obesity possibly However, anti-miR-34a transfection to hepatocytes upon through suppressing these corresponding miRs expression FFA treatment failed to upregulate TRb mRNA and protein to enhance hepatic deiodination and TRb expression. levels, and TH responsive genes expressions, indicating When the mice were fed for a longer time, both OP and

OR mice had upregulation of miR-383 and miR-146b, and microRNAs in renal cancer. Molecular and Cellular Endocrinology possibly resulting in impaired deiodination and reduction 384 61–70. (doi:10.1016/j.mce.2014.01.006) Chartoumpekis DV, Zaravinos A, Ziros PG, Iskrenova RP, Psyrogiannis of TRb expression, and subsequent dysregulation of TH AI, Kyriazopoulou VE & Habeos IG 2012 Differential expression of responsive genes. Hence, therapeutic strategies for obesity microRNAs in adipose tissue after long-term high-fat diet-induced obesity should take into consideration the role of miR-383 and in mice. PLoS ONE 7 e34872. (doi:10.1371/journal.pone.0034872) Cornier M-A, Salzberg AK, Endly DC, Bessesen DH, Rojas DC & Tregellas miR-146b in hepatic deiodination and TRb action. JR 2009 The effects of overfeeding on the neuronal response to visual food cues in thin and reduced-obese individuals. PLoS ONE 4 e6310–e6310. (doi:10.1371/journal.pone.0006310) Dixon JB, Bhathal PS & O’Brien PE 2001 Nonalcoholic fatty liver Supplementary data disease: predictors of nonalcoholic steatohepatitis and liver fibrosis This is linked to the online version of the paper at http://dx.doi.org/10.1530/ in the severely obese. Gastroenterology 121 91–100. (doi:10.1053/ JOE-17-0044. gast.2001.25540) Dong H, Paquette M, Williams A, Zoeller RT, Wade M & Yauk C 2010 Thyroid hormone may regulate mRNA abundance in liver by acting on microRNAs. PLoS ONE 5 e12136. (doi:10.1371/journal. pone.0012136) Declaration of interest Enriori PJ, Evans AE, Sinnayah P, Jobst EE, Tonelli-Lemos L, Billes SK, The authors declare that there is no conflict of interest that could be Glavas MM, Grayson BE, Perello M, Nillni EA, et al. 2007 Diet-induced perceived as prejudicing the impartiality of the research reported. obesity causes severe but reversible leptin resistance in arcuate melanocortin neurons. Cell Metabolism 5 181–194. (doi:10.1016/j. cmet.2007.02.004) Folch J 1957 A simple method for the isolation and purification of total Funding lipids from animal tissues. Journal of Biological Chemistry 226 497–506. The study was supported by the Fundamental Research Funds for the Harrold JA, Williams G & Widdowson PS 2000 Early leptin response Central Universities (JUSRP115A33), Wuxi Science and Technology to a palatable diet predicts dietary obesity in rats: key role of Development Fund (CSE31N1625) and Natural Science Foundation of melanocortin-4 receptors in the ventromedial hypothalamic nucleus. Jiangsu Province, China (BK20140147). Journal of Neurochemistry 74 1224–1228. (doi:10.1046/j.1471- 4159.2000.741224.x) Haslam DW & James WPT 2005 Obesity. Lancet 366 1197–1209. (doi:10.1016/S0140-6736(05)67483-1) Hobert O 2004 Common logic of transcription factor and microRNA Endocrinology Author contribution statement action. Trends in Biochemical Sciences 29 462–468. (doi:10.1016/j. of S F X, X M D, X R C, L M C, Y J K, P W, Y H S and G W L conceived, designed tibs.2004.07.001) and performed the experiments. S F X, X M D and Y J K analyzed the data. Huang XF, Han M & Storlien LH 2003 The level of NPY receptor mRNA Y H S and X T contributed reagents/materials/analysis tools. S F X drafted expression in diet-induced obese and resistant mice. Molecular Brain Journal the article. All authors read and approved the final manuscript. Research 115 21–28. (doi:10.1016/S0169-328X(03)00174-8) Huang XF, Xin X, McLennan P & Storlien L 2004 Role of fat amount and type in ameliorating diet-induced obesity: insights at the level of hypothalamic arcuate nucleus leptin receptor, neuropeptide Y References and pro-opiomelanocortin mRNA expression. Diabetes, Obesity and Agarwal AK & Garg A 2006 Genetic disorders of adipose tissue Metabolism 6 35–44. (doi:10.1111/j.1463-1326.2004.00312.x) development, differentiation, and death. Annual Review of Ikemoto S & Panksepp J 1999 The role of nucleus accumbens dopamine Genomics and Human Genetics 7 175–199. (doi:10.1146/annurev. in motivated behavior: a unifying interpretation with special genom.7.080505.115715) reference to reward-seeking. Brain Research Reviews 31 6–41. Araujo R, Andrade B, Padrón A, Gaidhu M, Perry R, Carvalho D & (doi:10.1016/S0165-0173(99)00023-5) Ceddia R 2010 High-fat diet increases thyrotropin and oxygen Jackman MR, MacLean PS & Bessesen DH 2010a Energy expenditure consumption without altering circulating 3,5,3′-triiodothyronine (T3) in obesity-prone and obesity-resistant rats before and after the and thyroxine in rats: the role of iodothyronine deiodinases, reverse introduction of a high-fat diet. American Journal of Physiology: T3 production, and whole-body fat oxidation. Endocrinology 151 Regulatory, Integrative and Comparative Physiology 299 1097–1105. 3460–3469. (doi:10.1210/en.2010-0026) (doi:10.1152/ajpregu.00549.2009) Bartel DP 2004 MicroRNAs: genomics, biogenesis, mechanism, and Jackman MR, MacLean PS & Bessesen DH 2010b Energy expenditure function. Cell 116 281–297. (doi:10.1016/S0092-8674(04)00045-5) in obesity-prone and obesity-resistant rats before and after the Bianco AC 2011 Minireview: cracking the metabolic code for thyroid introduction of a high-fat diet. American Journal of Physiology: hormone signaling. Endocrinology 152 3306–3311. (doi:10.1210/ Regulatory, Integrative and Comparative Physiology 299 1097–1105. en.2011-1104) (doi:10.1152/ajpregu.00549.2009) Boelaert K & Franklyn JA 2005 Thyroid hormone in health and disease. Jazdzewski K, Boguslawska J, Jendrzejewski J, Liyanarachchi S, Pachucki Journal of Endocrinology 187 1–15. (doi:10.1677/joe.1.06131) J, Wardyn KA, Nauman A & de la Chapelle A 2011 Thyroid Boguslawska J, Wojcicka A, Piekielko-Witkowska A, Master A & Nauman Hormone Receptor beta (THRB) is a major target gene for microRNAs A 2011 MiR-224 targets the 3′UTR of type 1 5′-iodothyronine deregulated in Papillary Thyroid Carcinoma (PTC). Journal of Clinical deiodinase possibly contributing to tissue hypothyroidism in renal Endocrinology and Metabolism 96 546–553. (doi:10.1210/jc.2010-1594) cancer. PLoS ONE 6 e24541. (doi:10.1371/journal.pone.0024541) John B, Enright AJ, Aravin A, Tuschl T, Sander C & Marks DS 2004 Boguslawska J, Piekielko-Witkowska A, Wojcicka A, Kedzierska H, Human microRNA targets. PLoS Biology 2 e363. (doi:10.1371/journal. Poplawski P & Nauman A 2014 Regulatory feedback loop between T3 pbio.0020363)

Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin Endocrinology and Metabolism 94 3521–3529. (doi:10.1210/jc.2009- P, da Piedade I, Gunsalus KC, Stoffel M, et al. 2005 Combinatorial 0212) microRNA target predictions. Nature Genetics 37 495–500. Puhl RM & Heuer CA 2009 The stigma of obesity: a review and update. (doi:10.1038/ng1536) Obesity 17 941–964. (doi:10.1038/oby.2008.636) Lee J & Kemper JK 2010 Controlling SIRT1 expression by microRNAs Schwartz MW, Woods SC, Seeley RJ, Barsh GS, Baskin DG & Leibel RL in health and metabolic disease. Aging 2 527–534. (doi:10.18632/ 2003 Is the energy homeostasis system inherently biased toward aging.100184) weight gain? Diabetes 52 232–238. (doi:10.2337/diabetes.52.2.232) Lewis BP, Shih Ih, Jones-Rhoades MW, Bartel DP & Burge CB 2003 Sharma AD, Narain N, Händel EM, Iken M, Singhal N, Cathomen T, Prediction of mammalian microRNA targets. Cell 115 787–798. Manns MP, Schöler HR, Ott M & Cantz T 2011 MicroRNA‐221 (doi:10.1016/S0092-8674(03)01018-3) regulates FAS-induced fulminant liver failure. Hepatology 53 Ng R, Wu H, Xiao H, Chen X, Willenbring H, Steer C & Song G 2014 1651–1661. (doi:10.1002/hep.24243) Inhibition of microRNA‐24 expression in liver prevents hepatic Sinha RA, Singh BK & Yen PM 2014 Thyroid hormone regulation of lipid accumulation and hyperlipidemia. Hepatology 60 554–564. hepatic lipid and carbohydrate metabolism. Trends in Endocrinology (doi:10.1002/hep.27153) and Metabolism 25 538–545. (doi:10.1016/j.tem.2014.07.001) Nishi H, Ono K, Horie T, Nagao K, Kinoshita M, Kuwabara Y, Watanabe Soulage C, Zarrouki B, Soares AF, Lagarde M & Geloen A 2008 Lou/C S, Takaya T, Tamaki Y, Takanabe-Mori R, et al. 2011 MicroRNA-27a obesity-resistant rat exhibits hyperactivity, hypermetabolism, regulates beta cardiac myosin heavy chain gene expression by targeting alterations in white adipose tissue cellularity, and lipid tissue profiles. thyroid hormone receptor beta1 in neonatal rat ventricular myocytes. Endocrinology 149 615–625. (doi:10.1210/en.2007-0317) Molecular and Cellular Biology 31 744–755. (doi:10.1128/MCB.00581-10) Trajkovski M, Hausser J, Soutschek J, Bhat B, Akin A, Zavolan M, Heim Oppenheimer JH, Schwartz HL, Mariash CN, Kinlaw WB, Wong NCW & MH & Stoffel M 2011 MicroRNAs 103 and 107 regulate insulin Freake HC 1987 Advances in our understanding of thyroid hormone sensitivity. Nature 474 649–653. (doi:10.1038/nature10112) action at the cellular level. Endocrine Reviews 8 288–308. (doi:10.1210/ Weiss RE, Murata Y, Cua K, Hayashi Y, Seo H & Refetoff S 1998 Thyroid edrv-8-3-288) hormone action on liver, heart, and energy expenditure in thyroid Pihlajamäki J, Boes T, Kim E-Y, Dearie F, Kim BW, Schroeder J, Mun E, hormone receptor β-deficient mice.Endocrinology 139 4945–4952. Nasser I, Park PJ, Bianco AC, et al. 2009 Thyroid hormone-related (doi:10.1210/endo.139.12.6412) regulation of gene expression in human fatty liver. Journal of Clinical Wright SM & Aronne LJ 2012 Causes of obesity. Abdominal Imaging 37 Endocrinology and Metabolism 94 3521–3529. (doi:10.1210/jc.2009- 730–732. (doi:10.1007/s00261-012-9862-x) 0212) Xia SF, Duan XM, Hao LY, Li LT, Cheng XR, Xie ZX, Qiao Y, Li LR, Tang X, Pihlajamaki J, Boes T, Kim EY, Dearie F, Kim BW, Schroeder J, Mun E, Shi YH, et al. 2015 Role of thyroid hormone homeostasis in obesity- Nasser I, Park PJ, Bianco AC, et al. 2009 Thyroid hormone-related prone and obesity-resistant mice fed a high-fat diet. Metabolism 64 regulation of gene expression in human fatty liver. Journal of Clinical 566–579. (doi:10.1016/j.metabol.2014.12.010) Endocrinology Received in final form 17 May 2017 of Accepted 31 May 2017 Accepted Preprint published online 1 June 2017 Journal