Investigating the Roles of CD44 and CD147 in Prostate Cancer Metastasis and Drug-Resistance

Investigating the roles of CD44 and CD147 in prostate cancer metastasis and drug-resistance

Jingli Hao

A Thesis submitted for the Degree of Doctor of Philosophy St. George Clinical School Faculty of Medicine University of New South Wales

April 2012

ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ……………………………………………......

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ……………………………………………......

Date ……………………………………………......

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ……………………………………………......

Date ……………………………………………...... Abstract

Prostate cancer (CaP) is a major health problem in males in western countries. Although early-stage CaP can be controlled using conventional therapies, almost all CaP patients invariably progress to recurrent castration resistant CaP and eventually die from secondary disease. Targeting tumour-associated antigens is fast emerging as an area of promise for late stage CaP. This thesis provides an overview of literature regarding CaP-related issues, with emphasis on the putative roles of the tumour microenvironment and selected tumour-associated antigens, i.e. CD44 and CD147 in CaP. The aims of the study were to: 1) investigate the expression of CD44 and CD147 in primary CaP tissues and various metastatic CaP cell lines, and identify whether CD44 and CD147 are related with CaP progression, whether they are related with multidrug-resistance proteins, and whether these two proteins are inter-related; 2) develop CaP cell lines with downregulated CD44 and CD147 expression, study the in vitro functions of these molecules in CaP, and the potential mechanisms involved; and 3) develop CaP animal models with CD44/CD147-knock-down (KD) xenografts, and look at the roles of CD44 and CD147 in vivo in respect of tumour growth, metastasis, and drug resistance. The results indicated that CD44 and CD147 are both associated with CaP progression. CD44 and CD147 are co-expressed and interact in CaP cells. KD of CD44 or CD147 enhanced docetaxel sensitivity, reduced CaP invasive potential, and down-regulated main signal modulators associated with cell growth and survival. In vivo, CD44 or CD147-KD PC-3M-luc subcutaneous xenografts showed suppressed tumour growth with increased docetaxel responsiveness compared to control xenografts. Preliminary studies of an intracardiac model showed metastatic spread of PC-3M-luc cells imaged using bioluminescence, indicating this is an appropriate model for future studies assessing the in vivo roles of CD44 and CD147 in tumour spread. These findings suggest that CD44 and CD147 are both closely related with CaP metastasis and drug resistance. Selective targeting of CD44/CD147 alone or combined with docetaxel may limit CaP metastasis and increase chemosensitivity, indicating promise for future CaP treatment. To date, these studies appear to be the first to show that CD44 and CD147 are collaborators in CaP.

Acknowledgements

I‟m greatly indebted to my supervisor Associate Professor Yong Li, whose support, encouragement and help has been invaluable for the thesis and for my development as a researcher at large. In particular, he supported me during all my research work, encouraged me to apply for several awards and travel grants, encouraged me to go to international and domestic conferences and taught me a lot about how to improve my observations, basic experimental skills, manuscript writing, conference presentation and response to all comments. He reviewed my papers and thesis with a lot of patience and actively sought collaborations which supported my skill development. Without him I could not have written this thesis. My co-supervisor Dr. Michele Madigan has always kindly given me the most sincere advice on not only studying but life in general. She always took time out of her busy schedule to discuss with me about scientific problems and the progress of my project. She always carefully reviewed my papers or thesis, or giving hands on demonstrations to develop my experimental skills. Michele, I‟m lucky to have you as my co-supervisor! I am also grateful to my co-supervisor Dr. Aparajita Khatri. I worked under her supervision during the 2nd year of my PhD in the Oncology Research Center (ORC) in the Prince of Wales Hospital. She imparted a tremendous amount of knowledge about molecular biology on me. Thanks Aparajita for providing a very good research environment for me. I also learned a lot from her Post-doctoral Fellows and Research Assistants. I would like to thank them as well: Dr. Nirupama Verma, Ms. Swapna Joshi, Ms. Xiaochun Wang, and Mr. Zhe Yuan. I made good progress when I was working there. Without them I could not have done so. The animal experiments and the preparation for them greatly benefitted from the help I received from Dr. Carl Power and Dr. Tzong-Tyng Hung. They gave me lots of helpful advice, from ethics applications, experiment designing, experiment techniques, to data analysis. I also learned a lot from them about animal experiments and research ethics. Without them, the animal experiments would not have been completed. I also want to say thank you to Professor Pamela Russell, who kindly introduced me to her research group in the ORC and for sharing her precious research resources with us. To all staff in the Oncology Research Center, the help with all little things is greatly appreciated.

I also would like to thank Dr Paul Cozzi at the Urology Sydney and Professor Warick Delprado at the Douglass Hanly Moir Pathology, for kindly providing prostate cancer and benign prostatic hyperplasia (BPH) tissues and clinical data for my study. Otherwise, I could not complete my studies on the primary CaP. In addition, I thank all funding bodies including NHMRC, Cancer Institute NSW, St George and Southerland Medical Research Foundation, Urology Research Fund and Cancer Care Centre Cancer Research Trust Fund for their generous supports. I appreciate all supports from the administrative staff at the St George Clinical School, UNSW and the Cancer Care Centre at St George Hospital (Associate Professor Peter Graham and Professor John Kerasley). Further, I want to thank Ms. Julia Beretov, who helped me with all histology preparation related studies. I want to thank my colleagues and friends in the prostate cancer group in St. George Hospital: Dr. Hongmin Chen, Dr. Hongtu Chao, Dr. Weiwei Xiao, and Dr. Jingjing You, we share happiness and sadness together and help each other to go through difficulties in studying and living. Last but not least, I want to thank my beloved family, my husband Josef who always stands by my side and gives me powerful support. He is not only my partner but also my best friend. I want to thank my parents, Lanyun Hao and Shuangzhen Zhao, for their unlimited love and support through out my life.

Publications, Presentations and Awards

Publications arising from this thesis

Hao JL, Cozzi PJ, Khatri A, Power CA, Li Y. EMMPRIN/CD147 and CD44 are potential therapeutic targets for metastatic prostate cancer. Curr Cancer Drug Targ 2010;20:287-306 (IF: 4.8) Hao JL, Chen HM, Madigan MC, Cozzi PJ, Beretov J, Xiao W, Delprado WJ, Russell PJ, Li Y. Co-expression of CD147 (EMMPRIN), CD44v3-10, MDR1 and monocarboxylate transporters (MCTs) is related with prostate cancer drug resistance and progression. Br J Cancer 2010;103:1008-1018 (IF: 4.8) Hao JL, Madigan MC, Khatri A, Power CA, Hung TT, Beretov J, Xiao W, Cozzi PJ, Graham PH, Kearsley JH, Li Y. CD44 and CD147 modulate prostate cancer cells in vitro and in vivo metastasis and chemoresistance. Submitted to PLoS ONS in a revised version 2012 (IF: 4.4)

Book Chapter:

Hao JL, Madigan MC Cozzi PJ, Kearsley J, Li Y. Angiogenesis, lymphangiogenesis and vasculogenic mimicry in human prostate cancer therapy. In: Advances in Medicine and Biology. Editor: Leon V. Berhardt. Volume 38. Nova Science Publishers, Inc. USA. Accepted on 31/03/2011 in press.

Other publications:

Chen H, Wang L, Beretov J, Hao JL, Xiao W, Li Y. Co-expression of CD147/EMMPRIN with monocarboxylate transporters and multiple drug resistance proteins is associated with epithelial ovarian cancer progression. Clin Exp Metastas 2010; 27: 557-569 (IF: 4.1) Wang L, Chen HM, Liu FH, Madigan MC, Hao JL, Power CA, Patterson KI, Pourgholami MH, O‟Brien P, Perkins AC, Li Y. Monoclonal antibody targeting MUC1 and increasing sensitivity to docetaxel as a novel strategy in treating human epithelial ovarian cancer. Cancer Lett 2011;300:122-133 (IF: 4.9) Wang L, Chen HM, Pourgholami MH, Beretov J, Hao JL, Chao HT, Perkins AC, Kearsley JH, Li Y. Anti-MUC1 monoclonal antibody (C595) and docetaxel markedly

7 reduce tumour burden and ascites, and prolong survival in an in vivo ovarian cancer model. Plos ONE 2011;6:e24405 (IF: 4.4) Xiao W, Graham P, Power C, Hao JL, Kearsley J, Li Y. CD44 is biomarker correlated with human prostate cancer radiation sensitivity. Clin Exp Metastas 2012; 29:1-9 (IF: 4.1) Chao H, Wang L, Hao J, Ni J, Graham P, Kearsley J, Li Y. Combination of the histone deacetylase inhibitor LBH589 with docetaxel is highly effective in treating human epithelial ovarian cancer. Submitted to Cancer Lett 2012 (IF: 4.9)

Conference presentations:

1. Hao JL, Madigan MC, Kingsley EA, Cozzi PJ, Delprado WJ, Russell PJ, Li Y (2008). The Role of EMMPRIN and CD44 in Prostate Cancer Metastasis. St George Symposium. Dec 2008, Sydney, Australia. (Poster presentation) 2. Wang L, Chen H, Hao JL, Li Y (2009). Co-expression of invasive markers (uPA, CD44) and multiple drug resistance proteins (MDR1, MRP2) is correlated with epithelial ovarian cancer progression. 5th International Conference on Tumour Microenvironment: Progression, Therapy and Prevention. Oct 20-24, 2009, Versailles, France. (Oral presentation) 3. Hao JL, Madigan MC, Chen HM, Cozzi PJ, Delprado WJ, Li Y (2009). Is there a relationship between the expression of CD147 (EMMPRIN), CD44, multidrug resistance (MDR) and monocarboxylate (MCT) transporters, and prostate cancer (CaP) progression? 5th International Conference on Tumour Microenvironment: Progression, Therapy and Prevention. Oct 20-24, 2009, Versailles, France. (Poster presentation- Travel Grant Award from the Faculty of Medicine, UNSW, Australia) 4. Wang L, Chen H, Liu F, Madigan MC, Hao JL, Power C, Patterson KI, Beretov J, Pourgholami MH, O‟Brien PM, Perkins AC, Kearsley J, Li Y (2009). Preclinical studies using monoclonal ant-MUC1 and docetaxel: A novel strategy for targeting advanced epithelial ovarian cancer. 20th Asia Pacific Cancer Conference. 12-14 Nov, 2009, Tsukuba, Japan. (Oral presentation) 5. Hao JL, Madigan MC, Chen H, Cozzi PJ, Beretov J, Khatri A, Delprado WJ, Russell PJ, Kearsley J, Li Y(2009). The co-operative roles of CD147 and CD44 in prostate cancer chemoresistance and metastasis. 20th Asia Pacific Cancer Conference. 12-14 Nov,

2009. Tsukuba, Japan. (Oral presentation-The Young Investigator Award from APCC Conference, Japan) 6. Hao JL, Madigan MC, Cozzi PJ, Khatri A, Power CA, Beretov J, Kearsley J, Li Y (2010). CD44 and CD147 expression influence prostate cancer chemoresistance and metastasis. The Australian Society for Medical Research. 7 June, 2010. Sydney Australia. (Poster presentation) 7. Xiao W, Graham P, Madigan MC, Hao JL, Khatri A, Li Y (2010). HDAC inhibitor sodium butyrate can inhibit prostate cancer cell growth via regulation of CD44 and HER2 expression. The Australian Society for Medical Research. 7 June 2010. Sydney, Australia. (Poster presentation) 8. Hao JL, Madigan MC, Cozzi PJ, Khatri A, Power CA, Beretov J, Kearsley J, Li Y (2010). The St George and Sutherland Hospital Medical Research Symposium. 30 September, 2010. Sydney, Australia. (Oral presentation) 9. Xiao W, Graham P, Hao JL, Li Y (2010). Down-regulation of stem cell marker- CD44 sensitizes prostate cancer cells to radiation. The St George and Sutherland Hospital Medical Research Symposium. 30 September, 2010. Sydney, Australia. (Poster presentation) 10. Li Y, Hao JL, Cozzi PJ, Kearsley JH (2010). CD44 and CD147 in prostate cancer metastasis and chemoresistance. Sixth International Symposium on Hormonal Oncogenesis. 12-16 September, 2010. Tokyo, Japan. (Poster presentation) 11. Xiao W, Graham P, Power C, Hao JL, Li Y (2010). Enhanced radiation sensitivity in prostate cancer by down-regulation of stem cell marker-CD44. The Inaugural Biomarker Discovery Conference. 6-10 December, 2010. Port Stephens, Australia. (Oral presentation) 12. Hao JL, Madigan MC, Cozzi PJ, Khatri A, Power CA, Kearsley J, Li Y (2010). CD44 and CD147 expression influences prostate cancer chemoresistance and metastasis. Annual meeting of the Australian Association of Chinese Biomedical Scientists, 24 October 2010. Sydney, Australia. (Oral presentation-The Best Presentation Award from the organizing committee, Sydney, Australia) 13. Xiao W, Graham P, Power C, Hao JL, Li Y (2010). Down-regulation of stem cell marker-CD44 sensitizes prostate cancer cells to radiation. Annual meeting of the Australian Association of Chinese Biomedical Scientists, 24 October 2010. Sydney, Australia. (Oral presentation)

14. Hao JL, Madigan MC, Khatri A, Power CA, Hung TT, Beretov J, Xiao W, Cozzi PJ, Kearsley J, Li Y (2011). CD44 and CD147 confer metastasis and chemoresistance potential on prostate cancer in vitro and in vivo. Montreal International Symposium on Angiogenesis and Metastasis, 15-17 June 2011. Montreal, Canada. (Poster presentation) 15. Hao JL, Madigan MC, Khatri A, Power CA, Hung TT, Beretov J, Xiao W, Cozzi PJ, Kearsley J, Li Y (2011). CD44 and CD147 confer metastasis and chemoresistance potential on prostate cancer in vitro and in vivo. The St George and Sutherland Hospital Medical Research Symposium. Oct 2011, 2011. Sydney, Australia. (Oral presentation) 16. Hao JL, Madigan MC, Khatri A, Power CA, Hung TT, Beretov J, Xiao W, Cozzi PJ, Kearsley J, Li Y (2011). CD44 and CD147 confer metastasis and chemoresistance potential on prostate cancer in vitro and in vivo. 12th Australasian Prostate Cancer Conference. 1-4 August 2011. Melbourne, Australia. (Poster presentation-Travel Grant Award from the Conefence, Melbourne, Australia)

Table of Contents

Abstract…………………..…………………..………………...…..…..…………. 4 Acknowledgements…………………..…………………..…………………..…… 5 Publications, Presentations and Awards…………………..…………………..…... 7 Table of Contents…………………..…………………..……………………..…... 11 List of Figures…………………..…………………..…………………………..… 16 List of Tables…………………..…………………..……………..…………..…… 18 List of Abbreviations…………………..…………………..………………..…...... 19 Chapter 1-Literature Review and Aims…………………..…………………….…. 24 1.1 The prostate…………………..…………..…………………..…… 25 1.2 Cancer of the prostate…………………..…………..………..……. 27 1.2.1 Epidemiology, screening and diagnosis…………………..…..…... 28 1.2.2 Gleason score and staging…………………..………………..…… 29 1.2.3 Treatment strategies…………………..…………..…………..…... 31 1.3 Role of tumour microenvironment in CaP……………………...... 33 1.3.1 Angiogenesis…………..…………………..………………..…...... 33 1.3.1.1 VEGF and VEGFR…………………..……………..……... 34 1.3.1.1.1 VEGF in CaP therapy…………………..…………...…….. 35 1.3.1.1.2 VEGFR in CaP therapy…………………..…………..…… 39 1.3.1.2 Integrin αvβ3 in human CaP…………………..…….…….. 41 1.3.1.3 Angiostatin and endostatin in human CaP angiogenesis...... 43 1.3.1.4 Notch signalling pathway and angiogenesis paradox in CaP…………….………………..…………..…………….……………... 45 1.3.2 Lymphangiogenesis and lymph node metastasis……………..…… 50 1.3.3 Vasculogenic mimicry……………….………………..…………... 55 1.3.4 Hyaluronan (HA) ………………….……………..……………….. 59 1.4 Tumour associated antigens…………………..……………...…… 62 1.4.1 CD44……………..………………..…………………………..….. 62 1.4.1.1 The structure of CD44………………….………………..... 62 1.4.1.2 The function of CD44 in cancer……………….………….. 64 1.4.1.2.1 CD44 and cancer metastasis……………..…………..……. 64 1.4.1.2.2 CD44 and cancer drug resistance…………………….…… 65

1.4.1.3 The expression of CD44 in human CaP…………..………. 67 1.4.1.4 CD44 and CaP cancer stem cells (CSCs) ………….……... 72 1.4.1.5 CD44 in future CaP therapy……………..………….…….. 74 1.4.2 CD147……………..…………………..………………………….. 77 1.4.2.1 The structure of CD147…………..………….……………. 77 1.4.2.2 The function of CD147 in cancer…………..…………...… 78

1.4.2.2.1 CD147 and tumour angiogenesis…………..……..………. 79 1.4.2.2.2 CD147 and tumour invasion and metastasis……..……...... 80 1.4.2.2.3 CD147 and drug resistance……..……..……..……..……... 82 1.4.2.2.4 CD147 and MCTs……..……..……..……………..……… 83 1.4.2.2.5 CD147 in cancer diagnosis……..……..……..….…..…….. 85 1.4.2.3 CD147 in human CaP……..……..……..……..……..……. 85 1.4.2.4 CD147 in future CaP therapy……..……..……..…………. 87 1.5 Modeling CaP……..……..……..……..……...……..……..……..……… 90 1.5.1 Non-mouse in vivo CaP models……..……..……..……..………… 90 1.5.2 Xenograft mouse models in CaP……..……..……..……....………. 90 1.5.3 Non-invasive imaging in CaP models……..……..……..……..…... 92 1.6 Thesis aims……..……..……..……..……..……..……..……...……..….. 92 Chapter 2 – General materials and methods……..……..……..……..….………… 94 2.1 Ethical approval……..……..……..……....……..……..……..……..….... 95 2.2 Materials……..……..……..……..……..……..……..……..……………. 95 2.3 Methods……..……..……..……..……..……..……..……..…………….. 100 Chapter 3 – Expression of CD44 and CD147 in CaP and their clinical significance………………………………………………………………………... 111 3.1 Introduction………………………………………………………………. 112 3.2 Materials and methods………………………………………………….... 113 3.2.1 Antibodies…………………………………………………………. 113 3.2.2 Cell lines and cell culture………………………………………...... 114 3.2.3 Immunofluorescence confocal microscopy analysis of CaP cell lines……………………………………………………………………… 114 3.2.4 Western blot analysis…………………………..………………...... 115 3.2.5 MTT assay…………………………..………………………...….... 115 3.2.6 Patients and clinical data……………..…………………..…..……. 116

3.2.7 TMAs for detecting cancer markers…………………..……...……. 117 3.2.8 Immunohistochemistry for TMAs staining………………….....….. 117 3.2.9 Immunofluorescence staining of CaP tissues……………………… 117 3.2.10 Assessment of immunostaining results……………………...…… 118 3.2.11 Statistical analysis…………………..……………..………...…… 118 3.3 Results…………………..……………..…………………..……...……... 119 3.3.1 Expression and co-localization of CD147, CD44v3-10, MDR1, MCT1 and MCT4 in metastatic and drug resistance CaP cell lines…...... 119 3.3.2 Expression of CD147 and CD44v3-10 is related with DTX response in metastatic CaP cell lines…..………………..………...……... 125 3.3.3 Expression of CD44v3-10, MDR1, MCT1 and MCT4 in CaP tissues..……………..…………………..……...……...…….……...……. 126 3.3.4 Correlation between CD44v3-10, MDR1, and MCT4 expression and clinicopathological parameters…………………..………………...... 128 3.3.5 Co-immunolabelling of primary CaP tissues with CD147, CD44, MDR1, MCT1 and MCT4 antibodies…………………..………….…..... 129 3.4 Discussion…………………..……………..…………………..…….….... 133 Chapter 4 – CD44 and CD147 modulate chemoresistance and metastatic potential in CaP cell lines in vitro…………………..……………………..…….... 138 4.1 Introduction…………………..……………..…………………..……...... 139 4.2 Materials and methods……..……..……..……..……..……..……..…...... 140 4.2.1 Antibodies……..……..……..……....……..……..……..……..…... 140 4.2.2 Cell lines and cell culture……..……..……..……..……..………… 140 4.2.3 shRNA transfection for CD44/CD147……..……..……..………… 141 4.2.4 Immunofluorescence confocal microscopy analysis of PC-3M-luc and PC-3M-luc-KD cell lines……..……..……..……..…..……..………. 141 4.2.5 Western blotting analysis……..……..……..……...……..………... 141 4.2.6 MTT assay for DTX response……..……..……..……..…………... 142 4.2.7 Colony forming assay……..……..……..……..……..…………...... 142 4.2.8 Matrigel invasion assay……..……..……..……..……..…………... 143 4.2.9 Assessment of immunostaining……..……...……..……..………… 143 4.2.10 Statistical analysis……..……..……..……..……..……..………... 144 4.3 Results……..……..……..……..….……..……..……..……..……..…...... 144

4.3.1 Expression of CD44, CD147, MCT4 and MRP2 in CD44 or CD147-KD and control cell lines..……..……..…....……..……..………. 144 4.3.2 Knock down of CD44 or CD147 sensitizes monolayer CaP cells to DTX treatment in vitro……..……..……..……..…...…..……..………… 146 4.3.3 Knock down of CD44 or CD147 reduces clonogenic ability and sensitizes CaP colonies to DTX treatment……..…….....……..………… 147 4.3.4 Knock down of CD44 or CD147 reduces CaP cell invasion….…... 147 4.3.5 PI3K/Akt and MAPK/Erk signalling pathways are related to the expression of CD44 and CD147 in CaP cells……..……..……..……...... 149 4.4 Discussion……..……..……..……..……..……..……..……..…………... 150 Chapter 5 – CD44 and CD147 modulate chemoresistance and metastatic potential in CaP cell lines in vivo……..……..…………..…..……..……..………. 154 5.1 Introduction……..……..……....……..……..……..……..……..………… 155 5.2 Materials and methods……..……..……..……..……..……..……..…….. 155 5.2.1 Determinination for the dose of DTX for chemotherapy in vivo….. 155 5.2.2 s.c. CaP xenograft animal model……..……..……..……..………... 156 5.2.3 DTX response in a s.c. CaP animal model……..……..…………… 156 5.2.4 Mouse tissues and histology……..……..……....……..……..…….. 157 5.2.5 Immunohistochemistry……..……..……..……..……..……..…...... 157 5.2.6 TUNEL assay for apoptotic cells in vivo……..……..……..……… 158 5.2.7 Assessment of immunostaining……..……..……..……..…………. 158 5.2.8 Development of an i.c CaP model……..……..……..……..………. 158 5.2.9 In vitro and in vivo monitoring of bioluminescence using BLI…… 158 5.2.10 Statistical analysis……..…….….…..……..……..……..………... 159 5.3 Results……..……..……..……..……..……..……..……..……..………... 159 5.3.1 In vivo toxicity study……..……..……..……..……..……..………. 159 5.3.2 Knock down of CD44 or CD147 affects tumourigenicity, lymph node metastases and DTX sensitivity in a s.c. CaP xenograft model…… 160 5.3.3 CaP tumour xenografts histology following CD44 or CD147-KD with or without DTX treatment……..………..……..……..……..…….... 165 5.3.4 Assessment of tumour microvascular density in CD44 or CD147- KD tumour xenografts with/without DTX treatment……..………..…..... 168

5.3.5 CD44 and CD147 expression in CaP xenografts after knocking down of CD44 or CD147……..……..……..……..……..……..……...… 168 5.3.6 Cell proliferation, death and apoptosis in CaP xenografts after CD44 or CD147-KD with or without DTX treatment……..……………. 169 5.3.7 BLI monitoring of bioluminescence in PC-3M-luc, PC-3M-luc- scr, PC-3M-luc-CD147-KD, and PC-3M-luc-CD44-KD cell lines in vitro..…..……..……..……..……..…… ..…..……..……..……..………. 174 5.3.8 BLI monitoring of in vivo PC-3M-luc metastases…….…...... 174 5.4 Discussion……..……..……..…..……..……..……..……..……………... 177 Chapter 6 – Summary and perspectives……..……..……..……..……..…………. 180 References……..……..……..……..……..….……..……..……..……..…………. 186 Appendix 1 – The sequence of MISSION® pLKO.1-puro Non-Mammalian shRNA Control Plasmid DNA (targets no known mammalian genes) …………... 248

List of Figures

Figure 1-1 Male reproductive tract. 26 Figure 1-2 Cross-section of the prostate gland. 26 Figure 1-3 Zonal anatomy of the prostate. 27 Figure 1-4 Gleason grading system and representative histology images. 30 Figure 1-5 The Notch signalling pathway. 47 Figure 1-6 Schematic diagram of the lymphatic circulation and vascular system. 51 Figure 1-7 Diagram showing the hypothetical increased peritumour LVD and 54 dilated peritumour lymphatic vessels. Figure 1-8 VM and transformation of plastic tumour cells. 56 Figure 1-9 The components of the CD44 protein domains and exons. 63 Figure 1-10 Diagram illustrating putative expression of various markers, 71 including CD44, during prostate basal cell differentiation and the development of CaP from tumour initiating cells. Figure 1-11 The structure of the domains of CD147 and the link with cancer. 78 Figure 3-1 Co-immunolabelling of CD147, CD44v3-10, MDR1, MCT1 and 120 MCT4 in metastatic CaP cell lines. Figure 3-2 Co-immunolabelling of CD44v3-10, MDR1, MCT1 and MCT4 in 122 metastatic CaP cell line. Figure 3-3 Expression of CD147, CD44v3-10, MDR1, MCT1 and MCT4 in 124 CaP cell lines by western blotting. Figure 3-4 Dose response of metastatic CaP cell lines to DTX, measured using 125 MTT assay. Figure 3-5 Expression of CD44v3-10, MDR1 and MCT4 in CaP TMAs. 127 Figure 3-6 Co-immunolabelling of CD147, CD44v3-10, MDR1, MCT1 and 131 MCT4 in primary CaP tissues. Figure 4-1 The effects of reduced CD44 and CD147 on MRP2 and MCT4 in 145 CaP cell lines. Figure 4-2 Cell viability (MTT) assay after DTX treatment for PC-3M-luc, -scr 146 and CD44/CD147-KD cell lines. Figure 4-3 Colonogenic assays after DTX treatment in PC-3M-luc, -scr and 148 CD44/CD147-KD cell lines.

Figure 4-4 Matrigel invasion assay for PC-3M-luc, -scr and CD44 or CD147- 149 KD cell lines. Figure 4-5 Assessement of PI3K/Akt or MAPK/Erk related signalling proteins 150 with western blot after CD44 or CD147 knock down in PC-3M-luc cells. Figure 5-1 In vivo effects of CD44- and CD147-KD on tumourigenicity and 162 sensitivity to DTX in s.c xenograft models. Figure 5-2 Lymph node metastases in different CaP groups after treatments. 164 Figure 5-3 Histology and CD31, CD44 and CD147 immunolabelling 166 expression of s.c. xenografts. Figure 5-4 Ki-67, TUNEL, and Caspase-3 (active) expression at the end of 171 experiments after knocking down CD44 or CD147 and treatment with DTX. Figure 5-5 BLI monitoring of in vitro and in vivo bioluminescence and tumour 175 development post cell inoculation. Figure 5-6 Confirmation of CaP metastases by histopathology. 176

List of Tables

Table 1-1 Anatomic stage/prognostic groups 31 Table 1-2 Treatment options for different stages of CaP. 33 Table 1-3 Comparison of features of blood vessels and lymphatic vessels. 50 Table 1-4 Preclinical studies with HA as carriers targeting CD44 in cancers. 61 Table 1-5 Summary of CD44 expression in human CaP, CaP metastatic sites, 69 BPH and normal prostates. Table 1-6 CD44 and subpopulations of putative CaP stem cells (PCSCs) with 74 androgen receptor negative cells. Table 1-7 Clinical trials of antibody anti-CD44 conjugates. 76 Table 1-8 Summary of CD147 expression in CaP, BPH and normal prostate. 87 Table 2-1 Antibodies used for western blot (WB), immunofluorescence (IF) 96 staining, immunohistochemistry (IHC) and immunoprecipitation (IP). Table 2-2 Characteristics of metastatic CaP cell lines. 99 Table 2-3 Sequences of CD44 and CD147 shRNA lentiviral transduction 100 particles. Table 3-1 Immunostaining for CD147, CD44v3-10, MDR1, MCT1 and MCT4 124 in metastatic CaP cell lines, and response to DTX (IC50). Table 3-2 Percentage of the positive immunostaining for CD44v3-10, MDR1, 128 MCT1 and MCT4 in normal prostate, BPH and different grades of CaP. Table 3-3 Clinicopathological characteristics associated with CD44v3-10, 130 MDR1 and MCT4 expression in primary CaPs. Table 4-1 Immunostaining for CD44, CD147, MCT4 and MRP2 in KD and 145 control CaP cell lines. Table 5-1 Summary of body weight and WBC count of nude mice receiving 161 DTX at different dosage. Table 5-2 The intensity of immunohistochemical staining of CD44, CD147, 173 CD31, Ki-67, Caspase-3(active), TUNEL in tumour xenografts from PC-3M- luc, PC-3M-luc-scr, PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD cell line with DTX and/or veihicle treatment.

List of Abbreviations

A ABC ATP-binding cassette ACEC Animal Care and Ethics Committee ADT Androgen deprivation therapy AI Androgen independent AR Androgen receptor ASO Antisense oligonucleotide B BLI Bioluminescence imaging BM Bone marrow BPH Benign prostatic hyperplasia C C Degrees celcius CaP Prostate cancer CD44s CD44 standard CD44v CD44 variant CRPC Castration-resistant prostate cancer CSC Cancer stem cell CT Computed tomography CZ Central zone D DAB 3,3‟ diaminobenzidine Dll Delta-like DMEM Dulbecco‟s modified eagles medium DMSO Dimethyl sulfoxide DPBS Dulbecco‟s phosphate buffered saline DRE Digital rectal examination DTX Docetaxel E ECL Enhanced chemiluminescence ECM Extracellular matrix

EDTA Ethylenediaminetetraacetic acid EGFR Epidermal growth factor receptor EMMPRIN Extracellular matrix metalloproteinase inducer EMT Epithelial-mesenchymal transition ER Endoplasmic reticulum F FBS Fetal bovine serum FDA Food & Drug Administration FGF Fibroblast growth factor FRAP FKBP12-rapamycin-associated protein G g G force H h Hour H&E Hematoxylin and eosin HA Hyaluronan HCC Hepatocellular carcinoma HEG High-expression group HGPIN High-grade prostatic intraepithelial neoplasia HIF Hypoxia-inducible factor-1 hpf High power field HRP Horseradish peroxidase HUVEC Human umbilical vein endothelial cell I i.c. Intracardiac ICD Intracellular domain Ig Immunoglobulin i.p. Intraperitoneal IL Interleukin IP Immunoprecipitation K KD Knock-down KDa Kilodalton

20 kg Kilogram L LEC Lymphatic endothelial cell LEG Low-expression group LVD Lymphatic vessel density M M Molar MAb Monoclonal antibody MAPK Mitogen-activated protein kinase MCT Monocarboxylate transporter MDR Multi-drug resistance mg Milligram min Minute mL Milliliter MMP Matrix metalloproteinases MRI Magnetic resonance imaging MRP Multiple drug resistance protein MTD Maximum tolerated dose MTT 3-(4,5-dimethylthlthiazol-2-yl)-2,5-diphenyl tetrazolium bromide MVD Microvessel density N NE Neuroendocrine nM nanomolar NOD/SCID Non-obese diabetic/ severe combined immunodeficiency NSCLC Non-small cell lung cancer O OD Optical density o/n Overnight P PAb Polyclonal antibody PAS Periodic acid-Schiff PDGF platelet-derived growth factor

PI Propidium iodide PI3K Phosphatidyl inositol 3-kinase PIN Prostatic intraepithelial neoplasia Pgp P-glycoprotein PSA Prostate-specific antigen PSMA Prostate-specific membrane antigen PTEN Phosphatase and tensin homolog PVDF Polyvinyl difluoride PZ Peripheral zone R RAG Recombination-activating gene RNAi RNA interference RP Radical prostatectomy RPMI-1640 Rosewell Park Memorial Institute RT Room temperature S s.c. Subcutaneous scr Scramble SCID Severe combined immunodeficiency SD Standard deviation siRNA Small interfering RNA T TAA Tumour associated antigen TBS Tris buffer saline TMA Tissue microarray TMN Tumour, node, and metastasis TRUS Trans-rectal Ultrasound TRAMP transgenic adenocarcinoma of the mouse prostate TURP Trans-urethral resection of the prostate TZ Transition zone U µL Microliter UNSW University of New South Wales

22 uPA Urokinase plasminogen activator V VC Vehicle control VE Vascular endothelial VEGF Vascular endothelial growth factor VEGFR Vascular endothelial growth factor receptor VM Vasculogenic mimicry W wk Week

Chapter 1-Literature Review and Aims

Parts of this literature review have been published in:

Hao JL, Cozzi PJ, Khatri A, Power CA, Li Y. EMMPRIN/CD147 and CD44 are potential therapeutic targets for metastatic prostate cancer. Curr Cancer Drug Targ 2010;20:287-306

1.1 The prostate

The prostate is the largest accessory gland in the male reproductive system. A healthy prostate is about the size of a chestnut, lying in front of the rectum, through which it can be palpated for prostate diseases. It sits under the bladder and surrounds the urethra (Figure 1-1). Therefore patients with prostate diseases are likely to show micturition problems. The paired seminal vesicles are located posterior of the prostate, and open to the prostate through the ejaculatory duct. The normal prostate is composed of glands, which secret prostatic fluid into semen, and muscle tissue which helps in male ejection. The prostate glands are tubuloalveolar glands irregular branched from the urethra (Figure 1-2). Each lobule of the glands contains an epithelial layer of cells which are columnar, apical secretory granules projecting inwards, as well as a basal layer for epithelial regeneration. The prostate is divided into three distinct zones (Figure 1-3) - peripheral zone (PZ), transition zone (TZ), and central zone (CZ) by zonal anatomy (McNeal JE, 1981). Of the three zones, the PZ is at the back of the prostate and comprises about 70% of the prostate gland. It attracts most attention because it is where most CaPs arise from. The TZ is located in the interior of the prostate and contributes to about 5% of the prostate gland. In older age, the TZ enlarges and this is the region responsible for benign prostatic hyperplasia (BPH). CZ CaP is very rare, however it tends to be more aggressive and features a distinct route of spread (Cohen RJ et al., 2008). The widely used imaging modalities for CaP diagnosis include: transrectal ultrasound (TRUS), computed tomography (CT), and magnetic resonance imaging (MRI). TRUS and MRI can be used to identify PZ zone CaP reliably, while CT only applies to the nodal and distal disease because of its poor sensitivity and specificity (Pahuja A et al., 2006).

Figure 1-1. Male reproductive tract. (Adapted from the Melbourne Prostate Institute website http://www.melbourneprostate.org/pages/prostate/prostate.htm)

Figure 1-2. Cross-section of the prostate gland. (Adapted from the Andrology Australia website http://www.andrologyaustralia.org/pageContent.asp?pageCode=THEPROSTATE)

Figure 1-3. Zonal anatomy of the prostate. (Adapted from the Aboutcancer website http://www.aboutcancer.com/prostate_anatomy_images_ultrasound.htm)

1.2 Cancer of the prostate

CaP is mostly seen as adenocarcinomas arising from abnormal growth of epithelial cells. Other forms of CaP include: squamous cell carcinoma, signet-ring carcinoma, transitional carcinoma, neuroendocrine carcinoma and sarcoma (Bracarda S et al., 2005). Normally it begins in the PZ, and can extend beyond to surrounding organs such as seminal vesicles. Like other solid tumours, CaP cells can invade through local tissues and migrate to distant organs such as bone, lung, liver, or brain. Notably, a high propensity for bone metastasis is seen in CaP (Bubendorf L et al., 2000). In addition to the malignant nature of metastatic cancer cells, the process of CaP is largely driven by microenvironmental factors such as adhesion molecules, proteinases, blood vessels, and osteoblast-related factors (Jin JK et al., 2011). Bubendorf et al reported the metastatic patterns of CaP from an autopsy study of 1,589 patients and found that haematogeneous metastases were present in 35% of 1,589 patients with CaP, with the most frequent involvement being bone (90%), lung (46%), liver (25%), pleura (21%), and adrenals (13%) (Bubendorf L et al., 2000). Unfortunately, the mechanisms responsible for this phenomenon remain largely undefined.

1.2.1 Epidemiology, screening and diagnosis

CaP is the second most common cancer diagnosed and the sixth cause of cancer death among men around the world (Baade PD et al., 2009). It remains the most common cancer and the second leading cause of death from cancer in males in the United States (Jemal A et al., 2009) as well as in Australia (AIHW, 2010). In Australia, CaP incidence increased sharply from 1982 to 2003. In 2007, the risk for Australian men being diagnosed with CaP was as high as 1 in 7 before the age of 75 years and 1 in 4 before the age of 85 years (AIHW, 2010). Incidence of CaP varies largely between countries and ethnic populations. The rate of this disease is higher in developed countries such as USA, UK, Canada, European countries and Australia compared to undeveloped countries. In addition, there is a difference in the incidence between African-American and European-American men (Powell IJ, 2007). Other risk factors for CaP include family history and age (Gronberg H, 2003). Very few men are diagnosed with CaP under the age of 50 years. However, those with a CaP family history are more likely to be diagnosed at an earlier age and have a more aggressive disease (Kupelian PA et al., 1997). Because of the advances in early detection or the improved treatment, the mortality rate of CaP is decreasing in developed countries (Baade PD et al., 2009). Although the number of CaP cases is much lower in Asian countries compared to western countries, they have been also experiencing an escalation of both incidence and mortality of CaP, probably due to the increasing influences of western culture (Crawford ED, 2009). There are tests available before a diagnosis is made, i.e. PSA test, digital rectal examination (DRE), and biopsy of CaP. A PSA test measures the level of blood stream PSA or PSA isoforms secreted by prostate cells (You J et al., 2010). An increased level of PSA may indicate a higher chance of prostate disease including CaP, BPH or other prostate diseases. However, there are also cases of CaP detected without elevated PSA (Thompson IM et al., 2004). Based on the reviewed evidence that PSA screening only results in minimal benefit for CaP specific mortality (Chou R et al., 2011), the United States Preventive Services Task Force does not recommend it for the early diagnosis of healthy men. DRE is another important checkup for CaP. During the DRE test, a doctor inserts a gloved finger into the patient‟s rectum and feels for lumps, enlargement, or hardness in the prostate. However, the DRE test only gets to the rear of the prostate;

28 those tumours located elsewhere might not be detected. Thus a combination of DRE and PSA test is highly recommended for the screening of CaP. Generally speaking, doctors recommend that men over 50 are encouraged to take the PSA and DRE examination annually with the informed risks and benefits. When the PSA level or DRE is found to be abnormal at the screening, a biopsy is made for pathology. The biopsy procedure is TRUS aided. The process involves the use of an ultrasound probe to profile the prostate outline on the computer, and a biopsy device to remove a cylinder of tissue in the selected area. Usually this procedure is repeated several times since multiple samples are requested at the biopsy. The outcome of biopsy is classified into four categories: a. benign prostate tissue, b. atypical small acinar proliferation (or atypia), very few cells might be cancerous, repeated biopsy recommended, c. prostatic intraepithelial neoplasia (PIN): low grade PIN might be present in early age and do not necessarily develop to CaP; high grade PIN (HGPIN) is associated with higher risk of cancer present in the prostate gland. d. CaP: the cancer tissue is scored according to the grading system. After CaP is diagnosed in a patient, there are tests to be done to establish whether cancer cells have spread within the prostate or other organs. Such tests includes: radionuclide bone scan, MRI, pelvic lymphadenectomy, CT scan, seminal vesicle biopsy.

1.2.2 Gleason score and staging

Gleason score, originally described by Dr. Gleason Donald (Bailar JC, 3rd et al., 1966, Gleason DF, 1966), is the most commonly accepted grading system to evaluate CaP prognosis, although there are also limitations in the Gleason scoring system because of the heterogeneity of CaP, as well as its dependence on subjective observation. The Gleason score is based on the glandular pattern rather than cytological characteristic of either biopsy or radical prostatectomy (RP) specimens. The microscopic pattern of tumour structure is presented as grades from 1-5 (Figure 1-4), with the worst referred to as grade 5. Both the primary pattern (greater than 50% of the total cancer observed) and the secondary pattern (less than 50% but more than 5% of the total cancer observed) are

29 attributed a grade individually, and the same Gleason grade is given if the pattern is universally distributed. Because the prognosis of CaP patients is related to both primary and secondary scores, the Gleason score was generated as the sum of these two scores and has a total value ranging from 2-10. Patients with a higher Gleason score are normally associated with more aggressive CaP and worse prognosis. It has been reported that Gleason score 7 has a distinct role in predicting biomedical failure after RP (Sakr WA et al., 2000, Tefilli MV et al., 1999). The disease outcome of Gleason score 5-6 is only slightly worse than Gleason score 2-4, but significantly better than Gleason score 7. The tumour behavior of a Gleason score of 7 is intermediate to Gleason score 6 or less and 8 or more, thus it was suggested to be considered as an independent category (Sakr WA et al., 2000, Tefilli MV et al., 1999). Increasing evidence has also been found that the percentage of Gleason grade 4/Gleason grade 5 instead of Gleason score has a more profound role as predictor for CaP progression (Noguchi M et al., 2000, Stamey TA et al., 1999).

Figure 1-4. Gleason grading system and representative histology images. (Adapted from the Prostate Cancer Research Institute website http://www.prostate-cancer.org/pcricms/node/165)

Staging is very important in cancer diagnosis. The Gleason score reflects how aggressive the CaP is, but staging indicates the extent of the disease progression. Thus accurate staging is critical for the treatment of CaP. In CaP, the TNM (Tumour, Node, 30 and Metastasis) staging system is the standard way for the cancer health professionals to describe how far the CaP has progressed. According to the the guildlines from American Joint Committee on Cancer, cancer is classified in the following categories: 1) T: the size and location of the primary tumour; 2) N: whether lymph nodes spread was present; 3) M: whether distant metastasis was present. Each of these stages was assigned a number as a rating of a specific status in each stage (Edge SB et al., 2010). The stage groups of the cancer can be obtained by combining the TNM classification, the PSA level and Gleason score. The assignment of the stage groups as a combination of all factors is summarized in Table 1-1.

Table 1-1. Anatomic stage/prognostic groups* Stage Tumour Nodes Metastasis PSA Grade Stage I T1-2a N0 M0 <10 ≤6 T1-2a N0 M0 <20 7 T1-2a N0 M0 ≥10,<20 ≤6 Stage II T2b N0 M0 <20 ≤7 Any Any Stage III T3a-b N0 M0 PSA Gleason Any Any T4 N0 M0 PSA Gleason Any Any Any T N1 M0 PSA Gleason Any Any Any Stage IV Any T N M1 PSA Gleason Note: *Table adapted from the Cancer Staging Manual of the American Joint Committee on Cancer (Edge SB et al., 2010).

1.2.3 Treatment strategies

Treatment of CaP currently involves active surveillance, radiotherapy, surgery, hormone therapy, immunotherapy or chemotherapy depending on the stage of the disease. Table 1-2 summarizes the treatment options for different stages of CaP (Higano CS et al., 2011). Despite castration levels of testosterone, the tumour will finally become independent of androgens resulting in death within a few years from diagnosis. ADT is one option that was introduced following the observation that castration significantly reduced serum acid phosphatase in CaP patients (Huggins C et al., 1972). The initial therapeutic response to the ADT is only brief (8 month-3 years), and CaP patients then

31 become refractory to additional treatment, as tumours eventually relapse to an androgen-independent (AI) state (Daneshgari F et al., 1993). Up to 30% of treated CaP patients suffer a relapse and develop a PSA recurrence, a more invasive or metastatic disease, within 10 years after surgery (Hull GW et al., 2002, Roehl KA et al., 2004). The majority of deaths in CaP result from progression or advancing to castration- resistant prostate cancer (CRPC) (Valdespino V et al., 2007b). For the late stage of CaP, chemotherapy remains a standard treatment, although it can only provide very limited therapeutic benefit. Docetaxel (DTX) is an antineoplastic agent and the most common choice for the metastatic CaP treatment at the moment. The actions of DTX on cells involve the disruption of the cell cycle and induction of apoptosis (Logothetis CJ, 2002, Yu JX et al., 2010). The recent two clinical trial reports from TAX 327 and SWOG-99-16 studies suggested that the treatment of DTX plus prednisone improved the qulity of life of the CRPC patients and increased the median survival time by 2.4 and 1.9 months respectively, compared to the standard mitoxantrone with/without prednisone treatments (Petrylak DP et al., 2004, Tannock IF et al., 2004). These exciting results launched a number of new directions investigating DTX combination therapies that may offer superior benefits for CRPC patients. Due to the low response rate and short median survival time of CRPC to various cytotoxics, CRPC was considered as naturally chemo-resistant (Yagoda A et al., 1993). The DTX responsive rate was about 50-60% in current clinical trials (Caffo O et al., 2012, Petrylak DP et al., 2004). MDV3100 and Cabazitaxel are two emerging drugs to treat late stages of CaP (Higano CS et al., 2011). Although the use of both MDV3100 and Cabazitaxel has recently made some progress in overcoming taxane resistance in CRPC treatment (Bellmunt J et al., 2012), large multicentre clinical trials are required to confirm the clinical benefits. The chemo-resistant nature of advanced CRPC can possibly be explained by the cell kinetics of CaP. Chemotherapeutic agents induce cell death by perturbing the cell cycle; therefore cells are required to be actively proliferative to respond to this therapy (Denmeade et al, 1996). Both primary CaP and metastases are characterized by a very low proliferation rate (Berges et al, 1995), and chemotherapy agents that block cell cycling are more likely to establish host toxicity in highly proliferative organs than have an anti-tumour effect on CaP. On the other hand, cancer cells are genetically unstable, and can rapidly mutate and develop acquired drug resistance to tumour-targeted therapy. This suggests that other mechanisms such as altering the tumour microenvironment or 32 targeting TTAs, either alone or in combination with traditional chemotherapy will have unique advantages in the treatment of CaP. This thesis investigated aspects of the CaP microenvironment, including two specific TAAs - CD44 and CD147 (Section 1.4.1 and 1.4.2). Table 1-2. Treatment options for different stages of CaP* Hormone sensitive Newly diagnosed localized disease Metastatic hormone naïve Radical prostatectomy ADT External-beam radiation therapy with/without ADT Denosumab Active surveillance Castration resistant Non-metastatic Metastatic, Chemotherapy-naïve Metastatic post-docetaxel No standard Sipuleucel-T Cabazitaxel therapy Docetaxel Abiraterone 89Strontium, 153Samarium, Mitoxantrone 233Radium 233Radium Sipuleucel-T Note: *Table adapted from (Higano CS et al., 2011).

1.3 Role of tumour microenvironment in CaP

1.3.1 Angiogenesis

Angiogenesis is reported to be an essential prerequisite for CaP development and metastasis (Choy M et al., 2001, Izawa JI et al., 2001). Gleason score and disease progression have previously been shown to be positively correlated with microvessel density (MVD) (Weidner N et al., 1993). MVD was shown to be an independent predictor of the pathologic stage and survival in CaP (Weidner N et al., 1993, Concato J et al., 2009) as well as a prognostic marker for CaP recurrence after RP (Bettencourt MC et al., 1998, Bono AV et al., 2002, Silberman MA et al., 1997). The expression of multiple angiogenic factors such as vascular endothelial growth factor (VEGF), and Interleukin (IL)8 are significantly higher in CaP tissues than in normal or benign prostate tissues (Ferrer FA et al., 1998). The expression of basic fibroblast growth factor (FGF) and IL8 have also been found to be correlated with a higher metastatic potential in CaP cell lines (Greene GF et al., 1997). A unique relationship between CaP and angiogenesis was found in the regulatory role of androgen on the formation of new 33 vasculature (Choy M et al., 2001, Franck-Lissbrant I et al., 1998). ADT suppresses tumour development, at least in part, through effectively blocking angiogenesis (Stewart RJ et al., 2001). Interestingly, subcutaneous (s.c.) implantation of CaP tumour, in the absence of androgen, produces much lower levels of angiogenic factors than an orthotopic implanted tumour (Greene GF et al., 1997). These results suggest that angiogenic gene expression might be influenced by the organ microenvironment. Another example related to specific mechanisms of CaP neovasculature is the PSA- involved generation of angiostatin-like fragment, an endogenous angiogensis inhibitor (Heidtmann HH et al., 1999, Migita T et al., 2001). Inhibition of angiogenesis by PSA- induced angiostatin-like fragment may explain the characteristic slow development of CaP at an early stage. By comparing the apoptotic index and intra-tumoural MVD before and after ADT, spontaneous apoptosis was found to be related with hypo- vascularity. Conversely, hormone-induced apoptosis was associated with hyper- vascularity after androgen withdraw (Matsushima H et al., 1999). These studies provide strong support for anti-angiogenesis therapy being potentially useful in controlling late stage CRPC, which currently has no effective treatment.

1.3.1.1 VEGF and VEGFR

Angiogenic stimuli produced due to the metabolic demands of host tissues initiate an angiogenic response. In normal conditions, angiogenesis is maintained by an intricate balance between endogenous stimulators of angiogenesis and endogenous inhibitors of angiogenesis. During tumourigenesis, the angiogenic switch is activated directly via induction of angiogenic growth factors, or indirectly, by recruiting host immune cells that release mediators of angiogenesis (Folkman J et al., 1987). Among the angiogenic activators, VEGF and VEGF receptor (VEGFR) appear to be the most important factors for maintaining tumour angiogenesis and attract most interest. VEGF is an endothelial cell specific mitogen (Leung DW et al., 1989), initially identified and called vascular permeability factor, related to its capacity to induce microvascular permeability (Senger DR et al., 1983). With the discovery of VEGF, two independent studies showed that VEGF and the vascular permeability factor were identical, with significant homology to platelet-derived growth factor (PDGF) and the sis oncogene family (Leung DW et al., 1989). VEGF has since been characterized to have multiple functions, including

34 inducing proliferation of endothelial cells, increasing permeability of blood vessels, neuro-protection and homeostasis of vasculature (Azam F et al., 2010, Ellis LM et al., 2008, Ferrara N, 2002). Six isoforms of VEGF-A have been identified related to alternative splicing: VEGF-

A115, VEGF-A121, VEGF-A145, VEGF-A165, VEGF-A189, VEGF-A206 (Brown LF et al.,

1997), of which VEGF-A165 is most commonly produced by normal and tumour cells. These isoforms differ not only in terms of the size but also the affinity to heparin and heparan-sulphate (Neufeld G et al., 1999). The discovery of VEGF was followed by the identification of the receptors VEGFR-1and VEGFR-2 (Millauer B et al., 1993, Terman BI et al., 1992). The binding of VEGF to VEGFR-2 is regarded as the major signal transduction pathway for proliferation and chemotaxis (Neufeld G et al., 1999). The inhibition of VEGF activity, either by neutralizing antibodies or mutant VEGFR, significantly regresses tumour growth (Kim KJ et al., 1993, Millauer B et al., 1994). Other members of the VEGF and VEGFR family include VEGF-B (Olofsson B et al., 1996), VEGF-C (Joukov V et al., 1996), VEGF-D (Yamada Y et al., 1997), VEGF-E (Ogawa S et al., 1998), and placental growth factor (Maglione D et al., 1991). VEGFR- 3 (Aprelikova O et al., 1992) and neurophilin-1 (NRP-1) (Soker S et al., 1998) have been identified as members of the VEGFR family. Diverse VEGF members bind VEGFR-1 and VEGFR-2, which are primarily expressed on endothelial cells (Neufeld G et al., 1999). VEGFR-3 expression is normally restricted to lymphatic vessels (Neufeld G et al., 1999), and its major ligands are VEGF-C and VEGF-D. Neuropilin-1 is expressed on both endothelial cells and tumour cells and is a VEGF-A165 specific receptor (Soker S et al., 1998). VEGF and VEGFR are interesting potential targets for CaP therapy, as detailed in the following sections.

1.3.1.1.1 VEGF in CaP therapy

Serum levels of VEGF have been found to possess high sensitivity for detecting CaP in clinical studies (Trapeznikova MF et al., West AF et al., 2001). Higher levels of circulating VEGF have been reported to be associated with a higher Gleason score and metastasis stage of CaP (Duque JLF et al., Jones A et al., 2000, Strohmeyer D et al., 2000, Turner K et al., 2000). Expression of VEGF in CaP tumours was also found to be correlated with MVD (Borre M et al., 2000), and VEGF in CaP tumour, serum and

35 urine has been reported to be a predictor of disease-specific survival (Borre M et al., 2000, George DJ et al., 2001, Strohmeyer D et al., 2000, Bok RA et al., 2001). Jackson et al (1997) found that VEGF was expressed in both CaP epithelial cells and stromal cells (Jackson MW et al., 1997). VEGF-A121, VEGF-A165, VEGF-A189 mRNA were observed whereas only VEGF-A121 and VEGF-A165 proteins were detected in CaP (Jackson MW et al., 1997). Joseph et al (1997) reported that androgen ablation could directly result in decreased VEGF in both CaP and normal tissues in animals, and that exogenous androgen increases VEGF levels (Joseph IB et al., 1997). Benjamin et al (1999) further confirmed that reduced VEGF as a consequence of androgen ablation, could lead to selective obliteration of immature tumour vessels, which are devoid of peri-endothelial cells (Benjamin LE et al., 1999). Using immunohistochemistry, VEGF was found to be expressed in CaP cells as well as neuroendocrine cells, and downregulated after ADT (Haggstrom S et al., 2001, Mazzucchelli R et al., 2000). Notably, intense VEGF was observed in neuroendocrine cells, associated with increased vascularization (Harper ME et al., 1996, Borre M et al., 2000, Mazzucchelli R et al., 2000). These results indicate that neuroendocrine differentiation is a significant indicator of poor prognosis for CaP, which may increase CaP neovascularization and be involved in cancer progression (di Sant'Agnese PA, 1992, Borre M et al., 2000). Hypoxia-inducible factor-1 (HIF-1) is regarded as the most potent stimulus for regulating VEGF production (Goldberg MA et al., 1994). Increased levels of VEGF are associated with hypoxia in CaP tissues (Shweiki D et al., 1992), and increased expression of serum VEGF is associated with increased clinically detectable hypoxia in CaP tissues (Cvetkovic D et al., 2001). Jiang et al (1997) reported that oncogene v-Src up-regulates VEGF via the induction of HIF-1 in mouse embryo fibroblast cells (Jiang BH et al., 1997), and the tumour suppressor gene-p53 has been demonstrated to dose- dependently inhibit VEGF either alone or in the presence of v-Src (Mukhopadhyay D et al., 1995). IL1 (α and β) and tumour necrosis factor (α and β) can stimulate VEGF produced by the metastatic CaP cell line-DU145 (Ferrer FA et al., 1997). These results suggest that the VEGF expression in CaP is regulated by many factors. VEGF expression is also associated with the PI3K/Akt pathway in human CaP. PI3K signalling is important for regulating cell growth and survival, particularly during tumour progression and metastases. PI3K activates a number of downstream targets including the serine/threonine kinase Akt, a downstream member of the PI3K cascade, 36 which plays an important role in cell growth, death, adhesion and migration, and is frequently activated in cancer cells (Jiang BH et al., 1999, Lin HK et al., 2003). Arbiser et al reported that introducing the activated oncogene H-ras into endothelial cells induced angiogenesis through two distinct mechanisms: 1) upregulation of VEGF, matrix metalloproteinases (MMPs) and downregulation of tissue inhibitor of MMPs; and 2) signal transduction in the PI3K pathway (Arbiser JL et al., 1997). Senthil et al also demonstrated that the binding of VEGF to VEGFR-2 induces the recruitment of an insulin receptor substrate-1 in the receptor complex which is necessary for triggering the PI3K pathway and protein synthesis subsequently in kidney tubular epithelial cells (Senthil D et al., 2002). Furthermore, VEGF is induced by hypoxia through the PI3K pathway and HIF-1 in PC-3 and LNCaP cells (Koul D et al., 2002). Phosphatase and tensin homolog (PTEN), is a PI3K/Akt signalling antagonist that converts PI(3,4,5)P3 phosphatase to PI(3,4)P2 (Steelman LS et al., 2004). Functional studies have demonstrated that PTEN acts as a highly effective tumour suppressor, and may be frequently mutated, deleted, or epigenetically silenced in various human cancers (Birck A et al., 2000, Byun D-S et al., 2003, Harima Y et al., 2001) including CaP (de Muga S et al., 2010, Pedrero JMG et al., 2005, Sircar K et al., 2009). Koul et al showed that over-expression of PTEN down-regulated endothelial cell proliferation and migration by inhibiting VEGF production in PC-3 and LNCaP CaP cell lines (Koul D et al., 2002). One possible mechanism is the inhibition of the common PI3K pathway shared by PTEN and VEGF (Koul D et al., 2002). Blocking the PI3K/PTEN/Akt/FRAP (FKBP12-rapamycin-associated protein) pathway by LY294002 (an inhibitor of PI3K) and rapamycin (inhibitor of FRAP) has been reported to be able to alter the expression of transcriptional factor HIF-1α, and thus inhibit HIF-1 targeted VEGF gene expression in CaP cell lines (DU145, PC-3, PPC-1, and TSU) (Zhong H et al., 2000). The binding of VEGF to VEGFR in the extracellular domain can activate the phosphorylation of its receptor and the subsequent phosphorylation of signalling mediators such as protein kinase C/protein kinase D/Erk (Wong C et al., 2005), Src kinase/PI3K/PKB (Schlessinger J, 2000) and Raf kinase (Gollob JA et al., 2006). Furthermore, the ligand- receptor interaction also facilitates the release of proteinases which degrade basement membranes, critical for tumour cell invasion and new vessel growth (Lamoreaux WJ et al., 1998, Arbiser JL et al., 1997, Anteby EY et al., 2004). These results combined support the importance of the PI3K/PTEN/Akt pathway in CaP angiogenesis and VEGF expression. 37

Higher levels of VEGF and VEGFR-1 are associated with higher metastatic potential in a CaP orthotopic animal model (Haggstrom S et al., 2000, Balbay MD et al., 1999). The VEGF neutralizing antibody, A4.6.1 has been reported to be effective in preventing primary tumour growth and metastasis in a s.c. CaP animal model, suggesting that it might be a good option for metastatic CaP (Melnyk O et al., 1999). Krupski et al found that the function of VEGF in a CaP animal model is organ context specific, where the overexpression of VEGF increases tumourigenicity in an intra- prostate and metastatic CaP model, but not in a s.c CaP model (Krupski T et al., 2001). The reason for this observation is because the prostate can provide a favorable micrivoenvironment for CaP growth. Haggstrom et al also demonstrated that in the rat ventral prostate model, VEGF-A121, -A165, -A189 and VEGFR-1, VEGFR-2 were detected, and VEGF but not VEGFR-1, decreased after castration (Haggstrom S et al., 1998). However, neither VEGF nor VEGFR was decreased in the Dunning CaP model (Haggstrom S et al., 1998). These results indicate that the expression of VEGF and VEGFR is variable depending on the CaP model used. Since FDA (Food & Drug Administration) approval of the first anti-angiogenesis drug, Avastin, an anti-VEGF monoclonal antibody (MAb), a number of agents have been developed for targeting VEGF in the eye, such as pegaptanib (Macugen) (Gragoudas ES et al., 2004) and Ranibizumab (Lucentis) (Rosenfeld PJ et al., 2006). The common mechanism for their action is recognition and blocking of VEGF-A, thus obstructing subsequent signal transduction mediated by VEGF-VEGFR interaction. In one study, adenoviral delivery of VEGFR-2 demonstrated inhibition of tumour growth, MVD and prolonged survival time in transgenic adenocarcinoma of the mouse prostate (TRAMP) model (Becker CM et al., 2002). Using a combination of anti-VEGF antibodies and DTX, an increased tumour inhibition activity was observed, more than with either agent alone, in an androgen-independent CaP CWR22R xenograft model (Fox WD et al., 2002). A recombinant human MAb targeting VEGF (rhuMab VEGF) was developed and tested in phase I and II trials in CRPC patients (Gordon MS et al., 2001, Steinbild S et al., 2007). The results from the trials indicated that there were no dose-limiting toxicity up to 10 mg/kg, however the trials produced no objective response with a single agent at this dosage (Gordon MS et al., 2001, Reese David M et al., 2001). Therefore, it is worth considering application of combination therapies such as anti-VEGF MAb and chemo-reagents including DTX in the future for CRPC.

1.3.1.1.2 VEGFR in CaP therapy

Both VEGFR-1 and -2 have been found to be expressed on CaP cells (Jackson MW et al., 2002), and co-localization of VEGF and VEGFR has been observed in CaP, PIN and basal cells of normal prostate tissue (Jackson MW et al., 2002). VEGFR-1 is constantly expressed in CaP and BPH, whereas VEGFR-1 expression is grade dependent, with lower grade showing higher expression (Jackson MW et al., 2002). The expression of both VEGFR-1 and -2 is higher in PIN and well/moderate differentiated tumour than in normal prostate glands but is decreased in poorly differentiated tumour (Jackson MW et al., 2002). It was reported that DNA methylation could silence VEGFR-1 gene expression in CaP cell lines and CaP tissues, but not in BPH tissues (Yamada Y et al., 2003). Treating VEGFR-1 negative CaP cell lines (LNCaP and DU145) with methyltransferase inhibitor resulted in the re-expression of VEGFR-1 (Yamada Y et al., 2003). These findings suggest that the DNA methylation contributes to VEGF silencing in CaP cells and some of CaP patients (Yamada Y et al., 2003), and that the loss of VEGFR-1 expression may play a role in CaP carcinogenesis. The activation of VEGFR-1 was found to sustain angiogenesis and upregulate anti- apoptotic genes, such as Bcl-2, survivin and COX-2, on endothelial cells via the PI3K/Akt pathway (Cai J et al., 2003). VEGFR-1 not only serves as a tyrosine receptor for intracellular signal transduction but also modulates endothelial cell division to form blood vessels. VEGFR-1 deficient embryos had an increased mitotic index in endothelial cells and VEGFR-1 mutant mice die of vascular overgrowth (Kearney JB et al., 2002). Using an Ad Flk-Fc (adenovirus-delivered soluble fragment of VEGFR-2) treatment, Becker et al found a profound reduction of tumour growth in both a spontaneous transgenic animal model and an orthotopic CaP xenograft model (Becker CM et al., 2002). Using a combined therapy of oral AEE778 [targeting phosphorylation of EGFR (epidermal growth factor receptor) and VEGFR] and intraperitoneal (i.p.) paclitaxel, Busby et al demonstrated that this combination therapy or any of the therapies alone could induce apoptosis in tumour xenografts associated with endothelial cells. This resulted in significant apoptosis and necrosis of surrounding tumour cells, effectively preventing the tumour from developing metastasis in an AI, multi-drug resistant (MDR) CaP xenograft model (Busby JE et al., 2006). In vitro tumour cell paclitaxel sensitivity was not significantly affected compared to the in vivo situation

39 where endothelial cells were more sensitive to AEE778 than tumour cells, with subsequent inhibition of tumour growth. These results suggest that AEE778 has potential for treating late stage CRPC and chemoresistant CaP, and that targeting tumour microenvironment rather than the tumour alone is a more promising approach for therapy. A number of natural products have also demonstrated anti-angiogenesis potential via activation of receptor tyrosine kinases (Pang X et al., 2009, Wen W et al., 2008, Yi T et al., 2008, Zhu X-F et al., 2005). The advantage of these agents is their low toxicity. Acetyl-11-keto-beta-boswellic acid (AKBA), a component from the Indian ayurvedic medicinal plant, can significantly inhibit in vivo CaP growth by inhibiting VEGF- induced tumour angiogenesis in a dose-dependent manner, via the VEGFR-2 pathway (Pang X et al., 2009). Gambogic acid, the main component of Gambogic hanburyi (a traditional Chinese anti-inflammatory medicine), was found to have significant anti- angiogensis properties with very low toxicity (Yi T et al., 2008). Yi et al found that Gambogic acid at nanomolar concentrations displayed anti-tumour and anti- angiogenesis potential in CaP, and that its inhibition was through de-activation of VEGFR-2 on endothelial cells and the subsequent down-regulation of Src/p-Src, FAK/pFAK, AKT/pAKT, Caspase-3/cleaved caspase-3 pathways (Yi T et al., 2008). Polyphenol is an effective component derived from grape seed extract which can inhibit tumour proliferation, migration and capillary sprouting via inhibition of VEGFR-2. This natural product is a low cost and safe candidate for anti-angiogenesis therapy, and has been used in both in vitro breast cancer cell lines and in vivo breast cancer animal models (Wen W et al., 2008). This could be useful for CaP treatment in the future. ON- III (2,4-dihy-droxy-6-methoxy-3,5-dimethylchalcone), a chalcone derivative from traditional chinese medicine, the dried flower Cleistocalyx operculatis, is reported to have anti-angiogenic activity in human hepatocarcinoma and lung cancer xenografts via altering the phosphorylation of Akt/MAPK, although the total expression of MAPK and Akt was not affected. This appears to be another low toxicity candidate (Zhu X-F et al., 2005) and may be promising if used in combination treatment stratagies for CRPC therapy in the future. With the well-established role of angiogenesis pathways in tumour growth, several therapies targeting VEGFR mediated activation of pathways have been attempted. By inhibiting VEGFR-2, a cascade of intra-cellular signalling molecules were decreased: pSrc, pFAK, pAkt, pErk, pmTOR, pS6K, thereby suppressing in vitro endothelial cell 40

[human umbilical vein endothelial cell (HUVECs)] proliferation, migration and survival (Pang X et al., 2009). Erk1/2, a member of the MAPK family, can be activated by various growth factors, and the disruption of the signal cascade can result in carcinogenesis (Katsanakis KD et al., 2002). Soy isoflavones have been reported to be able to constantly activate Erk1/2 and result in decreased proliferation via upregulation of VEGFR, whereas the introduction of VEGF165 only transiently activated Erk1/2 but resulted in an increased proliferation via VEGFR (Clubbs EA et al., 2007). These results suggest that the effect of Erk might be dependent on the duration of the activation time (Clubbs EA et al., 2007). Gu et al recently reported that the Inositol hexaphosphate (IP6), a dietary nutrient supplement, strongly inhibited PC-3 CaP cell proliferation in vitro and angiogenesis in a tumour xenograft model with low toxicity, and the activity, at least partly, is through inhibition of PI3K/Akt pathway (Gu M et al., 2009). Sun et al demonstrated that the combination of a novel conjugate of camptothecin and a somatostatin analog could specifically target CaP and inhibit tumourigenicity and angiogenesis possibly via the inhibition of PI3K pathway (Sun LC et al., 2007). They also demonstrated that integrin αvβ3 and MMP2 and 9 were involved in the mechanism of action (Sun LC et al., 2007). AZD2171, a VEGFR-1 and -2 inhibitor, was tested in a Phase I clinical trial (Ryan CJ et al., 2007). The maximum tolerated dose (MTD) was determined as below 20 mg/day, but the PSA changes, off study response and muscle weakness require further study to verify mechanisms (Ryan CJ et al., 2007).

1.3.1.2 Integrin αvβ3 in human CaP

Integrin is a multifunctional biological protein that can mediate cell adhesion, migration and angiogenesis. Its expression has been observed on macrophages, activated leukocytes, cytokine-stimulated endothelial cells, osteoclasts and certain invasive tumours but not on normal epithelial cells (Cooper CR et al., 2002). There are many integrins that play important roles in cancer development. In this section, integrin αvβ3 and its role in human CaP angiogenesis is specifically discussed. Endothelial cell cycle and expression of integrin αvβ3 is activated by stimulation of multiple tumour-secreted growth factors (Alam N et al., 2007, Goel HL et al., 2008, Maeshima Y et al., 2001).

The major role of integrin αvβ3 is to allow the interaction of endothelial cells and ECM,

41 thus inhibiting apoptosis and enhancing the invasive potential of endothelial cells (Cooper CR et al., 2002). The aggressive potential of endothelial cells is mediated via the activation of NF-kB (Scatena M et al., 1998). In a chimeric human/mouse model, integrin αvβ3 was induced on the endothelial cells by a breast cancer cell line and accordingly, tumour growth and MVD was increased in the human skin microenvironment (Brooks PC et al., 1995). Furthermore, blocking integrin αvβ3 activity by using LM609, a MAb directed to integrin αvβ3, dramatically suppressed angiogenesis and tumour growth (Brooks PC et al., 1995). Because of its unique expression on activated endothelial cells, the role of integrin αvβ3 was explored as a molecular tracer for angiogenesis radio-/MRI imaging in preclinical and clinical studies (Stollman TH et al., 2009, Dijkgraaf I et al., 2009, Ke T et al., 2007, Line BR et al.,

2005). Mitra et al reported that after conjugation of αvβ3 with a radioisotope to form an integrin-targeting peptide (RGD4C), this conjugate could be used as a vehicle for the delivery of radiotherapy to arrest tumour growth, using an angiogenesis-targeting therapy approach (Line BR et al., 2005). Because traditional radiotherapy can upregulate integrin αvβ3, and activate Akt, it was suspected that the radio-resistant potential resulted from tumour cells escaping via integrin signalling. In that scenario, a combination of radiotherapy and anti-integrin αvβ3 treatment may help overcome tumour angiogenesis and radio-resistance (Abdollahi A et al., 2005). Abdollahi et al reported that a combination therapy of S247, an integrin αvβ3 antagonist, together with radiotherapy could provide enhanced anti-tumour and anti-angiogenesis effects in vitro for human glioma cells (U87), and for PC-3 CaP cells in vitro and in the corresponding xenografts in vivo (Abdollahi A et al., 2005). In addition to the PTEN-VEGFR axis, the inactivation of PTEN was also found to be associated with increased angiogenesis via reduction of integrin-mediated PI3k signalling in clinically localized CaP tissues (Giri D et al., 1999). It was reported that bone marrow (BM) derived cell lines from breast, lung, and prostate showed strong integrin αvβ3 expression (Sung V et al., 1998, van der P et al., 1997). Because the adhesive and proliferative function was most likely mediated by integrin αvβ3, inhibition of integrin αvβ3 with antibodies was found to reduce the migratory ability of breast cancer cells to bone (Sung V et al., 1998, van der P et al., 1997). Metastasis to the bone is the most common site in CaP, and high levels of integrin αvβ3 expression were detected in CaP cell lines derived from human bone (PC-3) and dura mater (DU145) metastases but not in lymph node-derived LNCaP cells (Zheng DQ et al., 2000). This 42 suggests that integrin αvβ3 may play a role in CaP metastasis by both promoting angiogenesis and bone resorption through diverse mechanisms. AbegrinTM (etaracizumab; previously known as VitaxinR or MEDI-522) is a humanized murine MAb, also called LM609, that is used for targeting integrin αvβ3 in a variety of solid tumours associated with high integrin αvβ3 levels (Brooks PC et al., 1995). A phase I clinical trial has been conducted with this MAb and found no toxicity (McNeel DG et al., 2005). Ongoing clinical studies are being undertaken to test its efficacy in melanoma (Hersey P et al., 2010, Moschos SJ et al., 2010) and advanced solid tumours (Delbaldo C et al., 2008). The activity of AbegrinTM has been demonstrated to be not only restricted to endothelial cells (McNeel DG et al., 2005) but also to integrin αvβ3-expressing tumour cells (Mulgrew K et al., 2006), in which tumour growth was regressed in a dose-dependent manner. Taken together, the current data support the potential of antiintegrin αvβ3 therapy as a future option for treating CRPC, either alone or in combination.

1.3.1.3 Angiostatin and endostatin in human CaP angiogenesis

Angiostatin and endostatin are the two most potent angiogenesis inhibitors identified to date, with strong anti-tumour effects individually (O'Reilly MS et al., 1994, O'Reilly MS et al., 1997) and in combination (Scappaticci FA et al., 2001, Li X et al., 2006, Raikwar SP et al., 2005). The mechanism of in vivo angiostatin production was largely unknown until the identification of the plasminogen proteolytic ability of several MMPs (Dong Z et al., 1997, Patterson BC et al., 1997, Lijnen HR et al., 1998). Angiostatin, an NH2-terminal fragment comprising kringles 1 to 3 of plasminogen, also shows potent anti-angiogenic (O'Reilly MS et al., 1994) and/or anti-tumour effects (Griscelli F et al., 1998, Griscelli F et al., 2000). Endostatin, a COOH-terminal proteolytic fragment of collagen XVIII, blocks endothelial cell proliferation, migration/invasion, and tubular network formation in vitro and inhibits tumour growth and angiogenesis in a wide variety of animal models with little toxicity, immunogenicity, or resistance (Blezinger P et al., 1999, O'Reilly MS et al., 1997). A serine proteinase identified in human CaP cell lines was reported to be able to generate bioactive angiostatin from human plasminongen (Gately S et al., 1996). Similarly, angiostatin was identified in canine urine in animals with primary CaP, but

43 not in urine after castration (Pirie-Shepherd SR et al., 2002), suggesting that the angiostatin-producing agent might be released by tumour cells. As a site specific serine proteinase, PSA is attributed to a novel factor in producing angiostatin-like fragments almost exclusively in the prostate (Heidtmann HH et al., 1999, Fortier AH et al., 1999). The purified angiostatin-like fragment appears to have the same function and efficacy on HUVEC as angiostatin (Heidtmann HH et al., 1999). However, the human CaP cell lysates did not produce angiostatin in the absence of exogenous plasminogen (Migita T et al., 2001), suggesting that the production of angiostatin is dependent on plasminogen. By using immunohistochemistry, the distribution of angiostatin in CaP specimens was indicated by the presence of plasminogen lysine-binding sites, which were cytoplasmic in 87% of specimens, and correlated with Gleason Score (Migita T et al., 2001). However, the discrepancy between LBS and PSA staining suggests that other mechanisms, rather than PSA, may be involved in angiostatin generation in CaP (Migita T et al., 2001). Morikawa et al reported that CaP-derived cathepsin D is also responsible for the generation, and the production of angiostatin in a pH-dependent manner in vitro, causing the prevention of tumour growth and angiogenesis-dependent growth of metastases (Morikawa W et al., 2000). Taken together, these data are consistent with the involvement of endostatin and angiostatin in CaP angiogenesis and metastasis.

The anti-angiogenic effect of angiostatin has been attributed to its binding to αvβ3 integrin, ATP synthase, and CD26 (Gonzalez-Gronow M et al., 2005, Moser TL et al., 1999, Tarui T et al., 2001). Endostatin has been reported to mediate its anti-angiogenic effects by binding to integrin αvβ1 (Sudhakar A et al., 2003) and VEGFR-2 present on endothelial cells and cancer cells (Hajitou A et al., 2002, Kim Y-M et al., 2002), inhibition of MMPs (Kim Y-M et al., 2002), and down-regulation of c-myc and cyclin- D1 (Hanai J-i et al., 2002). Galaup et al reported that a combination of angiostatin gene therapy [adenovirus-delivered angiostatin (AdK3)] with DTX provided a marked regression of tumour growth and decreased intratumoural vascularization in a PC-3 xenograft model (Galaup A et al., 2003). In addition to inhibiting angiogenesis, Gonzalez-Gronow et al found that angiostatin directly acted on 1-LN CaP cells to inhibit tumour invasiveness and metastasis by preventing plasminogen-2 epsilon from binding to CD26 and subsequent Ca2+-induced mobility and secretion of MMP9 (Gonzalez-Gronow M et al., 2005). Raikwar et al also demonstrated a novel anti- angiogenesis adenoviral approach with a combination of angiostatin-endostatin (Ad- 44 hEndo-angio) and soluble Tie-2 (Ad-sTie2). This enhanced the effect of Tie-2 adenoviral therapy alone in a PC-3 CaP xenograft model, inducing tumour regression and prolonging survival time (Raikwar SP et al., 2005). Li et al recently reported that co-administering a replication-deficient adenovirus expressing the endostatin and angiostatin fusion gene (EndoAngio) and a prostate-restricted, replication competent adenovirus, showed dramatic anti-tumour efficacy in AI CWR22rv tumour models and led to complete regression of tumour for 14 wks in 7 out of 8 mice (Li X et al., 2008). This novel anti-angiogenic EndoAngio-PRRA approach represents a powerful agent for future clinical trials for CaP therapy. Using a TRAMP model, Isayeva et al (2009) found that endostatin significantly down-regulated the expression of growth factors, receptor tyrosine kinases, proteases, and androgen receptor (AR) both in vitro and in vivo, only when the cells expressed high-levels of AR (Isayeva, Moore et al., 2009). Systemic stable expression of endostatin delays the onset of the metastatic switch by acting on multiple pathways involving AR (Isayeva T et al., 2009). This observation demonstrated the close linkage between endostatin and AR in CaP progression, consistent with the involvement of angiostatin and endostatin in CaP progression and as useful targets for CRPC therapy.

1.3.1.4 Notch signalling pathway and angiogenesis paradox in CaP

The vertebrate Notch family includes four single transmembrane receptors: Notch-1,-2,- 3,-4, as well as five ligands: Delta-like (Dll)-1, -3, -4 and Jagged-1, -2 (Wang Z et al., 2008). Its importance has been highlighted during embryonic development and vascular homeostasis (Gridley T, 2001). Either downregulation or upregulation of Notch can result in defects of vascular function, suggesting the importance of proper Notch signalling in vasculogenesis. Because Notch signalling plays important roles in cellular development including proliferation and apoptosis, activation of Notch signalling pathways are also associated with tumourigenesis. The Notch pathway consists of multiple functional classes, including transmembrane cell-surface receptors, ligands, negative and positive modifiers and transcription factors (Allenspach et al, 2002). Each of these classes in turn has many members which modulate the role of Notch in cell survival, growth and differentiation. The multifactorial elements of the Notch signalling pathway have led to its implication in many forms of cancer. Interestingly, studies have

45 revealed that perturbation of Notch signalling resulted in increased numbers of non- functional blood vessels, whereas tumour growth was significantly repressed (Scehnet JS et al., 2007, Noguera-Troise I et al., 2006). In Notch-mediated neoplasis, Notch can act either as an oncogene or as a tumour suppressor, depending on the cellular context and differences in the strength and timing of Notch signals on the microenvironment (Weng AP et al., 2004, Hu XB et al., 2009, Koch U et al., 2007). The Notch receptor is synthesized in the rough endoplasmic reticulum (ER) as a single polypeptide precursor and proteolytically cleaved in the trans-golgi network by the furin protease, creating a heterodimeric mature receptor that comprises non- covalently associated extracellular and transmembrane subunits (Figure 1-5). This assembly travels to the cell surface where it interacts with specific transmembrane ligands, such as Jagged and Dll-1 (Lai EC, 2004). Notch ligand binding to Notch receptors leads to gamma secretase mediated cleavage of the intercellular domain of Notch. The intercellular domain then translocates to the nucleus and forms a complex where it regulates gene expression, converting repressor complexes into activator complexes, which results in the activation of genes such as: Hes-1, Nrarp, cyclin A, cyclin D1, p21 (Figure 1-5) (Weng AP et al., 2004, Miele L, 2006). The Notch pathway has been observed to crosstalk with other signalling pathways, such as NF-kappa B, Akt, mTOR, EGFR, PDGF, and sonic hedgehog to regulate tumour aggressiveness and angiogenesis (Wang Z et al., 2008). It has a profound role in normal prostate development and progression of CaP (Leong KG et al., 2008, Villaronga MA et al., 2008, Shou J et al., 2001).

Figure 1-5. The Notch signalling pathway. Notch receptors are single transmembrane proteins composed of extracellular, transmembrane, and intercellular domain (ICD). They are synthesized in the rough ER and processed in the Golgi complex before travelling to the cell surface. Gamma secretase cleavage leads to release of the intercellular domain of Notch. The intercellular domain is able to translocate to the nucleus and triggers the transcription of target genes.

There is accumulating evidence that Notch signalling plays an essential role in vascular development and angiogenesis. Numerous components of the Notch pathway are expressed in the vasculature at various stages of development (Hofmann JJ et al., 2007, Iso T et al., 2003). In one study summarizing the expression of Notch in mouse embryogenesis (stage E10-17), similar to ephrinB2, Notch-1, 3, 4 and Dll-4, Jagged-1 and Jagged-2 were all found to be restricted in arteries but absent from veins, while VEGFR-2 was expressed on both arteries and veins (Bello L et al., 2001). Of all the ligands and receptors, only Notch-4 and Dll-4 were expressed in capillaries (Bello L et al., 2001, Sullivan DC et al., 2003), indicating the role of different Notch ligands and receptors in various stages of vasculogeneisis. Because tumour angiogenesis initially arises from formation of capillaries, Dll-4/Notch-4 appear to be attractive vascular targets (Yan M et al., 2007). Recent studies highlighted Dll-4 as a potent regulator of vascular function that may be a potential target either alone or combined with other anti-

47 angiogenesis therapies. Overexpression of Dll-4 can result in reduction of blood vessels via activation of Notch signalling, but increased tumour growth in vivo (Li JL et al., 2007, Thurston G et al., 2007). Although the number of blood vessels was reduced, improved structure and function of larger vessels was associated with increased vessel perfusion and tumour oxygenation (Li JL et al., 2007), suggesting a role for DII-4 in vascular maturation. In a gene microarray study, Harrington et al found that overexpression of Dll-4 in HUVEC generally could attenuate angiogenic factors but stimulate differentiation and morphogenesis makers (Harrington LS et al., 2008). In addition, in vitro and in vivo studies suggested that Dll-4 plays an important role in the angiogenesis switch from proliferating endothelial cells to mature and differentiated blood vessels (Harrington LS et al., 2008). However, other studies demonstrated inhibition of Dll-4 induced signalling leading to sprouting of immature vessels (Noguera-Troise I et al., 2006) and a diminished tumour perfusion (Scehnet JS et al., 2007). Recent studies show the involvement of Notch signalling in cancer angiogenesis and metastasis (Hellstrom M et al., 2007, Noguera-Troise I et al., 2006, Zeng Q et al., 2005). It has been reported that Notch-1 was over-expressed in CaP cell lines and human CaP tissues (Zayzafoon M et al., 2004); Bin et al, 2009). Moreover, Notch-1 expression in human CaP tissues increased with increasing tumour grade and induction of vascular endothelial cells, suggesting that Notch-1 may facilitate angiogenesis and metastasis of CaP cells to neighbouring and distant organs (Bin et al, 2009). Emerging evidence suggests that the Notch signalling pathways play an important role in CaP development and progression, especially as the Notch signalling pathway was found to be over-expressed in CaP cell lines (Shou et al, 2001; Zhang et al, 2006; Leong and Gao, 2008; Bin et al, 2009). Notch signalling is active in intermediate, transit- amplifying prostate cells undergoing rapid proliferation, and Notch inhibition reduces proliferation of primary CaP epithelial cells (Ceder JA et al., 2008), suggesting that active Notch signalling is a key feature of CaP. Notch signalling is critical for CaP regeneration following castration and hormone replacement, and components of the Notch pathway are important regulators of CaP progression, metastasis, and epithelial- mesenchymal transition (EMT) (Leong and Gao, 2008). Notch-1 has also been reported to be overexpressed in malignant CaP cells in moderately differentiated adenocarcinoma of TRAMP mice (Shou et al, 2001). Although Dll-4 was found to be up-regulated in tumour vasculature, few studies 48 attempted to investigate Dll-4 in CaP, probably due to the lack of expression in various CaP cell lines. Rather than Dll-4, the role of Jagged-1 was broadly investigated. Notch- 1 over-expression has been reported in bone metastases from CaP patients (Zayzafoon M et al., 2004). In a comprehensive study using a tissue microarray (TMA) from 154 patients, the Notch-ligand, Jagged-1, was overexpressed in advanced malignant and recurrent CaPs, strongly correlated with recurrent PSA level and an independent predictor of CaP recurrence (Santagata et al, 2004). Notch-1 signalling has been linked with regulation of CaP cell motility (Scorey N et al., 2006). However, Whelan et al (2009) reported that Notch-1 signalling is lost in prostate adenocarcinoma and defects in Notch-1 signalling may play a role in human CaP formation in part via a mechanism that involves regulation of the PTEN tumour suppressor (Whelan JT et al., 2009). These data illustrate the emerging complexity of the Notch pathway in CaP. The precise molecular mechanism by which activation of Notch signalling pathway leads to CaP cell growth and invasion is unclear. Mamaeva et al (2009) demonstrated that the calcium/calmodulin-dependent kinase II regulates Notch-1 signalling in CaP cells and suggested that the crosstalk between the calcium/calmodulin-dependent kinase II and Notch-1 pathways could potentially provide new targets for pharmacotherapeutics (Mamaeva OA et al., 2009). Wang et al found that knock-down of Notch-1 or Jagged-1 in the PC-3 CaP cell line results in inhibition of cell growth, migration and induction of apoptosis via downregulation of Akt, mTOR, NF-kB signalling pathway, with decreased expression and activity of NF- kB downstream genes such as MMP9, VEGF, and urokinase plasminogen activator (uPA), contributing to the inhibition of cell migration and invasion (Wang Z et al., 2010). Zhang et al also found that Notch-1 is involved in invasion in human CaP and that silencing of Notch-1 inhibits invasion of human CaP cells by inhibiting the expression of MMP9 and uPA (Bin Hafeez B et al., 2009). Another study showed that the Jagged-1/Notch-1 associated inhibition of CaP cell line growth is a consequence of S phase arrest (Li X et al., 2006). A well known problem with anti-VEGF treatments (such as bevacizumab) of cancer is therapy non-responsiveness or therapy resistance. It was reported that blocking Dll-4 in either bevacizumab-sensitive (U87 human glioblastoma) or bevacizumab-resistant (PC-3 prostate carcinoma) cell lines inhibited tumour growth via perturbation of vascular structure and function, despite the increased vascular density (Li JL et al., 2007). This result suggests that inactivation of Notch signalling pathways by innovative strategies could provide a potential targeted approach 49 for the treatment of metastatic CaP. Notch signalling is now challenging conventional CaP angiogenesis therapy by inducing immature blood vessels to cease tumour blood supply and metastasis, rather than targeting pre-existing and growing vasculature. Thus it is possible to develop novel therapies by interfering with vascular function through Notch signalling pathways either alone or in combination with other traditional therapies to overcome current resistance to anti-angiogenesis therapy.

1.3.2 Lymphangiogenesis and lymph node metastasis

Although both blood and lymphatic vessels are lined by endothelial cells, they are very different structurally and functionally (Table 1-3). Lymphatics are composed of a grape-like network of capillaries and lymph nodes. The lymphatic capillaries remove interstitial fluid from tissues that passes through the lymph nodes, and by merging to larger lymphatic vessels and lymphatic ducts, the lymph is finally transported back to blood circulation via the thoracic duct (see Figure 1-6).

Table 1-3. Comparison of features of blood vessels and lymphatic vessels Blood vessel Lymphatic vessel Cellular structure Lined by endothelial Lined by endothelium, lacks cells and coated by pericytes and continuous basement pericytes and continuous membrane. basement membrane Physiological Closed loop throughout Open circuit from tissues to structure whole body lymphatic vessels and emptying into veins Fluid delivery Blood is pumped into Lymph passively flows from mode arteries and returned by tissues into lymphatic vessels veins Function Collect and distribute Collect and remove waste oxygen, nutrients, hormones, etc

Figure 1-6. Schematic diagram of the lymphatic circulation and vascular system. The vascular system cycles blood from the heart to artery, vein and finally back to the heart. The lymphatic system is open-ended. The lymphatic capillaries transport interstitial fluid from tissues. Fluid passes through the lymph nodes, and the capillaries eventually merge to larger lymphatic vessels. Finally, the interstitial fluid is brought back to the blood circulation.

The expression of anchoring filaments composed of elastic fibers on lymphatic endothelial cells ensures attachment to the ECM, as well as creates a flexible lumen size according to the volume of fluid (Zwaans BM et al., 2007). However, in pathological conditions, the lymphatic system also provides an optimal route for tumour cells to disseminate. Unlike blood vessels, lymphatics are devoid of pericytes and basement membrane, with the existence of gaps between adjacent endothelial cells in lymphatic vessels allowing the movement of tumour cells into adjacent tissue (Witte MH et al., 2006). Thus, if the malignant tumours are located in proximity to lymphatic vessels, lymph node metastasis is frequently seen.

Lymphangiogenesis is initiated in a similar way to angiogenesis since they share a number of common factors, including expression of VEGF-A (Bjorndahl MA et al., 2005, Hirakawa S et al., 2005), VEGF-C (Makinen T et al., 2001), VEGF-D (Stacker SA et al., 2001), VEGFR-3 (Kubo H et al., 2002), PDGF (Bjorndahl MA et al., 2005),

Angiopoietin-1 (Morisada T et al., 2005), Angiopoietin-2 (Gale NW et al., 2002), insulin-like growth factor-1 (Bjorndahl MA et al., 2005), insulin-like growth factor-2 (Bjorndahl M et al., 2005), and FGF-2 (Kubo H et al., 2002). Much evidence shows that the blood vessels and lymphatic vessels are always adjacent to each other, suggesting that they might functionally interact (Scavelli C et al., 2004). The androgen-responsive

CaP cell line (CWR22Rv-1) transfected with mutant VEGF-C [VEGF-C156s (exclusively targeting VEGFR-3)], induced fewer lymphatic vessels than the complete form of VEGF-C, suggesting that anigogenesis induced by VEGF-C can positively affect generation of lymphangiogenesis (Burton JB et al., 2008) Interest in lymphaniogenesis has increased in recent years, although there is ongoing debate as to the role of lymphangiogenesis in tumour progression. There is a lack of direct evidence showing increased lymphatic vessels within the tumour region in various clinical samples (Bolenz C et al., 2009). It was suggested that tumour lymphatic metastasis can occur if a malignant tumour is located in proximity to lymphatic vessels without triggering lymphangiogenesis. However, in vitro and in vivo animal experiments support the contention that tumours can potentially elicit lymphanigogenesis during cancer development (Brakenhielm E et al., 2007). Whether either or both of the lymphatic mechanisms proposed occur clinically remains unclear. In CaP, a body of reports established that peritumoural lymphatic vessel density (LVD) was higher than non-tumoural LVD (Kim HS et al., 2009, Zeng Y et al., 2005) and intratumoural LVD (Kim HS et al., 2009, Zeng Y et al., 2005, Trojan L et al., 2004). Peritumoural LVD was significantly correlated with lymph node metastasis (Zeng Y et al., 2005, Roma AA et al., 2006), suggesting that in CaP, lymph node metastases travel via peritumoural lymphatics and that peritumoural LVD may be a predictor of lymph node metastasis. Kim et al found that lower intratumoural LVD is associated with higher PSA and tumour volume (Kim HS et al., 2009). Notably, rather than well organized lymphtic vessels, destructed vessels were observed in intratumoural areas, whereas in peritumoural areas, the vessels were dilated (Kim HS et al., 2009). The destruction may be due to mechanical compression from the solid tumour, and increased fluid pressure in the peritumoural area leading to forced dilation of lymphatic vessels (Kim HS et al., 2009). This is also consistent with the hypothesis in the cutaneous lymphatic system under tumour bearing conditions (Zwaans BM et al., 2007). May et al suggest that lymph-vascular invasion is an independent marker of biomedical

52 failure after RP (May M et al., 2007). The hypothetical mechanism for increased peritumoural LVD and dilated peritumoural lymphatic vessels is shown in Figure 1-7. The main targets for lymphangiogenic therapy to date have been the VEGF- C/VEGFR-3 axis. In this section, the role of the VEGF-C/VEGFR-3 axis in CaP will be discussed. VEGFR-3 has been detected in normal prostate, BPH and CaP tissues, with upregulated levels of expression in CaP (Li R et al., 2004). VEGFR-3 expression is correlated with Gleason score, pre-operative PSA and lymph node metastasis (Li R et al., 2004). Zeng et al found that VEGF-C and VEGF-D were detected in both BPH and CaP, and that VEGF-C was higher in CaP than in BPH (Jennbacken K et al., 2005, Zeng Y et al., 2004b), whereas VEGF-D showed no difference in expression (Zeng Y et al., 2004a). VEGFR-3 immunostaining was also detected in lymphatics, and positive vessels were associated with lymph node metastasis, Gleason score, extra-capsular extension and surgical margin status (Zeng Y et al., 2004a). Interestingly, VEGF- C/VEGF-D+ cells were observed inside the VEGFR-3 positive lymphatic vessels (Zeng Y et al., 2004a). Yang et al also reported that both VEGF-C and VEGFR-3 were associated with CaP progression (Yang J et al., 2006). Lymphangiogenesis can be potentially induced by VEGF-C, as observed in in vivo experimental models (Brakenhielm E et al., 2007). PC-3 and LNCaP CaP cells which produce abundant VEGF-A, -C, -D, are more potent in inducing lymphatic endothelial cell (LEC) migration, invasion and lymphatic vessel formation (Zeng Y et al., 2006). Inhibition of the VEGF-C/VEGFR-3 axis significantly reduced intratumoural and perituimoral lymphatics (Burton JB et al., 2008). However, in an immunohistochemistry study of uveal melanoma, the presence of both VEGF-C and VEGFR-3 was not associated with lymphangiogenesis (Clarijs R et al., 2001), suggesting that VEGF-C/VEGFR-3 expression alone may not be sufficient for initiating lymphangiogenesis. Interestingly, LYVE-1 (a lymphatic endothelial cell marker) was detected and co-localized with VEGFR-3 in melanoma cells as well (Laakkonen P et al., 2002), suggesting potential for lymphangiogenic mimicry in melanoma, similar to vasculogenic mimicry (VM). VM will be discussed in the following section (Section 1.3.3).

Figure 1-7. Diagram showing the hypothetical increased peritumour LVD and dilated peritumour lymphatic vessels. A: In normal physiological condition, interstitial fluid in the prostate is drained through lymphatic capillaries and lymph nodes to larger lymphatic vessels. B: In pathological conditions such as when prostate tumours are present, tumour cells invade toward the peri-tumoural and intra-tumoural lymphatic capillaries. Increased pressure may lead to the destruction of intratumoural lymphatic capillaries, and subsequent compression and dilation of the peritumoural lymphatic capillary network. Presumably the stress also leads to sprouting of lymphatic capillaries and an increase of the peri-tumoural LVD.

The role of VEGFR-2 in lymphangiogenesis in CaP remains controversial. A study aiming to uncover the relationship between VEGFR-2 and lymphatic vessel formation suggested that VEGFR-2 interacts with LEC and contributes to LEC behaviour and lymph node metastasis in CaP (Zeng Y et al., 2006). Although both VEGFR-2 and VEGFR-3 were detected in lymphatic vessels and isolated LECs, recombinant VEGF-A and VEGF-C, but not VEGF-C165S (an engineered VEGFR-3 specific ligand), were able to induce LEC tubular formation in vitro (Zeng Y et al., 2006). VEGF-C only binds to VEGFR-2 and -3, so that VEGFR-2 is most likely the modulator of lymphatic tube formation, rather than VEGFR-3 (Zeng Y et al., 2006). On the other hand, Wong et al pointed out that tumour secreted VEGF-C was capable of inducing intratumoural lymphangiogenesis but is not essential for lymph node metastasis (Wong SY et al., 2005), although many reports showed a positive relationship between LVD and lymph node metastasis (Sugiura T et al., 2009, Werynska B et al., 2009, Cunnick GH et al.,

2008). These observations indicate that caution should be taken in regard to the relationship between lymphangiogenesis and lymph node metastasis. Isaka et al established that by inducing lymphangiogenesis with VEGF-C, the peritumoural lymphatic vessels were significantly increased, although functionally abnormal (Isaka N et al., 2004). Robert et al found that inactivation of VEGFR-3 is more potent in inhibiting lymph node and distant metastasis, whereas blocking VEGFR- 2 has a more pronounced effect on angiogenesis and tumour growth, although both reduced lymphangiogenesis (Roberts N et al., 2006). This may indicate that lymph node and distant metastasis only partly result from lymphangiogenesis, and that VEGFR-3 is closely related with metastasis via both lymphangiogenesis-related and lymphangiogenesis-independent pathways. It is highly possible that tumour cell leakage to pre-existing lymphatics or dilated lymphatics may co-exist to contribute to lymphatic metastasis. Conversely, this also suggests that the combination of both anti-VEGFR-3 and -VEGFR-2 antagonists can provide synergistic effects with anti-tumour therapy. In a recent study, two commercial tyrosine kinase inhibitors, cediranib and vandetanib (both targeting VEGFR-2 and VEGFR-3) inhibited tumour growth and angiogenesis (Padera TP et al., 2008). However, cediranib was able to prevent lymph node metastasis, and reduce the diameters of the draining lymphatic vessels only when administered during tumour development but not metastases (Padera TP et al., 2008). This may indicate that combination therapy is feasible, but that anti-lymphatic or anti- lymphangiogenesis interventions can only be effective at an early stage, before the initiation of tumour metastasis.

1.3.3 Vasculogenic mimicry

Vasculogenic mimicry (VM) describes the formation of channels by highly invasive, aggressive tumour cells that display a plastic phenotype, expressing genes and proteins that are usually associated with other cell phenotypes such as endothelial cells (Maniotis et al, 1999; Folberg and Maniotis, 2004). The channels formed in VM are composed solely of a basement membrane (secreted by tumour cells) and lined by tumour cells themselves. Blood plasma and red blood cells can flow through these channels (Folberg, 2004), and inflammatory cells or necrosis are not observed surrounding these channels (Figure 1-8). These channels display a highly patterned matrix-rich vascular-like

55 network that is observed in several highly aggressive and metastatic malignant tumours including cutaneous and uveal melanoma, breast, liver, ovarian and CaPs (Sun B et al., 2004, Warso MA et al., 2001, Xu X et al., 2010, Wang W et al., 2010, You J et al., 2010). These vascular channels are clearly seen using periodic acid Schiff (PAS) stain and are rich in laminin, collagen IV and VI, and proteoglycans (Folberg and Maniotis, 2004). The complexity and extent of PAS patterns are generally related to tumours being more or less aggressive, and to patients‟ outcome, especially those with metastatic disease. PAS+ channels form part of a distinct and complex matrix-associated microcirculation characteristic of CaP and other tumours including ocular and cutaneous melanomas and breast cancer (Maniotis et al, 1999; Folberg and Maniotis, 2004). The processes involved in forming these PAS+ matrix-rich networks remain to be defined. The presence of PAS+ channels has also been correlated with decreased disease-free survival in patients with cutaneous melanoma (Warso et al, 2001), suggesting that the presence of VM is a poor prognostic factor.

Figure 1-8. VM and transformation of plastic tumour cells. VM represents the formation of microvascular-like channels by aggressive tumour cells. Tumour cells are able to form vascular-like channels that are patent and allow blood flow. In the later stages, VM provides an additional circulation in solid tumours. The channels may adapt to accumulated blood components, and vessel-associated tumour cells; surrounding tumour cells may eventually induce transdifferention of VM lining cells toward endothelial cells and finally be incorporated in the vascular circulation system.

In hepatocellular carcinoma (HCC), VM is correlated with recurrence after orthotropic liver transplantation (Guzman G et al., 2007), suggesting that VM is a poor prognostic factor. Although VM has been described in several human malignancies, the molecular basis of this phenomenon is not entirely understood. The molecular mechanisms that underlie VM are not fully clear. Cleavage of laminin by MMPs, vascular endothelial (VE)-cadherin expression, tumour cell de-differentiation, and the tumour microenvironment have all been shown to play a role in VM (Hess AR et al., 2006, Hess AR et al., 2003). Three factors have been found to be critical in VM channel formation: plasticity of highly malignant tumour cells, remodelling of the ECM, and the connection of VM and host microcirculation (Sood et al, 2004; Fujimoto et al, 2006). Tumour-associated vasculature is not the same as physiologically normal blood vessels (Gustafsson MV et al., 2005). Previous strategies using anti-angiogenesis molecular targets instead of chemotherapy were based on the genomic stability of endothelial cells, nevertheless, more recent studies showed that tumour-associated endothelial cells were genetically abnormal (Hida K et al., 2004). Plasticity of cell differentiation is a phenomenon shared by aggressive tumour cells and stem cells. Thus, it is interesting to consider whether stem cell markers are also expressed in VM. In a recent study, El Hallani et al reported that CD133+ stem cell-like glioblastoma cells possessed the potential for vasculogenesis and expressed endothelium-associated genes, and that a subpopulation of these stem cells was able to transdifferentiate into vascular smooth muscle-like cells (El Hallani S et al., 2010). Another independent study showed that Nodal, an embryonic morphogen important for human embryonic stem cell pluripotency, is associated with VM-like tumour lined channels in a humanized xenograft model (McAllister JC et al., 2010). Inhibition of Nodal resulted in a downregulation of VE-cadherin and VM (Hendrix MJ et al., 2001). Tumour cell plasticity was also revealed by shared expression of the endothelial cell specific marker-VE- caderin (Zhang LZ et al., 2010). VE-cadherin is considered an important regulator in angiogenesis, and has been found in VM patterns generated by osteosarcoma cells (Cai XS et al., 2004). In HCC, the EMT regulator Twist1 has also been implicated in VM, by inducing tumour cell plasticity through up-regulation of VE-cadherin (Sun T et al., 2010). The knock-down of VE-cadherin could significantly repress angiogenic sprouting and the vasculogenic network, and unlike traditional anti-angiogenic therapies, targeting VE-cadherin may be able to regulate both endothelial-mediated angiogenesis and VM (Zhang LZ et al., 2010). 57

High level expression of protein tyrosine kinases, particularly EphA2, have been found to be extensively co-localized with tubular networks in melanoma 3D cultures, and the transient knockout of EphA2 with small interfering RNA (siRNA) abrogated the VM phenotype (Hess AR et al., 2001). Shirakawa‟s subsequent study showed the role of VM in association with aggressive phenotype in breast cancer in vitro and in vivo (Shirakawaet al, 2001). ECM-rich loops or hollows were identified in the absence of endothelial cells, without necrosis and fibrosis in the surrounding area, but this was only seen with the highly invasive and metastatic breast cancer cell lines (Shirakawa K et al., 2001). By comparing two groups of breast cancer patients (VM+ versus VM-), they further confirmed that VM was inversely related to prognosis and was associated with the likelihood of haematogenous metastases (Shirakawa K et al., 2002). In a recent study, VM was reported as an important mechanism mediating lymph node metastasis in laryngeal squamous cell carcinoma (Wang W et al., 2010). The association between metastases and VM could result from infiltration or shedding of tumour cells into the perfusable channels. In CaP, one study showed that aggressive and highly tumourigenic Duning rat and human CaP cells were able to form vascular-like networks both in vitro and in vivo (Sharma N et al., 2002). Notably in human CaP patients, VM was only found in the patients with a Gleason score>5, suggesting that VM may be correlated with a higher Gleason grade (Sharma N et al., 2002). Preliminary observations in this thesis confirmed that PAS+ staining was only found in high Gleason score (>7) primary CaP tissues. Therefore, the presence of VM may provide one explanation for why aggressive tumours (including CaP) show a limited response to anti-angiogenesis therapies. Silver et al originally identified prostate specific membrane antigen (PSMA)- associated vasculature in various tumours as endothelial cells (Silver DA et al., 1997). Liu et al further characterized the microvasculature lining cells in CaP, and found that phenotypically distinct channels were lined by either PSMA-positive cells or CD31- postive endothelial cells (Liu C et al., 2002). Using in vivo administration of a PSMA- directed selective tumour vascular thrombogen, extensive vessel thrombotic infarction was induced (Liu C et al., 2002). These results are consistent with the PSMA+ lining cells being tumour cells that had adapted a pseudo-endothelial phenotype, further supporting the hypothesis that tumour plasticity can lead to the formation of VM, and that this could be a feasible target for CaP treatment.

The development of anti-VM targeted treatments is still in its infancy. Hess et al found that the potential for forming VM was related to PI3K activity in melanoma and that blocking PI3K led to abrogation of the VM phenotype in vitro, whereas removing the PI3K inhibitor recovered the VM phenotype (Hess AR et al., 2003). As a result of enhancing the FAK/PI3K/MMP pathway, increased MMP generation cleaved laminin 5 gamma 2 fragments in the ECM (Hess AR et al., 2003). These results suggested that PI3K/Akt signalling may play a role in the development of VM, and that PI3K might be a promising target for the novel VM cascade. It will be very interesting to further investigate the role of the PI3K/Akt pathway in the formation of VM in CaP development especially in CRPC disease. Because angiogenesis and VM have been found to be induced by common environmental factors such as MMPs- or hypoxia-related factors or pathways, modulating the microenvironment may be effective in arresting both angiogenic and VM circulation in tumours. Seftor et al used a chemically modified tetracycline (COL-3) that inhibits MMP activity and demonstrated that COL-3 inhibited VM and the expression of VM-associated genes in aggressive melanoma cells via inhibition of laminin 5 gamma 2 chain generation (Seftor RE et al., 2002). COL-3 also reduced the induction of VM in poorly aggressive cells grown in an aggressive cell-preconditioned matrix (Seftor RE et al., 2002). Millimaggi et al recently also demonstrated that treatment of the ovarian cancer cell line-SKOV-3 (high invasion activity and high level expression of CD147/EMMPRIN-extracellular matrix metalloproteinase inducer) with siRNA to CD147/EMMPRIN, an inducer of MMPs in ovarian and other cancers, resulted in suppression of VM generation (Millimaggi D et al., 2009). In contrast, transfection of CD147 into CD147- ovarian cancer cells (CABAI, low invasion activity), led to increased tumour invasiveness and enabled VM formation (Millimaggi D et al., 2009). These results suggest that CD147 plays a critical role in VM of ovarian cancer cell lines and cancer progression, and is a useful target for controlling aggressive cancer (also see Section 1.4.2 - CD147).

1.3.4 Hyaluronan (HA)

HA is a glycosaminoglycan consisting of disaccharide repeats that is found in the ECM and plays an important role in cancer cell invasion and metastasis (Takahashi K et al.,

1996). Since HA is the major CD44 ligand (see Section 1.4.1-CD44), it can be used to target cells on which CD44 is expressed (Jaracz S et al., 2005, Vercruysse KP et al., 1998). Several reviews have previously discussed the advantages of HA as a drug carrier and a targeting ligand for cancer, as well as other pathologies (Jaracz S et al., 2005, Liao YH et al., 2005, Platt VM et al., 2008, Vercruysse KP et al., 1998, Yadav AK et al., 2008). HA targeting increases drug accumulation on CD44 expressing cells, thus an HA-attached drug can enter the cell via endocytosis (Luo et al, 2000). For CD44 to internalize via endocytosis it must be acetylated (Thankamony et al, 2006). Shuster et al (2002) have shown that hyaluronidase could eradicate HA as well as modify expression of CD44 variant exons of tumour cells, and reduce human breast cancer xenografts in SCID (severe combined immunodeficiency) mice without toxic side effects (Shuster et al, 2002). Rosato et al (2006) demonstrated a new water-soluble paclitaxel-hyaluronic acid bioconjugate, HYTAD1-p20, could directly interact with CD44 expressed by bladder tumour cells and target human bladder cancer cells in vitro and in an in vivo animal model (Rosato et al, 2006). Auzenne et al (2007) combined HA with paclitaxel prodrugs to form HA-paclitaxel. This HA-based prodrug administered locoregionally had antitumour activity in the in vivo in NMP-1 xenograft animal model (CD44+ cancer cells) (Auzenne et al, 2007). Banzato et al (2008) have recently reported that a paclitaxel hyaluronan bioconjugate (ONCOFID-P) interacted with CD44, could target IGROV-1 and OVCAR-3 xenografts after i.p. administration. This showed that this approach is promising for future clinical trials. Using HA-modified DOTAP/DOPE liposomes for targeted delivery of anti-telomerase siRNA to CD44 receptor-expressing lung cancer cells, Taetz et al (2009) demonstrated that these novel lipoplexes could successfully be targeted to CD44+ A549 cells but not CD44- Calu-3 cancer cells (Taetz et al, 2009). Surace et al designed a lipoplex containing a HA- dioleoylphosphatidylethanolamine (HA-DOPE) conjugate to target the CD44 receptor on breast cancer cells. Cationic liposomes containing the HA-DOPE conjugate mediated good transfection on CD44 expressing cell lines in culture demonstrating the potential of targeting such a receptor for gene delivery (Surace et al, 2009). The preclinical studies with HA as carriers targeting CD44 in cancers are summarized in Table 1-4.

Table 1-4. Preclinical studies with HA as carriers targeting CD44 in cancers HA-drug complex Model of cancer Effect Reference HA-paclitaxel Bladder cancer RT-112/84 cells Slightly higher tumour suppression effect (Rosato A et al., (HYTAD1-p20) inoculated s.c in right flank of mice than paclitaxel alone, but the 2006) biocompatibility was significantly improved. HA-paclitaxel Human ovarian cancer cell lines Reduced cytotoxity, decreased tumour (Auzenne E et al., (HA-TXL) NMP-1, SKOV-3ip inoculated i.p burden, improved survival. 2007) in mice HA-paclitaxel Human ovarian cancercell lines Improved efficacy and biocompatability, (Banzato A et al., (ONCOFID-P) IGROV1, OVCAR-3 inoculated controlled released of drug. 2008) i.pin mice HA-DOTAP/DOPE* A549 and Calu-3 representing Improved stability and reduced cytotoxity. (Taetz S et al., (encapsuled with anti- CD44+/- lung cancer cells Targeted to CD44+ lung cancer cells 2009) telomerase siRNA) HA-DOPE MDA-MB-231 and MCF-7 Increased transfection efficiency, the (Surace C et al., representing breast cancer cells efficiency is dependent on CD44 expression. 2009) with different CD44 levels Notes: DOTAP: 1,2-dioleoyl-3-trimethylammonium-propane; DOPE: 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine.

1.4 Tumour associated antigens

1.4.1 CD44

1.4.1.1 The structure of CD44

CD44 (Hermes, ECM-III, H-CAM and HUTCH-1) (Haynes BF et al., 1989, Underhill C, 1992), is a 85 to 90 KD integral transmembrane glycoprotein and multifunctional membrane receptor involved in cell adhesion and motility, lymphcyte activation and homing, and cancer metastases (Naor D et al., 1997). CD44 consists of 4 functional domains, and is a single-chain glycoprotein with a conserved N terminal extracellular domain, a non-conserved membrane proximal region, a conserved transmembrane domain and a conserved cytoplasmic tail. The distal extracellular domain is primarily responsible for the binding of HA, while the proximal extracellular domain is the site for alternative splicing of CD44 mRNA that produces the isoforms of CD44. The intracytoplasmic domain exhibits protein motifs that interact with cytoskeletal proteins and other intracellular signalling proteins (see Figure 1-9A). The CD44 gene, which maps to chromosome 11, contains 20 exons spanning 60 kb, many of which are subject to alternative mRNA splicing, resulting in a large number of transcripts. CD44 can assume several isoforms (see Figure 1-9B). The most common isoform of CD44, designated as standard CD44 (CD44s), is encoded by nine standard exons and has a molecular weight of approximate 90 kDa. A variant form of CD44 (CD44v) contains additional exons, referred to as variant exons (v2–v10 in humans) that result in additional protein sequences being inserted into the extracellular and membrane proximal region of the protein (Ponta H et al., 2003). Splice variants are expressed by some normal epithelial cells in a tissue-specific manner and CD44v10 is expressed by normal lymphocytes (Okamoto I et al., 1998). Cancers express novel variant isoforms, reflecting deregulated mRNA splicing. In fact, the expression of certain CD44 variant (CD44v) isoforms has been shown to be closely associated with tumour progression. Alternative splicing to produce variant exons takes place in the membrane-proximal extracellular

62 domain and the cytoskeletal tail, and the cell‟s microenvironment influences this process. The sizes of CD44 protein expressed in different cell types range up to 120 kDa (Iwase A et al., 2004, Screaton GR et al., 1992). Theoretically, inclusion of all variant exons would yield a protein of molecular weight 230 kDa, but most variant isoforms are less than 120 kDa. All CD44 isoforms contain a HA-binding site in their extracellular domain that serves as the major cell surface receptor for HA (Underhill C, 1992). The low molecular weight CD44 isoform, CD44s, binds to HA to a greater extent than the high molecular weight isoforms. The binding of HA to CD44 is associated with the activation of the cytoplasmic domain of CD44 and the subsequent interaction between CD44 and cytoplasmic ankyrin with stimulation of several cell signalling pathways.

Figure 1-9. The components of the CD44 protein domains and exons. A: CD44 protein has four domains: distal extracelluar domain, proximal extracelluar domain, transmembrane domain, and cytoplasmic domain. The alternative splicing site is shown in red within proximal domain. The cytoplasmic domain is intercalated with actin cytoskeleton. B: CD44 gene is composed of 20 exons. The exons in orange encode the most common form of CD44, CD44s. A number of variant forms can be generated from extensive alternative

63 splicing of the blue variant exon regions. The alternative splicing of exon 19 instead of exon 20 encodes for a rare short tail cytoplasmic domain. CD44 participates in a diverse set of cellular functions including lymphocyte homing, T- lymphocyte activation, signal transmission involved in cell proliferation, cell migration and apoptosis (Liu J et al., 2006, Naor D et al., 1997, Ponta H et al., 2003) and is essential to the physiological activities of normal cells as well as pathological activities of cancer cells. The roles of CD44 in cancer progression are summarized in the following subsections.

1.4.1.2 The function of CD44 in cancer

1.4.1.2.1 CD44 and cancer metastasis

CD44 isoforms (CD44s and CD44v) play a major role in cancer invasion and metastasis. Miyoshi et al (1997) reported that the expression of CD44v6 was particularly associated with lymph node metastasis in non-small cell lung carcinomas (NSCLC) (Miyoshi T et al., 1997). Yamaguchi et al (1998) have shown that serum CD44v8-10 levels were significantly higher in the colorectal cancer patients than in the healthy controls and serum CD44v8-10 levels were significantly higher in carcinomas associated with lymph node or liver metastasis than in those without metastasis (Yamaguchi A et al., 1998). Kinoshita et al (1999) also demonstrated that the expression of CD44v7-8 antigen was correlated to lymphatic metastasis of human breast cancer (Kinoshita J et al., 1999). In one immunohistochemical study of paraffin-embedded tissues from 136 patients (with and without recurrences) the prevalence of CD44+/CD24-/low cells in breast cancer was reported and it was postulated that this may correlate with distant metastasis (Abraham BK et al., 2005). Draffin et al (2004) reported that cell surface expression of CD44 on prostate and breast cancer cells may promote the retention of a HA coat that facilitates their initial arrest on BM endothelium (Draffin JE et al., 2004). Omara-Opyene et al (2004) demonstrated that CaP invasion was facilitated more by its over-expression of CD44v9 than by Muc18 (Omara-Opyene AL et al., 2004). Klingbeil et al (2009) reported that CD44v promoted metastasis formation in the highly metastatic rat adenocarcinoma line BSp73ASML [ASML(wt)] by a tumour cell-matrix cross-talk that supports adhesion and 64 apoptosis resistance (Klingbeil P et al., 2009). Golshani et al (2008) have shown that Hyaluronic acid synthase-1 expression regulates bladder cancer growth, invasion, and angiogenesis through CD44 (Golshani R et al., 2008). Using the MCF-7 breast cancer cell line, Ouhtit et al (2007) demonstrated that CD44s could promote breast tumour invasion and metastasis to the liver in a xenograft animal model (Ouhtit A et al., 2007). Desai et al (2007) reported that surface expression of CD44 was an important event in the activation of MMP9 and migration of CaP cells (Desai B et al., 2007). Using breast cancer cell lines, Sheridan et al (2006) showed that the CD44+/CD24- subpopulation expressed higher levels of proinvasive genes and had highly invasive properties (Sheridan C et al., 2006). In SW620 colon cancer cell line, Kim et al (2004) demonstrated HA facilitated invasion of colon carcinoma cells in vitro via interaction with CD44 (Kim HR et al., 2004). Harrison et al (2002) found that multiple CD44 isoforms co-localized with ezrin in DU- 145 and PC-3 CaP cells, and the CD44/ezrin complex plays a pivotal role in the capture and invasion of endothelial cells by CaP cells (Harrison GM et al., 2002). Weber et al (2002) found that CD44 gene products are important in regulating metastasis formation, and absence of the CD44 gene prevents sarcoma metastasis (Weber GF et al., 2002). Using Colo320 and WiDr cells and colon cancer tissues, Kuniyasu et al (2001) demonstrated that CD44v3 expression was associated with a more advanced pathological stage and poorer prognosis and plays an important role in invasion and metastasis by colorectal carcinoma cells (Kuniyasu H et al., 2001). The expression of CD44s and CD44v3-10 and association with CaP progression is investigated in primary CaP and metastatic CaP cell lines in Chatpter 3.

1.4.1.2.2 CD44 and cancer drug resistance

A correlation between the expression of MDR1 and CD44 has been found in breast cancer cell lines, which showed that the two proteins co-localized within the cell membrane (Miletti-Gonzalez KE et al., 2005). One protein directly influences the expression of the other and disruption of this interaction has profound effects on drug resistance, cell migration, and in vitro invasion (Miletti-Gonzalez KE et al., 2005). Previous studies 65 indicated that both HA and CD44 are involved in chemotherapeutic drug resistance in many cancer types (Cordo Russo RI et al., 2008, Misra S et al., 2005, Misra S et al., 2003, Ohashi R et al., 2007). Specifically, HA binding to CD44 is capable of stimulating MDR1 expression and drug resistance in breast tumour cells through ErbB2 PI3K/Akt-related survival pathways (Misra S et al., 2005). Bourguignon and colleagues have recently shown that HA-CD44 interaction activates the stem cell marker Nanog, Stat-3-mediated MDR1 gene expression, and ankyrin-regulated multi-drug efflux in breast and ovarian cancer cells (Bourguignon LY et al., 2008). They further confirmed that the interactions between HA/CD44-stimulated p300 (acetyltransferase) and resveratrol-activated SIRT1 (deacetylase) play pivotal roles in regulating the balance between cell survival versus apoptosis, and multidrug resistance versus sensitivity in breast tumour cells (Bourguignon LY et al., 2008). Ohashi et al (2007) reported that the interaction between CD44s and HA plays a pivotal role in acquired resistance to cisplatin in NSCLC and that MRP2 could be involved in this potential mechanism (Bourguignon LY et al., 2008). Takaishi et al (2009) demonstrated that the CD44+ gastric cancer cells showed the stem cell properties of self-renewal and the ability to form differentiated progeny and gave rise to CD44- cells. CD44 knock-down by shRNA resulted in much reduced spheroid colony formation and smaller tumour production in SCID mice, and the CD44- populations had significantly reduced tumourigenic ability in vitro and in vivo and CD44+ gastric cancer cells showed increased resistance for chemotherapy- or radiation-induced cell death (Takaishi S et al., 2009). Liu et al (2009) found that treatment with CD44 siRNA suppresses the HA-substratum-induced doxorubicin resistance and HA substratum induces MDR in placenta-derived human mesenchymal stem cells via CD44 signalling (Liu CM et al., 2009). Slomiany et al (2009) have recently shown that CD44 formed complexes with multidrug transporters, BCRP (breast cancer resistance protein) (ABCG2) and MDR1/Pgp (P-glycoprotein) (ABCB1), in the plasma membrane of human malignant peripheral nerve sheath tumour cells, and disrupting HA-CD44 interactions with small HA oligosaccharides could abrogate drug resistance in malignant peripheral nerve sheath tumours (Slomiany MG et al., 2009c). Xie et al (2008) demonstrated that inhibition of CD44 expression by CD44 antisense oligonucleotide (ASO) significantly induced apoptosis, decreased tumourigenesis and invasion, and increased chemosensitivity in HCC (Xie Z et al., 2008). Using drug-sensitive (M14 WT, MDR1-

66 negative) and drug-resistant (M14 ADR, MDR1-positive) human melanoma cells, Colone et al (2008) demonstrated that in MDR cells, CD44 and MDR1 co-localized in the plasma membrane as visualized by confocal microscopy and immune-electron microscopy on ultrathin cryosections. The Pgp (MDR1) molecule, after stimulation with specific antibodies, appeared to cooperate with CD44, through the activation of Erk1/2 and p38 MAPK proteins. A link was identified between MDR transporter Pgp, and MAPK signalling and invasion (Colone M et al., 2008). Lakshman et al (2004) reported that expression of variant CD44 isoforms (CD44s, CD44v3-10, CD44v8-10) which is characteristic of colon cancer confers a selective advantage to resist apoptosis, thereby promoting cell transformation into a malignant phenotype, in conjunction with other anti- apoptotic factors (Lakshman M et al., 2004).

1.4.1.3 The expression of CD44 in human CaP

The expression of CD44 and its variants is associated with the progression of several cancers, including CaP (De Marzo AM et al., 1998, Nagabhushan M et al., 1996, Noordzij MA et al., 1999, Noordzij MA et al., 1997). It was reported that the level of CD44 variants changes with the differentiation stage of prostate epithelial cells (see Figure 1-10) and the main isoforms that exist in prostate epithelial cells are CD44v3-10, CD44v6-10, CD44v8- 10, and CD44s (Alam TN et al., 2004). With the differentiation of prostate epithelial cells, the amount of lower molecular weight CD44 variant decrease while an increase in the proportion of higher molecular weight proteins was shown. The largest isoform was expressed most abundantly when the cells undergo further differentiation (Alam TN et al., 2004). The heavy form CD44v3-10 is associated with differentiated cells (Alam TN et al., 2004). In normal prostate, CD44 is expressed in most basal cells. In CaP, a variable CD44 expression has been reported in different studies. In one study of 109 cases, a complete lack of membranous expression of all CD44 isoforms was reported in 93–98% of primary tissues examined (Kallakury BV et al., 1996). However, another study investigating 74 CaP tissues reported moderate to high levels of CD44 expression in 60% of primary CaP with ~14% of metastases expressing low levels of CD44 (Nagabhushan M et al., 1996). Another 67 study reported significantly reduced CD44 expression in all 94 primary CaP foci and 48 metastases (De Marzo AM et al., 1998). The relationship between CD44 expression and tumour grade is also uncertain – one study showed a strong correlation between Gleason score and loss of CD44 expression (De Marzo AM et al., 1998), whereas another reported no correlation (Paradis V et al., 1998). Furthermore, although CD44 expression was reported to be reduced in metastases (De Marzo AM et al., 1998, Nagabhushan M et al., 1996, Noordzij MA et al., 1999), the CD44+ CaP cells were found to predominate in two visceral metastases (Liu AY et al., 1999). Similar to expression studies, the potential role of CD44 in CaP development and metastases is controversial - although some studies showed a tumour-suppressive function of CD44 in overexpression studies (Gao AC et al., 1997), many other studies implicated CD44 in CaP cell proliferation, adhesion, migration, and invasion in vitro as well as in metastatic dissemination in vivo (Draffin JE et al., 2004, Liu AY et al., 1999, Lokeshwar BL et al., 1995, Omara-Opyene AL et al., 2004, Paradis V et al., 1998). Noordzij et al (1997) reported CD44 expression was strongly reduced in CaP metastases as well as in the corresponding primary tumours (Noordzij MA et al., 1997). Harrison et al (2006) reported that non-invasive prostate epithelial cells expressed a high molecular weight CD44 isoform, CD44v3-10, which may counteract the standard isoform function of CD44s by reducing adhesion and invasion of endothelium by CaP cells through negation of the MMP14 function (Harrison GM et al., 2006). The role of CD44 in CaP metastasis is uncertain. The expression of CD44 in human CaP tissues and the role of CD44 in CaP progression from different research groups are summarized in Table 1-5. Tumour grade and metastasis may be related to other isoforms which were not tested. The considerable variability in CD44 expression reported in normal prostates, BPH and CaP tissues could be due to differences in methodology such as antibody specificity, processing of tissue samples and the complexity of the disease itself or inaccuracy due to the small sample size included in the earlier studies. In addition, the expression of CD44s and CD44v is regulated by tumour microenvironment during CaP progression and affected by many growth factors.

Table 1-5. Summary of CD44 expression in human CaP, CaP metastatic sites, BPH and normal prostates Cases Antibody Immunohistochemistry staining Correlation with CaP Reference Normal BPH CaP Metastasi progression s 109 CD44s A3D8 CD44s (H) CD44s CD44s (L) N Negatively correlated with (Kallakury CD44v3 3G5 V3 (H) (H) v3 (L) tumour grade BV et al., CD44v4/5 3D2 V4/5 (L) v3 (L) v4/5 (L) 1996) CD44v6 2F10 V6 (H) v4/5 v6 (L) CD44v7/8 VFF17 V7/8 (L) (L) v7/8 (L) CD44v10 VFF14 V10 (L) v6 (L) v10 (L) v7/8 (L) v10 (L) 64 CD44 GKW.A3 N/A N/A (H) (L) Negatively correlated with (Nagabhush Gleason score an M et al., 1996) 99 CD44s SFF-2 CD44s (H) N/A CD44s N Inversely related with (Noordzij CD44v5 VFF-8 CD44v6 (H) (H) Gleason score MA et al., CD44v6 VFF-7 CD44v5 (L) CD44v6 1997) (H) CD44v5 (L) 142 CD44s 3C5 CD44s (H) N/A CD44s CD44s (L) Inversely related with (De Marzo CD44v6 2F10 CD44v6 (H) (H) CD44v6 Gleason score AM et al., CD44v6 (L) 1998) (L) 109 Anti-sera CD44H N/A N/A (L ) N/A No relation with CaP (Paradis V CD44v6 progression et al., 1998)

Table 1-5. (Continued) Summary of CD44 expression in human CaP, CaP metastatic sites, BPH and normal prostates

Cases Antibody Immunohistochemistry staining Correlation with CaP Reference Normal BPH CaP Metastasi progression s 72 CD44H CD44 (H) N/A CD44H N/A CD44H, v6, v9 inversely (Takahashi CD44v3 v3 (H) (H) correlated with tumour S et al., CD44v4/5 v4/5 (L) v3 (L) grade 1998) CD44v6 v6 (H) v4/5 (L) CD44v7/8 v7/8 (L) v6 (L) CD44v9 v9 (M) v7/8 (L) CD44v10 v10 (H) v9 (H) v10 (L) 163 CD44 2C5 N/A N/A (H) N/A Lower expression in high (Lipponen P TMN and high Gleason et al., 2001) score 73 CD44v10 L N/A (H) N/A Increased in tumour, no (Omara- significant difference Opyene AL among Gleason grades. et al., 2004)

133 CD44 F10-44-2 N/A N/A H N/A N/A (Peehl DM et al., 2008) 73 Anti-CD44 N/A N/A L N/A Positively related with (Simon RA Gleason score et al., 2009) Notes: (H): high level expression; M: medium level expression; L: low level expression; N: No expression; N/A: not available.

The expression of CD44s and CD44v3-10 expression was shown in most metastatic CaP cell lines; CD44s expression was shown solely in the basal layer of the normal prostate gland and only low expression was seen in CaP tissues; CD44v3-10 was absent in normal prostate tissues but higher in CaP tissues (Hao J et al., 2010). These results support the concept that in the development of CaP, the CD44 isoform changes progressively from CD44s to the high molecular weight variant form (CD44v) (see Figure 1-10), while the CD44+ cells moved from the basal layer to the layer intermediately next to the basal layer. Cells are negative in the outermost luminal layer. These results indicate that the tumour microenvironment also plays an important role for the generation of CD44 variants. Therefore, CD44v3-10 expression could be an important indicator of the stage of differentiation of prostate epithelial cells (Alam TN et al., 2004).

Figure 1-10. Diagram illustrating putative expression of various markers, including CD44, during prostate basal cell differentiation and the development of CaP from tumour initiating cells.

1.4.1.4 CD44 and CaP cancer stem cells (CSCs)

The nature of the prostate stem cell is more difficult to define, and a prostate-specific stem cell marker has yet to be identified. CSCs within a tumour by definition possess the capacity for self-renewal and differentiation into the heterogeneous lineages of cancer cells that comprise a tumour (Clarke NW, 2006). Since normal adult prostate prostate-specific stem cells are AI, it is reasonable to suspect they may be the source of prostate CSCs. Because the putative prostate CSC does not express ARs, it is likely to be non-susceptible to most androgen-based therapies, and an inherent genetic instability would enable the tumour to develop the new variants present in castrate-resistant disease. CD44 is a marker of CSC (Dalerba P et al., 2007). The CaP stem/progenitor cells isolated from primary neoplasms express several prostatic stem cell-like markers including +/high CD133, CD44, integrin 2 1 , CK5/14, CK18, and/or CXCR4 but lack AR and PSA luminal marker expression (De Marzo AM et al., 1998, Litvinov IV et al., 2003, Rizzo S et al., 2005, Signoretti S et al., 2005, Wang S et al., 2003). Patrawala et al (2006) demonstrated that the CD44+ population displays enhanced proliferative activity in vitro and increased tumour-initiating and metastatic activity in vivo. These CD44+ cells are likewise AR– and express higher mRNA levels of several “stemness” genes, including OCT3/4, BMI1, β-CATENIN, and SMOOTHENED (Patrawala L et al., 2006). Hurt et al (2008) recently identified a rare subpopulation of CD44+CD24- CaP cells with stem-like characteristics such as increased clonogenic and tumourigenic properties. These CD44+CD24- cells form colonies in soft agar and formed tumours in non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mice when as few as 100 cells were injected. Furthermore, CD44+CD24- cells expressed genes known to be important in stem cell maintenance, such as BMI-1 and OCT-3/4 (Hurt EM et al., 2008). The poorly differentiated and tumourigenic AR- PC-3 cell line with intermediate phenotype (CK5/18), which contains a small subpopulation of CaP progenitor cells expressing stem cell-like markers (CD133+ and CD44high), can also form poorly differentiated tumours in vivo that resemble the original patient‟s tumour (Patrawala L et al., 2006, van Bokhoven A et al., 2003, Yang M et al., 1999). Similarly, it has been reported that the CaP cells constituting xenograft tumours established from LAPC9 or DU145 cells may be organized as a 72

+ +/high -/low functional hierarchy, where CD44 /integrin 2 1 or integrin 2 1 expressing cells displayed a higher tumourigenic potential than the CD44- cell fraction in nude mice (Patrawala L et al., 2006, Patrawala L et al., 2007, Tang DG et al., 2007). Additionally, the results from a recent study have revealed that the very small subpopulation of + + high - CD133 /CD44 / integrin 2 1 DU145 cells isolated from the parental AR DU145 cell mass, which express a high level of -catenin but a low level of apoptotic factor Bax, showed self-renewal, extensive differentiating, and proliferative abilities and a higher - + -/low tumourigenic potential relative to the CD133 /CD44 /integrin 2 1 DU145 cell fraction in vivo (Wei C et al., 2007). More specifically, a very small subpopulation of + + high - CD133 /CD44 /integrin 2 1 /AR CaP stem/progenitor cells, comprising about 0.1–3.0% of total CaP cells, has been identified and isolated from primary and metastatic CaPs (Brown MD et al., 2007, Collins AT et al., 2005). These cells were basal in phenotype and showed some evidence of the genomic instability required for an adaptable CSC. A recent study indicates that a CD133+/CD44+ population of cells enriched in CaP progenitors has tumour-initiating potential, that these progenitors can be expanded under non-adherent, serum-free, sphere-forming conditions, and that the PTEN/PI3K/Akt pathways are critical for the maintenance and viability of CaP stem-like cell populations (Dubrovska A et al., 2009). Bisson et al (2009) demonstrated that WNT signalling regulates self-renewal and differentiation of CaP cells with stem cell characteristics (CD44, ABCG2 and CD133) in LNCaP and C4-2B independently of AR activity (Bisson I et al., 2009). Genomic analysis of prostate CSCs isolated from a highly metastatic cell line (PC3- MM2) indicates that CD44 is one of highest markers except for CD133 and CD166 (Rowehl RA et al., 2008). Simon et al (2009) have recently found that CD44 is the first marker that shows a high degree of tissue/organ specificity for small cell neuroendocrine carcinomas (Simon RA et al., 2009). The lack of expression of prostate luminal differentiation markers AR and PSA in prostatic small cell neuroendocrine carcinomas suggest that the tumour cells may retain cancer stem cell features (Simon RA et al., 2009). The same research group further provided strong evidence that CD44, a marker that has been shown to be associated with increased tumourigenic potential in CaP cell line and xenograft tumours, was expressed selectively in neuroendocrine cells of human CaP (Palapattu GS et al., 2009). Using both primary and established CaP cell lines, Klarmann et 73 al (2009) showed that a subpopulation of CD44+ CSC-like cells invaded matrigel through an EMT, while in contrast, CD44- cells were non-invasive. Furthermore, the genomic profile of the invasive cells closely resembled that of CD44+CD24- prostate CSCs and showed evidence for increased Hedgehog signalling (Klarmann GJ et al., 2009). The relationship of CD44 with prostate CSCs is summarized in Table 1-6. Table 1-6. CD44 and subpopulations of putative CaP stem cells (PCSCs) with androgen receptor negative cells

Potential markers Original classification References CD133+/CD44+/integrin Stem-like characteristics and basal (Yang M et al., 1999, Collins +/high 2 1 phenotype AT et al., 2005, Collins AT et (human CaP tissue study) al., 2006) CD44+/integrin Stem-like characteristics (Patrawala L et al., 2006) +/high 2 1 (CaP cell line study) CD44+ Expression on most basal cells and (Tang DG et al., 2007) prostate stem/progenitor cells CD44+, CD133+, Minor tumour initiating cell (Rowehl RA et al., 2008) CD166+ population (CaP cell lines) CD44+CD24- Stem-like characteristics (Hurt EM et al., 2008, (CaP cell line study) Klarmann GJ et al., 2009) CD133+/CD44+ Tumour progenitors with tumour (Dubrovska A et al., 2009) initiating potential (human CaP and CaP cell line study) CD44+, ABCG2+ and Stem cell associated characteristics (Bisson I et al., 2009) CD133+ (CaP cell lines) CD44+ CD44 neuroendocrine tumour cells (Palapattu GS et al., 2009, (human CaP and CaP cell lines) Simon RA et al., 2009)

1.4.1.5 CD44 in future CaP therapy

Over-expression of CD44 in cancer cells provides an opportunity for targeting CD44 to control cancer progression. Most anti-CD44 therapies are targeting CD44 with anti-CD44 antibodies or HA. Even though CD44 is expressed in normal epithelial cells, and HA is part of the matrix of normal tissues, selective targeting of cancer is possible. Marangoni et al (2009) reported that antibody-mediated CD44-targeting in human breast cancer xenografts significantly reduced tumour growth. This effect was associated to the 74 induction of growth-inhibiting factors; treatment with ant-CD44 MAb prevented tumour relapse after chemotherapy-induced remission in a basal-like breast cancer xenografts (Marangoni E et al., 2009). Using siRNA CD44 gene therapy, Subramaniam et al (2007) demonstrated that siRNA targeting a discrete sequence of human CD44 could regress HT 29 colon cancer cells in vitro and suppress tumour growth in xenografts in a nude mouse model (Subramaniam V et al., 2007). Anti-CD44 antibody-drug conjugates can target drugs to CD44 that is overexpressed on various tumours (Naor D et al., 2002). Anti-CD44 antibody drug conjugates have shown promise during clinical development (see Table 1-7). However, CD44 is endogenously expressed at low levels in healthy tissues (Mackay CR et al., 1994); because of this expression, side effects can still occur. The main toxicity of bivatuzumab mertansine (a combination of bivatuzumab, a humanized anti-CD44v6 monoclonal antibody, and mertansine, a cytotoxic agent) was directed against the skin (Sauter A et al., 2007, Tijink BM et al., 2006).

Table 1-7. Clinical trials of antibody anti-CD44 conjugates Antibody Cancer Effect References conjugates U36 -186Re* Head and neck squamous cell Myelotoxicity was detected, and a limiting dose (Dalerba P et al., carcinoma was determined 2007) Bivatuzumab -186Re Head and neck squamous cell Tumour specific suppression was demonstrated, (Borjesson PK et carcinoma dose limiting myelotoxicity is observed al., 2003) Bivatuzumab -186Re Breast cancer in early stage Unfavorable tumour-non tumour ratio, limited (Koppe M et al., usage in early stage breast cancer 2004) Bivatuzumab -186Re Head and neck squamous cell Good specificity of drug to tumourous tissue, (Postema EJ et carcinoma less toxic to normal organs al., 2003) Bivatuzumab- CD44v6 positive metastatic Stabilize 50% of disease. No immunogenic (Rupp U et al., mertansine breast cancer response. 2007)

Bivatuzumab- Head and neck squamous cell Low clearance time, low inter-individual (Sauter A et al., mertansine carcinoma variability, no immune response 2007) Bivatuzumab- Head and neck squamous or Skin toxicity was detected due to CD44 (Tijink BM et mertansine esophagus cell carcinoma expression, low inter-individual variability al., 2006) Note: U36 is a chimeric anti-CD44v6 MA

1.4.2 CD147

1.4.2.1 The structure of CD147

CD147 (Basigin, EMMPRIN, TCSF, M6, OK, 5A11, gp42, neurothelin) is a membrane protein highly enriched on many human epithelial cancer cells. It is an evolutionary conserved and a highly glycosylated member of the immunoglobulin (Ig) superfamily of proteins that is particularly rich in complex N-Glycans (Biswas C et al., 1995, Tang W et al., 2004a). CD147 is composed of two extracellular Ig domains, a single transmembrane domain and a short cytoplasmic domain (Guo H et al., 1998, Miyauchi T et al., 1991, Muramatsu T et al., 2003) (Figure 1-11). The first Ig domain in the N-terminal is required for counter receptor activity (Sun J et al., 2001), involved in MMP induction (Yoshida S et al., 2000) and oligomerization. Peptides derived from the second 20 amino acids of this domain could block CD147 activity possibly by interfering with CD147 oligomerization (Nabeshima K et al., 2004). The second Ig domain is required for association with caveolin-1, which leads to decreased self-association on the cell surface (Tang W et al., 2004b). There are three Asn glycosylation sites located in the two extracelluar Ig regions (Figure 1-11), two within the proximal IgG domain and one within the distal IgG domain, thus resulting in variable proteins with different molecular weights, depending on the degree of glycosylation. It was reported that CD147 itself may act as a counterpart receptor on the surface of fibroblast cells, indicating that CD147 also participates in heterotypic and homotypic cell-cell adhesion through homophilic interactions (Sun J et al., 2001). The transmembrane and cytoplasmic domains of CD147 are well conserved among species, suggesting a critical role of these regions. The existance of a single charged glutamic acid residue in the transmembrane domain supports the possibility of its association with various membrance bound proteins (Muramatsu T et al., 2003). The cytoplasmic domain is believed to be involved in transduction of celluar signals and is associated with MCT1(Nabeshima K et al., 2006). Several studies have shown that the expression and functional activities of CD147 are associated with and regulated by other important molecules, MCTs (MCT1 and MCT4) 77

(Kirk P et al., 2000), and cyclophilins (CypA, CypB, and Cyp60) (Pushkarsky T et al., 2005, Pushkarsky T et al., 2001, Yurchenko V et al., 2001). It has also been reported that CD147 stimulates the production of VEGF and HA, leading to angiogenesis and MDR (Misra S et al., 2003, Tang Y et al., 2005). It has widely been accepted that CD147 is a multifunctional transmembrane protein mediating molecular events that are crucial to many biological circumstances. However, the molecular mechanisms and structural basis whereby CD147 modulates numerous phenomena are still unclear.

Figure 1-11. The structure of the domains of CD147 and the link with cancer. ECD: extracellular domain; CD: cytoplasmic domain; TD: transmembrane domain.

1.4.2.2 The function of CD147 in cancer

CD147 is thought to be involved in inflammation, neural-glial interaction and virus infection (Fadool JM et al., 1993, Kaname T et al., 1993, Muramatsu T et al., 2003), as well as in various physiological functions including embryo implantation, spermatogenesis (Igakura T et al., 1998), retinal function (Hori K et al., 2000) and odour physiology (Igakura T et al., 1996). It also plays multiple roles in cancer invasion. The main aspects of CD147 in cancer development are summarized in the following subsections.

1.4.2.2.1 CD147 and tumour angiogenesis

Angiogenesis, the development of new blood vessels, is a fundamental physiological process that promotes embryonic development, tissue repair and fertility, yet also promotes chronic inflammation, tumour growth and tumour metastasis (Carmeliet P, 2005). The process of angiogenesis, which is critically important in cancer progression, is mediated by a multitude of pro- and anti-angiogenic factors. CD147 is one stimulator of angiogenesis in CaP metastasis (Li Y et al., 2010). CD147 has been shown to promote neovascularization through the expression of VEGF in murine models of breast cancer (Tang Y et al., 2005, Zucker S et al., 2001). Tang et al reported that CD147 could stimulate the production of MMPs in tumour stroma. The increased MMP activity in tumour local environment results in proteolytic cleavage of membrane-associated CD147, releasing soluble CD147 (Tang Y et al., 2004). This soluble CD147 in turn acts in a paracrine fashion on stromal cells (both adjacent and distant to tumour sites). It further stimulates the production of MMPs and additional CD147, which consequently contributes to tumour angiogenesis, tumour growth, and metastasis (Tang Y et al., 2004). In a subsequent study, they further demonstrated that CD147 regulates VEGF production via the PI3K/Akt pathway but not via the MAPK, JUN, or p38 kinase pathways in MDA-MB-231 breast cancer cells and in an in vivo animal model (Tang Y et al., 2005). Silencing CD147 resulted in a significant reduction of MMP2 and VEGF in pancreatic satellite cells (Zhang W et al., 2007). In gastric carcinoma, CD147 was found to be negatively linked to favorable prognosis, positively correlated with VEGF, MMP2, MMP9, tumour size, depth of invasion, lymphatic invasion, but not with lymph node invasion (Zheng HC et al., 2006). Millimaggi et al demonstrated that transfection of CD147 cDNA into the ovarian cancer cell line CABA I enabled CABA I-derived vesicles to induce angiogenesis and to promote MMP gene expression in HUVECs, suggesting that vesicles shed by ovarian cancer cells may induce proangiogenic activities of human umbilical vein endothelial cells via a CD147-mediated mechanism (Millimaggi D et al., 2007). These results indicate that CD147 plays an important role in cancer angiogenesis.

1.4.2.2.2 CD147 and tumour invasion and metastasis

Although the exact mechanisms by which CD147 promotes tumour growth are unclear (Rosenthal EL et al., 2006, Tang Y et al., 2005, Zhang W et al., 2006), it has been well established that CD147 modulates the tumour microenvironment by stimulating MMP1, MMP2, and MMP3 production from stromal tissues (Braundmeier AG et al., 2006, Caudroy S et al., 2002, Dalberg K et al., 2000). Secreted and transmembrane MMPs are important in ECM remodeling and play a major role in tumour invasion and metastasis, including roles in angiogenesis, inflammation, apoptosis, cell-surface protein-shedding, release and activation of ECM-sequestered growth factors such as transforming growth factor-beta and FGF-2 and signal transduction (Overall CM et al., 2006). Tumour cell anchorage-independent growth (anoikis), a characteristic of malignant cancer cells that is critical for metastatic spread, can also be potentiated by CD147 (Li QQ et al., 2007, Yang JM et al., 2006). CD147 was shown to induce the synthesis of MMPs from stromal and tumour cells from breast cancer, and has an important function in tumour metastasis in an in vivo mouse breast cancer model (Zucker S et al., 2001). Wang et al (2006), using RNA interference (RNAi), have shown that inhibition of CD147 expression reduces tumour cell invasion in a human CaP cell line (Wang L et al., 2006). Li et al (2006) reported Cyclophilin A was overexpressed in human pancreatic cancer cells and stimulated cell proliferation through interactions with CD147 involving activation of Erk1/2 and p38 MAPKs (Li M et al., 2006). Quemener et al (2007) demonstrated that CD147 up-regulates the urokinase-type plasminogen activator system (uPA, uPAR, PAI1), promoting tumour cell invasion in a tumourigenic breast epithelial cell line (NS2T2A) (Quemener C et al., 2007). Elevated CD147 expression in tumours of the oral cavity has been correlated with lymphatic metastasis and tumour progression (Bordador LC et al., 2000). Du et al demonstrated that Cav-1 and CD147 were over-expressed in 49.48% and 59.39% of nasopharyngeal carcinomas, respectively; that both Cav-1 and CD147 expression levels correlated significantly with metastasis and a lower five-year survival rate; that Cav-1 and CD147 over-expression predict poor nasopharyngeal carcinoma prognosis and enhance tumour cell migration, which is associated with MMP3 and MMP11 (active) secretion (Du 80

ZM et al., 2009). Reimers et al (2004) demonstrated that CD147 was expressed on approximately 90% of micrometastatic breast cancer cells in BM (Reimers N et al., 2004). Ju et al (2008) reported expression of CD147 was associated with slower reduction of cervical tumours following brachytherapy; increased CD147 expression after brachytherapy seemed to be an important predictor of poor survival as supported by the fact that expression of CD147 conferred resistance to radiotherapy (Ju XZ et al., 2008). Hanata et al (2007) demonstrated that soluble CD147 stimulated the migration of HEp-2 human laryngeal carcinoma cells, accompanied by increased MMP2 production in fibroblasts (Hanata K et al., 2007). Ishibashi et al (2004) reported that CD147 and MMP2 protein expression is significant prognostic factors in esophageal squamous cell carcinoma (Ishibashi Y et al., 2004). However, Sillanpaa et al reported that CD147 and MMP2 in cancer cells are significant indicators of a favorable prognosis of epithelial ovarian cancer (Sillanpaa S et al., 2007). CD147 was found to be involved in tumour progression in many types of cancers, including bladder cancer (Als AB et al., 2007), breast cancer (Reimers N et al., 2004), HCC (Tsai WC et al., 2006), CaP (Zhong WD et al., 2008, Als AB et al., 2007, Han ZD et al., 2009, Zhong WD et al., 2012), lymphoma (Nabeshima K et al., 2004), gastric carcinoma (Zheng HC et al., 2006), pancreatic neoplasm (Zheng HC et al., 2006) and lung cancer (Sienel W et al., 2008). It was reported as an independent indicator of patient survival in lung cancer (Sienel W et al., 2008). Using TMAs, our laboratory demonstrated co-localization of CD147 with MMP1, MMP2 and MMP9 in high grades of CaP and over- expression of CD147 is correlated significantly with progression parameters including pretreatment PSA level, Gleason score, pathological stage, nodal involvement and surgical margin (Madigan MC et al., 2008). These results are consistent with the involvement of CD147 in cancer metastasis and progression. The role of CD147 in CaP is further explored in Chapter 3. In Chapter 3, the role of CD147 in CaP progression and metastasis is further explored using primary CaP and metastatic cell lines.

1.4.2.2.3 CD147 and drug resistance

Drug resistance is the main cause of treatment failure and mortality in cancer patients. CD147 expression has been reported to be upregulated in MDR cancer cells (Yang JM et al., 2003) and it can stimulated the production of HA in mammary carcinoma cells leading to an induction of MDR in a HA-dependent manner (Misra S et al., 2003, Toole BP, 2004). Yang et al (2003) demonstrated that the expression of CD147 is responsible for the increased activity of MMPs in MDR cell lines during the development of MDR (Yang JM et al., 2003). In a follow up study, they further confirmed that treatment of MDR breast cancers with MDR1 substrates could adversely affect therapeutic outcomes through modulating the production of CD147, MMP2, MMP9 and EGFR (Li QQ et al., 2007). It was reported that CD147 conferred resistance of breast cancer cells to anoikis through inhibition of Bim and this effect was mediated at least in part by a MAPK dependent reduction of Bim (Yang JM et al., 2006). Zou et al (2007) reported that inhibition of CD147 gene expression via RNAi could reduce tumour cell invasion, tumourigenicity and increase chemosensitivity to paclitaxel in HO-8910pm ovarian cancer cells (Zou W et al., 2007). Yang et al (2007) demonstrated that MDR1/Pgp and CD147/CD98hc complex were both found highly expressed on cisplatin resistant ovarian cancer cell line (SKOV3/DDP), but only slightly expressed on its parent cell line (SKOV3), and RNAi targeting CD98hc or CD147 reduced both the target gene and

MDR1 expression as well as the cisplatin IC50 (dose of 50% of cell survival) of the drug- resistant tumour cells (Yang H et al., 2007). Kuang et al (2008) documented an abundance of molecules that interact with CD147 in the MDR of human oral squamous carcinoma cells using proteomics (Kuang YH et al., 2008) and they have further shown that targeting CD147 with siRNA induced apoptosis of MDR cancer cells related to X-linked inhibitor of apoptosis protein (XIAP) depletion (Kuang YH et al., 2009). Jia et al (2009) reported that silencing CD147 using an RNAi approach inhibited tumour progression and increased chemosensitivity in murine lymphoid neoplasm P388D1 cells (Jia L et al., 2009). Thus, CD147 represents a potent target for both tumour metastatic behavior and drug resistance. The potential for CD147 as a target protein important drug resistance and tumour spread is

82 further investigated in Chapters 4 and 5 using knock-down of CD147 in CaP cell lines and in vivo models of CaP. Although progress has been made in investigating the roles of CD147 in cancer drug resistance, the mechanism(s) underlying the effects of CD147 on MDR remains unclear. Studies in our laboratory have indicated co-localization of CD147 with MDR1 and MRP2 in prostate and ovarian cancer cell lines, as well as in primary and metastatic tissues (Chen H et al., 2010, Hao J et al., 2010). This suggests that CD147 has a close link with MDR in these cancers. The result from CaP study is shown in Chapter 3. The functional link between CD147 and MDR in CaP has been further investigated as part of this thesis in Chapters 4 and 5.

1.4.2.2.4 CD147 and MCTs

CD147 interacts with and regulates cell surface expression and function of tumour cell MCTs. This is significant, as lactate produced by glycolysis in hypoxic tumour regions is transported to the extracellular microenvironment by MCTs. An acidic tumour microenvironment is integral to the development of MDR and enhanced cell invasion which are hallmarks of metastatic disease. Tumour cell invasion and development of MDR are associated with hypoxia and low tumour pH. Several studies show a direct relationship between increased cancer cell glucose uptake, glycolysis and tumour aggressiveness (McCarty MF et al., 2010, Pinheiro C et al., 2012). MCT activity is fundamental to the glycolytic phenotype that characterizes most malignant cancers, wherein glycolysis is increased even in the presence of oxygen: the so- called “Warburg effect”. Increased glycolysis in cancers is associated with various conditions, such as hypoxia, acidosis, and mitochondrial defects, which result in enhanced drug resistance and malignancy (Gatenby RA et al., 2004, Koukourakis MI et al., 2006, Pelicano H et al., 2006, Tredan O et al., 2007). An outcome of increased glycolysis is the production of lactate, which must be pumped across the plasma membrane via the proton- coupled MCTs to avoid cytotoxic intracellular accumulation of lactate. Lactate efflux at the leading edge of tumour cells acidifies the surrounding microenvironment, which can enhance cell invasion (Martinez-Zaguilan R et al., 1996), metastasis (Schlappack OK et al., 83

1991), and drug resistance (Tredan O et al., 2007). Non-invasive spectroscopy imaging for hyperpolarized lactate also shows elevated lactate for high grade CaP in a transgenic mouse model, compared to normal prostate (Albers MJ et al., 2008). Metastatic cancer cells increase glucose consumption and metabolism via glycolysis, producing large quantities of lactate (Gatenby RA et al., 2007). Recent work has shown that lactate efflux is mediated by a combination of a catalytic unit (MCT) and an accessory subunit (CD147) (Gallagher SM et al., 2007). At least 14 members of the MCT family have been cloned and are distinguished by their kinetic properties and tissue distribution (Enerson BE et al., 2003). MCT1, MCT3, and MCT4 require association with CD147 in the ER for trafficking to the plasma membrane. Recent studies have shown that MCT1 and MCT4 are heteromeric transporters composed of a catalytic α-subunit and an accessory β- subunit (Kirk P et al., 2000). MCT1 and MCT4 require association with CD147 in the ER for trafficking to the plasma membrane (Deora AA et al., 2005, Gallagher SM et al., 2007, Wilson MC et al., 2005). In the absence of CD147, MCTs are targeted for degradation. MCT1 is the most widely expressed member of this family and is elevated in a variety of cancers, including neuroblastoma (Fang J et al., 2006), high-grade gliomas (Froberg MK et al., 2001), and colorectal carcinomas (Koukourakis MI et al., 2006). MCT4 is expressed preferentially in tissues that require high levels of glycolysis. Recently, MCT4 was shown to be co-localized with CD147 in the plasma membrane of metastatic MDA-MB231 breast cancer cells, wherein trafficking of these two proteins to the plasma membrane is mutually interdependent. Moreover, suppressed expression of MCT4 resulted in decreased migratory capacity in these cells, most likely due to the inhibition of CD147 function (Gallagher SM et al., 2007). Slomiany et al (2009) have recently demonstrated that HA, CD44, and CD147 contribute to the regulation of MCT localization and function in the plasma membrane of breast carcinoma cells (Slomiany MG et al., 2009c). RNAi of CD147 results in an inhibition of lactate efflux ability of breast cancer cells and the tranportation of MCT to plasma membrane (Slomiany MG et al., 2009c). Schneiderhan et al (2009) further confirmed that CD147 silencing inhibits lactate transport and reduces malignant potential of pancreatic cancer cells in in-vitro and in-vivo models (Schneiderhan W et al., 2009). Su et al (2009) demonstrated that highly-expressed CD147 interacts with MCT1 and MCT4 to promote

84 tumour cell glycolysis, resulting in the progression of malignant melanoma (MM) and silencing of CD147/basigin in A375 cells by a siRNA inhibits the proliferation, invasiveness, and VEGF production of human malignant melanoma cells by down- regulating glycolysis (Su J et al., 2009). Baba et al (2008) reported that in LoVo cells, CD147 and MCT1 co-localized on the cell surface, and MEM-M6/1 (anti-CD147 MAb) inhibited the association of these molecules, suppressed lactate uptake, lactate release, and reduced intracellular pH. Blocking CD147 induces cell death in cancer cells through the impairment of glycolytic energy metabolism (Baba M et al., 2008).

1.4.2.2.5 CD147 in cancer diagnosis

Mamori et al (2007) reported that the degree of staining of CD147 was significantly higher in tumour tissues than non-tumour tissues, even in tumours less than 15 mm in diameter, and CD147 is useful for pathological diagnosis of early HCC in needle biopsy samples (Mamori S et al., 2007). Newman et al (2008) have demonstrated systemically administered fluorescently labeled anti-CD147 antibody can detect head and neck squamous cell carcinoma xenografts in vivo (cell line FaDu overexpressing CD147) (Newman JR et al., 2008). This approach is promising to detect CaP micrometastases and residual metastatic disease after RP. Tsai et al (2006) have shown higher CD147 immunostaining scores in HCC, which correlated significantly with tumour grading and TNM stages, thus CD147 was considered a novel biomarker for the diagnosis and treatment of HCC (Tsai WC et al., 2006). CD147 is the most frequently expressed protein in primary CaP and in micrometastases (Klein CA et al., 2002). It was reported that CD147 is overexpressed in most of metastatic CaP cell lines, with the exception of DuCaP (Madigan MC et al., 2008).

1.4.2.3 CD147 in human CaP

Over-expression of CD147 has been found in CaP cell lines (Madigan MC et al., 2008, Wang L et al., 2006). In 11 metastatic CaP cell lines, expression of CD147 with the exception of DuCaP cells has been demonstrated (Liu AY et al., 2000, Madigan MC et al., 85

2008). By siRNA transfection, PC-3 cells displayed a reduced invasion ability and decreased expression of MMP2 and MMP9 (Wang L et al., 2006). Transcriptome analysis and comparative genomic hybridization of individual tumour cells isolated from BM of CaP patients showed that CD147 is the most frequently expressed protein in primary tumours and in micrometastases (Klein CA et al., 2002). High levels of CD147 were reported in numerous malignancies, including CaP (Madigan MC et al., 2008), and are associated with CaP progression (Reimers N et al., 2004). CD147 and MMPs are considered significant prognostic factors in human CaP (Zhong WD et al., 2008). The expression of CD147 correlated significantly with clinicopathological factors such as TNM grade, depth of prostatic wall invasion, Gleason score and histologic grade (Han ZD et al., 2009). Patients with a strong expression of CD147 had a poor prognosis and a low survival rate (Han ZD et al., 2009). In another study, CD147 expression was found to be correlated with MMP1, MMP2, MMP9 and the co-expression of CD147 and MMP2 was associated with the lowest survival, TNM and Gleason score (Zhong WD et al., 2008). Results from our research team add to this and show that in TMAs including 120 primary CaPs and 20 lymph node metastases, CD147 was detected in 65% of CaP and correlated with progression parameters such as pre-treatment PSA levels and increased with progression of CaP (Madigan MC et al., 2008). These results suggest that CD147 plays an important role in CaP metastasis. The expression of CD147 on human CaP tissues is summarized in Table 1-8. A TMA approach is used in Chapter 3 to investigate the expression of CD147 and its relationship to CaP metastasis by comparing its expression in BPH, primary CaP (Gleason score < or ≥ grade 7) and metastatic CaP.

Table 1-8. Summary of CD147 expression in CaP, BPH and normal prostate Cases Antibody Immunohistochemistry Correlation Reference staining* with CaP Normal BPH Cancer progression 69 Anti-CD147 N/A N/A Mediu Y (Riethdorf S antibody MEM- m et al., 2006) M6/1 and HUM6 (MAb) 92 Anti- N/A Low High Y (Han ZD et HAb18G/CD147 al., 2009) antibody, No. CGMCC0426 (MAb) 101 Anti- No N/A High Y (Zhong WD HAb18G/CD147 et al., 2008) antibody, No. CGMCC0426 (MAb) 155 Anti-CD147 Low Low High Y (Madigan antibody (PAb) MC et al., 2008) 99 Anti- N/A N/A Mediu Y (Han ZD et CD147/EMMPRI m al., 2009) N antibody (MAb)

Notes: *Staining intensity: High: >60%; Medium: 40-60%; Low: <40%; No: no expression in this trial, the number of normal sample was not statistically available. MAb: monoclonal antibody; PAb: polyclonal antibody; N/A: not available; Y: yes.

1.4.2.4 CD147 in future CaP therapy

Targeting CD147 could provide a useful tool in controlling metastasis and cancer recurrence, with a potential application to CaP. In vitro studies have shown that knock- down of CD147 expression with siRNA in PC-3 CaP cells decreased invasiveness and reduced MMP2 and MMP9 secretion (Wang L et al., 2006). Xu and colleagues showed that CD147 and the CD147 antibody could regulate MMP production (Xu J et al., 2007b). 131 Blocking HAb18G/CD147 in HCC cells with I-labeled HAb18D F(ab‟)2 (LICARTIN) antibody effectively inhibited HCC growth in vitro and in an orthotopic nude mouse model 87

(Xu J et al., 2007b). Recently, using a mouse model of head and neck cancer, Dean et al. demonstrated that treatment with anti-CD147 MAb delayed tumour growth compared with untreated controls, and treatment with a combination of radiation and anti-CD147 MAb resulted in a further reduction in tumour growth (Dean NR et al., 2009). Furthermore, radiation-treated CD147 knock-down xenografts showed a reduction in tumour growth compared with untreated knock-down controls, whereas radiation-treated CD147 expressing xenografts did not show a delay in tumour growth (Dean et al, 2009). These data suggest that anti-CD147 antibody inhibits tumour cell proliferation in vivo and may represent a novel targeted cancer treatment option in the future. CaP bone-metastases are currently the biggest challenge for CaP therapy. BM micrometastases of CaP patients have been found to express CD147 (Klein CA et al., 2002) and our research team also observed that CaP cell lines derived from human bony metastases (PC-3, PC-3M, PC-3MM2) were strongly positive for CD147 (Madigan MC et al., 2008). These data suggest that targeting CD147 may be useful in addressing the major problem of bony metastases in patients with late stage micrometastatic CaP. Minimal residual disease after RP is difficult to detect clinically. CD147-targeted treatment to control micrometastatic CaP or minimal residual disease could be achieved using tools such as low- or non-glycosylated forms of CD147, CD147 activity-blocking peptides or radiolabeled or toxin-conjugated anti-CD147 antibody, or antisense expression constructs or siRNA constructs for CD147. Moreover, targeting CD147 may provide additive or synergistic treatment benefits if used in combination with conventional chemotherapy such as DTX or radiation, in particular in CRPC. MMPs are an important contributor to the degradation of ECM in prostate, other tumours, and in tumour invasion. However, the clinical trials targeting MMPs failed, mainly because of the side effects of the treatment (Nabeshima K et al., 2006). In such a scenario, targeting via CD147 may offer a solution, which can result in the reduction of overproduction of MMPs before they were synthesized. Given that CD147 is also a potent inducer of angiogenesis, uPA and HA, as well has a role in the assembly of MCTs, targeting via CD147 may constitute an important strategy for future CaP treatment. In clinical trials, CD147 MAb has already been applied in graft-vs-host disease to target CD147 on activated T lymphocytes (Deeg HJ et al., 2001, Macmillan ML et al., 2007) and

88 hematoma (Chen ZN et al., 2006, Xu J et al., 2007a). In a clinical study, combined CD147 immunotherapy and radiotherapy with (131I) metuximab (Licartin), a MAb targeting CD147 was very effective for HCC. In Phase I and Phase II clinical trials, the antibodies were highly restricted to the targeted tumour site and no life threatening toxic effects were observed. The survival rate of progression free patients was significantly higher than those patients with progressive disease after one or two cycles. In another trial, Licartin was used for the prevention of the recurrence of hepatoma after liver transplantation. Sixty post transplantation patients were included in the study. The recurrence rate was reduced by 30.4% and survival rate was increased by 20.6%, and no Licartin related toxic effect was detected. Since CD147 protein is widely expressed and is important for the maintenance of certain functions in normal tissues, the route of drug delivery is crucial for minimising drug-related toxicity. Systematic administration of CD147- antibody directed targeting therapy may impose a risk of damage to the CD147 positive cells in normal organs. In these situations, local arterial intubation resembles a better choice for the drug delivery, especially if higher expression CD147 marks tumour cells from non-tumour cells in the organ locally. However, a personalized screening for the expression of this marker would need to be established prior to treatment. To study and optimize the delivery of Licartin (a commercial CD147 antibody drug), it was given by hepatic artery intubation in hepatocellular carcinoma patients, and the results showed a well-accumulated drug concentration in the targeted tumour and no drug-related toxicity (Zhang Z et al., 2006). Using artery intubation, the drug is concentrated in the cancerous area and selectively targets CD147 positive cells which are predominantly tumour cells (Zhang Q et al., 2007). Novel targeted gene therapy also provides potential to overcome toxicity arising from collateral damage of normal cells. By applying a tissue-specific delivery system, the oncogene can be silenced by stably expressed shRNA, causing minimal toxicity (Misra S et al., 2009). Related techniques are still being developed and awaiting validation in clinical trials. There are very few studies, either preclinical or clinical, employing this crucial molecule (CD147) for CaP therapy, but these results support the application of Licartin in CaP preclinical studies and clinical trials in the future.

1.5 Modeling CaP

1.5.1 Non-mouse in vivo CaP models

Among all animal models, a canine model is considered to most closely resemble human CaP. Similar to humans, dogs develop CaP spontaneously in their old age and with bone metastasis. In a dietary study, no prostate carcinoma was found in various zoo mammals except dogs (Coffey DS, 2001). The canine prostate gland shares common characteristics with humans, but its prostate tumour is more aggressive and does not respond to the ADT (Leroy BE et al., 2009). However it is not practical to use dogs for CaP research related to the high cost and difficulties for experimental manipulations. In addition to dogs, rats also develop spontaneous CaP. Available models include Dunning, ACI, Copenhagen, and Lobund-Wistar rats (Banerjee PP et al., 2001, Isaacs JT et al., 1978, Pollard M, 1998, Bosland MC, 1992). Because the spontaneous tumours in the rats are slow-developing, relatively lower in incidence and have a longer latency period, the use of rat models are also limited in CaP research.

1.5.2 Xenograft mouse models in CaP

Transplant mouse models are popular in CaP research, although naturally mice do not develop spontaneous CaP (Shappell SB et al., 2004). Currently the established, immortalized CaP cell lines for research are mainly derived from metastatic tumours. As CaP cells from cell lines may have already lost the characteristics of a primary tumour, difficulties are present in the extrapolation of research data to clinic situations. However it is encouraging that the use of primary cultures is growing with the advent of techniques and commercial availability (Peehl DM, 2005). As the recipient of foreign cell lines, tissue, or primary culture, the host mice have to be immune-deficient. The incompetence of generating immunological responses is a key requirement for xenograft models. However, this represents a major defect for an animal model as it bypasses the normal immune processes that occur during tumour development.

The present popular mouse hosts include: nude mice, SCID mice, NOD-SCID mice, NOD/NSG (NOD SCID gamma) mice, and RAG (recombination-activating gene) mice. Choice of host to be used is dependent on the requirement of the completeness of immune- deficiency. The number of xenograft models is potentially unlimited due to the multitude of the combination of the types of cells and grafting site. There are pros and cons of different implantation sites for CaP: 1) s.c. CaP animal model: Implantation in the flank or shoulder of the mouse is currently the most common xenograft site used. The advantage is the ease of implantation and contingency of monitoring. For the cell lines which are less tumourigenic, matrigel is co- injected to improve tumour take rate. Although the s.c. model is not considered to be as accurate as an orthotopic model for the context of tumour development (Fidler IJ, 1990), similar sites of metastasis have been reported in both s.c. and orthotopic models (Thalmann GN et al., 1994, Scatena CD et al., 2004). 2) Orthotopic CaP animal model: Orthotopic implantation is considered as an ideal xenograft for mimicking CaP growth and modeling tumour microenvironment influence. It is challenging in terms of surgical techniques and post-surgical monitoring. Monitoring is generally done by the assessment of PSA level or the tumour weight at the end of experiment or local regional lymph node metastasis. Encouragingly, the advent of imaging programs permit better monitoring quality of tumour xenografts (Fidler IJ, 1990). Orthotopic CaP xenografts do not spontaneously spread to bone except for a few cases with modified CaP cell lines (Thalmann GN et al., 1994, Davies MR et al., 2003). Thus much effort has been spent to generate an efficient osseous metastasis model. 3) CaP bone metastasis model: Currently the following implantation models have been utilized for the study of bone metastasis: a) intracardiac (i.c.) or intravenous injection; b) intratibial injection; c) direct bone injections; and d) SCID-hu model. Spontaneous bone metastasis is rare in mice but can be derived experimentally. Although orthotopic implantation best mimics metastasis, the disadvantage is that the metastasis incidence is low and appear in the very late stage (Rosol TJ et al., 2004). Intracadiac injection can induce bone metastasis in vivo, this technique typically results in early detectable metastasis and it supports the investigation of the interactions between tumour and bone microenvironment (Yoneda T et al., 1999, Zhang J et al., 2001). Interestingly, in the SCID-

91 hu model, by grafting human fetal bone prior to i.v. implantation of CaP cells, the metastases are specifically directed to the implanted bone tissue rather than lung, intestine or bone from the mouse (Nemeth JA et al., 1999). Therefore this model might be potentially valuable for studying the tumour-bone interactions-one of the most critical points of bone metastases.

1.5.3 Non-invasive imaging in CaP models

To gain a better understanding of tumourigenesis and metastasis and improve the ability to interfere with the disease progression, it is crucial to reveal the cellular and organic changes in vivo. Therefore the introduction of a well designed tracking system is acknowledged as important in the intact animal. Bioluminescence imaging (BLI) is a current method employed in monitoring disease progression in small animals. By labeling a constitutively expressing optical reporter gene (firefly luciferase gene) to the tumour cells before xenotransplant, it allows non-invasive monitoring of the growth and migration of these tumour cells using a photon detection instrument. CaP xenograft models are among the first models demonstrating exciting BLI results (El Hilali N et al., 2002, Iyer M et al., 2001). Another study has reported success in tracking luciferase-linked gene therapy in CaP (Adams JY et al., 2002), providing promise for using BLI monitoring in therapeutic and diagnostic strategies, and this has been investigated in Chapter 5 as part of studies developing an i.c. model for CaP metastases.

1.6 Thesis Aims

Targeting tumour-associated antigens is fast emerging as an area of promise to treat late stage and recurrent CaP. A better understanding of protein function on the basic cellular level in CaP tumour cell populations could provide potential therapeutic targets for cancer therapy. As discussed in the literature review (Sections 1.4.1 and 1.4.2) both CD44 and CD147 are multifunctional proteins associated with cancer progression, with a wide spectrum of interactions with other molecules. Their functions permit tumour-self promotion and tumour-microenvironment interactions. Since CD44 and CD147 represent 92 co-operative players in CaP progression, investigating their roles in the context of each other, as well as other molecules (such as MDR-related proteins and MCTs may provide better understanding for developing novel combination therapies for CaP. As such, the studies in this thesis aimed to: 1) Investigate the expression of CD44 and CD147 in primary CaP tissues and various metastatic CaP cell lines (Chapter 3); 2) Identify whether CD44 and CD147 are related with CaP progression, whether they are related with MDR proteins, and whether these two proteins are inter-related (Chapter 3); 3) Use shRNA to develop CaP cell lines with down-regulated CD44 and CD147 expression, and study the in vitro functions of these molecules, and some of the potential mechanisms involved in regulating their expression (Chapter 4); 4) Develop CaP animal models using CD44/CD147-knock-down (KD) xenografts, and investigate the roles of CD44 and CD147 in vivo with respect to tumour growth, metastasis, and drug resistance. These studies primarily used s.c. xenografts (Chapter 5). Preliminary work for a PC-3M-luc i.c. model for CaP bone metastases was also developed. The CaP i.c. model was assessed in vivo using BLI techniques (Chapter 5).

Chapter 2 – General materials and methods

2.1 Ethical approval

Ethical approval for using primary tissues from patients was obtained from the South East Area Health Human Research Ethics Committee-Southern Section. All animal experiments were approved by the Animal Care and Ethics Committee (ACEC), University of New South Wales (UNSW).

2.2 Materials

2.2.1 Preparation of media and buffers

All water used in this project to prepare media and buffers was deionised and filtered using the LiquiPureTM water system (ModulabTM Analytical, Australia). Dulbecco‟s phosphate buffered saline (DPBS) was prepared according to manufacturer‟s instructions (Invitrogen Australia Pty Ltd, VIC, Australia), followed by autoclaving and storage at 4 C. Dulbecco‟s modified eagles medium (DMEM) and Rosewell Park Memorial Institute

(RPMI-1640) medium (Invitrogen, Australia) with 3.7 g NaHCO3 (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia), were prepared according to manufacturer‟s instructions (Invitrogen Australia Pty Ltd, VIC, Australia), filtered using a peristaltic pump and Filtrpur 0.2 µm filter (Sarstedt, Germany), then stored at 4 ℃ for use. 10 x TBS (tris buffer saline) stock was prepared as follows: 30.2 g Tris was dissolved in 500 mL Milli Q water, pH was adjusted to 7.6 with concentrated HCl, and buffer stored at 4 C. Cell freezing media consisted of 20% (v/v) fetal bovine serum (FBS) and 20% dimethyl sulfoxide (DMSO) (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia) and was prepared in the appropriate media for each cell line using an aseptic technique.

2.2.2 Antibodies

Antibodies were obtained from different sources and the detailed information and conditions for all antibodies are listed in Table 2-1. Table 2-1. Antibodies used for western blot (WB), immunofluorescence (IF) staining, immunohistochemistry (IHC) and immunoprecipitation (IP) Incubation time and Antibody Source Type Dilution temperature Application Mouse anti-human CD44 (DF1485) Santa Cruz 1:200 (WB, o/n at 4℃ or 1 WB, IF, IP, antibody Biotechnology MAb IF, IHC) h at RT IHC Goat anti-human CD44var(v3-v10) Enzo Life 1:100 (WB, o/n at 4℃ or 1 antibody Sciences, Inc. PAb IHC, IF) h at RT WB, IF, IHC 1:400 (WB) Rabbit anti-human 1:200 (IF, o/n at 4℃ or 1 WB, IF, IP, CD147 antibody Invitrogen PAb IHC) h at RT IHC Rabbit anti-human Santa Cruz 1:400 (WB, o/n at 4℃ or 1 MCT-1 antibody Biotechnology PAb IF, IHC) h at RT WB, IF, IHC Rabbit anti-human Santa Cruz 1:400 (WB, o/n at 4℃ or 1 MCT-4 antibody Biotechnology PAb IF, IHC) h at RT WB, IF, IHC Mouse anti-human Sigma- MDR-1 antibody Aldrich MAb 1:400 (WB) o/n at 4℃ WB Rabbit anti-human Santa Cruz 1: 500 (IF, o/n at 4℃ or 1 MDR-1 antibody Biotechnology PAb IHC) h at RT IF, IHC Mouse anti-human Enzo Life 1:100 (WB) MRP-2 antibody Sciences, Inc. PAb 1:50 (IF) o/n at 4℃ WB, IF Rabbit anti-human Cell phospho-Merlin Signalling 1:1000 (Ser518) antibody Technology PAb (WB) o/n at 4℃ WB Rabbit anti-human Akt1/2/3 (H-136) Santa Cruz antibody Biotechnology PAb 1:200 (WB) o/n at 4℃ WB Cell Rabbit anti-human Signalling Phospho-Akt antibody Technology PAb 1:500 (WB) o/n at 4℃ WB Rabbit anti-human phosphor-Erk1 (pT202/pY204)/Erk2 (pT185/pY187) Epitomics, antibody Inc. PAb 1:500 (WB) o/n at 4℃ WB

Table 2-1. (Continued) Antibodies used for western blot (WB), immunofluorescence (IF) staining, immunohistochemistry (IHC) and immunoprecipitation (IP) Incubation time Antibody Source Type Dilution and temperature Application Rabbit anti-human phosphor-Erk1 (pT202/pY204)/Erk2 (pT185/pY187) 1:500 antibody Epitomics, Inc. PAb (WB) o/n at 4℃ WB Rat anti-mouse CD31(PECAM1) BD 1: 100 antibody Pharmingen MAb (IHC) o/n at 4℃ IHC Rabbit anti-human Zymed 1:50 Ki67 antibody Laboratories PAb (IHC) o/n at 4℃ IHC Rabbit anti-human caspase-3 (active) 1:100 antibody Epitomics, Inc. PAb (IHC) o/n at 4℃ IHC Mouse anti-human β- 1:10000 tubulin Sigma-Aldrich MAb (WB) o/n at 4℃ WB Swine anti-goat, mouse, rabbit immunoglobulins, biotinlyated, Multi- 1:150 Link Dako Pty. Ltd. PAb (IHC) 45 min at RT IHC Rabbit anti-rat immunoglobulins, 1:400 biotinlyated Dako Pty. Ltd. PAb (IHC) 45 min at RT IHC Goat anti-rabbit IgG- Santa Cruz 1:5000 HRP Biotechnology PAb (WB) 45 min at RT WB Goat anti-mouse IgG- Santa Cruz 1:5000 HRP Biotechnology PAb (WB) 45 min at RT WB Donkey anti-goat IgG- Santa Cruz 1:5000 HRP Biotechnology PAb (WB) 45 min at RT WB Mouse anti-human 1:1000 o/n at 4℃ or 1 h IgG1-negative control Dako MAb (IF) at RT IF Rabbit anti-human 1:1000 o/n at 4℃ or 1 h IgG-negative control Dako PAb (IF) at RT IF Goat anti-mouse Alexa Fluor® 488 Dye 1:1000 Conjugate Invitrogen PAb (IF) 45 min at RT IF Goat anti-rabbit Alexa Fluor® 488 Dye 1:1000 Conjugate Invitrogen PAb (IF) 45 min at RT IF Notes: HRP: horseradish peroxidase; IF: immunofluorescence; IHC: immunohistochemistry; IP: immunoprecipitation; MAb: monoclonal antibody; o/n: overnight; PAb: polyclonal antibody; RT: room temperature; WB: western blotting.

2.2.3 Cell lines.

In the current studies, androgen responsive and androgen non-responsive CaP metastasis cell lines derived from different origins were obtained. CD44 and CD147 knock-down cell lines (PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD) were generated by transducing PC-3M-luc-C6 cells with CD44 and CD147 targeting shRNA particles, respectively. PC- 3M-luc-scr cell line was generated by transducing PC-3M-luc-C6 cells with a scrambled sequence control shRNA for off-target effects. Detailed information of CaP cell lines is listed in Table 2-2.

2.2.4 Short-hairpin RNA (shRNA)

A set of five MISSION® lentiviral transduction particles encoding for shRNAs against CD44 (NM_000610) or CD147 (NM_001728) genes and MISSION® non-target shRNA control transduction particles were purchased and stored at -80 C (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia). Sequences of CD44 and CD147 shRNA are shown in Table 2-3. The sequence of the shRNA control plasmid DNA is shown in Appendix 1.

Table 2-2. Characteristics of metastatic CaP cell lines Androgen Cell Line Site of origin Source responsiveness* Culture media Hallym University, Seoul, DuCaP Dura mater (human) Korea R DMEM LNCaP- LN3 Lymph node (mouse) MD , Austin Texas, R RPMI-1640 plus F12K (1:1) DU145 Brain (human) ATCC N RPMI-1640 PC-3 Bone (human) ATCC-CRL-1435 N RPMI-1640 RX-DT2R PC-3 subline ( drug resistant) Developed by our group N RPMI-1640 PC-3 subline (mouse liver PC-3M-luc-metastases following intrasplenic C6 implantation of PC-3) Xenogen Corp, USA N RPMI-1640 PC-3 subline (mouse liver PC-3M-luc-metastases following intrasplenic Developed by the thesis RPMI-1640 plus puromycin (1 scr implantation of PC-3) (Chapter 4) N mg/mL) PC-3 subline (mouse liver PC-3M-luc-metastases following intrasplenic Developed by the thesis RPMI-1640 plus puromycin (1 CD44-KD implantation of PC-3) (Chapter 4) N mg/mL) PC-3 subline (mouse liver PC-3M-luc-metastases following intrasplenic Developed by the thesis RPMI-1640 plus puromycin (1 CD147-KD implantation of PC-3) (Chapter 4) N mg/mL) Notes: KD: knock-down; N: androgen non-responsive, R: androgen responsive

Table 2-3. Sequences of CD44 and CD147 shRNA lentiviral transduction particles A 5'-CCGGCCAACTCTAATGTCAATCGTTCTCGAGAACGA CD44 TTGACATTAGAGTTGGTTTTTG -3' shRNA B 5'-CCGGGCCCTATTAGTGATTTCCAAACTCGAGTTTGGA lentiviral AATCACTAATAGGGCTTTTTG -3' transduction C 5'-CCGGCCTCCCAGTATGACACATATTCTCGAGAATATG particles TGTCATACTGGGAGGTTTTTG -3' D 5'-CCGGCGCTATGTCCAGAAAGGAGAACTCGAGTTCTC CTTTCTGGACATAGCGTTTTTG -3' E 5'-CCGGCGGAAGTGCTACTTCAGACAACTCGAGTTGTC TGAAGTAGCACTTCCGTTTTTG -3' A 5'-CCGGCCAGAATGACAAAGGCAAGAACTCGAGTTCT CD147 TGCCTTTGTCATTCTGGTTTTT -3' shRNA B 5'-CCGGCCCATCATACACTTCCTTCTTCTCGAGAAGAA lentiviral GGAAGTGTATGATGGGTTTTT -3' transduction C 5'-CCGGGCTACACATTGAGAACCTGAACTCGAGTTCAG particles GTTCTCAATGTGTAGCTTTTT -3' D 5'-CCGGACAGTCTTCACTACCGTAGAACTCGAGTTCTA CGGTAGTGAAGACTGTTTTTT -3' E 5'-CCGGGAAGTCGTCAGAACACATCAACTCGAGTTGAT GTGTTCTGACGACTTCTTTTT -3'

2.3 Methods

2.3.1 Cell culture

After thawing frozen cells in a waterbath (Labec, NSW, Australia), the cells were centrifuged in 5 mL RPMI-1640 with 10% heat-inactivated FBS at 180 g for 5 min. After discarding the supernatants, cells pellets were resuspended with fresh media and then transferred to an appropriate flask. All CaP cell lines used in this study were cultured in RPMI-1640 or DMEM, supplemented with 10% (vol/vol) heated-inactivated FBS, 50 U/mL of penicillin, and 50 U/mL of streptomycin. PC-3M-luc-scr (scrambled shRNA control), PC-3M-luc-CD44-KD, PC-3M-luc-CD147-KD cells were grown in the same medium supplemented with additional 1µg/mL puromycin for screening. All cell lines were maintained in a humidified incubator at 37°C and 5% CO2. Subconfluent cells grown for 48 h were harvested as follows-after gently rinsing the flasks twice with DPBS, cells were detached with 0.25% trypsin-EDTA at 37°C for 5 minutes. The cells were collected and centrifuged at 180 g for 5 min at room temperature (RT), followed by resuspension in the appropriate buffers or media. All tissue culture supplements were from Invitrogen Australia Pty Ltd (Melbourne, VIC, Australia), unless otherwise stated. 100

2.3.2 Cell viability

Haemocytometer counting using 0.4% trypan blue was used to assess cell viability. Based on the principle that cell membranes of non-viable cells will not exclude vital dyes, cells with blue cytoplasm represent non-viable cells, and cells with clear cytoplasm represent live or viable cells. Briefly, adherent cells were trypsinized and detached from the flask, pelleted with centrifugation (180 g for 5 min) and resuspended in tissue culture media. Counts of both live cells and dead cells were made, and the percentage viability was calculated. Cell density was calculated (Avg. No. of cells x dilution x104 cells/mL).

2.3.3 Cell preservation/cell thrawing

Subconfluent cells were harvested, pelleted by centrifugation and counted using a haemocytometer and trypan blue. Cells were resuspended in freezing medium to create a suspension of approximately 1 x 106 cells/mL. Following pipetting, the cell suspension was aliquoted in 1 mL pre-labelled cryo-vials. The vials were then immediately transferred to the Nalgene® Cryo 1°C Freezing Container (Thermo Scientific, MA, USA) which allows a -1°C/minute cooling rate required for successful cell cryopreservation and recovery. The Nalgene® Cryo 1°C Freezing Container was then placed in the -80 °C freezer for at least 48 h before the vials were transferred to the liquid nitrogen tank for long-term storage. Recovery of cells involved removing vials from the liquid nitrogen, thawing at 37°C in a waterbath (< 1 min) then resuspending cells in 5 mL complete media, and centrifuging at 180 g for 5 min. After removing the supernatant, the cell pellet was resuspended and added into appropriate media, and cultured for at least 48 h before any experiments.

2.3.4 Paraffin sections

Paraffin sections were used to investigate the expression of markers in human CaP tissues and animal xenograft tissues. Paraffin blocks were prepared as follows. Briefly, fresh tissues from patients or animal tumour xenografts or other relevant animal organs 101 were fixed in 10% neutral buffered formalin for 24-48 h at RT. Following rinsing in PBS and dehydration through alcohols and xylene, the tissue was immersed in 3 changes of paraffin and finally embedded in a paraffin block on a warm platform. Paraffin sections were cut at 5-8 µm thick, flattened on a waterbath at 40 °C, then collected onto Superfrost slides. After drying overnight, one slide was used for hematoxylin and eosin (H&E) staining to examine tissue histology while other slides were stored at RT for future use. For bone tissues, after fixation in 10% neutral buffered formalin for 24-48 h at RT, the limbs were removed from most of the muscle tissue and transferred to a sterile decalcification solution [10% EDTA (ethylenediaminetetraacetic acid) and 0.5% paraformaldehyde in PBS (pH 8.0)] for 2 wks, with the solution changed every 2nd day. Bone samples were then paraffin embedded for sectioning as described above.

2.3.5 Cryosections

Cryosections were needed to investigate CD31 and CD44 expression in mouse tumour xenografts. After the fresh tissue was removed from the animals, it was placed in cold PBS to remove any blood, excess PBS was absorbed off and the tissue was placed in a mold filled with Tissue-Tek® OCT™ compound (Sakura Finetek, South Holland, Netherlands). The mold was then immersed in dry ice or liquid nitrogen briefly until the tissue/OCT was frozen. The frozen blocks were stored at -20°C prior to sectioning. Frozen sections were cut at 5-10 µm thick, collected onto slides and dried at RT till adhered firmly. After drying, one slide was used for H&E staining to identify tissue histology; the remaining slides were stored at -20 C for future use.

2.3.6 Immunofluorescence confocal microscopy analysis of CaP cell lines and CaP tissues

To examine for the expression of markers in CaP cell lines, cells were grown on glass coverslips for 48 h prior to immunolabelling. Sub-confluent cells were fixed with 100% methanol for 5-10 min and then rinsed in TBS (pH 7.6). To examine for co-localization of various molecules in CaP tissues, paraffin sections were deparaffinized in xylenes, followed by a graded series of ethanol (100, 95%, 75% and 50%) and re-hydration in

102

TBS. Slides were immersed in 0.01 M citrate buffer (pH 6.0) for 20 min at 100°C to enhance antigen retrieval, and rinsed in TBS. For all immunofluorescence experiments, coverslips or slides were blocked in 10% serum from the species the secondary antibody was raised in. Cells or sections were then incubated o/n at 4°C in primary antibodies. After washing with TBS, CaP cells or sections were incubated in Alexa-Fluor conjugated secondary antibodies for 1 h at RT, and rinsed in TBS. Negative controls were treated identically, but using non-specific immunoglobulins (mouse, goat or rabbit Ig) or with primary antibody omitted. Sections were examined using an FV300/FV500 Olympus laser scanning confocal microscope (Olympus, Tokyo, Japan). Multichannel excitation bleedthrough was minimized by using fluorochromes separated in peak excitation (488 nm and 594 nm respectively). Multitracking and sequential image capture was used to correct signal emission crosstalk between neighbouring channels, and the images were combined.

2.3.7 Immunohistochemistry

To examine expression of various molecular markers in human CaP tissues and mouse xenograft tissues, paraffin sections were deparaffinized in xylenes, followed by a graded series of ethanol (100%, 95%, 75% and 50%) and re-hydration in TBS. Slides were immersed in 0.01 M citrate buffer (pH 6.0) for 20 min at 100°C to enhance antigen retrieval, rinsed in TBS, and then treated with 3% hydrogen peroxide, and rinsed in TBS. After blocking in 10% serum of the species the secondary antibody was raised in, sections were incubated o/n at 4°C in primary antibodies. Some molecular markers only worked on frozen sections (i.e. CD31 and CD44 in animal xenograft tissues), and for these, cryosections were fixed with ice-cold acetone for 10 min at RT, followed by rinsing in TBS. After washing in TBS, the sections (paraffin or cyosections) were incubated with biotinylated secondary antibodies for 45 min at RT, rinsed in TBS and then incubated in streptavidin/HRP for 30 min at RT. After rinsing in TBS, immunoreactivity was developed with 3,3‟ diaminobenzidine (DAB) substrate and counterstained with hematoxylin. Negative controls were treated identically but incubated in control PAbs (non-specific Ig) or the primary antibody was omitted.

103

2.3.8 Assessment of immunostaining results

Staining intensity (Grade 0-3) was assessed for immunostaining results in human CaP cell lines, TMA tissue, whole primary and metastatic CaP tissues and animal tumour xenografts using light microscopy (Leica microscope, Nussloch, Germany) and confocal microscopy. The criteria for assessment were as follows: 0 (negative, <25%); 1+ (weak, 25–50%); 2+ (moderate, 50–70%); 3+ (strong, >75%) of the tumour cells stained as a previously published method (Cozzi et al, 2005). For TMA staining, three cores were scored per case. The analysis of 3 cores per case has been shown to be comparable with the analysis of the whole section in a recent study (Rubin MA et al., 2002). Where all 3 cores from the one tumour were positive (3/3), the reading was counted as positive. Where heterogeneous staining was seen among the three cores, an average score was determined. Evaluation of tissue staining was performed independently by three experienced observers (JLH, YL, JB). All specimens were scored blind and an average of grades was taken. For statistical analysis, CaP patients from RP cases were divided into 2 groups: the low-expression group (LEG), comprising Grade 0 and 1 immunostaining, and the high- expression (over-expression) group (HEG), comprising Grade 2 and 3 immunostaining.

2.3.9 Protein extraction

Adherent cells were washed with PBS for 2 times and then lysed in a buffer containing 50 mmol/L Tris-HCl (pH 8.0), 150 mmol/L NaCl, 0.1% SDS, 10 mmol/L NaF, 1 mmol/L Na3VO4, 0.5% sodium deoxycholate, 1% Triton X-100, and 1/12 (v/v) protease inhibitor cocktail (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia). After a brief incubation for about 5 min on ice, the lysates were collected and centrifuged at 17950 g for 10 min at 4˚C and the supernatants were collected and stored at -80˚C.

104

2.3.10 Protein quantification

A BCA assay kit (Thermo Scientific, USA) was used to quantify protein concentrations following the manufacturer‟s instructions. The optical density (OD) was measured with a BIO-TEC micro-plate reader (BIO-RAD, Hercules, CA, USA).

2.3.11 Western blot analysis

Protein expression levels were semi-quantified using western blotting analysis. Equal amounts of total protein were loaded and separated by NuPAGE® 4-12% Bis-Tris gel (Invitrogen Australia Pty Ltd, Australia) electrophoresis at 200V for 50 min and then transferred to a polyvinyl difluoride (PVDF) membrane in NuPAGE® transfer buffer at 30 V for 1.5 h. The membrane was blotted with 5% skim milk in PBS/0.05% Tween 20 buffer. Blots were hybridized with specific antibodies at appropriate concentrations o/n at 4˚C (Table 2-2). After washing 3×10 min in PBS/0.05% Tween 20 buffer, the blots were then incubated for another 1 h with a HRP-conjugated IgG secondary antibody (Santa Cruz, CA, USA). After washing 3×10 min in PBS/0.05% Tween 20 buffer, immunoreactive bands were detected using enhanced chemiluminescence (ECL) western blotting substrate (SuperSignal West pico Substrate, Thermo Scientific, USA), and imaged using the ImageQuant LAS4000 system (GE Health care, USA). To confirm equal loading of protein lysates, membranes were stripped (Restore Western Blot Stripping Buffer, Thermo Scientific, USA) and re-probed using β-tubulin antibody (Sigma-Aldrich Pty Ltd, Australia), then processed as above. The protein bands on films were scanned and processed in Adobe Photoshop.

2.3.12 MTT assay

MTT [3-(4,5-dimethylthlthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] assay was performed to examine the responsiveness to the chemotherapy drug, DTX, in CaP cell lines. CaP cells were seeded in triplicate in 96-well plates at 5000 cells/well and incubated for 24 h. A range of concentrations of DTX (Sigma-Aldrich, St Louis, MO, USA) diluted in 100% ethanol were added to cells. Control cells were treated with appropriate volumes of ethanol. The final concentration of ethanol is 0.01% in all 105 treated wells. After 48 h, 20 uL of MTT (5 mg/mL) (Sigma-Aldrich Pty Ltd, Castle Hill,

NSW, Australia) was added to each well, followed by incubation at 37 C/5% CO2 for 4 h. Subsequently, 100 L of DMSO (Sigma-Aldrich Pty Ltd, Castle Hill, NSW, Australia) was added and the plate was shaken for 20 min at RT to dissolve the formazan crystals. The OD was read at a wavelength of 562 nm on a BIO-TEC micro- plate reader (BIO-RAD, Hercules, CA, USA). Each experiment was repeated at least 3 times. Results represent the OD ratio of the treated and untreated cells. The growth inhibition curve and IC50 was generated using the GraphPad Prism 4 Program (GraphPad, San Diego, CA, USA).

2.3.13 shRNA transfection

To permanently reduce the expression of CD44 and CD147 in CaP cell line (PC-3M-luc) with high level expression of these two markers, shRNA was used to knock down their expression. A set of five MISSION® lentiviral transduction particles encoding for shRNAs against target genes and MISSION® non-target shRNA scrambled control (scr) transduction particles were used (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia) (Table 2.3 and Appendix 1). Briefly, 2 x 104 CaP cells were cultured in 24 well plates and transduced with all five clones of lentiviral particles or the same amount of non- target shRNA scr control transduction particles following the manufacturer‟s protocol (multiplicity of infection=2, viral transducing units/cell). The transduced clones were selected in puromycin-containing (0.5 µg/mL) (Invivogen, CA, USA) cell culture medium, propagated and finally transferred to the regular cell culture flasks and maintained in medium containing 1.0 µg/mL puromycin for the following experiments.

2.3.14 Colony forming assays

Colony formation assays provide a more appropriate measure of the long-term effects of potential therapeutic agents, assessing the ability of cells to retain proliferative potential after treatment, a characteristic that clinically facilitates tumour recurrences in patients. In the current studies, the colony forming ability of cells with variable expression of CD44 and CD147, with and without DTX was assessed. Briefly, CaP cells (1500 cells/dish) were seeded in 10 cm dishes for 48 h at 37 C, 5% CO2 and then treated with 106

DTX or the same volume of vehicle control (the final concentration of ethanol was 0.1‰). After 3 days treatment, the DTX-containing media was replaced with fresh media and all cultures were incubated for an additional 7 days until colonies were large enough to be clearly discerned. The colonies were stained with filtered 0.5% crystal violet for 20 min, followed by washing with tap water and drying o/n. The colonies, defined as groups of >50 cells, were counted manually with the aid of an Olympus INT- 2 inverted microscope (Tokyo, Japan). The average number of colonies were plotted [mean ± standard deviation (SD), n=3].

2.3.15 Matrigel invasion assay

The invasive ability of CaP cell lines was determined using commercial matrigel and control transwell chambers (BD Bioscience, NSW, Australia). Briefly, 2 x 104 CaP cells in 500 µL serum-free medium were added to each transwell insert and 750 µL complete medium was added to the outer well to provide chemoattractant and prevent dehydration.

Cells were incubated at 37°C in 5% CO2 for 24 h and then stained with a Diff-Quik staining kit (Allegiance Healthcare Corp, McGraw Park, Illinois, USA). Excess dye was washed away with tap water and the number of stained cells that invaded through matrigel and control inserts was counted in five high power fields (hpf) by light microscopy (Leica microscope, Nussloch, Germany). The invasive potential was calculated as follows: % Invasion = [(Mean cells invading through matrigel insert membrane) / (Mean cells migrating through control insert membrane)] x 100%. Cell invasion rates were plotted, with mean and SD (n=3).

2.3.16 Determination of DTX dose for chemotherapy

Male, 6-8 wks old Balb/c nude mice (Animal Resources Centre, Western Australia) were housed under specific pathogen-free conditions in facilities approved by ACEC, UNSW. Mice were kept at least 1 wk before experimental manipulation. To study the toxicity and determine the dose of DTX for chemotherapy in the following studies, 0 (vehicle only), 10, 15, 20, 25, 30 mg/kg of DTX were administered i.p. once per wk for three wks in non-tumour bearing mice. For each dosage, a group of 5 mice were administered and examined twice per wk for signs of toxicity, such as weight loss. After

107

3 wks treatment, 200 µL of blood were collected from the tails of live mice for haematology testing. After 13 wks, all mice were sacrificed and spleens, kidneys, hearts, and livers were removed for histology analysis. The highest dosage that did not cause systematic toxicity was chosen for the chemotherapy in the following studies.

2.3.17 Development of s.c CaP xenograft model and DTX chemotherapy

Male, 6-8 wks old Balb/c nude mice (Animal Resources Centre, Western Australia) were housed and maintained in laminar flow cabinets under specific pathogen-free conditions in facilities approved by the UNSW ACEC. Mice were kept for at least 1 wk before experimental manipulation. All mice remained healthy and active during the experiment. Cultured CaP cells (1.5 x 106/injection) in 100 µL DPBS were implanted s.c. in the right rear flank region of mice. Tumour progression was documented weekly by measurements using a caliper, and tumour volumes were calculated as follows: length x width x height x 0.52 (in millimetres) (Gleave M et al., 1991) for up to 8 wks. Upon sacrifice, primary tumours and local regional lymph nodes were removed for histological examination. After establishing s.c. models with CaP cell lines, when average tumour size reached 30±10 cm3 in each subgroup, half of the mice were treated with 25 mg/kg DTX-(the dose based on the results from the toxicity study) continuously for 3 wks by i.p. injection, and the remaining mice were treated with vehicle control. Tumour growth was calculated by measurements using a caliper as previously published (Gleave M et al., 1991).

2.3.18 Development of i.c CaP model

The same criteria were applied as for the s.c. model, male, 6-8 wks old Balb/c nude mice (Animal Resources Centre, Western Australia) were housed and maintained in laminar flow cabinets under specific pathogen-free conditions in facilities approved by the UNSW ACEC. Mice were kept for at least 1 wk before experimental manipulation. Mice were anesthetised with isoflurane by inhalation, and then stabilized on the bench by gently applying a piece of sticky tape on the abdomen. 3 x 106 cells in DPBS were injected into the left ventricle of the mouse. Successful injections were confirmed by blood pulsing in the syringe prior to injection. Tumour progression and metastases

108 formation were monitored with BLI for 5 wks. Upon sacrifice, mice were imaged with BLI and all luminescent positive organs were preserved for future analysis.

2.3.19 In vitro and in vivo monitoring of bioluminescence using BLI

For in vitro bioluminescence assay, luciferease positive cells were seeded in duplicate in 100 μL of culture medium on 96 well plates at serial dilutions: 104, 0.5 x 104, 0.25 x 104, 0.125 x 104, 6.25 x 103, 3.125 x 103, 1.625 x 103, 8.125 x 102, 4.062 x 102, 2.031 x 102, and 1.016 x 102. Two wells were filled with 100 μL of culture medium only as negative control. After incubating for 5 h at 37 C and 5% CO2, the medium was replaced with D- luciferin (Xenogen, CA, USA) containing medium (150 μg/mL). Bioluminescence images were taken 3 min after adding the substrate into the cells using Xenogen IVIS Lumina (Xenogen, CA, USA). For the in vivo bioluminescence assay, D-luciferin was injected i.p. at 150 μg/kg 10 min before the imaging. Biolumunescence was quantified using Living Image software (Xenogen, CA, USA). The total flux in photons/second (p/s) within each defined region of interest was regarded as a representative of tumour size.

2.3.20 TUNEL assay for apoptotic cells in vivo.

Apoptosis was assessed on tumour xenograft tissues using the TUNEL method with the TdT-fragEL in situ apoptotic detection kit (Calbiochem, San Diego, CA, USA) according to the manufacturer‟s instructions. Briefly, paraffin sections of tumour xenografts were deparaffinized in xylenes as described for immunohistochemistry, washed in TBS and then incubated with 20 mg/mL Proteinase K in 10 mM Tris–HCl, pH 7.4 for 5 min at RT. Following rinsing in TBS, endogenous peroxidase was quenched in 3% hydrogen peroxide for 5 min. After rinsing in TBS, slides were incubated with terminal deoxynucleotidyl transferase Equilibration Buffer for 30 min at RT and then incubated with 100 µL of the TUNEL reaction mixture for 1.5 h at 37 C in a humidified atmosphere. Following rinsing in TBS, slides were incubated with 100 µL stop solution at RT for 5 min, pre-diluted 1:50 in blocking buffer and incubated for a further 30 min at RT. After rinsing in TBS, the slides were incubated with 1 mg/mL DAB substrate and incubated for 10-15 min at RT. Slides were subsequently washed,

109 counterstained with methylgreen counterstain solution and mounted. The specificity of TUNEL reactivity was confirmed with appropriate negative (TdT omitted from the labeling mix) and positive (treated HL-60 slides provided by the company) controls. Slides were examined using a Leica light microscope (Nussloch, Germany).

2.3.21 Statistical analysis

All numerical data were expressed as the average of the values obtained, and the SD was calculated. The associations between protein expression levels and clinicopathological data were tested using a Chi-squared test. Data from different groups were compared using the two-tail student‟s t test. All P values were 2-sided. One way ANOVA, followed by the Dunnett‟s post hoc test was performed to determine the significance of differences between the growth curves in s.c. model of tumour volume changes. P<0.05 was considered significant. All statistical analyses were performed using the GraphPad Prism 4.00 package (GraphPad, San Diego CA, USA).

110

Chapter 3 – Expression of CD44 and CD147 in CaP and their clinical significance

The work in this Chapter has been published in:

Hao JL, Chen HM, Madigan MC, Cozzi PJ, Beretov J, Xiao W, Delprado WJ, Russell PJ, Li Y. Co-expression of CD147 (EMMPRIN), CD44v3-10, MDR1 and monocarboxylate transporters (MCTs) is related with prostate cancer drug resistance and progression. Br J Cancer 2010;103:1008-1018

111

3.1 Introduction

CaP remains the most common cancer and the second leading cause of death from cancer in males in the United States (Jemal A et al., 2009) as well as in Australia (AIHW, 2010). Although early-stage CaP can be controlled using conventional therapies, MDR and tumour metastasis remain the main causes of treatment failure and mortality in CaP patients. The majority of deaths in CaP result from progression to AI disease (Valdespino V et al., 2007a). For AI CaP, chemotherapy is the standard treatment option for palliation of symptoms associated with the disease. However, the drug-resistant nature of CaP minimizes therapeutic efficacy, and consequently, most patients die within 12 months. The relationship between tumour metastasis and MDR is not fully defined in CaP, although indirect evidence in advanced disease suggests a functional link between these processes. CD44 is a multifunctional protein involved in cell adhesion, migration and drug resistance. Alternative splicing of the CD44 gene produces many CD44v, some of which form the invariant extracellular domain of CD44s. CD44s is expressed in the majority of normal basal prostate cells; however, CD44v expression is reported in CaP (Harrison GM et al., 2006). The role of CD44s and CD44v in CaP development and progression is different, with studies showing both tumour-inhibiting (CD44s) and tumour-promoting (CD44v) effects (Gao AC et al., 1998, Omara-Opyene AL et al., 2004). Clearly the involvement of CD44 and its variants in CaP progression and metastasis is complex. CD147 is a multifunctional glycoprotein that can modify the tumour microenvironment by activating proteinases, inducing angiogenic factors in both tumour and stromal cells, and regulating growth and survival of anchorage-independent tumour cells (micrometastases) and MDR protein expression (Yan L et al., 2005). CD147 is highly expressed on the surface of various tumours, including CaP, and is associated with cancer progression (Riethdorf S et al., 2006). Transcriptome analysis and comparative genomic hybridisation of individual tumour cells isolated from the bone marrow of patients with CaP have shown that CD147 is the most frequently expressed protein in primary tumours and micrometastases (Klein CA et al., 2002). Moreover, CD147 expression is considered a significant prognostic factor in human CaP (Zhong WD et al., 2008). Results from our research team showed that high-level CD147 expression is significantly correlated with CaP progression to high-grade

112 disease, and is associated with the expression of MMPs in both tumour and stromal cells, including fibroblasts and endothelial cells (Madigan MC et al., 2008). The studies in this chapter aimed to investigate whether there is an association between markers of metastatic potential (CD147, CD44v3-10), MDR-related protein (MDR1) and MCTs (MCT1 and MCT4), and CaP progression and chemoresistance. CD147, CD44v3-10, MDR1, MCT1 and MCT4 were co-localised in metastatic CaP cells lines. Expression of CD147 and CD44v3-10 in metastatic CaP cells was inversely related to DTX sensitivity (IC50). In addition, the co-localisation of CD147 and CD44v3-10 with MDR1, MCT1 and MCT4 in low- and high-grade primary CaP tissues was confirmed. The results also demonstrated that overexpression of CD44v3-10, MDR1 and MCT4 is related to clincopathological markers of CaP progression. As discussed below, the findings suggest that CD147 and CD44v3-10 are associated with CaP drug resistance and metastasis, and could be useful therapeutic targets to prevent the development of incurable, recurrent and drug-resistant CaP.

3.2 Materials and methods

3.2.1 Antibodies

The following antibodies and conjugates were used: mouse anti-EMMPRIN/CD147 MAb) (8D6), rabbit anti-human MDR1 PAb antibody (sc-1517-R), rabbit anti-MCT1 PAb antibody (H-70), rabbit anti-MCT4 PAb (H-90) (Santa Cruz Biotechnology, Inc, Santa Cruz, CA, USA); goat anti-CD44v3-10 PAb (Alexis Biochemicals, San Diego, CA, USA); Alexa Fluor-488 goat anti-mouse IgG, Alexa Fluor-488 donkey anti-goat IgG, AlexaFluor-594 goat anti-rabbit IgG, Alexa Fluor-594 donkey anti-goat IgG (Molecular Probes, Eugene, Oregon, USA); biotinylated swine anti-goat, mouse, rabbit immunolobulins (Ig), streptavidin/HRP, mouse anti-human IgG1 negative control MAb (Dako, Glostrup, Denmark); mouse ant-human MDR1 MAb (F4) and goat or rabbit Ig (Sigma Aldrich Pty Ltd, Castle Hills, NSW, Australia). For dilutions and conditions see Table 2-1.

113

3.2.2 Cell lines and cell culture

Androgen non-responsive (PC-3- RX-DT2R, PC-3, DU145) and androgen responsive (LNCaP-LN3, DuCaP) CaP cell lines from different sources were studied (Table 2-2). Tissue culture reagents were supplemented with 10% (v/v) heated-inactivated FBS (Invitrogen Australia Pty Ltd, Melbourne, VIC, Australia), unless otherwise stated. PC- 3-RX-DT2R, PC-3, and DU145 cells were cultured in RPMI-1640; LNCaP-LN3 cells in 1:1 RPMI-1640:F12-K; and DuCaP cells in DMEM. All were grown in a humidified incubator at 37 C with 5% CO2. After 48 h culture, sub-confluent cells were rinsed twice with Dulbecco‟s DPBS (pH 7.2), detached with 0.25% trypsin/EDTA at 37 C, collected by centrifugation and resuspended in buffers or media. The PC-3-RX-DT2R cell line was developed by Russell‟s group (ORC, Prince of Wales Hospital, Sydney, Australia), by exposing xenografts of PC-3 to 3 doses of DTX 12.5mg/kg at 5 day intervals, intravenously, allowing the tumours to regress and then re-treating the mice after their re-growth. Tumours that re-grew after the second round of treatment were used to establish a line in culture. The cells were cultured in vitro with continuous exposure for 7 days to DTX at 1 to 1.25 x 10-9 M followed by a 14 day recovery period in the absence of added DTX through 3 rounds of treatment to establish them as a drug resistant cell line, PC-3- RX-DT2R. DuCaP cells were provided by Dr K. Pienta (Michigan, USA). PC-3 and DU145 CaP cell lines were obtained from American Type Culture Collection (ATCC, Rockville, MD, USA). LNCaP-LN3 cells were kindly provided by Dr. C. Pettaway (M. D. Anderson Hospital, Austin, TX, USA).

3.2.3 Immunofluorescence confocal microscopy analysis of CaP cell lines

As described in Chapter 2.3.6, to determine the cellular localization of CD147, CD44v3-10, MDR1, MCT1 and MCT4 in CaP cells, PC-3- RX-DT2R, PC-3, DU145, LNCaP-LN3 and DuCaP cells were grown on glass coverslips (105 cells) for 24 h. After washing with TBS (pH 7.6), cells were fixed on coverslips in ice-cold methanol for 10 min at RT and then incubated with 10% normal serum in TBS for 20 min to suppress non-specific binding of IgG. After rinsing in TBS, the cells were incubated in mouse anti-CD147, goat-anti-CD44v3-10, rabbit-anti-MDR1, -MCT1 and -MCT4 antibodies for 1 h at RT on a shaking table and rinsed with TBS, followed by a 45 min incubation

114 in Alexa Fluor-488 goat anti-mouse, donkey anti-goat or Alexa Fluor-594 goat anti- rabbit IgG (1:1000 dilution) at RT. Refer to Table 2-1 for the dilution of the antibodies. The stained cells were mounted with glass slides using glycerol (Sigma-Aldrich Pty Ltd, Castle Hills, NSW, Australia). Slides were examined using an FV300/FV500 Olympus laser scanning confocal microscope (Olympus, Tokyo, Japan). Negative control slides were treated identically but with either isotype control PAbs or omission of primary antibodies.

3.2.4 Western blot analysis

Protein expression levels were determined by western blotting analysis as described (Chapter 2.3.11). Briefly, whole cell lysates were separated by NuPAGE Novex 4-12% Bis-Tris gel electrophoresis and then transferred to PVDF membrane. After blocking of non-specific sites with 5% skim milk, the membrane was incubated with specific antibodies at appropriate concentrations (refer to Table 2-1) for o/n at 4˚C, followed by incubation with HRP-conjugated secondary antibody (Santa cruz, CA, USA). Immunoreactive bands were detected using ECL substrate (SuperSignal West pico Substrate, Thermo Scientific, USA), and imaged using the ImageQuant LAS4000 system (GE Health care, USA). To confirm equal loading of protein lysates, membranes were stripped (Restore Western Blot Stripping Buffer, Thermo Scientific, USA) and re- probed using house-keeping antibodies, then processed as above. Images were processed in Adobe Photoshop.

3.2.5 MTT assay

MTT assays were performed as described previously (Chapter 2.3.12). PC-3-RX-DT2R, PC-3, DU-145, LNCaP-LN3 and DuCaP cells were seeded in triplicate in 96-well plates at 5000 cells/well and incubated for 24 h. A range of concentrations of DTX (Sigma- Aldrich, St Louis, MO, USA) diluted in 100% ethanol (1000, 100, 10, 1, 0.1, 0.01, 0.001, 0.0001 nM) were added to cells. Control cells were treated with appropriate volumes of 100% ethanol. After 48 h, 20 µL of MTT (5 mg/mL) (Sigma-Aldrich Pty Ltd, Castle Hill, NSW, Australia) was added to each well, followed by incubation at

37 C/5% CO2 for 4 h. Subsequently, 100 L of DMSO (Sigma-Aldrich Pty Ltd, Castle

115

Hill, NSW, Australia) was added and the plate was shaken for 20 min at RT to dissolve the formazan crystals. The OD was read at a wavelength of 562 nm on a BIO-TEC micro-plate reader (BIO-RAD, Hercules, CA, USA). Each experiment was repeated at least 3 times. Results represent the OD ratio of the treated and untreated cells. The growth inhibition curve and IC50 was generated using the GraphPad Prism 4 Program (GraphPad, San Diego, CA, USA).

3.2.6 Patients and clinical data

The sample groups used in this study were from a previous study (Cozzi PJ et al., 2006). 140 CaP tissues were obtained with informed consent from patients with localized CaP undergoing RP or trans-urethral resection of the prostate (TURP) at Urology Sydney, St George Private Hospital, from 2000 to 2007. Controls (n=40) were from normal biopsies or from morphologically normal areas of CaP tissue. Ethical approval was obtained from the South East Area Health Human Research Ethics Committee, South Section. Specimens were grouped as follows: Group I: normal prostate glands (age<40 years, range 26-38 years, n=10, and age>50 years, range = 55-83 years, n=10), normal areas of prostate glands from CaP patients (median age 67 years, range 62-84 years, n=20); BPH (median age 66 years, range 58-72 years, n=40); PIN (median age 63 years, range 57-71 years, n=20). Group II: 120 CaP specimens (96 RP, 24 TURP), containing Gleason score < 7 (n=30), Gleason score = 7 (3+4) (n=30), Gleason score = 7 (4+3) (n=30), Gleason score > 7 (n=30) median age 61 years (range 46-76 years). Formalin fixed tissues were routinely processed, paraffin-embedded and H&E sections were reviewed by Professor Warick Delprado (Director of Douglass Hanly Moir Pathology, Sydney and CaP pathologist). Tumour foci were identified, circled in ink, and graded (Gleason system). Pathological stage (RP) was determined using the TNM system. Clinical data in RP patients (n=96) indicated average age at surgery, 63 years (range 49-72 years) and median follow-up time, 18 months (range 2-50 months). A detectable level of PSA (> 0.2 ng/mL) following surgery was defined as biochemical recurrence (Cozzi et al, 2006). Pertinent clinical information (pre-treatment PSA level, Gleason score, clinical stage, surgical margin status, assessment by clinic visit, phone, or e-mail contact to determine overall, cancer-specific, and recurrence-free survival) was recorded. All patients were advised to undergo a serum PSA test twice/year.

116

3.2.7 TMAs for detecting cancer markers

TMAs were constructed from specimens from a previous study (Cozzi PJ et al., 2006) (as described in Chapter 3.2.6) and used in the current project. These had three tissue cores (diameter 1.0 mm)/donor block within the marked areas, being arrayed into a recipient paraffin block (35 mm x 20 mm) of the semi-automated Beecher Instruments (Silver Springs, MD, USA). Sections (5- m) were cut, collected on Superfrost Plus slides (Lomb Scientific, Australia) and H&E staining performed.

3.2.8 Immunohistochemistry for TMAs staining

As described in Chapter 2.3.7, to examine expression of protein immunoreactivity, paraffin-embedded TMAs were deparaffinized in xylenes, followed by a graded series of ethanol (100%, 95%, 75% and 50%) and re-hydration in TBS. Slides were immersed in 0.01 M citrate buffer (pH 6.0) for 20 min at 100°C to enhance antigen retrieval, rinsed in TBS, and then treated with 3% hydrogen peroxide, and rinsed in TBS. After blocking in 10% normal swine serum in TBS for 30 min, sections were incubated o/n at 4°C in goat anti-CD44v3-10, rabbit anti-MDR1, rabbit anti-MCT1 and rabbit anti- MCT4 PAbs respectively, washed in TBS, then incubated in biotinlyated swine anti- goat, mouse, rabbit immunoglobulins for 45 min at RT, rinsed in TBS and then incubated in streptavidin/HRP (1:200 dilution) for 30 min at RT. For dilutions of the antibodies, refer to Table 2-1. After rinsing in TBS, immunoreactivity was developed with DAB substrate and counterstained with hematoxylin. Negative controls were treated identically but incubated in control PAbs (non-specific goat or rabbit Ig) or the primary antibody was omitted.

3.2.9 Immunofluorescence staining of CaP tissues

Immunofluorescence staining was performed as previously described (Chapter 2.3.6). To examine the co-localization of CD147, CD44v3-10, MDR, MCT1 and MCT4 in CaP tissues, whole sections (10 CaP specimens from each subgroup based on TMA immunohistochemistry results, n=40) were incubated o/n at 4°C in primary mouse anti- CD147 MAb; or goat anti-CD44v3-10, rabbit anti-MDR1, rabbit anti-MCT1 and rabbit 117 anti-MCT4 PAbs, respectively. After washing with TBS, sections were incubated in goat anti-mouse Alexa 488 (CD147), goat anti-rabbit Alexa 594 (MDR1, MCT1 and MCT4) and donkey anti-goat Alexa 488 or 594 (for goat CD44v3-10) for 1 h at RT, and rinsed in TBS. For dilutions of the antibodies refer to Table 2-1. Controls were treated identically, using non-specific immunoglobulins (goat or rabbit Ig) as a negative control. Sections were examined using a FV 300/FV500 Olympus laser scanning confocal microscope (Olympus, Tokyo, Japan). Multichannel excitation bleed-through was minimized by using fluorochromes separated in peak excitation (488 nm and 594 nm respectively). Multitracking and sequential image capture was used to correct signal emission crosstalk between neighbouring channels, and the images were combined.

3.2.10 Assessment of immunostaining results

Immunostaining results were assessed by staining intensity (Grade 0-3) for cancer cell lines, TMA tissue and whole CaP tissues using light microscopy (Leica microscope, Nussloch, Germany) and confocal microscopy. The criteria for assessment were as described in Chapter 2.3.8 with modifications: 0 (negative); 1 (weak); 2 (moderate); 3 (strong). For TMA staining, three cores were scored per case. The analysis of 3 cores per case has been shown to be comparable with the analysis of the whole section in a recent study (Rubin MA et al., 2002). Where all 3 cores from the one tumour were positive (3/3), the reading was counted as positive. Where heterogeneous staining was seen among the three cores, an average score was determined. Evaluation of tissue staining was performed independently by three experienced observers. All specimens were scored blind and an average of grades was taken. For statistical analysis, CaP patients from RP cases were divided into 2 groups: the low-expression group (LEG), comprising Grade 0 and 1 immunostaining, and the high-expression (over-expression) group (HEG), comprising Grade 2 and 3 immunostaining.

3.2.11 Statistical analysis

As described in Chapter 2.3.21, the associations between CD44v3-10, MDR1, and MCT4 expression levels (LEG and HEG) and clinicopathological data were tested using a Chi-squared test. Comparison of staining intensity for CD44v3-10, MDR1, MCT1 and

118

MCT4 between CaP tissues and normal prostate tissues was performed, where P<0.05 (2-tail) was considered significant. All statistical analyses were performed using GraphPad Prism 4.00 (GraphPad, San Diego CA, USA).

3.3 Results

3.3.1 Expression and co-localization of CD147, CD44v3-10, MDR1, MCT1 and MCT4 in metastatic and drug resistance CaP cell lines

Immunofluorescence labeling of CaP cells with CD147, CD44v3-10, MDR1, MCT1 and MCT4 antibodies showed positive staining in PC-3- RX-DT2R, PC-3, DU145 and LNCaP-LN3 CaP cell lines with variation in different cells (Figure 3-1). Strong (Grade 3) expression of CD147, CD44v3-10, MDR1, MCT1 and MCT4 expression was found in PC-3-RX-DT2R and PC-3 cell lines. Medium expression of CD147, CD44v3-10, MDR1 and MCT1 and strong expression of MCT4 was found in DU145 cell line. Low expression of CD147, CD44v3-10, MDR1 and MCT1 and medium expression of MCT4 was found in LNCaP-LN3 cell line. The DuCaP cell line showed no staining for CD147 and CD44v3-10, and weak immunostaining for MDR1, MCT1 and MCT4. The immunostaining grades are summarized in Table 3-1. Membrane expression was found for CD44v3-10 PAb, whereas both membrane and cytoplasm expression were seen for CD147, MDR1, MCT1 and MCT4 antibodies. Strong co-localization of CD147/CD44v3-10, CD147/MDR1, CD147/MCT1, CD147/MCT4, CD44v3-10/MDR1, CD44v3-10/MCT1 and CD44v3-10/MCT4 was observed in PC-3- RX-DT2R, PC-3 and DU145 non-androgen responsive metastatic CaP cell lines; weak co-localization of these markers was observed in LNCaP-LN3 cell line but no co-localization was found in the DuCaP androgen responsive CaP cell line (Figure 3-1 and Figure 3-2). The immunofluorescence results for the expression of CD147, CD44v3-10, MDR1, MCT1 and MCT4 in CaP cell lines were further confirmed by western blotting and high levels of these proteins were found in RX-DT2R and PC-3 cell lines (Figure 3-3).

119

120

Figure 3-1. Co-immunolabelling of CD147, CD44v3-10, MDR1, MCT1 and MCT4 in metastatic CaP cell lines. Representative confocal images of CD147 (green), CD44v3-10, MDR1, MCT1 and MCT4 (red) expression are shown. Merged images, and red and green channels are shown separately. Membrane expression was found for CD147 and CD44v3-10 PAbs, whereas both membrane and cytoplasm expression were seen for MDR1, MCT1 and MCT4 antibodies. All immunostaining is more homogeneous. A: CD147; B: CD44v3-10; C: MDR1; D: MCT1; E: MCT4; F: Co- localization of CD147 with CD44v3-10; G: Co-localization of CD147 with MDR1; H: Co-localization of CD147 with MCT1; I: Co-localization of CD147 with MCT1. Magnification: A to I x 100.

121

122

Figure 3-2. Co-immunolabelling of CD44v3-10, MDR1, MCT1 and MCT4 in metastatic CaP cell line. Representative confocal images of CD44v3-10 (green), MDR1, MCT1 and MCT4 (red) expression are shown. Merged images, as well as red and green channels are shown separately. Membrane expression was found for CD44v3- 10 PAb, whereas both membrane and cytoplasm expression were seen for MDR1, MCT1 and MCT4 antibodies. All immunostaining is more homogeneous. A: CD44v3- 10; B: MDR1; C: MCT1; D: MCT4; E: Co-localization of CD44v3-10 with MDR1; F: Co-localization of CD44v3-10 with MCT1; G: Co-localization of CD44v3-10 with MCT4. (Magnification: A to G x 100).

123

Figure 3-3. Expression of CD147, CD44v3-10, MDR1, MCT1 and MCT4 in CaP cell lines by western blotting. Representative western blotting results show high levels of CD147, CD44v3-10, MDR1 (F4), MCT1 and MCT4 expression was found in RX- DT2R and PC-3 cell lines, medium levels of proteins in DU145 cell line and lower or negative levels of proteins in LNCaP and DuCaP cell lines. β-tubulin was used as a loading control demonstrated in the lower panel (Lane 1: RX-DT2R, lane 2: PC-3, lane 3: DU145, lane 4: LNCaP-LN3. Lane 5: DuCaP).

Table 3-1 Immunostaining for CD147, CD44v3-10, MDR1, MCT1 and MCT4 in metastatic CaP cell lines, and response to DTX (IC50)

DTX IC50 Cell Line CD147 CD44v3-10 MDR1 MCT1 MCT4 (nM) PC-3-RX- DT2R 3 3 3 2 3 44.7 PC-3 2 2 2 2 3 17.8 DU145 1~2 1~2 2 2 3 10.5 LNCaP- LN3 1 1 1 2 1~2 7.9 DuCaP 0 0 0 1 1 4.0 Notes: Immunofluorescence staining: 0= negative; 1= weak; 2= moderate; 3= strong.

DTX IC50: DTX concentration that reduces cell viability to 50% of control (as determined in MTT assay; n=3)

124

3.3.2 Expression of CD147 and CD44v3-10 is related with DTX response in metastatic CaP cell lines

Metastatic CaP cell lines (PC-3- RX-DT2R, PC-3, DU145, LNCaP-LN3 and DuCaP) with different levels of CD147 and CD44v3-10 expression responded differently to

DTX treatment. The IC50 values for these CaP cell lines were highly related to the levels of CD147 and CD44v3-10 expression (see Figure 3-4 and Table 3-2). Thus, PC-3-RX- DT2R drug resistant cells (CD147 and CD44v3-10, Grade3) were the least sensitive

(IC50: 44.7 nM), while DuCaP cells (CD147 and CD44v3-10, Grade 0) were very sensitive to DTX treatment (IC50: 4.0 nM).

Figure 3-4. Dose response of metastatic CaP cell lines to DTX, measured using MTT assay. Drug resistant and metastatic CaP cell lines treated with a range of concentrations of DTX (0.001 to 1000 nM) displayed varying responses. The IC50 (50% cell survival) is related to the expression of CD147 and CD44v3-10. For example, the drug resistant cell line-PC3-RX-DT2R displays Grade 3 CD147 and CD44v3-10 expression, and an IC50 of 44.7 nM; the drug sensitive CaP cell line-DuCaP displays

Grade 0 CD147 and CD44v3-10 immunostaining and the lowest IC50 of 4 nM. (n=3, mean ± SD)

125

3.3.3 Expression of CD44v3-10, MDR1, MCT1 and MCT4 in CaP tissues

Our group previously reported CD147 expression in the TMAs used in the current study (Madigan et al, 2008). In this study, immunostaining for CD44v3-10, MDR1, MCT1 and MCT4 expression was conducted. In primary CaP tissues, 74% (89/120), 78% (94/120), 88% (106/120) and 92% (110/120) were positive for CD44v3-10, MDR1, MCT1 and MCT4 (Grade 1 to 3), respectively. In CD44v3-10-positive primary CaP sections, weak staining (Grade 1) was found in 16% (14/89) (Figure 3-5A), moderate staining (Grade 2) in 45% (40/89) (Figure 3-5B) and strong staining (Grade 3) in 39% (35/89) (Figure 3-5C), respectively, while no staining was observed in negative controls (Figure 3-5D). In MDR1-positive primary CaP sections, weak staining (Grade 1) was found in 17% (16/94) (Figure 3-5E), moderate staining (Grade 2) in 44% (41/94) (Figure 3-5F) and strong staining (Grade 3) in 39% (37/94) (Figure 3-5G), respectively, while no staining was found in negative controls (Figure 3-5H). The immunostaining patterns and % positive cells for MCT1 and MCT4 in TMAs were similar, and MCT4 results are presented as representative of this study. In MCT4- positive primary CaP sections, weak staining (Grade 1) was found in 20% (22/110) (Figure 3-5I), moderate staining (Grade 2) in 38% (42/110) (Figure 3-5J) and strong staining (Grade 3) in 42% (46/110) (Figure 3-5K), respectively, while no staining was found in negative controls (Figure 3-5L). No CD44v-3-10, MDR1, MCT1 and MCT4 immunostaining was found in normal prostate tissues and PIN (data not shown) and non-tumour regions from primary CaP tissues (Figure 3-5D, 3-5H and 3-5L). Scattered areas of weak (≤ Grade 1) heterogeneous epithelial cell staining were observed in 3% (1/40) for MDR1, and in 5% (2/40) for MCT4 in BPH specimens, respectively (Table 3-2). The staining intensity and % positive staining for CD44v3-10, MDR1, MCT1 and MCT4 in primary CaP tissues, PIN, BPH and normal prostates are summarized in Tables 3-2. For CaP specimens, the immunostaining was mostly Grade 2 or 3, but was negative in PIN specimens.

126

Figure 3-5. Expression of CD44v3-10, MDR1 and MCT4 in CaP TMAs. Representative images of Grade 1 (weak) CD44v3-10 (A), MDR1(E) and MCT4 (I); Grade 2 (medium) CD44v3-10 (B), MDR1(F) and MCT4 (J) and Grade 3 (strong) CD44v3-10 (C), MDR1(G) and MCT4 (K) immunostaining. No immunoreactivity is seen in non-specific negative controls for CD44v3-10 (D), MDR1 (H) and MCT4 (L). The brown color indicates positive immunostaining. The insets indicate the typical areas of staining at high amplification. Magnification: A to L x 400.

127

Table 3-2. Percentage of the positive immunostaining for CD44v3-10, MDR1, MCT1 and MCT4 in normal prostate, BPH and different grades of CaP (n=120) CD44v3-10 MDR1 MCT1 MCT4

Group I Normal prostate 0 0 0 0 (n=40) BPH (n=40) 0 3% (1/40) 0 5% (2/40) PIN (n=20) 0 0 0 0 Group II G < 7 (n=30) 60% (18/30) 73% (22/30) 83% (25/30) 87% (26/30) G = 7 (3+4) 73% (22/30) 77% (23/30) 83% (25/30) 90% (27/30) (n=30) G = 7 (4+3) 77% (23/30) 80% (24/30) 93% (28/30) 93% (28/30) (n=30) G > 7 (n=30) 87% (26/30) 83% (25/30) 93% (28/30) 97% (29/30) Total positive 74% (89/120) 78% (94/120) 88% (106/120) 92% (110/120) CaP

Expression of CD44v3-10, MDR1, MCT1 and MCT4 was generally uniform in most tumours. The expression of CD44v3-10 was mostly cell membrane-associated; however, distinct positive cytoplasmic staining was also seen. Immunostaining for MDR1, MCT1 and MCT4 was mainly cytoplasmic as well as some membrane staining. In high-grade primary CaP (Gleason score ≥7), most tumour stroma also showed a strong positive reaction for CD44v3-10, MDR1, MCT1 and MCT4 (data not shown).

3.3.4 Correlation between CD44v3-10, MDR1, and MCT4 expression and clinicopathological parameters

Of the 96 RP patients, only 9% (9/96) relapsed with biochemical progression (PSA> 0.4 ng/mL), and no patients died of CaP during the follow-up period (5 years). The median time to relapse was 40 months (range 18-50 months). 26% (25/96) of the tumours had a Gleason score <7 while 74% (71/96) of tumours had a Gleason score ≥7. 27% (26/96) of tumours were small (pT1), 38% (36/96) were organ-confined (stage pT2) and 36% (34/96) of tumours had extracapsular extension (stage pT3). Table 3-3 summarizes the correlations between CD44v3-10, MDR1 and MCT4 expression in primary CaP with pretreatment PSA level, Gleason score, pathologic stage, surgical margin status, nodal involvement (development of metastases) and biochemical recurrence. Over-expression

128

(HEG) of CD44v3-10, MDR1 and MCT4 was significantly correlated with pretreatment PSA levels (P<0.05), and increased with progression of CaP (Gleason score, P<0.05; pathologic stage, P<0.05; nodal involvement, P<0.05). CD44v3-10 and MDR1 over- expression, but not MCT4, were also significantly correlated with PSA-defined recurrence (P<0.05). There was no correlation between over-expression of CD44v3-10, MDR1 or MCT4 and surgical margin (P>0.05).

3.3.5 Co-immunolabelling of primary CaP tissues with CD147, CD44, MDR1, MCT1 and MCT4 antibodies

Co-localization of CD147 and CD44v3-10, MDR1, MCT1and MCT4 was also assessed in primary CaP tissue (N=40) by confocal microscopy. Most samples displayed co- immunolabelling with two different markers although single staining in different samples was variable. The immunostaining patterns are very similar to those seen by peroxidase immunohistochemistry as described above. Representative images from different tumours are shown in Figure 3-6. For co-immunolabelling of CD147 with CD44v3-10 (Figure 3-6A ), CD147 with MDR1 (Figure 3-6B), CD147 with MCT1 (Figure 3-6C), CD147 with MCT4 (Figure 3-6D), CD147 appears green while CD44v3-10, MDR1, MCT1 and MCT4 expression appear red. For co-immunolabelling of CD44v3-10 with MDR1 (Figure 3-6E), MCT1 (Figure 3-6F) and MCT4 (Figure 3- 6G), CD44v3-10 is green while MDR1, MCT1 and MCT4 expression is red.

129

Table 3-3. Clinicopathological characteristics associated with CD44v3-10, MDR1 and MCT4 expression in primary CaPs (RP patients, n=96) Variable CD44v3-10, MDR1 and MCT4 Expression/Total No. (%) CD44v3-10 MDR1 MCT4 LEGa HEGb P- LEG HEG P- LEG HEG P- value* value value* * Pretreatment PSA level <10 53% (21/40) 47% (19/40) 0.001 45% (18/40) 55% (22/40) 0.014 35% (14/40) 65% (26/40) 0.004 10 21% (12/56) 79% (44/56) 21% (12/56) 79% (44/56) 11% (6/56) 89% (50/56) Gleason score <7 52% (13/25) 48% (12/25) 0.031 56% (14/25) 44% (11/25) 0.002 36% (9/25) 64% (16/25) 0.029 7 28% (20/71) 72% (51/71) 23% (16/71) 77% (55/71) 15% (11/71) 85% (60/71) Pathologic stage pT1 54% (14/26) 46% (12/26) 0.041 58% (15/26) 42% (11/26) 0.002 42% (11/26) 58% (15/26) 0.006 pT2 30% (11/36) 70% (25/36) 25% (9/36) 75% (27/36) 11% (4/36) 89% (32/36) pT3 24% (8/34) 76% (26/34) 18% (6/34) 82% (28/34) 15% (5/34) 85% (29/34) Nodal involvement No 40% (32/81) 60% (49/81) 0.014 36% (29/81) 64% (52/81) 0.024 25% (20/81) 75% (61/81) 0.031 Yes 7% (1/15) 93% (14/15) 7% (1/15) 93% (14/15) 0% (0/15) 100% (15/15) Surgical margin Negative 39% (24/61) 61% (37/61) 0.176 38% (23/61) 62% (38/61) 0.075 25% (15/61) 75% (46/61) 0.232 Positive 26% (9/35) 74% (26/35) 20% (7/35) 80% (28/35) 14% (5/35) 86% (30/35) PSA-defined recurrence No 37% (33/89) 62% (54/87) 0.023 34% (30/87) 66% (57/87) 0.034 23% (20/87) 77% (67/87) 0.106

Yes 0% (0/9) 100% (9/9) 0% (0/9) 100% (9/9) 0% (0/9) 100% (9/9)

Notes: a. LEG Low Expression Group (Grade 0 or 1 immunostaining); b. HEG High Expression Group ( Grade 2 immunostaining); * Chi-squared test, P<0.05 significant.

130

131

Figure 3-6. Co-immunolabelling of CD147, CD44v3-10, MDR1, MCT1 and MCT4 in primary CaP tissues. Representative confocal images of CD147 and CD44v3-10 (green), CD44v3-10, MDR1, MCT1 and MCT4 (red) immunolabelling are shown. Merged images, and red and green channels are shown separately. A: CD147 and CD44v3-10 in high grade CaP (Gleason score=8); B: CD147 and MDR1 in high grade CaP (Gleason score=8); C: CD147 and MCT1 in low grade CaP (Gleason score=6); D: CD147 and MCT4 in high grade CaP (Gleason score=8); E: CD44v3-10 and MDR1 in high grade CaP (Gleason score=9); F: CD44v3-10 and MCT1 in high grade CaP (Gleason score=8); G: CD44v3-10 and MCT4 in high grade CaP (Gleason score=8). CD147 immunolabeling is seen on epithelial cell membranes and stromal cells. CD44v3-10, MDR1, MCT1 and MCT4 immunostaning is predominantly epithelial. MCT4 localises mostly to basal epithelial cells, and lateral cell walls. (Magnification: A to G x 100).

132

3.4 Discussion

In the present study, the expression of CD147, CD44v3-10, MDR1, MCT1 and MCT4 were examined in metastatic CaP cell lines, in primary CaP, PIN, BPH and normal prostate tissues using a tissue archive, and were investigated further for any links among these markers. High levels of CD147, CD44v3-10, MDR1, MCT1 and MCT4 were observed in metastatic and drug resistant CaP cell lines and in specimens of advanced CaP but not in PIN, BPH and normal prostate tissues. Co-localization of invasion and metastatic markers (CD147, CD44v3-10), MDR related protein (MDR1) and monocarboxylate transporters (MCT1 and MCT4) was also found in most metastatic CaP cell lines as well as in primary CaP tissues. To my knowledge, this is the first report investigating the phenotype relationship between CD147, CD44v3-10, MDR1, MCT1 and MCT4 during CaP progression. The co-localization of CD147 separately with several different molecules: CD44v3-10, MDR1, MCT1, and MCT4, and the co-localization of CD44v3-10 with MDR1, MCT1 and MCT4 in primary and metastatic CaP cells suggest interactions between these proteins. Toole and Slomiany (2008) reported that CD147 and CD44 interact with various multidrug transporters of the ATP-binding cassette (ABC) family, and MCTs associated with resistance to cancer therapies. Slomiany et al (2009) reported that CD44 co-localizes with MCT1, MCT4, and CD147 at the plasma membrane, and HA, CD44, and CD147 contributed to the regulation of MCT localization and function in the plasma membrane of breast cancer cells (Slomiany MG et al., 2009c). Co-localization of CD44 and MDR1 was shown to increase in melanoma cells engineered to express MDR compared with parental cells (Colone M et al., 2008). Su et al (2009) also found that CD147 co-localizes with MCT1 and MCT4 in membranes of malignant A375 melanoma cells, leading to an increased glycolytic rate compared with that in normal human melanocytes. Silencing of CD147 in A375 cells abrogates expression of MCT1 and MCT4, and co-localization with CD147, and dramatically decreases cellular glycolytic rate, extracellular pH, and the production of ATP (Su J et al., 2009). The present data show co-localization of CD147 with MCT1 and MCT4 in primary and metastatic CaP cells, consistent with CD147 being an ancillary protein required for the expression of these MCTs (Deora AA et al., 2005, 133

Gallagher SM et al., 2007). This supports the hypothesis that expression of CD147 is closely related to that of CD44v3-10, and may be involved in regulating the expression of MDR1, MCT1 and MCT4 during CaP metastasis. The expression of CD44 and its variants is associated with the progression of several cancers, although this remains controversial for CaP (De Marzo AM et al., 1998, Noordzij MA et al., 1999). One study reported a complete lack of membranous expression of all CD44 isoforms in 93-98% primary CaP tissues (Kallakury BV et al., 1996), while another reported moderate to high levels of CD44 expression in 60% of primary CaP with ~14% of metastases expressing low levels of CD44 (Nagabhushan M et al., 1996). Significant reduction in CD44 expression was also reported in primary CaP foci and metastases by De Marzo et al (1998). The relationship between CD44 expression and tumour grade is also uncertain with a strong correlation between Gleason grade of the CaP and loss of CD44 expression in one study (De Marzo AM et al., 1998), but no correlation in another (Paradis V et al., 1998). Similar to expression studies, the potential role of CD44 in CaP development and metastases is controversial. Earlier over-expression experiments have suggested that CD44 may exert a tumour-suppressive function (Gao AC et al., 1998), although other studies have implicated the roles of CD44 in CaP cell proliferation, adhesion, migration, and invasion in vitro as well as in metastatic dissemination in vivo (Omara- Opyene AL et al., 2004, Paradis V et al., 1998). The variation in CD44 expression seen in different studies may be attributable to the use of different methodologies in the assessment of CD44 expression or to the different stages of CaPs used in the analyses or to the use of different antibodies. Differences in the CD44 isoform expressed also explain some of these controversies. Non-invasive prostate epithelial cells have been shown to express a high molecular weight CD44 isoform, CD44v3-10, which may counteract the function of the CD44s by reducing adhesion to and invasion of the endothelium by CaP cells (Harrison GM et al., 2006). In the present study, CD44s was expressed in normal prostate tissues and in a very low percentage of cells in CaP tissues (of different stages, not shown); CD44v3-10 was negative in all normal prostate and PIN tissues. However, high levels of expression of CD44v3-10 were correlated with tumour grade, clinical stage, residual tumour, and relapse, but not with differences in tumour histological type. These observations support the idea that in the

134 development of CaP, CD44 isoform expression changes progressively from CD44s to high molecular weight variant forms such as CD44v3-10, and that CD44s basal cell expression is lost with over-expression of variant forms in CaP cells (Hao JL et al., 2010). The data suggest that CD44v3-10 is a marker of progression of prostate epithelial cells from a benign to malignant phenotype, and thus may be an important indicator of the stage of CaP reflecting CaP progression and metastasis. Aberrant MDR1 expression has been seen in many cancer types including CaP, and contributes significantly to treatment failure. MDR1 expression was found to be associated with drug resistance in androgen-dependent and AI human prostate xenografts (Chen CT et al., 1998), whilst downregulation of the MDR1 gene by hypermethylation has been associated with an increase in cellular proliferation possibly related to disease progression (Enokida H et al., 2004, Van Brussel JP et al., 2001). In vitro studies have also reported a functional interaction between CD44 and MDR1, associated with increased cell migration, in vitro invasion, and metastasis (Miletti-Gonzalez KE et al., 2005). The analysis of primary CaP tumour samples of different stages/grades prior to drug therapy has shown high levels of MDR1 expression to be correlated with the tumour grade, clinical stage, residual tumour and relapse, suggesting that MDR1 expression maybe involved in CaP progression and metastasis. The current study also found that expression of CD147 and CD44v3-10 is co-localized in metastatic CaP cells and inversely related to DTX sensitivity in metastatic CaP cell lines, suggesting that CD147 and CD44v3-10 may be involved in CaP drug resistance. The functional roles of CD147 and CD44v3-10 in CaP metastatsis and drug resistance are currently being investigated in our laboratory. Increased glycolysis and adaptation to acidosis are key events in the transition from in situ to invasive cancer (Gatenby RA et al., 2004). Given their essential function in exporting lactate, the end-product of glycolysis, MCTs are considered key elements in regulating tumour intracellular pH and induction of extracellular acidosis. The rapid transport of lactate via MCTs is of critical importance for tumour cells where an increased glycolytic rate gives a proliferative advantage over other cells. Upregulation of MCTs has been described in several tumour types, but only three studies have evaluated its clinicopathological significance (Pinheiro C et al., 2008a, Pinheiro C et al., 2008b, Pinheiro C et al., 2009). In this study the high level of expression of MCT4 is shown for the first time to

135 be correlated with CaP tumour grade, clinical stage, residual tumour, relapse, but not to differences in histological type, consistent with MCT1/MCT4 expression being involved in CaP progression. Our research team previously demonstrated CD147 expression in metastatic CaP cell lines, primary CaP tissues and lymph node metastases (Madigan MC et al., 2008). This has been ratified in the present study, together with over-expression of CD44v3-10, MDR1, MCT1, MCT4 and co-localization of CD147 and CD44v3-10, with MDR1, MCT1 and MCT4 in CaP cells in most primary tumours. The co-localization of these markers in CaP tissues is consistent with that seen in the CaP cell lines, suggesting that cancer clones that escape from primary tumours to the common metastatic sites in human CaP do not lose expression of these antigens. Differential expression of CD147, CD44v3-10, MDR1, MCT1 and MCT4 also suggests that the phenotypes of CaP metastasis may be controlled by genetics and/or the tumour microenvironment during CaP progression. Functional interactions between CD44 and MDR1 are increasingly recognized as being important in tumour metastases. For example, in breast and ovarian cancer cell lines, immunoprecipitation and co-localisation studies together with functional assays, showed that CD44 and MDR can directly influence expression of each other, producing a malignant tumour cell phenotype characterised by MDR, increased migration and invasion (Miletti- Gonzalez KE et al., 2005). The co-localization of CD147 with CD44v3-10, MDR1, MCT1, MCT4 in the current study further suggests that CD147 and CD44v3-10 could concomitantly regulate MDR1, MCT1 and MCT4 expression during CaP progression, with the latter ones being associated with drug resistance. However, the mechanism(s) involved in CD147 and CD44v3-10 regulation during CaP metastasis require further study. Given that CD147 and CD44v3-10 co-localize with MDR1-positive cells in CaP specimens, their targeting could potentially overcome drug resistance in the late stage of metastatic CaP. Previous studies have shown that CD147 knock-down using siRNA (Wang L et al., 2006), or antibodies (Dean NR et al., 2009, Xu J et al., 2007b) inhibits tumour growth in vitro or in vivo, associated with changes in the regulation of MMP production (Dean NR et al., 2009, Xu J et al., 2007b), and radiation sensitivity of the tumours (Dean NR et al., 2009). Schneiderhan et al (2009) further confirmed that CD147 silencing inhibits lactate transport and reduces malignant potential of pancreatic cancer cells in in vitro and in vivo

136 models (Slomiany MG et al., 2009c). MCT1 inhibition has also been shown to have anti- tumour potential against in vivo models of lung carcinoma, colorectal carcinoma and a squamous carcinoma cell line after a-cyano-4-hydroxycinnamate-mediated MCT1 inhibition (Sonveaux P et al., 2008). These results suggest that targeting CD147 could be useful in controlling metastasis and cancer recurrence, with a potential application to CaP. Targeting over-expressed CD44 in cancer cells may also control CaP progression. Antibody-mediated CD44 targeting has inhibited growth of breast cancer xenografts and prevented the regrowth of basal-like xenograft cells after chemotherapy induced remission (Marangoni E et al., 2009). Gene therapy using siRNA CD44 also caused in vitro and in vivo regression of colon cancer cells (Subramaniam V et al., 2007). Several reviews have also discussed the advantages of HA (major CD44 ligand) as a drug carrier and a targeting ligand for cancer, and other pathologies (Platt VM et al., 2008, Yadav AK et al., 2008); it has been used with prodrugs against cancer cell lines and xenografts (Auzenne E et al., 2007), or in novel lipoplexes to target siRNA (Taetz S et al., 2009), or for gene delivery (Surace C et al., 2009). The potential for these approaches in CaP, alone or in combination with CD147 targeted therapies (discussed above), is promising and remains to be investigated in future studies. In summary, this study demonstrates for the first time that co-expression of CD147 and CD44v3-10 with MDR1, MCT1 and MCT4 was found in most CaP metastatic cell lines and primary CaP tissues. The over-expression of CD44v3-10, MDR1 and MCT4 was significantly associated with CaP progression. Co-localization of CD147 and CD44v3-10 with MDR1 and MCTs in tumour cells and stromal cells supports a role for these invasive markers in the regulation of drug resistance in the progression of CaP, as indicated by my in vitro DTX sensitivity findings. These results further suggest both CD147 and CD44v3- 10 may be potential therapeutic targets for treating late-stage, incurable, recurrent metastatic CaP to overcome drug resistance.

137

Chapter 4 – CD44 and CD147 modulate chemoresistance and metastatic potential in CaP cell lines in vitro

Parts of this work have been submitted for publication:

Hao JL, Madigan MC, Khatri A, Power CA, Hung TT, Beretov J, Xiao W, Cozzi PJ, Graham PH, Kearsley JH, Li Y. CD44 and CD147 modulate prostate cancer cells in vitro and in vivo metastasis and chemoresistance. Submitted to PLoS ONS in a revised version, 2012

138

4.1 Introduction

Chemotherapy is traditionally used for palliation of symptoms, because advanced CaP is naturally resistant to chemo-agents. A major mechanism for drug resistance in cancer is through energy-dependent efflux pumps that reduce intracellular drug accumulation. One of these, which is well characterised, is MDR1 or ABCB1, a 170-kDa membrane phosphoglycoprotein encoded by the MDR1 gene (Germann UA, 1996). Previous studies indicated that CD147 expression is upregulated in MDR cancer cells, and also demonstrated that CD147 increases the activity of MMPs in MDR-expressing breast cancer cell lines (Yang JM et al., 2003). Treatment of MDR-expressing breast cancers with MDR1/Pgp substrates can adversely affect therapeutic outcomes through modulation of CD147, MMP2, MMP9 and EGFR production (Li QQ et al., 2007). HA production in mammary carcinoma cells is also increased by CD147, with MDR being induced in an HA- dependent manner (Marieb EA et al., 2004). Expression of CD44 and MDR1/Pgp seems to be co-regulated, as modulation of CD44 expression correspondingly affects MDR1/Pgp expression in breast cancer (Miletti-Gonza´lez et al., 2005). Previous studies indicate that both CD44 and HA are involved in chemotherapeutic drug resistance in many cancer types (Miletti-Gonzalez KE et al., 2005, Ohashi R et al., 2007), but regulation of MDR by CD147 and CD44 in CaP remains to be fully defined. Tumour cell invasion and development of MDR are associated with hypoxia and low tumour pH. Several studies show a direct relationship between increased cancer cell glucose uptake, glycolysis and tumour aggressiveness. Non-invasive spectroscopy imaging for hyperpolarised lactate also shows elevated lactate for high-grade CaP in a transgenic mouse model, compared with a normal prostate (Albers MJ et al., 2008). Tumour cell expression of MCT1 and MCT4 has been reported to be regulated by CD147 (Kirk P et al., 2000). Specifically, interaction of CD147 with MCT1 or MCT4 within the ER is necessary for MCT trafficking to the plasma membrane; without CD147, MCTs are degraded and thus non-functional (Gallagher SM et al., 2007). However, the relationship of MCTs with CD147, CD44 and MDR1 in CaP is still unclear. In Chapter 3, CD44 and CD147 were found to be co-localised on both primary and metastatic CaP cells, and that over-expression of CD44v3-10 and CD147 is associated with

139

CaP progression. Furthermore, a clear inverse relationship was found between DTX sensitivity and CD44v3-10/CD147 expression in CaP cell lines. In this chapter, it was hypothesized: 1) that down-regulation of CD44 or CD147 expression could have therapeutic potential in limiting CaP metastasis and enhancing CaP chemotherapeutic sensitivity; and 2) that the effect of CD44 and CD147 in CaP may be mediated via MRP2, PI3K and Erk pathways. The findings in the following sections demonstrate that CD44 and CD147 do confer properties significant for CaP metastasis and chemoresistance in vitro, and are potentially useful therapeutic targets for future CaP therapy.

4.2 Materials and methods

4.2.1 Antibodies

Antibodies were obtained from different sources. Detailed information and conditions for all antibodies is listed in Table 2-1.

4.2.2 Cell lines and cell culture

The androgen-non-responsive PC-3M-luc-C6 (PC-3M-luc) CaP cell line was obtained from Xenogen Corp, USA. All tissue culture reagents were supplied by Invitrogen Australia Pty Ltd (Melbourne, VIC, Australia), unless otherwise stated. PC-3M-luc cells were cultured in RPMI-1640 supplemented with 10% (v/v) heat-inactivated FBS, 50 U/mL of penicillin, and 50 U/mL of streptomycin. PC-3M-luc-scr (scrambled shRNA control), PC-3M-luc-CD44- KD, PC-3M-luc-CD147-KD cells were grown in the same medium supplemented with additional 1 µg/mL puromycin for screening. All cell lines were maintained in a humidified incubator at 37°C and 5% CO2.

140

4.2.3 shRNA transfection for CD44/CD147

PC-3M-luc cells with shRNA-mediated knock-down of CD44 (s and v)/CD147 or a scrambled sequence control for off-target effects (PC-3M-luc-scr) were generated following the manufacturer‟s instructions. Five MISSION® lentiviral transduction particles encoding for shRNAs against CD44 or CD147 and MISSION® non-target shRNA control transduction particles were used (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia) (Table 2-3, Appendix 1) (refer to Chapter 2.3.13).

4.2.4 Immunofluorescence confocal microscopy analysis of PC-3M-luc and PC-3M- luc-KD cell lines

Immunofluorescence staining was performed as previously described (Chapter 2.3.6). Briefly, cells grown on glass coverslips were fixed, rinsed and incubated with various primary antibodies o/n at 4 C: mouse anti-human CD44 MAb, CD147 PAb, MRP2 MAb, rabbit anti-human MCT1 PAb or MCT4 PAb. After rinsing in TBS, cells were incubated for 45 min in Alexa Fluor-488 goat anti-mouse or Alexa Fluor-488 goat anti-rabbit IgG at RT. Dilutions of the antibodies refer to Table 2-1. Propidium iodide (0.2 mg/L) was used to stain the nuclei. Negative controls were treated identically but incubated with either mouse or rabbit isotype control. Immunofluorescence was visualized using an FV300/FV500 Olympus laser scanning confocal microscope (Olympus, Tokyo, Japan).

4.2.5 Western blotting analysis

141 for the host species of primary antibody) (1:5000 dilution). Immunoreactive bands were detected using ECL substrate (Pierce Chemical Co, Rockford, USA), and imaged using the ImageQuant LAS4000 system (GE Health care, USA). To confirm equal loading of protein lysates, membranes were stripped (Restore Western Blot Stripping Buffer, Pierce) and re- probed using mouse anti-β-tubulin MAb (1:10000 dilution), then processed as above. Images were processed in Adobe Photoshop.

4.2.6 MTT assay for DTX response

MTT assays were performed as described previously (Chapter 2.3.12). Briefly, cells were seeded in 96-well plates and treated with a range of concentrations (0.001-1000 nM) of DTX diluted in 100% ethanol, and a vehicle control. After 72 h incubation, the medium was replaced with fresh medium containing 0.5 mg/mL MTT. After 4 h, the supernatants were removed and the resulting MTT formazan solubilized in DMSO and measured spectrophotometrically at 562 nm on a BIO-TEK microplate reader (Bio-Rad, Hercules, CA, USA). Results represent the OD ratio of treated and vehicle-treated cells. The growth inhibition curve was generated using the GraphPad Prism 4 Program (GraphPad, San Diego,

CA, USA). Absolute IC50 values were calculated using the intersection of the 50% normalised drug response and the growth inhibition curves for each cell line, to find the x axis values for IC50 DTX concentration (nM).

4.2.7 Colony forming assay

PC-3M-luc and PC-3M-luc-KD cells were used for colony forming assays as described previously (Chapter 2.3.14). Briefly, 1500 cells/dish were seeded in 10 cm dishes for 48 h at 37 C in 5% CO2 and then treated with a fixed dose of DTX at 3.5 nM final concentration

(1/2 dose of the lowest IC50 from the MTT assay in four CaP cell lines) or the same volume of vehicle control (the final concentration of ethanol was 0.1‰). After 3 days treatment, the DTX-containing media was replaced with fresh media and all cultures were incubated for an additional 7 days until colonies were large enough to be clearly discerned. The colonies were stained with filtered 0.5% crystal violet for 20 min, followed by washing with tap 142 water and drying o/n. The colonies, defined as groups of >50 cells, were scored manually with the aid of an Olympus INT-2 inverted microscope (Tokyo, Japan). The average number of colonies were plotted (Mean ± SD, n=3).

4.2.8 Matrigel invasion assay

The invasive ability of CaP cell lines was determined using commercial matrigel and control transwell chambers (BD Bioscience, NSW, Australia) (see Chapter 2.3.15 for details). Briefly, 2 x 104 PC-3M-luc, PC-3M-luc-scr, PC-3M-luc-CD44-KD and PC-3M- luc-CD147-KD CaP cells in 500 µL serum-free medium were added to each transwell insert and 750 µL complete medium was added to the outer well as a chemoattractant and prevent dehydration. Cells were incubated at 37°C in 5% CO2 for 24 h and then stained with a Diff-Quik staining kit (Allegiance Healthcare Corp, McGraw Park, Illinois, USA). Excess dye was washed away with tap water and the number of stained cells that invaded through matrigel and control inserts was counted in five hpf by light microscopy (Leica microscope, Nussloch, Germany). The invasive potential was calculated as follows: % Invasion = [(Mean cells invading through matrigel insert membrane)/(Mean cells migrating through control insert membrane)] x 100%. Cell invasion rates were plotted, with mean and SD (n=3).

4.2.9 Assessment of immunostaining

Staining intensity (0-3) was assessed using light microscopy (Leica, Germany) and a x40 objective. The criteria used for assessment were as previously described (Chapter 2.3.8) with modifications, where: 0 (negative); 1 (weak); 2 (moderate); 3 (strong) expression of the tumour cells stained. Evaluation of tissue staining was done, independently, by three experienced observers. All slides were scored blind and an average of grades was taken.

143

4.2.10 Statistical analysis

As described in Chapter 2.3.21, all numerical data were expressed as the average of the values obtained, and the SD was calculated. Data from different groups were compared using the two-tail student‟s t test. All P values were 2-sided. P<0.05 was considered significant. All numerical statistical analyses were performed using the GraphPad Prism 4.00 package (GraphPad, San Diego CA).

4.3 Results

4.3.1 Expression of CD44, CD147, MCT4 and MRP2 in CD44 or CD147-KD and control cell lines

PC-3M-luc and PC-3M-luc-scr CaP cell lines showed strong positive staining for CD44, CD147, MCT4 and MRP2 (Figure 4-1A). After knocking down CD44, the reduction in CD44 expression was also associated with a concomitant reduction in the levels of expression of CD147, MCT4 and MRP2 (Figure 4-1A). Similarly, after knocking down CD147, the levels of CD147 expression were reduced and a concomitant reduction in the levels of expression of CD44, MCT4 and MRP2 was also seen (Figure 4-1A). No detectable staining was seen in the cells incubated with isotype controls (not shown). The immunofluorescence staining results in different CaP cell lines are summarized in Table 4- 1. The immunofluorescence results for the expression of CD44, CD147, MCT4 and MRP2 in CaP cell lines were further confirmed by western blotting (Figure 4-1B).

144

Figure 4-1. The effects of reduced CD44 and CD147 on MRP2 and MCT4 in CaP cell lines. Knock down of CD44 and CD147 proteins can affect each other, and the expression of MRP2 and MCT4 in CaP cell lines. Representative confocal images of CD44, CD147, MCT4 and MRP2 (green) immunofluorescence after knocking down CD44 or CD147 (A). Nuclei are stained with PI (red). Magnification: all images x 400. Western blot is shown to confirm the level of protein knock down (B). β-tubulin was used as a loading control. scr: scrambled shRNA control.

Table 4-1. Immunostaining for CD44, CD147, MCT4 and MRP2 in knock-down and control CaP cell lines Cell Line CD44 CD147 MCT4 MRP2 PC-3M-luc 2-3 2-3 3 1-2 PC-3M-luc-scr 2-3 2-3 3 1-2 PC-3M-luc-CD44-KD 0-1 1-2 1-2 0-1 PC-3M-luc-CD147-KD 1-2 0-1 0 1

Notes: Immunofluorescence staining: 0= negative; 1= weak; 2= moderate; 3= strong. KD: knock-down; scr: scrambled shRNA control.

145

4.3.2 Knock down of CD44 or CD147 sensitizes monolayer CaP cells to DTX treatment in vitro

Knock-down (PC-3M-luc-KD-CD44 and PC-3M-luc-KD-CD147) and control (PC-3M-luc and PC-3M-luc-scr) CaP cell lines with different levels of CD44 and CD147 expression responded differently to DTX treatment. The IC50 values (the dose for obtaining 50% cell killing) strongly correlated with the levels of CD44 and CD147 expression (Figure 4-2). Accordingly, PC-3M-luc and PC-3M-luc-scr control cells (high levels of CD44 and CD147) were the least sensitive (IC50: 118 and 104 nM, respectively), while PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD cells (low levels of CD44 and CD147) were very sensitive to

DTX treatment (IC50: 7 and 19 nM, respectively). Significant differences (P<0.05) in the

IC50 were observed between PC-3M-luc-CD44-KD/PC-3M-luc-CD147-KD cells and PC- 3M-luc/PC-3M-luc-scr cells.

Figure 4-2. Cell viability (MTT) assay after DTX treatment for PC-3M-luc, -scr and CD44/CD147-KD cell lines. PC-3M-luc, PC-3M-luc-scr, PC-3M-luc-CD44-KD and PC- 3M-luc-CD147-KD CaP cells treated with DTX (0.001-1000 nM) showed variable response. Sensitivity of CD44/CD147-KD cells to different concentrations of DTX compared to controls was obviously increased by MTT assay. Results were from three independent experiments (Mean ± SD, n=3). 146

4.3.3 Knock down of CD44 or CD147 reduces clonogenic ability and sensitizes CaP colonies to DTX treatment

To investigate whether knock-down of CD44 and CD147 affect the clonogenicity of either alone or combined with DTX treatment, the cultured knock-down and control CaP cells were assessed. The number of colonies was significantly decreased either with vehicle control or with DTX treatment in PC-3M-luc-CD44 or CD147-KD cells compared with PC-3M-luc or PC-3M-luc-scr cells, while there was no significant difference (P≥0.05) between the number of colonies generated from PC-3M-luc and PC-3M-luc-scr cells. Significant differences (P<0.05) in the average number of colonies was observed 1) between DTX treated cells and vehicle control (VC) treated cells in PC-3M-luc-CD44- KD/CD147-KD cell lines; 2) between DTX treated PC-3M-luc-CD44-KD/CD147-KD cells and VC treated PC-3M-luc/PC-3M-luc-scr cells. Representative images are shown in Figure 4-3A. The DTX response in PC-3M-luc-CD44 or CD147-KD cell lines was greater than that in PC-3M-luc and PC-3M-luc-scr cell lines (Figure 4-3B). The clonogenicity (average DTX-treated colonies/average vehicle control-treated colonies %) was 89%, 84%, 56% and 74% for PC-3M-luc, PC-3M-luc-scr, PC-3M-luc-CD44-KD, and PC-3M-luc- CD147-KD cell lines, respectively.

4.3.4 Knock down of CD44 or CD147 reduces CaP cell invasion

After knocking down CD44 or CD147, cell invasion was significantly reduced for both PC- 3M-luc-CD44-KD (P<0.001) and PC-3M-luc-CD147-KD cells (P<0.01) compared with PC-3M-luc and PC-3M-luc-scr control cells (Figure 4-4A). A relatively greater reduction in invasion ability was found in PC-3M-luc-CD44-KD cells than in PC-3M-luc-CD147-KD cells. The percentage invasion for PC-3M-luc, PC-3M-luc-scr, PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD cells was 70%, 62%, 22%, and 47% respectively (Figure 4-4A). Representative images for each cell line are shown in Figure 4-4B.

147

Figure 4-3. Colonogenic assays after DTX treatment in PC-3M-luc, -scr and CD44/CD147-KD cell lines. Four CaP cell lines were seeded in 10 cm dishes and treated with a fixed DTX dose (3.5 nM) for 3 d. Following treatment, cells were cultured in growth medium for 7 d. Typical images are shown for colony growth in CaP cell lines treated with VC or DTX (A). Colonogenic ability and DTX sensitivity in colonies of CaP cell lines are shown (B): “▲” indicates no significant difference in the average number of colonies between the DTX treated cells and VC treated cells in PC-3M-luc/PC-3M-luc-scr cell lines (P≥0.05); “○” indicates significant difference in the average number of colonies between the DTX treated cells and VC treated cells in PC-3M-luc-CD44-KD orPC-3M-luc-CD147- KD cell lines (P<0.05); “∆” indicates significant difference in the average number of colonies between DTX treated cells in PC-3M-luc-CD44-KD or PC-3M-luc-CD147-KD cell lines and DTX treated cells in PC-3M-luc/PC-3M-luc-scr cell lines (P<0.05). DTX: docetaxel; VC: vehicle control; results were from three independent experiments (Mean ± SD, n=3).

148

Figure 4-4. Matrigel invasion assay for PC-3M-luc, -scr and CD44 or CD147-KD cell lines. Matrigel invasion assay was used to study the change in invasion potential in PC-3M- luc, PC-3M-luc-scr and PC-3M-luc-CD44/CD147-KD cells. The invasive potential was significantly reduced to 25% and 50% in PC-3M-luc-CD44-KD and PC-3M-luc-CD147- KD cells respectively, compared to 69% and 64% in PC-3M-luc and PC-3M-luc-scr cells, respectively (P<0.01) (A). Representative light microscopy images for CaP cell invasion (B). DTX: docetaxel; VC: vehicle control; * indicates 0.01

4.3.5 PI3K/Akt and MAPK/Erk signalling pathways are related to the expression of CD44 and CD147 in CaP cells

After knocking down CD44 or CD147, it was found that the expression of p-Akt and p-Erk were both downregulated in PC-3M-luc-CD44 or CD147-KD cells compared to PC-3M-luc and PC-3M-luc-scr control cells, with a more significant reduction in PC-3M-luc-CD44- KD cells; there was no obvious change in t-Akt and t-Erk expression in all CaP cell lines (Figure 4-5).

149

Figure 4-5. Assessement of PI3K/Akt or MAPK/Erk related signalling proteins with western blot after CD44 or CD147 knock down in PC-3M-luc cells. Four signal transduction molecules (p-Akt, t-Akt, p-Erk and t-Erk) were assessed to investigate the relationship between CD44, CD147 and cell signalling pathways. The levels of p-Akt and p-Erk were reduced in knock-down cell lines compared to wild-type and scr controls. Representative results are shown. KD: knock-down; p-Akt: phosphorylated-Akt; p-Erk: phosphorylated-Erk; scr: scrambled shRNA control; t-Akt: total-Akt; t-Erk: total-Erk.

4.4 Discussion

Previous reports have shown that CD44 and CD147 are closely involved in various cancers (Slomiany MG et al., 2009b, Slomiany MG et al., 2009c, Toole BP et al., 2008). CD147 stimulates production of HA (Marieb EA et al., 2004), an extracellular polysaccharide that promotes tumour chemoresistance through interactions with the cell surface receptor CD44 (Gilg AG et al., 2008, Misra S et al., 2005, Misra S et al., 2003). CD147, through interactions with HA receptors (CD44) (Misra S et al., 2003) and membrane-bound transporters (Wang WJ et al., 2008) facilitates tumour cell chemoresistance. In addition, disruption of HA interactions with its cognate receptors interferes with CD147-mediated drug resistance (Misra S et al., 2003) in part through disruption of protein complexes containing CD147 (Slomiany MG et al., 2009b, Slomiany MG et al., 2009c). In the present study, knocking down of either CD44 or CD147 affected the expression of the other protein 150 to a less extent as well as the expression of drug resistance protein (MRP2) and transporter protein (MCT4) in CaP cells. These data suggest that CD44 and CD147 are co-regulated and associated with MRP2 and MCT4 in CaP cells, and may play an important role in CaP metastasis and chemoresistance. The association of CD44 and CD147 with MCT transporter proteins has been documented for different cancers (Slomiany MG et al., 2009b, Slomiany MG et al., 2009c, Miletti-Gonzalez KE et al., 2005, Slomiany MG et al., 2009a, Wang WJ et al., 2008). Metastatic cancer cells increase glucose consumption and metabolism via glycolysis, producing large quantities of lactate. Up-regulation of glycolysis and adaptation to acidosis are key events in the transition from in situ to invasive cancer (Gatenby RA et al., 2004). The rapid transport of lactate by MCTs is of critical importance for almost all cells, especially tumour cells with elevated levels of glycolysis resulting in a decrease in extracellular pH. MCT4 and CD147 overexpression have been reported to be associated with poor prognosis in CaP (Pertega-Gomes N et al., 2011). Rudrabhatla et al reported that MCT4 is an important efflux pump for lactate and that the accumulation of lactate in the microenvironment may stimulate HA production and contribute to an acquired malignancy in melanoma cells (Rudrabhatla SR et al., 2006). MRP2 is one of 48 human ABC transporters, also called ABCC2/the canalicular multiple organic anion transporter (cMOAT), and plays a role in the occurrence of the MDR phenotype in cancer cells (Kruh GD et al., 2003). An association with MCT4 or MRP2 is often an attribute of an aggressive phenotype and drug resistance in cancers (Chen H et al., 2010, Yamasaki M et al., 2011, Hao J et al., 2010). CD147 silencing has been reported to inhibit MCT1/MCT4 and reduce the malignant potential of pancreatic cancer cells in vivo and in vitro (Schneiderhan W et al., 2009). The mechanisms underlying how CD44 and CD147 may regulate or influence MCT4 and MRP2 are not well defined. However, modifications of MCT4 and MRP2 can influence tumour growth and sensitivity to chemotherapy, and are a useful approach for cancer treatment (Izumi H et al., 2011, Ma JJ et al., 2009). In the current study, reducing CD44 or CD147 expression related to the concurrent reduction of MCT4 and MRP2 could increase the sensitivity of CaP cells to DTX treatment. This suggests that the effect of the DTX-related response after CD44 or CD147-KD in CaP cells may be functionally related to MCT4 and MRP2 expression and particular signalling pathways. In addition, CD44-KD

151 displayed a clear enhancement of sensitivity to DTX compared to CD147-KD cells, suggesting a possibly stronger inhibition of survival pathways. Colony formation assays provide a more appropriate measure of the long-term effects of potential therapeutic agents, assessing the ability of cells to retain the proliferative potential after treatment, a characteristic that clinically facilitates tumour recurrences in patients. The current clonogenic assays indicated that downregulated CD44 or CD147 expression suppressed the survival potential of CaP cells in the presence of either vehicle or DTX treatment. The sensitivity to DTX treatment was also higher in CD44 or CD147-KD cells compared to control cells, suggesting that CD44 and CD147 play an important role in CaP growth and DTX resistance. Wang et al reported that inhibition of CD147 expression reduces tumour cell invasion in PC-3 CaP cells via RNAi (Wang L et al., 2006). Zhu et al also found that CD147 regulates cell adhesion, invasion, and cytoskeleton reorganization in PC-3 CaP cells using a shRNA approach (Zhu H et al., 2012). In the current study, reduced in vitro invasion was found for CD44 or CD147-KD cells compared to control cells; this was greater in CD44-KD cells indicating that both CD44 and CD147 affect CaP invasion and that CD44 plays a more important role in invasion than CD147 does. The matrigel invasion assay mimics the ECM microenvironment by providing growth factors and creating a matrix scaffold for tumour cells to invade through. One possible mechanism for the reduced invasion observed in this study could be reduced levels of MMPs (for example, MMP9) as observed with gelatin zymography for CaP cells with reduced CD44 or CD147 expression (preliminary observation). PI3K/Akt and MAPK/Erk signalling pathways are related to CaP invasion (Shukla S et al., 2007, Wegiel B et al., 2009). PI3K activation can induce chemoresistance in CaP cells through the up-regulation of MRP1 (Lee JT, Jr. et al., 2004). Activated forms of Akt can also increase the drug resistance of advanced CaP, and the PI3K/PTEN/Akt pathway appears to be more prominently involved in CaP drug resistance than the Raf/MEK/Erk pathway (McCubrey JA et al., 2006). One recent study reported that PTEN/PI3K/Akt pathways are critical for maintaining a CaP stem-like cell (CD44+/CD133+) phenotype and that targeting PI3K signalling may be beneficial in CaP treatment by eliminating CaP stem- like cells (Dubrovska A et al., 2009). CD44 and CD147 were hypothesized to be involved in PI3K/Akt or MAPK/Erk signalling pathways in CaP metastasis and drug resistance. In

152 the current study, CD44 or CD147-KD could reduce both p-Akt and p-Erk levels in CaP cells. A more obvious reduction of p-Akt and p-Erk was seen in CD44-KD cells, suggesting that both PI3K/Akt and MAPK/Erk signalling pathways are involved in CD44/CD147-mediated CaP metastasis and drug resistance, and that CD44 plays a prominent role in this regulation compared to CD147. These findings are consistent with the colony assay, cell invasion and DTX responsiveness results. The role of CD44 and CD147 in the regulation of these two signalling pathways will be investigated in future studies.

153

Chapter 5 – CD44 and CD147 modulate chemoresistance and metastatic potential in CaP cell lines in vivo

Parts of this work have been submitted for publication:

154

5.1 Introduction

Two recent DTX-based clinical studies have for the first time shown the potential benefits of chemotherapy to prolong the survival time and life quality of CaP patients (Petrylak DP et al., 2004, Tannock IF et al., 2004). DTX is currently the most effective chemotherapeutic drug for metastatic CaP (Calabro F et al., 2007, Petrylak DP, 2005, Petrylak DP et al., 2004, Tannock IF et al., 2004). However, the drug-resistant nature of CaP still challenges the effectiveness of such therapies. Clearly, multidrug resistance and metastatic disease remain the main causes of treatment failure and mortality in CaP patients. Current in vitro studies have been advancing to mimic extracellular conditions, whereas the biological environment in vivo still provides the best frame to look at tumour behavior. Thus, it is of significant value to investigate the mechanisms of CaP metastasis and drug resistance in vivo, and identify useful therapeutic targets to improve current therapeutic modalities. In Chapters 3 and 4, CD44 and CD147 were found to be associated with each other in terms of immunolocalistion and reciprocal effects on invasiveness, the downregulation of these two molecules modulated in vitro metastasis and chemoresistance potential in CaP cell line PC-3M-luc. The potential mechanisms conferring their functionalities involve MRP2, PI3K, and Erk pathways. In the present chapter further investigation of CD44 and CD147 in CaP metastasis and DTX responsiveness using an in vivo s.c. mouse CaP model was explored. Moreover, a haematological bone metastasis CaP model was established for animal imaging monitoring for future studies.

5.2 Materials and methods

5.2.1 Determinination for the dose of DTX for chemotherapy in vivo

Male, 6-8 wks old Balb/c nude mice (Animal Resources Centre, Western Australia) were housed under specific pathogen-free conditions in facilities approved by the ACEC of UNSW. Mice were kept at least 1 wk before experimental manipulation. To study the toxicity and determine the dose of DTX for chemotherapy in the following studies, 0 (vehicle only), 10, 15, 20, 25, 30 mg/kg of DTX were administered i.p. once per week for

155 continuously three weeks in non-tumour bearing mice. For each dosage, a group of 5 mice were administered and examined twice per wk for signs of toxicity, such as weight loss. After 3 wks of treatment, 200 µL of blood were collected from the tails of live mice for a haematology test. After 13 wks, all mice were sacrificed and their spleen, kidney, heart, and liver were removed for histology analysis. The highest dosage which did not cause systematic toxicity was chosen for the chemotherapy in the following studies.

5.2.2 s.c. CaP xenograft animal model

Male, 6-8 wks old Balb/c nude mice (Animal Resources Centre, Western Australia) were housed under specific pathogen-free conditions in facilities approved by the ACEC of UNSW. Mice were kept at least 1 wk before experimental manipulation. All mice remained healthy and active during the experiment. As described previously (Chapter 2.3.17), cultured PC-3M-luc, PC-3M-luc-scr, PC-3M-luc-CD44-KD or PC-3M-luc-CD147-KD CaP cells (1.5 x 106/injection) in 100 µL DPBS were implanted s.c. in the right rear flank region of mice (n=10 mice/per group). Tumour progression was documented weekly by measurements using callipers, and tumour volumes were calculated as follows: length x width x height x 0.52 (in millimetres) for up to 8 wks. Upon sacrifice, primary tumours and local regional lymph nodes were removed for histological examination.

5.2.3 DTX response in a s.c. CaP animal model

As described previously (Chapter 2.3.17), after establishing s.c. models with CaP cell lines, when average tumour size reached 30±10cm3 in each group (n=10/group), 5 mice (n=5/subgroup) were treated with 25 mg/kg DTX continuously for 3 wks by i.p. injection, and the other 5 mice (n=5/subgroup) were treated with vehicle control (saline). Tumour growth was calculated by measurements using calipers.

156

5.2.4 Mouse tissues and histology

All animal tissues were either formalin fixed or snap frozen. For protocols refer to Chapter 2.3.4 and Chapter 2.3.5. H&E-stained sections were reviewed to assess important organs such as liver, kidney, lung, spleen, brain and heart for toxicity and tumour structure. Tumour xenografts and local regional lymph nodes were collected at the end of the experiments and processed for histology, immunohistochemistry and TUNEL assay. Five- micron frozen sections of fresh tumour samples were used for CD31 and CD44 immunostaining.

5.2.5 Immunohistochemistry

Standard immunoperoxidase procedures were used to visualize CD147, Ki-67, and caspase- 3 (active) as previously described (Chapter 2.3.7). Briefly, paraffin sections were dewaxed and rehydrated, then incubated with primary antibodies anti-CD147, Ki-67 and caspase-3 (active), respectively o/n at 4°C. Slides were then incubated with swine anti-goat, mouse, rabbit biotinylated IgG second antibody for 45 min at RT and with streptavidin/HRP solution (1:300 dilution) for 30 min at RT. Sections were finally developed with DAB substrate solution (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia), then counterstained with hematoxylin; positive cells appeared brown. Control slides were treated in an identical manner, using isotype Abs or omitting primary antibody as a negative control. CD44 and CD31 immunostaining on frozen sections was performed as previously published (Chapter 2.3.7). Sections were incubated with mouse anti-human CD44 or rat anti-mouse CD31 MAb o/n at 4 C. Sections were incubated with rabbit anti-mouse/rat biotinylated IgG (1:200 dilution) for 45 minutes at RT, and then with conjugated streptavidin/HRP (1:200 dilution) for another 30 minutes. Sections were developed by using DAB solution (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia), and counterstained with hematoxylin. For negative controls, sections were stained with the isotype MAb or with secondary antibody alone.

157

5.2.6 TUNEL assay for apoptotic cells in vivo

Apoptosis was assessed on tumour xenograft tissues using the TUNEL method with the TdT-fragEL in situ apoptotic detection kit (Calbiochem, San Diego, CA, USA) as described in Chapter 2.3.20. The specificity of TUNEL reactivity was confirmed with appropriate negative (TdT omitted from the labeling mix) and positive (treated HL-60 slides provided by the company) controls. Slides were examined using a Leica light microscope (Nussloch, Germany).

5.2.7 Assessment of immunostaining

Staining intensity (0-3) was assessed using a x40 objective. The criteria used for assessment were as previously described (Chapter 2.3.8), where: 0 (negative, <25%); 1+ (weak, 25– 50%); 2+ (moderate, 50–70%); 3+ (strong, >75%) of the tumour cells stained. Evaluation of tissue staining was done, independently, by three experienced observers. All specimens were scored blind and an average of grades was taken.

5.2.8 Development of an i.c CaP model

Mice were anesthetised with isoflurane inhalation and stabilized on the bench by gently applying a piece of sticky tape on the abdomen. A number of 3 x 106 cells were injected into the left ventricle of the mouse. Successful injections were confirmed by blood pulsing in the syringe prior to injection. Tumour progression and metastases formation were monitored with BLI for 6 wks. Upon sacrifice, mice were imaged with BLI and all luminescent positive organs were preserved for future analysis (refer to Chapter 2.3.18).

5.2.9 In vitro and in vivo monitoring of bioluminescence using BLI

For in vitro bioluminescence assay, luciferease positive cells were seeded in duplicate in 100 μL of culture medium on 96 well plates at serial dilutions: 104, 0.5 x 104, 0.25 x 104,

158

0.125 x 104, 6.25 x 103, 3.125 x 103, 1.625 x 103, 8.125 x 102, 4.062 x 102, 2.031 x 102, and 1.016 x 102. Two wells were filled with 100 μL of culture medium only as negative control.

After incubating for 5 h at 37 C, 5% CO2, the medium was replaced with D-luciferin (Xenogen, CA, USA) containing medium (150 μg/mL). Bioluminescence images were taken 3 min after adding the substrate into the cells using Xenogen IVIS Lumina (Xenogen, CA, USA). For the in vivo bioluminescence assay, D-luciferin was injected i.p. at 150 μg/kg 10 min before the imaging. Biolumunescence were quantified using Living Image software (Xenogen, CA, USA). The total flux in photons/second (p/s) within each defined region of interest was regarded as a representative of tumour size (refer to Chapter 2.3.19).

5.2.10 Statistical analysis

The statistical analysis of immunostaining intensity in animal xenografts was performed as described previously (Chapter 2.3.21). One-way ANOVA, followed by Dunnett‟s post hoc test was performed to determine the significance of differences between the growth curves in the s.c. model of tumour volume changes. P<0.05 was considered significant. All numerical statistical analyses were performed using the GraphPad Prism 4.00 package (GraphPad, San Diego CA).

5.3 Results

5.3.1 In vivo toxicity study

A series of DTX containing 0, 10, 15, 20, 25, 30 mg/kg were administered i.p. weekly for 3 wks. The blood tests after three treatments revealed no signs of immunosuppression and systematic toxicity at 13 wks. The necropsies with organ histopathology showed no signs of systemic toxicity. There were no macroscopic signs of chronic toxicity to major organs for any mice. Leukocyte counts and body weight were depressed in mice treated with 30 mg/kg DTX at 3 wks post injection compared to the mice treated with vehicle control (Table 5-1), with recovery occurring. Normal haematology was seen at 13 wks. The

159 highest dosage which did not cause systematic toxicity was found to be 25 mg/kg in this study.

5.3.2 Knock down of CD44 or CD147 affects tumourigenicity, lymph node metastases and DTX sensitivity in a s.c. CaP xenograft model

As shown in Figure 5-1A, the weekly measurements of CD44 and CD147-KD xenografts, either treated with VC (saline) or DTX (25 mg/kg), showed a significantly reduced tumour growth rate in the VC and DTX-treated groups (P<0.05). There were no significant differences in the tumour growth rate of PC-3M-luc wild-type and PC-3M-luc-scr xenografts in both VC and DTX treated groups (P>0.05). In VC-treated xenografts, a slightly stronger tumour growth regression was seen in CD44-KD xenografts and no obvious difference was found between the growth of CD44-KD and CD147-KD tumours (P>0.05). In the DTX-treated xenografts, the tumour xenografts from the four CaP cell lines had smaller tumour volumes compared to corresponding VC-treated xenografts at all time points. Slightly more tumour regression is seen in DTX-treated CD44-KD xenografts but no significant difference is found between CD44-KD and CD147-KD growth curves (P>0.05). Tumour weight in each group was evaluated at completion of the experiments (8 wks post cell inoculation) (Figure 5-1B). There was no significant difference in weight between the parental and scramble-transfected cell lines, showing that the cells‟ in vivo characteristics was not altered by the transfection process (Figure 5-1B and C). At this point in time, CD44- KD and CD147-KD xenografts both showed significantly reduced tumour weights compared to control groups (789 ± 192 mg for PC-3M-luc-CD44-KD and 892 ± 238 mg for PC-3M-luc-CD147-KD versus 1369 ± 117 mg for PC-3M-luc and 1376 ± 250 mg for PC-3M-luc-scr, respectively). This represented 58% and 65% tumour weight reductions in knock-down treated versus scr-control groups (P<0.05) (Figure 5-1B and C). In addition, an obvious decrease in overall body weight was observed in the DTX-treated mice compared to the untreated control mice (P<0.05, unpublished data). There was obviously a delay in weight gain after DTX treatment in all mice.

160

Table 5-1. Summary of body weight and WBC count of nude mice receiving DTX at different dosages Control 10 mg/kg 15 mg/kg 20 mg/kg 25 mg/kg 30 mg/kg

Wks post 1st DTX treatment 4 wk 13 wk 4 wk 13 wk 4 wk 13 wk 4 wk 13 wk 4 wk 13 wk 4 wk 13 wk 19.90 Body weight 20.96 23.60 20.84 23.46 20.50 23.28 20.42 22.54 22.32 22.60 ± 1.02 22.14 (g) ±SD ± 0.49 ± 0.75 ± 1.22 ± 0.78 ± 1.22 ± 1.21 ± 1.37 ± 1.26 ± 1.08 ± 1.30 * ± 1.44 4.2 ± 4.1 ± 4.0 ± 4.2± 3.9 ± 4.0± 3.9 ± 4.3± 3.9 ± 4.1± 3.5 ± 4.2± WBC (x109) 0.07 0.12 0.09 0.15 0.11 0.09 0.08 0.07 0.13 0.10 0.09 * 0.07

Notes: WBC: White blood cell; * indicates P<0.05

161

162

Figure 5-1. In vivo effects of CD44- and CD147-KD on tumourigenicity and sensitivity to DTX in s.c xenograft models. Tumour growth curves for PC-3M-luc, PC-3M-luc-scr, PC-3M-luc -CD44-KD and PC-3M-luc-CD147-KD xenografts are shown either with VC or with DTX treatments (A). At the end of experiments, tumour weight from PC-3M-CD44- KD and PC-3M-luc-CD147-KD group mice was obviously reduced compared to that from PC-3M-luc and PC-3M-luc-scr mice with VC and DTX treatments (P<0.05) (B). Representative images for tumour sizes and lymph node metastases from different groups and treatments are shown (C). DTX: docetaxel; KD: knock-down; scr: scrambled shRNA control; VC: vehicle control. * indicates 0.01

163

All mice from control groups without DTX treatment developed regional lymph node metastases; no lymph node metastases were seen in CD44- or CD147-KD or control mice treated with DTX (Figure 5-2). Tumour volumes of mice with knock-down xenografts were less than control groups, and tumour volumes of DTX-treated mice were less than VC-treated mice. Typical tumour sizes including lymph node metastases are shown in Figure 5-1C.

Figure 5-2. Lymph node metastases in different CaP groups after treatments. Representative images demonstrating lymph node metastases in histology (H&E staining) 8 wks post cell inoculation in different CaP groups with different treatments. Lymph node metastases was found in PC-3M-luc xenograft mice (A) and PC-3M-luc-scr xenograft mice (B) but not in PC-3M-luc-CD44-KD xenograft mice (C) and PC-3M-luc-CD147 xenograft mice (D). The arrows indicate typical PC-3M-luc metastatic cancer cells in local regional lymph nodes. Magnification: x 100, x 200, x 400 as indicated in the figure. KD: knock- down; scr: scrambled shRNA control.

164

5.3.3 CaP tumour xenografts histology following CD44 or CD147-KD with or without DTX treatment

To compare the histology of each group, tumours from control mice (PC-3M-luc- and PC- 3M-luc-scr-xenografts) and knock-down mice (PC-3M-luc-CD44-KD- and PC-3M-luc- CD147-KD-xenografts) treated with VC and DTX were harvested at the end of the experiments, paraffin embedded, sectioned and stained with H&E. With light microscopy (Figure 5-3), PC-3M-luc and PC-3M-luc-scr tumour xenografts in VC treated groups consisted of tightly packed cells. Loosely packed or dispersed tumour cells associated with areas of cell death were apparent in both PC-3M-luc-CD44-KD and PC-3M-luc-CD147- KD xenografts (Figure 5-3A). In DTX-treated groups, the tumours were less densely packed with necrotic and apoptotic regions in all groups. This was greater in PC-3M-luc- CD44-KD and PC-3M-luc-CD147-KD xenografts, relative to PC3-3M-luc or PC-3M-luc- scr tumours (Figure 5-3B).

165

166

Figure 5-3. Histology and CD31, CD44 and CD147 immunolabelling expression of s.c. xenografts. Morphological changes are shown in PC-3M-luc-CD44-KD and PC-3M-luc- CD147-KD xenografts with VC treatment (A). Obvious targeted lesions are shown in PC- 3M-luc-CD44-KD and PC-3M-luc-CD147-KD xenografts with DTX treatment compared to the xenografts from PC-3M-luc and PC-3M-luc-scr cell lines (B). Low to medium CD31 expression is shown in PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD treated with VC and high CD31 expression is shown in PC-3M-luc and PC-3M-luc-src xenografts treated with VC (P<0.05) (C). Markedly reduced CD31 expression is shown in PC-3M-luc-CD44- KD and PC-3M-luc-CD147-KD xenografts treated with DTX and medium CD31 expression is shown in PC-3M-luc and PC-3M-luc-scr xenografts treated with DTX (P<0.05) (D). High CD44 expression is shown in PC-3M-luc and PC-3M-luc-scr xenografts; medium CD44 expression is seen in PC-3M-luc-CD147-KD xenografts; low CD44 expression is seen in PC-3M-luc-CD44-KD xenografts (P<0.05) (E). High CD147 expression is shown in PC-3M-luc and PC-3M-luc-scr xenografts; low CD147 expression is seen in PC-3M-luc-CD44-KD xenografts; very low CD147 expression is seen in PC-3M- luc-CD147-KD xenografts (P<0.05) (F). Brown color staining indicates positive expression while blue hematoxylin stains nuclei. Magnification: x 100 in all images. DTX: docetaxel; KD: knock-down; scr: scrambled shRNA control; VC: vehicle control.

167

5.3.4 Assessment of tumour microvascular density in CD44 or CD147-KD tumour xenografts with/without DTX treatment

To assess the effect of CD44 or CD147-KD on vascular density in different xenografts, frozen sections of tumours were stained with CD31 MAb. Representative images for CD31 expression in VC-treated mice (Figure 5-3C) and DTX-treated mice (Figure 5-3D) are shown. MVD (number of CD31 positive cells/ hpf) was high in PC-3M-luc and PC-3M- luc-scr xenografts treated with VC, and decreased in VC treated PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD xenografts, with the greatest reduction in DTX treated in PC-3M- luc-CD44-KD and PC-3M-luc-CD147-KD xenografts (Figure 5-3C and D). The numbers of CD31+ vessels/per hpf in PC-3M-luc, PC-3M-luc-scr, PC-3M-luc- CD44-KD and PC-3M-luc-CD147-KD groups were 16-20/hpf, 9-13/hpf, 6-10/hpf, 5-8/hpf, respectively in VC-treated mice. The numbers of CD31+ vessels/per hpf in PC-3M-luc, PC- 3M-luc-scr, PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD groups were 14-19/hpf, 9- 12/hpf, 6-8/hpf, 2-5/hpf, respectively in DTX-treated mice. The CD31 immunostaining results are summarized in Table 5-2. The difference in staining intensity for CD31 between PC-3M-luc-CD44-KD/PC-3M-luc-CD147-KD and PC-3M-luc/PC-3M-luc-scr cell lines was significant (P<0.05). PC-3M-luc-CD147-KD xenografts had the least CD31 expression in DTX-treated mice.

5.3.5 CD44 and CD147 expression in CaP xenografts after knocking down of CD44 or CD147

At the end of the experiments, expression of CD44 and CD147 was examined for the VC- treated xenografts from PC-3M-luc, PC-3M-luc-scr, PC-3M-luc-CD44-KD and PC-3M- luc-CD147-KD cells with CD44 and CD147 antibodies. These results indicated high levels of CD44 expression in PC-3M-luc and PC-3M-luc-scr xenografts (95-100%, +++); intermediate levels of CD44 in CD147-KD xenografts (40-50%, ++); low levels of CD44 in CD44-KD xenografts (30%-40%, +) (Figure 5-4E, Table 5-2). The significant difference in staining intensity for CD44 expression was found between PC-3M-luc-CD44-KD/PC- 3M-luc-CD147-KD and PC-3M-luc/PC-3M-luc-scr cell lines (P<0.05). High levels of 168

CD147 were observed in PC-3M-luc (80-90%, +++) and PC-3M-luc-scr xenografts (70- 80%, +++); low levels of CD147 in CD44-KD xenografts (20-30%, +); very low levels of CD147 in CD147-KD xenografts (~20%, +) (Figure 5-4F, Table 5-2). The difference in staining intensity for CD147 expression between PC-3M-luc-CD44-KD/PC-3M-luc- CD147-KD and PC-3M-luc/PC-3M-luc-scr cell lines was significant (P<0.05). These results suggest that CD44 and CD147-KD can significantly reduce CD44/CD147 expression and affect each other in PC-3M-luc xenografts.

5.3.6 Cell proliferation, death and apoptosis in CaP xenografts after CD44 or CD147- KD with or without DTX treatment

To investigate whether knock down of CD44/CD147 in CaP cells affect proliferative potential either alone or in response to DTX in vivo, tumour sections from nude mice were assessed for Ki-67 expression. At the end of experiments (8 wks), high numbers of Ki-67+ tumour cells were seen in PC-3M-luc (70-80%) and PC-3M-luc-scr (80-90%) xenografts; modest Ki-67+ tumour cells in PC-3M-luc-CD44-KD (60-80%) and PC-3M-luc-CD147- KD (60-70%) xenografts with VC-treatment, suggesting that the knock-down has limited effects on the proliferation of the CaP cells. The difference in staining intensity for Ki-67+ cells between PC-3M-luc-CD44-KD/PC-3M-luc-CD147-KD and PC-3M-luc/PC-3M-luc- scr cell lines was significant (P<0.05). DTX treatment successfully reduced the number of proliferative cells in all groups, and again with small differences between the control and the knock-down groups (Table 5-2). Representative images are shown in Figure 5-4A and B. To investigate whether apoptosis may be involved in the targeted lesions of tumour xenografts, TUNEL assay was used. Representative results are shown in Figure 5-4C and D. At the end of experiments, TUNEL-positive tumour cells from PC-3M-luc-CD44-KD (28-35/hpf) and PC-3M-luc-CD147-KD (30-36/hpf) xenografts in DTX-treated groups displayed typical apoptotic cell morphology with nuclear chromatin condensation and fragmentation. Tumour cells from PC-3M-luc (11-15/hpf) and PC-3M-luc-scr (15-19/hpf) xenografts with DTX-treatment showed fewer apoptotic cells while tumours from PC-3M- luc-CD44-KD (17-21/hpf) and PC-3M-luc-CD147-KD (12-18/hpf) xenografts with VC- 169 treated groups showed few apoptotic cells; almost no apoptotic cells were found in PC-3M- luc and PC-3M-luc-scr xenografts for VC-treated mice (Figure 5-4C and D, Table 5-2). The significant difference in staining intensity for TUNEL-positive areas was seen between PC-3M-luc-CD44-KD/PC-3M-luc-CD147-KD and PC-3M-luc/PC-3M-luc-scr cell lines (P<0.05). There were very high levels of caspase-3 (active)+ cells in PC-3M-luc-CD44-KD (30-35/hpf) and PC-3M-luc-CD147-KD (20-25/hpf) xenografts after DTX treatment; high level of caspase-3 (active)+ cells in PC-3M-luc (8-12/hpf) and PC-3M-luc-scr (8-13/hpf) xenografts with DTX treatment; medium level of caspase-3 (active)+ cells in PC-3M-luc- CD44-KD (7-10/hpf) and PC-3M-luc-CD147-KD (12-17/hpf) with VC treatment; and only few caspase-3 (active)+ cells in PC-3M-luc (0-5/hpf) and PC-3M-luc-scr (1-7/hpf) with VC treatment (Figure 5-4E and F, Table 5-2). The difference in staining intensity for caspase- 3 (active) between PC-3M-luc-CD44-KD/PC-3M-luc-CD147-KD and PC-3M-luc/PC-3M- luc-scr cell lines was significant (P<0.05). Overall, the regression of s.c. tumours, reduced tumour weight and vascular density were associated with a decrease in Ki-67 expression (cell proliferation), increases in TUNEL-positive lesions and expression of apoptotic proteins [caspase-3 (active)]. The staining results for Ki-67, TUNEL and caspase-3 (active) are summarized in Table 5-2.

170

171

Figure 5-4. Ki-67, TUNEL, and Caspase-3 (active) expression at the end of experiments after knocking down CD44 or CD147 and treatment with DTX. Very strong expression Ki-67 is seen in PC-3M-luc and PC-3M-luc-scr xenografts treated with VC; medium expression Ki-67 is seen in PC-3M-luc-CD44-KD and PC-3M-luc-CD147- KD xenografts treated with VC (P<0.05) (A). Medium to high expression Ki-67 is seen in PC-3M-luc and PC-3M-luc-scr xenografts treated with DTX; low expression Ki-67 is seen in PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD xenografts treated with DTX (P<0.05) (B). No TUNEL-positive cells are seen in PC-3M-luc and PC-3M-luc-scr xenografts treated with VC; low TUNEL-positive cells are seen in PC-3M-luc-CD44-KD and PC-3M-luc- CD147-KD xenografts treated with VC (C). Medium TUNEL-positive cells are seen in PC- 3M-luc and PC-3M-luc-scr xenografts treated with DTX; high TUNEL-positive cells are seen in PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD xenografts treated with DTX (P<0.05) (D). Very low caspase-3 (a) cells are seen in PC-3M-luc and PC-3M-luc-scr xenografts treated with VC; low to medium caspase-3 (a) cells are seen in PC-3M-luc- CD44-KD and PC-3M-CD147-KD xenografts treated with VC (P<0.05) (E). High caspase- 3 (a) cells are seen in PC-3M-luc and PC-3M-luc-scr xenografts treated with DTX; very high caspase-3 (a) cells are seen in PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD treated with DTX (P<0.05) (F). The brown color indicates nuclear staining for Ki-67 and caspase-3 (a) antibodies; blue indicates nuclear staining with hematoxylin. TUNEL positive cells are brown counterstained with methyl green nuclear staining. Magnification: x 100 in all images. a: active; DTX: docetaxel; KD: knock-down; scr: scrambled shRNA control; VC: vehicle control.

172

Table 5-2. The intensity of immunohistochemical staining of CD44, CD147, CD31, Ki-67, Caspase-3(active), TUNEL in tumour xenografts from PC-3M-luc, PC-3M-luc-scr, PC-3M-luc-CD44-KD and PC-3M-luc-CD147-KD cell line with DTX and/or vehicle treatment PC-3M-luc PC-3M-luc-scr PC-3M-luc-CD44-KD PC-3M-luc-CD147-KD VC DTX VC DTX VC DTX VC DTX 95-100% 95-100% 30-40% 40-50% CD44

+++ +++ + ++ N/A N/A N/A N/A 80-90% 70-80% 20-30% ~20% CD147 +++ +++ + + CD31 16-20/hpf 14-19/hpf 9-13/hpf 9-12/hpf 6-10/hpf 6-8/hpf 5-8/hpf 2-5/hpf +++ +++ +++ +++ ++ + ++ + Ki-67 70-80% 60-70% 80-90% 60-70% 60-80% 50-60% 60-70% 50% +++ +++ +++ +++ ++ + ++ + Caspase-3 (a) 0-5/hpf 8-12/hpf 1-7/hpf 8-13/hpf 7-10/hpf 30-35/hpf 12-17/hpf 20-25/hpf - + - + + ++ + ++ TUNEL 0-5/hpf 11-15/hpf 0-6/hpf 15-19/hpf 17-21/hpf 28-35/hpf 12-18/hpf 30-36/hpf - ++ - ++ + +++ + ++

Notes: a: active; DTX: docetaxel; hpf: high power fields; KD: knock-down; N/A: not available; scr: scrambled shRNA control; VC: vehicle control.

173

5.3.7 BLI monitoring of bioluminescence in PC-3M-luc, PC-3M-luc-scr, PC-3M-luc- CD147-KD, and PC-3M-luc-CD44-KD cell lines in vitro

CaP cell lines PC-3M-luc, PC-3M-luc-scr, PC-3M-luc-CD147-KD, and PC-3M-luc-CD44- KD were assessed for bioluminescent signals individually. It was found that after scr transfection or knock-down of CD44 or CD147, the activity of luciferase was affected. PC- 3M-luc-CD147-KD showed the strongest signals, followed by PC-3M-luc, PC-3M-luc-scr, and PC-3M-luc-CD44-KD cells showed the lowest bioluminescence (not shown). The bioluminescence intensity of PC-3M-luc before i.c. cell inoculation was shown in Figure 5- 5A.

5.3.8 BLI monitoring of in vivo PC-3M-luc metastases

The PC-3M-luc cell line was used to establish the i.c. bone metastasis model. Briefly, 3 x 106 cells were injected into the left ventricle of the mouse. Lung metastases were observed at wk 1, and bone metastases started to be present in wk 2. At wk 3-4 the tumours became prominent using BLI. The growth kinetics of tumours was represented by the change of average total photon flux in over 4 wks in Figure 5-5D. Representative BLI images showing metastases development was shown in Figure 5-5B. The major sites of metastasis included: bone, jaw, lung, liver, and kidney. Post 5 wks tumour cell innoculation, BLI images were taken before and after necropsy to locate bioluminescent positive tumours, and representative images are shown in Figure 5-5C. The presence of metastases was confirmed by histology staining. The representative histology of CaP metastases in bones (Figure 5-6A-C) and lung (Figure 5-6D) are shown in Figure 5-6.

174

175

Figure 5-5. BLI monitoring of in vitro and in vivo bioluminescence and tumour development post cell inoculation. (A) Bioluminescence of PC-3M-luc cell line before i.c. cell inoculation. (B) Representative BLI images showing PC-3M-luc metastatic development in vivo from wk 1 to wk 4 post cell inoculation. (C) Representative images showing the locations of BLI-positive metastases (bone, lung, adrenal glands, and rib) before and after necropsy. (D) Tumour (PC-3M-luc) progression from wk 1 to wk 4 as represented by total bioluminescent photons/second.

Figure 5-6. Confirmation of CaP metastases by histopathology. A-C. Representative images showing H&E staining of the tibia which were also positive using BLI from different mice. D. Representative image showing H&E staining of the lung which was positive in BLI. Arrows mark the typical carcinoma cells. Magnification: x 20 in all images.

176

5.4 Discussion

To validate the in vitro findings in Chapter 4, a further investigation of the roles of CD44 and CD147 in CaP metastasis and chemosensitivity was conducted using an s.c. xenograft animal model. Lymph node metastases derived from s.c. human CaP PC-3 xenografts were reported by another research group (Ware JL et al., 1982). Our group has previously demonstrated the development of 100% lymph node metastases in nude mice injected with PC-3 cells post 8 wks cell inoculation (Li Y et al., 2002). The current study demonstrated that the PC-3M-luc xenograft model developed from this study has 100% tumour take, with 100% local regional lymph node metastases in wild-type CaP cell xenografted mice post 8 wks cell inoculation. This provides an appropriate model to mimic clinical CaP metastasis. The findings from the current study indicated that CD44 or CD147-KD in VC treatment strongly regressed tumour progression for at least 8 wks. Tumour volumes at the end of experiment in the CD44 or CD147-KD mice decreased by 37% and 35% respectively compared with the scr-controls. After 3 wks continuous treatment with DTX, obvious tumour growth regression was found in CD44 or CD147-KD mice compared with the controls. The sensitivity rate to DTX treatment was higher in CD44 or CD147-KD cells compared to control cells. These results further confirmed the in vitro colony assay observations. CD44 or CD147-KD cell lines treated with VC and DTX can also completely prevent lymph node metastases for at least 8 wks, during which period all control mice treated with VC developed lymph node metastases. These results suggest that CD44 or CD147-KD inhibit the growth of PC-3M-luc tumours, increase DTX response and prevent local regional lymph node metastases, and that combining CD44 or CD147-KD with DTX has advantages over a single treatment approach and can greatly reduce tumour growth and reduce tumour burden. In the current study, shRNA lentiviral transfection was used for the CD44 or CD147-KD cell lines to stably reduce CD44 and CD147 expression and ensure continued downregulation during the in vivo tumourgenecity study. The current study indicates that in vitro CD44 and CD147-KD remained downregulated in the in vivo biological system for 8 wks post cell inoculation, and that the data from the current model system are reliable. Compared to control cell lines, CD44 and CD147-KD affected the expression of each other 177 in the animal xenografts, consistent with the in vitro findings from the same cell lines (see Figure 4-1A and B). In CD44 or CD147-KD xenografts treated with VC or DTX, the tumour structure was comparatively dispersed, with evidence of scattered targeted areas. Angiogenesis plays a critical role in tumour progression, providing adequate nutritional and oxygen supply essential for tumour proliferation and metastasis, and promoting tumour recovery following cytotoxicity (Mesiano S et al., 1998). In fact, the angiogenic potential of a tumour is directly correlated with poor prognosis (Nishida N et al., 2004). In the present study, MVD (CD31 expression/hpf) was profoundly reduced in the CD44 or CD147-KD xenografts, especially the CD147-KD tumours, suggesting that CD44 and CD147 are related to CaP angiogenesis and that targeting CD44 and CD147 can inhibit CaP angiogenesis. CD147 is reported to affect angiogenesis mainly via three mechanisms: a) Inducing proteinases which cleave VEGF from the ECM; b) Stimulating the production of tumour-derived VEGF; and c) Increasing VEGFR2 expression on the endothelial cells (Bougatef F et al., 2009). However, the exact mechanism by which CD147 affects angiogenesis in CaP remains to be determined. As for how CD44 can influence CaP angiogenesis, one possibility is that CD44 regulates the production of MMPs which cleave ECM-bound VEGF. Reduced MMP9 production has been observed in CD44-KD cells (preliminary observation). Another possibility is that CD147 downregulation induced inhibition of angiogenesis leading to a secondary CD44 associated effect on tumour vasculature. DTX is now considered the preferred chemotherapeutic agent for CRPC and bone metastasis (Ide H et al., 2010). The most widely described mechanism by which DTX achieves this effect is through its activity as a mitotic spindle poison, disrupting microtubule dynamics and inducing G2/M cell cycle arrest, a downstream effect thought to be related to the phosphorylation of Bcl-2 (Mollinedo F et al., 2003). As expected, DTX could inhibit tumour growth compared with VC treatment (P<0.05, see Figure 5-1), with larger targeted areas and reduced MVD in DTX-treated mice. In a recent study, our group also demonstrated that DTX could inhibit epithelial ovarian cancer growth in an i.p. OVCAR-3 model through inhibition of tumour angiogenesis (Wang L et al., 2011). In the current study, CD44 or CD147-KD xenografts treated with DTX showed significant targeted areas with tumour islands and obviously reduced MVD, suggesting that DTX may

178 have a similar anti-angiogenic function as seen in the epithelial ovarian cancer model (Wang L et al., 2011). The exact mechanisms by which the combination of CD44 or CD147-KD and DTX affect angiogenesis and vascular regression will be investigated in future studies.

179

Chapter 6 – Summary and perspectives

180

Summary

Castration-resistant prostate cancer is the major problem in current CaP therapy, and as few treatment options are available for this stage of the disease, most patients ultimately die from metastasis. Over the last decade, new therapies have been investigated, including targeted therapy with prodrugs, immunotherapy, gene therapy, and inhibition of angiogenesis. The importance of chemotherapy was not addressed until the more recent reports showed a survival benefit with DTX treatment. Chemoresistance and cancer metastasis are still the main causes of treatment failure and mortality in CRPC patients. Overexpression of certain TAAs plays a pivotal role in cancer progression and is shown to be correlated with various stages of CaP. It is therefore worthwhile to investigate and employ their functions in diagnosis and therapeutics. The current thesis studies focus on exploring the roles CD44 and CD147 in metastasis and chemoresistance during CaP progression. The first part of the work in this thesis explored the relationship between the expression of CD44 and CD147 in primary human CaP tissues and metastatic CaP cell lines, and the potential clinical significance of CD44 and CD147 expression (Chapter 3). CD147 and specifically CD44v (CD44v3-10) were identified to be positively associated with CaP progression. CD44v3-10 is the longest isoform of CD44v, and was shown to be overexpressed in metastatic CaP cell lines and high grade CaP in this study. Similar results were also seen for CD147 expression in metastatic CaP cell lines and high grade CaP. The co-localization of CD44v3-10 and CD147 was confirmed and the expression levels of both were correlated with sensitivity to the chemotherapeutic agent docetaxel in metastatic CaP cell lines. These results support the use of CD44v3-10 and CD147 as potential therapeutic targets, and pose questions related to whether expression of CD44 and CD147 in CaP are functionally crucial for disease aggressiveness, and if so, what are the mechanisms involved, and whether and how they interact. In the following in vitro studies (Chapter 4), knock down of CD44 (s and v isoforms) and CD147 individually in a metastatic CaP cell line (PC3), demonstrated that the expression of one of these proteins simultaneously down-regulated the expression of the other (i.e. knock- down of CD44 decreased expression of CD147, and vice-versa). Decreased expression of MCT4 and MRP2, as well as p-Akt and p-Erk was also seen in the CD44 and CD147

181 knock-down cell line. The alteration of cell surface transporter proteins and signalling pathways may link the function of CD44 and CD147 to the advanced stage of CaP. Reduced invasiveness and chemoresistance was also ascertained in the in vitro functional tests. Given that knock down of CD44 and CD147 individually leads to a suppression of malignant cancer behavior in vitro, further investigations of the roles of CD44 and CD147 in vivo were considered (Chapter 5). Using an in vivo s.c. xenograft mouse model, KD of CD44 or CD147 reduced tumourigenicity and angiogenesis in knock-down CaP xenografts compared with control CaP xenografts (Chapter 5). Furthermore, knock-down of CD44 or CD147 could reduce lymph node metastasis and increase DTX chemosensitivity. CD44 or CD147-KD combined with DTX treatment was also shown to be more effective in inhibiting tumour growth, and reducing tumour volume and MVD in this model. While the mechanisms for this remain unclear, preliminary studies indicated that apoptosis was primarily involved (TUNEL and active caspase-3). Reduced cell proliferation was also observed in CD44 or CD147-KD and DTX-treated CaP xenografts, and this was further reduced in CD44/CD147-KD xenografts combined with DTX treatment. The number of apoptotic cells (TUNEL-positive) and caspase-3 (active) positive cells in PC-3M-luc-CD44/CD147-KD tumours increased, consistent with tumour regression being related to both reduced cancer cell proliferation and increased apoptosis. These findings require further investigation including studies of the effect of CD44v3-10, and the use of a cell line with a combined CD44 and CD147 knock-down to further dissect functional interactions of these two proteins. Overall, these studies demonstrate for the first time that both CD44 and CD147 are involved in CaP proliferation, invasion and chemoresistance, and that this may be mediated through activation of both PI3K/Akt and MAPK/Erk pathways in vitro. Furthermore, reducing either CD44 or CD147 expression can effectively reduce CaP tumour growth, enhance the response to DTX, reduce angiogenesis and induce apoptosis in vivo. This study describes the roles of CD44 and CD147 in CaP metastasis and drug resistance. CD44 and CD147 are potentially important co-regulators in drug resistance and metastasis. Their activation triggers overlapping downstream pathways. However, it is not yet clear whether their interactions are direct or indirect. Some studies have reported that they can act indirectly via other molecules to foster the expression of each other and manipulate tumour

182 aggressiveness (Orian-Rousseau V, 2010, Stern R, 2005). For example, the export of lactate by the CD147-MCT complex stimulates CD44 variant expression (Stern R, 2005). Other evidence of an indirect effect comes from observations related to the production of HA via CD147, which is critical for the activation of downstream CD44 pathways (Marieb EA et al., 2004). In that study, during tumour invasion, CD147-induced MMP9 was required to be trapped on the cell surface by CD44 clusters in order to mediate invasive activity (Orian- Rousseau V, 2010). Clearly, there is an interconnected close relationship between CD44 and CD147, and these proteins exert essential influence on each other during tumour progression. Consequently, combined targeting of CD44 and CD147 with DTX or other new chemoreagents such as MDV3100 and Cabazitaxel could provide a potent therapeutic approach for advanced and recurrent CRPC.

Perspectives

Clearly, the overexpression of CD147 and CD44 in CaP can significantly impact the clinical behaviour of tumours, especially in relation to tumour invasion and metastases. As such, CD147 and CD44 represent accessible targets for therapeutic intervention. However, a more comprehensive elucidation of their functions in CaP is needed to further establish how advanced CaP can be controlled by targeting these proteins, especially in relation to the isoforms of CD44v. To date there are very few investigations specifically focusing on the function of CD44 variants in CaP. The next step following from the current studies would be to design studies to investigate the outcome of modulating a specific variant or a set of variants of CD44. It would also be of significance to investigate whether there is a specific CD44 isoform which is responsible for the interaction between CD44 and CD147, and what is the molecular basis underling their interactions. An essential further research approach is to study the roles of CD44 (s or v) and CD147 in relevant in vivo models. In this thesis a CaP cell line with a stable expression of luciferease gene has been established, and preliminary studies in Chapter 5 show that monitoring of bioluminescence provides an excellent tool for the non-invasive assessment of disease progression at different stages in a live animal. Future studies with orthotopic and bone metastasis models and bioluminescence monitoring will provide the best

183 candidates to investigate the mechanisms of how proteins can regulate disease progression and bone metastasis in the context of tumour-microenvironment interactions. Moreover, they also represent feasible models to evaluate the effect of targeted therapies in vivo. As AR plays a very important role in CaP metastasis and drug resistance, investigating the relationship of AR with CD44 and CD147 would also be very interesting and important. This work can be performed using our current human CaP tissue archive for co-localization, in vitro CaP cell lines and in vivo animal models. To further confirm the roles of CD44 and CD147 in CaP metastasis and chemoresistance in future studies, generation of stable CD147 and CD44 overexpression in CaP cells will be necessary. The overexpression of CD44 or CD147 or both CD44/CD147 CaP cell lines could be used for functional studies using our current experimental paradigms. From the drug development point of view, possible targeted therapies include antibodies to inactivate specific proteins, vaccination against tumour-specific antigens, antisense oligonucleotides against messenger RNA, radiolabeled or toxin-conjugated anti-CD147 or CD44 antibodies, molecules that block specific proteins and pathways, or gene therapy for insertion of wild-type genes to restore the function of defective tumour-suppressor genes. Any one of these approaches targeting CD44/CD147 could be investigated in the future to improve current CaP treatment approaches. For directed therapy against specific genes, a major safety concern is the toxicity arising from normal organs expressing certain levels of the target genes. Recently a CD44v6 directed therapy was abolished at the clinical trial stage, although it had been considered promising in regard to its anti-tumour effects (Tijink BM et al., 2006). Therefore, besides the effect of the drug candidate, careful design of the drug delivery carrier is critical. The technique of a tissue specific shRNA delivery system holds promise for effective silencing of oncogenes, without causing toxicity in normal tissues. shRNA can be stably expressed and can continuously silence tumour-causing genes. Although viral delivery of shRNA are mostly used in animal models, generally a non-viral delivery system would be more suitable for humans, related to the activation of a host immune response and variation in the acceptability to viral vectors. The use of nanoparticles as drug carriers has been improved over the last decade and this technique is now well accepted because of its high affinity and bio-degradablility. By

184 enclosing a tissue-specific promoter-driven Cre recombinase together with a shRNA gene in nanoparticle-coatings, the shRNA can be effectively released in the diseased organ, with no evidence of toxicity to date (Misra S et al., 2009). This approach addresses the optimization of the efficacy and toxicity, and therefore provides insight in designing novel gene targeted therapies. Targeting CD44/CD147 via nanoparticles and shRNA complexes could be of potential benefit for future CaP combination therapies. Since CD44v3-10/CD147 are only expressed in a proportion of advanced CaP (heterogeneous expression), it is necessary to assess the efficacy of targeted therapies in relation to the CD44v3-10/CD147 expression in the individual patient, rather than looking at overall efficacy. Once such therapies reach clinical practice, patients will need to be selected on the basis of their individual tumour CD44/CD147 profile. This may be assessed using immunohistochemistry on biopsies from local recurrences or distant metastases. To conclude, establishing that over-expression of CD147 and CD44 contributes to the metastasis and drug resistance of CaP, indicates that modulation of CD147, CD44 or CD147/CD44 in pre-malignant and malignant cells may alter the tumourgenic pathogenesis of CaP. Future investigations with respect to the functions of CD44 variants and elucidation of the molecular interactions between CD44 and CD147 are essential. Finally an effective combination treatment strategy with traditional chemotherapy and targeted therapy will significantly improve current treatment modalities for the clinical control of advanced and progressive CaP.

185

References

Abdollahi, A., Griggs, D. W., Zieher, H., Roth, A., Lipson, K. E., Saffrich, R., et al. 2005. Inhibition of alpha(v)beta3 integrin survival signaling enhances antiangiogenic and antitumor effects of radiotherapy. Clin Cancer Res, 11, 6270-9.

Abraham, B. K., Fritz, P., Mcclellan, M., Hauptvogel, P., Athelogou, M. and Brauch, H. 2005. Prevalence of CD44+/CD24-/low cells in breast cancer may not be associated with clinical outcome but may favor distant metastasis. Clin Cancer Res, 11, 1154-9.

Adams, J. Y., Johnson, M., Sato, M., Berger, F., Gambhir, S. S., Carey, M., et al. 2002. Visualization of advanced human prostate cancer lesions in living mice by a targeted gene transfer vector and optical imaging. Nat Med, 8, 891-7.

Aihw 2010. Cancer in Australia : an overview., Cancer series no. 60. Cat. no. CAN 56. Canberra, AIHW.

Alam, N., Goel, H. L., Zarif, M. J., Butterfield, J. E., Perkins, H. M., Sansoucy, B. G., et al. 2007. The integrin-growth factor receptor duet. J Cell Physiol, 213, 649-53.

Alam, T. N., O'hare, M. J., Laczko, I., Freeman, A., Al-Beidh, F., Masters, J. R., et al. 2004. Differential expression of CD44 during human prostate epithelial cell differentiation. J Histochem Cytochem, 52, 1083-90.

Albers, M. J., Bok, R., Chen, A. P., Cunningham, C. H., Zierhut, M. L., Zhang, V. Y., et al. 2008. Hyperpolarized 13C lactate, pyruvate, and alanine: noninvasive biomarkers for prostate cancer detection and grading. Cancer Res, 68, 8607-15.

Als, A. B., Dyrskjot, L., Von Der Maase, H., Koed, K., Mansilla, F., Toldbod, H. E., et al. 2007. Emmprin and survivin predict response and survival following cisplatin- containing chemotherapy in patients with advanced bladder cancer. Clin Cancer Res, 13, 4407-14.

186

Anteby, E. Y., Greenfield, C., Natanson-Yaron, S., Goldman-Wohl, D., Hamani, Y., Khudyak, V., et al. 2004. Vascular endothelial growth factor, epidermal growth factor and fibroblast growth factor-4 and -10 stimulate trophoblast plasminogen activator system and metalloproteinase-9. Molecular Human Reproduction, 10, 229- 35.

Aprelikova, O., Pajusola, K., Partanen, J., Armstrong, E., Alitalo, R., Bailey, S. K., et al. 1992. FLT4, a novel class III receptor tyrosine kinase in chromosome 5q33-qter. Cancer Research, 52, 746-8.

Arbiser, J. L., Moses, M. A., Fernandez, C. A., Ghiso, N., Cao, Y., Klauber, N., et al. 1997. Oncogenic H-ras stimulates tumor angiogenesis by two distinct pathways. Proc Natl Acad Sci U S A, 94, 861-6.

Auzenne, E., Ghosh, S. C., Khodadadian, M., Rivera, B., Farquhar, D., Price, R. E., et al. 2007. Hyaluronic acid-paclitaxel: antitumor efficacy against CD44(+) human ovarian carcinoma xenografts. Neoplasia, 9, 479-86.

Azam, F., Mehta, S. and Harris, A. L. 2010. Mechanisms of resistance to antiangiogenesis therapy. Eur J Cancer, 46, 1323-32.

Baade, P. D., Youlden, D. R. and Krnjacki, L. J. 2009. International epidemiology of prostate cancer: geographical distribution and secular trends. Mol Nutr Food Res, 53, 171-84.

Baba, M., Inoue, M., Itoh, K. and Nishizawa, Y. 2008. Blocking CD147 induces cell death in cancer cells through impairment of glycolytic energy metabolism. Biochem Biophys Res Commun, 374, 111-6.

Bailar, J. C., 3rd, Mellinger, G. T. and Gleason, D. F. 1966. Survival rates of patients with prostatic cancer, tumor stage, and differentiation--preliminary report. Cancer Chemother Rep, 50, 129-36.

187

Balbay, M. D., Pettaway, C. A., Kuniyasu, H., Inoue, K., Ramirez, E., Li, E., et al. 1999. Highly metastatic human prostate cancer growing within the prostate of athymic mice overexpresses vascular endothelial growth factor. Clinical Cancer Research, 5, 783-9.

Banerjee, P. P., Banerjee, S. and Brown, T. R. 2001. Increased androgen receptor expression correlates with development of age-dependent, lobe-specific spontaneous hyperplasia of the brown Norway rat prostate. Endocrinology, 142, 4066-75.

Banzato, A., Bobisse, S., Rondina, M., Renier, D., Bettella, F., Esposito, G., et al. 2008. A paclitaxel-hyaluronan bioconjugate targeting ovarian cancer affords a potent in vivo therapeutic activity. Clin Cancer Res, 14, 3598-606.

Becker, C. M., Farnebo, F. A., Iordanescu, I., Behonick, D. J., Shih, M.-C., Dunning, P., et al. 2002. Gene therapy of prostate cancer with the soluble vascular endothelial growth factor receptor Flk1. Cancer Biology & Therapy, 1, 548-53.

Bellmunt, J., Attard, G., Bahl, A., Huland, H., Klotz, L., Kuban, D., et al. 2012. Advances in the management of high-risk localised and metastatic prostate cancer. BJU Int, 109 Suppl 2, 8-13.

Bello, L., Lucini, V., Carrabba, G., Giussani, C., Machluf, M., Pluderi, M., et al. 2001. Simultaneous inhibition of glioma angiogenesis, cell proliferation, and invasion by a naturally occurring fragment of human metalloproteinase-2. Cancer Res, 61, 8730-6.

Benjamin, L. E., Golijanin, D., Itin, A., Pode, D. and Keshet, E. 1999. Selective ablation of immature blood vessels in established human tumors follows vascular endothelial growth factor withdrawal. Journal of Clinical Investigation, 103, 159-65.

Bettencourt, M. C., Bauer, J. J., Sesterhenn, I. A., Connelly, R. R. and Moul, J. W. 1998. CD34 immunohistochemical assessment of angiogenesis as a prognostic marker for

188

prostate cancer recurrence after radical prostatectomy. Journal of Urology, 160, 459-65.

Bin Hafeez, B., Adhami, V. M., Asim, M., Siddiqui, I. A., Bhat, K. M., Zhong, W., et al. 2009. Targeted knockdown of Notch1 inhibits invasion of human prostate cancer cells concomitant with inhibition of matrix metalloproteinase-9 and urokinase plasminogen activator. Clin Cancer Res, 15, 452-9.

Birck, A., Ahrenkiel, V., Zeuthen, J., Hou-Jensen, K. and Guldberg, P. 2000. Mutation and allelic loss of the PTEN/MMAC1 gene in primary and metastatic melanoma biopsies. Journal of Investigative Dermatology, 114, 277-80.

Bisson, I. and Prowse, D. M. 2009. WNT signaling regulates self-renewal and differentiation of prostate cancer cells with stem cell characteristics. Cell Res, 19, 683-97.

Biswas, C., Zhang, Y., Decastro, R., Guo, H., Nakamura, T., Kataoka, H., et al. 1995. The human tumor cell-derived collagenase stimulatory factor (renamed EMMPRIN) is a member of the immunoglobulin superfamily. Cancer Res, 55, 434-9.

Bjorndahl, M., Cao, R., Nissen, L. J., Clasper, S., Johnson, L. A., Xue, Y., et al. 2005. Insulin-like growth factors 1 and 2 induce lymphangiogenesis in vivo. Proc Natl Acad Sci U S A, 102, 15593-8.

Bjorndahl, M. A., Cao, R., Burton, J. B., Brakenhielm, E., Religa, P., Galter, D., et al. 2005. Vascular endothelial growth factor-a promotes peritumoral lymphangiogenesis and lymphatic metastasis. Cancer Res, 65, 9261-8.

Blezinger, P., Wang, J., Gondo, M., Quezada, A., Mehrens, D., French, M., et al. 1999. Systemic inhibition of tumor growth and tumor metastases by intramuscular administration of the endostatin gene. Nature Biotechnology, 17, 343-8.

Bok, R. A., Halabi, S., Fei, D. T., Rodriquez, C. R., Hayes, D. F., Vogelzang, N. J., et al. 2001. Vascular endothelial growth factor and basic fibroblast growth factor urine

189

levels as predictors of outcome in hormone-refractory prostate cancer patients: a cancer and leukemia group B study. Cancer Research, 61, 2533-6.

Bolenz, C., Fernandez, M. I., Tilki, D., Herrmann, E., Heinzelbecker, J., Ergun, S., et al. 2009. The role of lymphangiogenesis in lymphatic tumour spread of urological cancers. BJU Int, 104, 592-7.

Bono, A. V., Celato, N., Cova, V., Salvadore, M., Chinetti, S. and Novario, R. 2002. Microvessel density in prostate carcinoma. Prostate Cancer & Prostatic Diseases, 5, 123-7.

Bordador, L. C., Li, X., Toole, B., Chen, B., Regezi, J., Zardi, L., et al. 2000. Expression of emmprin by oral squamous cell carcinoma. Int J Cancer, 85, 347-52.

Borjesson, P. K., Postema, E. J., Roos, J. C., Colnot, D. R., Marres, H. A., Van Schie, M. H., et al. 2003. Phase I therapy study with (186)Re-labeled humanized monoclonal antibody BIWA 4 (bivatuzumab) in patients with head and neck squamous cell carcinoma. Clin Cancer Res, 9, 3961S-72S.

Borre, M., Nerstrom, B. and Overgaard, J. 2000. Association between immunohistochemical expression of vascular endothelial growth factor (VEGF), VEGF-expressing neuroendocrine-differentiated tumor cells, and outcome in prostate cancer patients subjected to watchful waiting. Clinical Cancer Research, 6, 1882-90.

Bosland, M. C. 1992. Animal models for the study of prostate carcinogenesis. J Cell Biochem Suppl, 16H, 89-98.

Bougatef, F., Quemener, C., Kellouche, S., Naimi, B., Podgorniak, M. P., Millot, G., et al. 2009. EMMPRIN promotes angiogenesis through hypoxia-inducible factor-2alpha- mediated regulation of soluble VEGF isoforms and their receptor VEGFR-2. Blood, 114, 5547-56.

190

Bourguignon, L. Y., Peyrollier, K., Xia, W. and Gilad, E. 2008. Hyaluronan-CD44 interaction activates stem cell marker Nanog, Stat-3-mediated MDR1 gene expression, and ankyrin-regulated multidrug efflux in breast and ovarian tumor cells. J Biol Chem, 283, 17635-51.

Bracarda, S., De Cobelli, O., Greco, C., Prayer-Galetti, T., Valdagni, R., Gatta, G., et al. 2005. Cancer of the prostate. Crit Rev Oncol Hematol, 56, 379-96.

Brakenhielm, E., Burton, J. B., Johnson, M., Chavarria, N., Morizono, K., Chen, I., et al. 2007. Modulating metastasis by a lymphangiogenic switch in prostate cancer. Int J Cancer, 121, 2153-61.

Braundmeier, A. G., Fazleabas, A. T., Lessey, B. A., Guo, H., Toole, B. P. and Nowak, R. A. 2006. Extracellular matrix metalloproteinase inducer regulates metalloproteinases in human uterine endometrium. J Clin Endocrinol Metab, 91, 2358-65.

Brooks, P. C., Stromblad, S., Klemke, R., Visscher, D., Sarkar, F. H. and Cheresh, D. A. 1995. Antiintegrin alpha v beta 3 blocks human breast cancer growth and angiogenesis in human skin. Journal of Clinical Investigation, 96, 1815-22.

Brown, L. F., Detmar, M., Claffey, K., Nagy, J. A., Feng, D., Dvorak, A. M., et al. 1997. Vascular permeability factor/vascular endothelial growth factor: a multifunctional angiogenic cytokine. EXS, 79, 233-69.

Brown, M. D., Gilmore, P. E., Hart, C. A., Samuel, J. D., Ramani, V. A., George, N. J., et al. 2007. Characterization of benign and malignant prostate epithelial Hoechst 33342 side populations. Prostate, 67, 1384-96.

Bubendorf, L., Schopfer, A., Wagner, U., Sauter, G., Moch, H., Willi, N., et al. 2000. Metastatic patterns of prostate cancer: an autopsy study of 1,589 patients. Hum Pathol, 31, 578-83.

191

Burton, J. B., Priceman, S. J., Sung, J. L., Brakenhielm, E., An, D. S., Pytowski, B., et al. 2008. Suppression of prostate cancer nodal and systemic metastasis by blockade of the lymphangiogenic axis. Cancer Res, 68, 7828-37.

Busby, J. E., Kim, S.-J., Yazici, S., Nakamura, T., Kim, J.-S., He, J., et al. 2006. Therapy of multidrug resistant human prostate tumors in the prostate of nude mice by simultaneous targeting of the epidermal growth factor receptor and vascular endothelial growth factor receptor on tumor-associated endothelial cells. Prostate, 66, 1788-98.

Byun, D.-S., Cho, K., Ryu, B.-K., Lee, M.-G., Park, J.-I., Chae, K.-S., et al. 2003. Frequent monoallelic deletion of PTEN and its reciprocal associatioin with PIK3CA amplification in gastric carcinoma. International Journal of Cancer, 104, 318-27.

Caffo, O., Pappagallo, G., Brugnara, S., Caldara, A., Di Pasquale, M. C., Ferro, A., et al. 2012. Multiple Rechallenges for Castration-resistant Prostate Cancer Patients Responding to First-line Docetaxel: Assessment of Clinical Outcomes and Predictive Factors. Urology, 79, 644-9.

Cai, J., Ahmad, S., Jiang, W. G., Huang, J., Kontos, C. D., Boulton, M., et al. 2003. Activation of vascular endothelial growth factor receptor-1 sustains angiogenesis and Bcl-2 expression via the phosphatidylinositol 3-kinase pathway in endothelial cells. Diabetes, 52, 2959-68.

Cai, X. S., Jia, Y. W., Mei, J. and Tang, R. Y. 2004. Tumor blood vessels formation in osteosarcoma: vasculogenesis mimicry. Chin Med J (Engl), 117, 94-8.

Calabro, F. and Sternberg, C. N. 2007. Current indications for chemotherapy in prostate cancer patients. Eur Urol, 51, 17-26.

Carmeliet, P. 2005. Angiogenesis in life, disease and medicine. Nature, 438, 932-6.

192

Caudroy, S., Polette, M., Nawrocki-Raby, B., Cao, J., Toole, B. P., Zucker, S., et al. 2002. EMMPRIN-mediated MMP regulation in tumor and endothelial cells. Clin Exp Metastasis, 19, 697-702.

Ceder, J. A., Jansson, L., Helczynski, L. and Abrahamsson, P.-A. 2008. Delta-like 1 (Dlk- 1), a novel marker of prostate basal and candidate epithelial stem cells, is downregulated by notch signalling in intermediate/transit amplifying cells of the human prostate. European Urology, 54, 1344-53.

Chen, C. T., Gan, Y., Au, J. L. and Wientjes, M. G. 1998. Androgen-dependent and - independent human prostate xenograft tumors as models for drug activity evaluation. Cancer Res, 58, 2777-83.

Chen, H., Wang, L., Beretov, J., Hao, J., Xiao, W. and Li, Y. 2010. Co-expression of CD147/EMMPRIN with monocarboxylate transporters and multiple drug resistance proteins is associated with epithelial ovarian cancer progression. Clin Exp Metastasis, 27, 557-69.

Chen, Z. N., Mi, L., Xu, J., Song, F., Zhang, Q., Zhang, Z., et al. 2006. Targeting radioimmunotherapy of hepatocellular carcinoma with iodine (131I) metuximab injection: clinical phase I/II trials. Int J Radiat Oncol Biol Phys, 65, 435-44.

Chou, R., Croswell, J. M., Dana, T., Bougatsos, C., Blazina, I., Fu, R., et al. 2011. Screening for prostate cancer: a review of the evidence for the u.s. Preventive services task force. Ann Intern Med, 155, 762-71.

Choy, M. and Rafii, S. 2001. Role of angiogenesis in the progression and treatment of prostate cancer. Cancer Investigation, 19, 181-91.

Clarijs, R., Schalkwijk, L., Ruiter, D. J. and De Waal, R. M. 2001. Lack of lymphangiogenesis despite coexpression of VEGF-C and its receptor Flt-4 in uveal melanoma. Investigative Ophthalmology & Visual Science, 42, 1422-8.

193

Clarke, N. W. 2006. Management of the spectrum of hormone refractory prostate cancer. Eur Urol, 50, 428-38; discussion 438-9.

Clubbs, E. A. and Bomser, J. A. 2007. Glycitein activates extracellular signal-regulated kinase via vascular endothelial growth factor receptor signaling in nontumorigenic (RWPE-1) prostate epithelial cells. Journal of Nutritional Biochemistry, 18, 525-32.

Coffey, D. S. 2001. Similarities of prostate and breast cancer: Evolution, diet, and estrogens. Urology, 57, 31-8.

Cohen, R. J., Shannon, B. A., Phillips, M., Moorin, R. E., Wheeler, T. M. and Garrett, K. L. 2008. Central zone carcinoma of the prostate gland: a distinct tumor type with poor prognostic features. J Urol, 179, 1762-7; discussion 1767.

Collins, A. T., Berry, P. A., Hyde, C., Stower, M. J. and Maitland, N. J. 2005. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res, 65, 10946-51.

Collins, A. T. and Maitland, N. J. 2006. Prostate cancer stem cells. Eur J Cancer, 42, 1213- 8.

Colone, M., Calcabrini, A., Toccacieli, L., Bozzuto, G., Stringaro, A., Gentile, M., et al. 2008. The multidrug transporter P-glycoprotein: a mediator of melanoma invasion? J Invest Dermatol, 128, 957-71.

Concato, J., Jain, D., Uchio, E., Risch, H., Li, W. W. and Wells, C. K. 2009. Molecular markers and death from prostate cancer. Ann Intern Med, 150, 595-603.

Cooper, C. R., Chay, C. H. and Pienta, K. J. 2002. The role of alpha(v)beta(3) in prostate cancer progression. Neoplasia, 4, 191-4.

Cordo Russo, R. I., Garcia, M. G., Alaniz, L., Blanco, G., Alvarez, E. and Hajos, S. E. 2008. Hyaluronan oligosaccharides sensitize lymphoma resistant cell lines to vincristine by modulating P-glycoprotein activity and PI3K/Akt pathway. Int J Cancer, 122, 1012-8.

194

Cozzi, P. J., Wang, J., Delprado, W., Madigan, M. C., Fairy, S., Russell, P. J., et al. 2006. Evaluation of urokinase plasminogen activator and its receptor in different grades of human prostate cancer. Hum Pathol, 37, 1442-51.

Crawford, E. D. 2009. Understanding the epidemiology, natural history, and key pathways involved in prostate cancer. Urology, 73, S4-10.

Cunnick, G. H., Jiang, W. G., Douglas-Jones, T., Watkins, G., Gomez, K. F., Morgan, M. J., et al. 2008. Lymphangiogenesis and lymph node metastasis in breast cancer. Mol Cancer, 7, 23.

Cvetkovic, D., Movsas, B., Dicker, A. P., Hanlon, A. L., Greenberg, R. E., Chapman, J. D., et al. 2001. Increased hypoxia correlates with increased expression of the angiogenesis marker vascular endothelial growth factor in human prostate cancer. Urology, 57, 821-5.

Dalberg, K., Eriksson, E., Enberg, U., Kjellman, M. and Backdahl, M. 2000. Gelatinase A, membrane type 1 matrix metalloproteinase, and extracellular matrix metalloproteinase inducer mRNA expression: correlation with invasive growth of breast cancer. World J Surg, 24, 334-40.

Dalerba, P., Dylla, S. J., Park, I. K., Liu, R., Wang, X., Cho, R. W., et al. 2007. Phenotypic characterization of human colorectal cancer stem cells. Proc Natl Acad Sci U S A, 104, 10158-63.

Daneshgari, F. and Crawford, E. D. 1993. Endocrine therapy of advanced carcinoma of the prostate. Cancer, 71, 1089-97.

Davies, M. R., Lee, Y. P., Lee, C., Zhang, X., Afar, D. E. and Lieberman, J. R. 2003. Use of a SCID mouse model to select for a more aggressive strain of prostate cancer. Anticancer Res, 23, 2245-52.

195

De Marzo, A. M., Bradshaw, C., Sauvageot, J., Epstein, J. I. and Miller, G. J. 1998. CD44 and CD44v6 downregulation in clinical prostatic carcinoma: relation to Gleason grade and cytoarchitecture. Prostate, 34, 162-8.

De Muga, S., Hernandez, S., Agell, L., Salido, M., Juanpere, N., Lorenzo, M., et al. 2010. Molecular alterations of EGFR and PTEN in prostate cancer: association with high- grade and advanced-stage carcinomas. Modern Pathology, 23, 703-12.

Dean, N. R., Newman, J. R., Helman, E. E., Zhang, W., Safavy, S., Weeks, D. M., et al. 2009. Anti-EMMPRIN monoclonal antibody as a novel agent for therapy of head and neck cancer. Clin Cancer Res, 15, 4058-65.

Deeg, H. J., Blazar, B. R., Bolwell, B. J., Long, G. D., Schuening, F., Cunningham, J., et al. 2001. Treatment of steroid-refractory acute graft-versus-host disease with anti- CD147 monoclonal antibody ABX-CBL. Blood, 98, 2052-8.

Delbaldo, C., Raymond, E., Vera, K., Hammershaimb, L., Kaucic, K., Lozahic, S., et al. 2008. Phase I and pharmacokinetic study of etaracizumab (Abegrin), a humanized monoclonal antibody against alphavbeta3 integrin receptor, in patients with advanced solid tumors. Invest New Drugs, 26, 35-43.

Deora, A. A., Philp, N., Hu, J., Bok, D. and Rodriguez-Boulan, E. 2005. Mechanisms regulating tissue-specific polarity of monocarboxylate transporters and their chaperone CD147 in kidney and retinal epithelia. Proc Natl Acad Sci U S A, 102, 16245-50.

Desai, B., Rogers, M. J. and Chellaiah, M. A. 2007. Mechanisms of osteopontin and CD44 as metastatic principles in prostate cancer cells. Mol Cancer, 6, 18.

Di Sant'agnese, P. A. 1992. Neuroendocrine differentiation in carcinoma of the prostate. Diagnostic, prognostic, and therapeutic implications. Cancer, 70, 254-68.

Dijkgraaf, I. and Boerman, O. C. 2009. Radionuclide imaging of tumor angiogenesis. Cancer Biother Radiopharm, 24, 637-47.

196

Dong, Z., Kumar, R., Yang, X. and Fidler, I. J. 1997. Macrophage-derived metalloelastase is responsible for the generation of angiostatin in Lewis lung carcinoma. Cell, 88, 801-10.

Draffin, J. E., Mcfarlane, S., Hill, A., Johnston, P. G. and Waugh, D. J. 2004. CD44 potentiates the adherence of metastatic prostate and breast cancer cells to bone marrow endothelial cells. Cancer Res, 64, 5702-11.

Du, Z. M., Hu, C. F., Shao, Q., Huang, M. Y., Kou, C. W., Zhu, X. F., et al. 2009. Upregulation of caveolin-1 and CD147 expression in nasopharyngeal carcinoma enhanced tumor cell migration and correlated with poor prognosis of the patients. Int J Cancer, 125, 1832-41.

Dubrovska, A., Kim, S., Salamone, R. J., Walker, J. R., Maira, S. M., Garcia-Echeverria, C., et al. 2009. The role of PTEN/Akt/PI3K signaling in the maintenance and viability of prostate cancer stem-like cell populations. Proc Natl Acad Sci U S A, 106, 268-73.

Duque, J. L. F., Loughlin, K. R., Adam, R. M., Kantoff, P., Mazzucchi, E. and Freeman, M. R. Measurement of plasma levels of vascular endothelial growth factor in prostate cancer patients: relationship with clinical stage, Gleason score, prostate volume, and serum prostate-specific antigen. Clinics, 61, 401-8.

Edge, S. B., Byrd, D. R., Compton, C. C., Fritz, A. G., Greene, F. L. and Trotti, A. 2010. AJCC Cancer Staging Manual, Springer.

El Hallani, S., Boisselier, B., Peglion, F., Rousseau, A., Colin, C., Idbaih, A., et al. 2010. A new alternative mechanism in glioblastoma vascularization: tubular vasculogenic mimicry. Brain, 133, 973-82.

El Hilali, N., Rubio, N., Martinez-Villacampa, M. and Blanco, J. 2002. Combined noninvasive imaging and luminometric quantification of luciferase-labeled human prostate tumors and metastases. Lab Invest, 82, 1563-71.

197

Ellis, L. M. and Hicklin, D. J. 2008. VEGF-targeted therapy: mechanisms of anti-tumour activity. Nat Rev Cancer, 8, 579-91.

Enerson, B. E. and Drewes, L. R. 2003. Molecular features, regulation, and function of monocarboxylate transporters: implications for drug delivery. J Pharm Sci, 92, 1531-44.

Enokida, H., Shiina, H., Igawa, M., Ogishima, T., Kawakami, T., Bassett, W. W., et al. 2004. CpG hypermethylation of MDR1 gene contributes to the pathogenesis and progression of human prostate cancer. Cancer Res, 64, 5956-62.

Fadool, J. M. and Linser, P. J. 1993. 5A11 antigen is a cell recognition molecule which is involved in neuronal-glial interactions in avian neural retina. Dev Dyn, 196, 252-62.

Fang, J., Quinones, Q. J., Holman, T. L., Morowitz, M. J., Wang, Q., Zhao, H., et al. 2006. The H+-linked monocarboxylate transporter (MCT1/SLC16A1): a potential therapeutic target for high-risk neuroblastoma. Mol Pharmacol, 70, 2108-15.

Ferrara, N. 2002. VEGF and the quest for tumour angiogenesis factors. Nat Rev Cancer, 2, 795-803.

Ferrer, F. A., Miller, L. J., Andrawis, R. I., Kurtzman, S. H., Albertsen, P. C., Laudone, V. P., et al. 1997. Vascular endothelial growth factor (VEGF) expression in human prostate cancer: in situ and in vitro expression of VEGF by human prostate cancer cells. Journal of Urology, 157, 2329-33.

Ferrer, F. A., Miller, L. J., Andrawis, R. I., Kurtzman, S. H., Albertsen, P. C., Laudone, V. P., et al. 1998. Angiogenesis and prostate cancer: in vivo and in vitro expression of angiogenesis factors by prostate cancer cells. Urology, 51, 161-7.

Fidler, I. J. 1990. Critical factors in the biology of human cancer metastasis: twenty-eighth G.H.A. Clowes memorial award lecture. Cancer Res, 50, 6130-8.

Folkman, J. and Klagsbrun, M. 1987. Angiogenic factors. Science, 235, 442-7.

198

Fortier, A. H., Nelson, B. J., Grella, D. K. and Holaday, J. W. 1999. Antiangiogenic activity of prostate-specific antigen. J Natl Cancer Inst, 91, 1635-40.

Fox, W. D., Higgins, B., Maiese, K. M., Drobnjak, M., Cordon-Cardo, C., Scher, H. I., et al. 2002. Antibody to vascular endothelial growth factor slows growth of an androgen- independent xenograft model of prostate cancer. Clinical Cancer Research, 8, 3226- 31.

Franck-Lissbrant, I., Haggstrom, S., Damber, J. E. and Bergh, A. 1998. Testosterone stimulates angiogenesis and vascular regrowth in the ventral prostate in castrated adult rats. Endocrinology, 139, 451-6.

Froberg, M. K., Gerhart, D. Z., Enerson, B. E., Manivel, C., Guzman-Paz, M., Seacotte, N., et al. 2001. Expression of monocarboxylate transporter MCT1 in normal and neoplastic human CNS tissues. Neuroreport, 12, 761-5.

Galaup, A., Opolon, P., Bouquet, C., Li, H., Opolon, D., Bissery, M.-C., et al. 2003. Combined effects of docetaxel and angiostatin gene therapy in prostate tumor model. Molecular Therapy: the Journal of the American Society of Gene Therapy, 7, 731- 40.

Gale, N. W., Thurston, G., Hackett, S. F., Renard, R., Wang, Q., Mcclain, J., et al. 2002. Angiopoietin-2 is required for postnatal angiogenesis and lymphatic patterning, and only the latter role is rescued by Angiopoietin-1. Dev Cell, 3, 411-23.

Gallagher, S. M., Castorino, J. J., Wang, D. and Philp, N. J. 2007. Monocarboxylate transporter 4 regulates maturation and trafficking of CD147 to the plasma membrane in the metastatic breast cancer cell line MDA-MB-231. Cancer Res, 67, 4182-9.

Gao, A. C., Lou, W., Dong, J. T. and Isaacs, J. T. 1997. CD44 is a metastasis suppressor gene for prostatic cancer located on human chromosome 11p13. Cancer Res, 57, 846-9.

199

Gao, A. C., Lou, W., Sleeman, J. P. and Isaacs, J. T. 1998. Metastasis suppression by the standard CD44 isoform does not require the binding of prostate cancer cells to hyaluronate. Cancer Res, 58, 2350-2.

Gately, S., Twardowski, P., Stack, M. S., Patrick, M., Boggio, L., Cundiff, D. L., et al. 1996. Human prostate carcinoma cells express enzymatic activity that converts human plasminogen to the angiogenesis inhibitor, angiostatin. Cancer Research, 56, 4887-90.

Gatenby, R. A. and Gillies, R. J. 2004. Why do cancers have high aerobic glycolysis? Nat Rev Cancer, 4, 891-9.

Gatenby, R. A. and Gillies, R. J. 2007. Glycolysis in cancer: a potential target for therapy. Int J Biochem Cell Biol, 39, 1358-66.

George, D. J., Halabi, S., Shepard, T. F., Vogelzang, N. J., Hayes, D. F., Small, E. J., et al. 2001. Prognostic significance of plasma vascular endothelial growth factor levels in patients with hormone-refractory prostate cancer treated on Cancer and Leukemia Group B 9480. Clinical Cancer Research, 7, 1932-6.

Germann, U. A. 1996. P-glycoprotein--a mediator of multidrug resistance in tumour cells. Eur J Cancer, 32A, 927-44.

Gilg, A. G., Tye, S. L., Tolliver, L. B., Wheeler, W. G., Visconti, R. P., Duncan, J. D., et al. 2008. Targeting hyaluronan interactions in malignant gliomas and their drug- resistant multipotent progenitors. Clin Cancer Res, 14, 1804-13.

Giri, D. and Ittmann, M. 1999. Inactivation of the PTEN tumor suppressor gene is associated with increased angiogenesis in clinically localized prostate carcinoma. Hum Pathol, 30, 419-24.

Gleason, D. F. 1966. Classification of prostatic carcinomas. Cancer Chemother Rep, 50, 125-8.

200

Gleave, M., Hsieh, J. T., Gao, C. A., Von Eschenbach, A. C. and Chung, L. W. 1991. Acceleration of human prostate cancer growth in vivo by factors produced by prostate and bone fibroblasts. Cancer Res, 51, 3753-61.

Goel, H. L., Li, J., Kogan, S. and Languino, L. R. 2008. Integrins in prostate cancer progression. Endocr Relat Cancer, 15, 657-64.

Goldberg, M. A. and Schneider, T. J. 1994. Similarities between the oxygen-sensing mechanisms regulating the expression of vascular endothelial growth factor and erythropoietin. Journal of Biological Chemistry, 269, 4355-9.

Gollob, J. A., Wilhelm, S., Carter, C. and Kelley, S. L. 2006. Role of Raf kinase in cancer: therapeutic potential of targeting the Raf/MEK/ERK signal transduction pathway. Seminars in Oncology, 33, 392-406.

Golshani, R., Lopez, L., Estrella, V., Kramer, M., Iida, N. and Lokeshwar, V. B. 2008. Hyaluronic acid synthase-1 expression regulates bladder cancer growth, invasion, and angiogenesis through CD44. Cancer Res, 68, 483-91.

Gonzalez-Gronow, M., Grenett, H. E., Gawdi, G. and Pizzo, S. V. 2005. Angiostatin directly inhibits human prostate tumor cell invasion by blocking plasminogen binding to its cellular receptor, CD26. Experimental Cell Research, 303, 22-31.

Gordon, M. S., Margolin, K., Talpaz, M., Sledge, G. W., Jr., Holmgren, E., Benjamin, R., et al. 2001. Phase I safety and pharmacokinetic study of recombinant human anti- vascular endothelial growth factor in patients with advanced cancer. J Clin Oncol, 19, 843-50.

Gragoudas, E. S., Adamis, A. P., Cunningham, E. T., Jr., Feinsod, M., Guyer, D. R. and The Vegf Inhibition Study in Ocular Neovascularization Clinical Trial Group 2004. Pegaptanib for Neovascular Age-Related Macular Degeneration. N Engl J Med, 351, 2805-2816.

201

Greene, G. F., Kitadai, Y., Pettaway, C. A., Von Eschenbach, A. C., Bucana, C. D. and Fidler, I. J. 1997. Correlation of metastasis-related gene expression with metastatic potential in human prostate carcinoma cells implanted in nude mice using an in situ messenger RNA hybridization technique. American Journal of Pathology, 150, 1571-82.

Gridley, T. 2001. Notch signaling during vascular development. Proceedings of the National Academy of Sciences of the United States of America, 98, 5377-8.

Griscelli, F., Li, H., Bennaceur-Griscelli, A., Soria, J., Opolon, P., Soria, C., et al. 1998. Angiostatin gene transfer: inhibition of tumor growth in vivo by blockage of endothelial cell proliferation associated with a mitosis arrest. Proceedings of the National Academy of Sciences of the United States of America, 95, 6367-72.

Griscelli, F., Li, H., Cheong, C., Opolon, P., Bennaceur-Griscelli, A., Vassal, G., et al. 2000. Combined effects of radiotherapy and angiostatin gene therapy in glioma tumor model. Proceedings of the National Academy of Sciences of the United States of America, 97, 6698-703.

Gronberg, H. 2003. Prostate cancer epidemiology. Lancet, 361, 859-64.

Gu, M., Roy, S., Raina, K., Agarwal, C. and Agarwal, R. 2009. Inositol hexaphosphate suppresses growth and induces apoptosis in prostate carcinoma cells in culture and nude mouse xenograft: PI3K-Akt pathway as potential target. Cancer Res, 69, 9465-72.

Guo, H., Majmudar, G., Jensen, T. C., Biswas, C., Toole, B. P. and Gordon, M. K. 1998. Characterization of the gene for human EMMPRIN, a tumor cell surface inducer of matrix metalloproteinases. Gene, 220, 99-108.

Gustafsson, M. V., Zheng, X., Pereira, T., Gradin, K., Jin, S., Lundkvist, J., et al. 2005. Hypoxia requires notch signaling to maintain the undifferentiated cell state. Dev Cell, 9, 617-28.

202

Guzman, G., Cotler, S. J., Lin, A. Y., Maniotis, A. J. and Folberg, R. 2007. A pilot study of vasculogenic mimicry immunohistochemical expression in hepatocellular carcinoma. Arch Pathol Lab Med, 131, 1776-81.

Haggstrom, S., Bergh, A. and Damber, J. E. 2000. Vascular endothelial growth factor content in metastasizing and nonmetastasizing Dunning prostatic adenocarcinoma. Prostate, 45, 42-50.

Haggstrom, S., Stattin, P., Wikstrom, P., Bergh, A. and Damber, J. E. 2001. Castration- induced reduction of vascular endothelial growth factor expression in benign human prostate tissue is lost in advanced prostate cancer. BJU International, 88, 110-6.

Haggstrom, S., Wikstrom, P., Bergh, A. and Damber, J. E. 1998. Expression of vascular endothelial growth factor and its receptors in the rat ventral prostate and Dunning R3327 PAP adenocarcinoma before and after castration. Prostate, 36, 71-9.

Hajitou, A., Grignet, C., Devy, L., Berndt, S., Blacher, S., Deroanne, C. F., et al. 2002. The antitumoral effect of endostatin and angiostatin is associated with a down-regulation of vascular endothelial growth factor expression in tumor cells. FASEB Journal, 16, 1802-4.

Han, Z. D., Bi, X. C., Qin, W. J., He, H. C., Dai, Q. S., Zou, J., et al. 2009. CD147 expression indicates unfavourable prognosis in prostate cancer. Pathol Oncol Res, 15, 369-74.

Hanai, J.-I., Dhanabal, M., Karumanchi, S. A., Albanese, C., Waterman, M., Chan, B., et al. 2002. Endostatin causes G1 arrest of endothelial cells through inhibition of cyclin D1. Journal of Biological Chemistry, 277, 16464-9.

Hanata, K., Yamaguchi, N., Yoshikawa, K., Mezaki, Y., Miura, M., Suzuki, S., et al. 2007. Soluble EMMPRIN (extra-cellular matrix metalloproteinase inducer) stimulates the migration of HEp-2 human laryngeal carcinoma cells, accompanied by increased MMP-2 production in fibroblasts. Arch Histol Cytol, 70, 267-77.

203

Hao, J., Chen, H., Madigan, M. C., Cozzi, P. J., Beretov, J., Xiao, W., et al. 2010. Co- expression of CD147 (EMMPRIN), CD44v3-10, MDR1 and monocarboxylate transporters is associated with prostate cancer drug resistance and progression. Br J Cancer, 103, 1008-18.

Hao, J. L., Cozzi, P. J., Khatri, A., Power, C. A. and Li, Y. 2010. CD147/EMMPRIN and CD44 are potential therapeutic targets for metastatic prostate cancer. Curr Cancer Drug Targets, 10, 287-306.

Harima, Y., Sawada, S., Nagata, K., Sougawa, M., Ostapenko, V. and Ohnishi, T. 2001. Mutation of the PTEN gene in advanced cervical cancer correlated with tumor progression and poor outcome after radiotherapy. International Journal of Oncology, 18, 493-7.

Harper, M. E., Glynne-Jones, E., Goddard, L., Thurston, V. J. and Griffiths, K. 1996. Vascular endothelial growth factor (VEGF) expression in prostatic tumours and its relationship to neuroendocrine cells. Br J Cancer, 74, 910-6.

Harrington, L. S., Sainson, R. C., Williams, C. K., Taylor, J. M., Shi, W., Li, J. L., et al. 2008. Regulation of multiple angiogenic pathways by Dll4 and Notch in human umbilical vein endothelial cells. Microvasc Res, 75, 144-54.

Harrison, G. M., Davies, G., Martin, T. A., Jiang, W. G. and Mason, M. D. 2002. Distribution and expression of CD44 isoforms and Ezrin during prostate cancer- endothelium interaction. Int J Oncol, 21, 935-40.

Harrison, G. M., Davies, G., Martin, T. A., Mason, M. D. and Jiang, W. G. 2006. The influence of CD44v3-v10 on adhesion, invasion and MMP-14 expression in prostate cancer cells. Oncol Rep, 15, 199-206.

Haynes, B. F., Telen, M. J., Hale, L. P. and Denning, S. M. 1989. CD44--a molecule involved in leukocyte adherence and T-cell activation. Immunol Today, 10, 423-8.

204

Heidtmann, H. H., Nettelbeck, D. M., Mingels, A., Jager, R., Welker, H. G. and Kontermann, R. E. 1999. Generation of angiostatin-like fragments from plasminogen by prostate-specific antigen. British Journal of Cancer, 81, 1269-73.

Hellstrom, M., Phng, L.-K., Hofmann, J. J., Wallgard, E., Coultas, L., Lindblom, P., et al. 2007. Dll4 signalling through Notch1 regulates formation of tip cells during angiogenesis. Nature, 445, 776-80.

Hendrix, M. J., Seftor, E. A., Meltzer, P. S., Gardner, L. M., Hess, A. R., Kirschmann, D. A., et al. 2001. Expression and functional significance of VE-cadherin in aggressive human melanoma cells: role in vasculogenic mimicry. Proc Natl Acad Sci U S A, 98, 8018-23.

Hersey, P., Sosman, J., O'day, S., Richards, J., Bedikian, A., Gonzalez, R., et al. 2010. A randomized phase 2 study of etaracizumab, a monoclonal antibody against integrin alpha(v)beta(3), + or - dacarbazine in patients with stage IV metastatic melanoma. Cancer, 116, 1526-34.

Hess, A. R., Seftor, E. A., Gardner, L. M., Carles-Kinch, K., Schneider, G. B., Seftor, R. E., et al. 2001. Molecular regulation of tumor cell vasculogenic mimicry by tyrosine phosphorylation: role of epithelial cell kinase (Eck/EphA2). Cancer Res, 61, 3250-5.

Hess, A. R., Seftor, E. A., Gruman, L. M., Kinch, M. S., Seftor, R. E. and Hendrix, M. J. 2006. VE-cadherin regulates EphA2 in aggressive melanoma cells through a novel signaling pathway: implications for vasculogenic mimicry. Cancer Biol Ther, 5, 228-33.

Hess, A. R., Seftor, E. A., Seftor, R. E. and Hendrix, M. J. 2003. Phosphoinositide 3-kinase regulates membrane Type 1-matrix metalloproteinase (MMP) and MMP-2 activity during melanoma cell vasculogenic mimicry. Cancer Res, 63, 4757-62.

Hida, K., Hida, Y., Amin, D. N., Flint, A. F., Panigrahy, D., Morton, C. C., et al. 2004. Tumor-associated endothelial cells with cytogenetic abnormalities. Cancer Res, 64, 8249-55.

205

Higano, C. S. and Crawford, E. D. 2011. New and emerging agents for the treatment of castration-resistant prostate cancer. Urol Oncol, 29, S1-8.

Hirakawa, S., Kodama, S., Kunstfeld, R., Kajiya, K., Brown, L. F. and Detmar, M. 2005. VEGF-A induces tumor and sentinel lymph node lymphangiogenesis and promotes lymphatic metastasis. J Exp Med, 201, 1089-99.

Hofmann, J. J. and Luisa Iruela-Arispe, M. 2007. Notch expression patterns in the retina: An eye on receptor-ligand distribution during angiogenesis. Gene Expression Patterns, 7, 461-70.

Hori, K., Katayama, N., Kachi, S., Kondo, M., Kadomatsu, K., Usukura, J., et al. 2000. Retinal dysfunction in basigin deficiency. Invest Ophthalmol Vis Sci, 41, 3128-33.

Hu, X. B., Feng, F., Wang, Y. C., Wang, L., He, F., Dou, G. R., et al. 2009. Blockade of Notch signaling in tumor-bearing mice may lead to tumor regression, progression, or metastasis, depending on tumor cell types. Neoplasia, 11, 32-8.

Huggins, C. and Hodges, C. V. 1972. Studies on prostatic cancer. I. The effect of castration, of estrogen and androgen injection on serum phosphatases in metastatic carcinoma of the prostate. CA Cancer J Clin, 22, 232-40.

Hull, G. W., Rabbani, F., Abbas, F., Wheeler, T. M., Kattan, M. W. and Scardino, P. T. 2002. Cancer control with radical prostatectomy alone in 1,000 consecutive patients. J Urol, 167, 528-34.

Hurt, E. M., Kawasaki, B. T., Klarmann, G. J., Thomas, S. B. and Farrar, W. L. 2008. CD44+ CD24(-) prostate cells are early cancer progenitor/stem cells that provide a model for patients with poor prognosis. Br J Cancer, 98, 756-65.

Ide, H., Kikuchi, E., Kono, H., Nagata, H., Miyajima, A., Nakagawa, K., et al. 2010. Docetaxel in combination with prednisolone for hormone refractory prostate cancer. Jpn J Clin Oncol, 40, 79-84.

206

Igakura, T., Kadomatsu, K., Kaname, T., Muramatsu, H., Fan, Q. W., Miyauchi, T., et al. 1998. A null mutation in basigin, an immunoglobulin superfamily member, indicates its important roles in peri-implantation development and spermatogenesis. Dev Biol, 194, 152-65.

Igakura, T., Kadomatsu, K., Taguchi, O., Muramatsu, H., Kaname, T., Miyauchi, T., et al. 1996. Roles of basigin, a member of the immunoglobulin superfamily, in behavior as to an irritating odor, lymphocyte response, and blood-brain barrier. Biochem Biophys Res Commun, 224, 33-6.

Isaacs, J. T., Heston, W. D., Weissman, R. M. and Coffey, D. S. 1978. Animal models of the hormone-sensitive and -insensitive prostatic adenocarcinomas, Dunning R- 3327-H, R-3327-HI, and R-3327-AT. Cancer Res, 38, 4353-9.

Isaka, N., Padera, T. P., Hagendoorn, J., Fukumura, D. and Jain, R. K. 2004. Peritumor lymphatics induced by vascular endothelial growth factor-C exhibit abnormal function. Cancer Research, 64, 4400-4.

Isayeva, T., Moore, L. D., Chanda, D., Chen, D. and Ponnazhagan, S. 2009. Tumoristatic effects of endostatin in prostate cancer is dependent on androgen receptor status. Prostate, 69, 1055-66.

Ishibashi, Y., Matsumoto, T., Niwa, M., Suzuki, Y., Omura, N., Hanyu, N., et al. 2004. CD147 and matrix metalloproteinase-2 protein expression as significant prognostic factors in esophageal squamous cell carcinoma. Cancer, 101, 1994-2000.

Iso, T., Hamamori, Y. and Kedes, L. 2003. Notch signaling in vascular development. Arteriosclerosis, Thrombosis & Vascular Biology, 23, 543-53.

Iwase, A., Shen, R., Navarro, D. and Nanus, D. M. 2004. Direct binding of neutral endopeptidase 24.11 to ezrin/radixin/moesin (ERM) proteins competes with the interaction of CD44 with ERM proteins. J Biol Chem, 279, 11898-905.

207

Iyer, M., Wu, L., Carey, M., Wang, Y., Smallwood, A. and Gambhir, S. S. 2001. Two-step transcriptional amplification as a method for imaging reporter gene expression using weak promoters. Proc Natl Acad Sci U S A, 98, 14595-600.

Izawa, J. I. and Dinney, C. P. 2001. The role of angiogenesis in prostate and other urologic cancers: a review. CMAJ Canadian Medical Association Journal, 164, 662-70.

Izumi, H., Takahashi, M., Uramoto, H., Nakayama, Y., Oyama, T., Wang, K. Y., et al. 2011. Monocarboxylate transporters 1 and 4 are involved in the invasion activity of human lung cancer cells. Cancer Sci, 102, 1007-13.

Jackson, M. W., Bentel, J. M. and Tilley, W. D. 1997. Vascular endothelial growth factor (VEGF) expression in prostate cancer and benign prostatic hyperplasia. Journal of Urology, 157, 2323-8.

Jackson, M. W., Roberts, J. S., Heckford, S. E., Ricciardelli, C., Stahl, J., Choong, C., et al. 2002. A potential autocrine role for vascular endothelial growth factor in prostate cancer.[Erratum appears in Cancer Res 2002 Apr 1;62(7):2200]. Cancer Research, 62, 854-9.

Jaracz, S., Chen, J., Kuznetsova, L. V. and Ojima, I. 2005. Recent advances in tumor- targeting anticancer drug conjugates. Bioorg Med Chem, 13, 5043-54.

Jemal, A., Siegel, R., Ward, E., Hao, Y., Xu, J. and Thun, M. J. 2009. Cancer statistics, 2009. CA Cancer J Clin, 59, 225-49.

Jennbacken, K., Vallbo, C., Wang, W. and Damber, J. E. 2005. Expression of vascular endothelial growth factor C (VEGF-C) and VEGF receptor-3 in human prostate cancer is associated with regional lymph node metastasis. Prostate, 65, 110-6.

Jia, L., Wei, W., Cao, J., Xu, H., Miao, X. and Zhang, J. 2009. Silencing CD147 inhibits tumor progression and increases chemosensitivity in murine lymphoid neoplasm P388D1 cells. Ann Hematol, 88, 753-60.

208

Jiang, B. H., Agani, F., Passaniti, A. and Semenza, G. L. 1997. V-SRC induces expression of hypoxia-inducible factor 1 (HIF-1) and transcription of genes encoding vascular endothelial growth factor and enolase 1: involvement of HIF-1 in tumor progression. Cancer Research, 57, 5328-35.

Jiang, B. H., Aoki, M., Zheng, J. Z., Li, J. and Vogt, P. K. 1999. Myogenic signaling of phosphatidylinositol 3-kinase requires the serine-threonine kinase Akt/protein kinase B. Proc Natl Acad Sci U S A, 96, 2077-81.

Jin, J. K., Dayyani, F. and Gallick, G. E. 2011. Steps in prostate cancer progression that lead to bone metastasis. Int J Cancer, 128, 2545-61.

Jones, A., Fujiyama, C., Turner, K., Fuggle, S., Cranston, D., Bicknell, R., et al. 2000. Elevated serum vascular endothelial growth factor in patients with hormone- escaped prostate cancer. BJU International, 85, 276-80.

Joseph, I. B., Nelson, J. B., Denmeade, S. R. and Isaacs, J. T. 1997. Androgens regulate vascular endothelial growth factor content in normal and malignant prostatic tissue. Clinical Cancer Research, 3, 2507-11.

Joukov, V., Pajusola, K., Kaipainen, A., Chilov, D., Lahtinen, I., Kukk, E., et al. 1996. A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases. EMBO J, 15, 290-98.

Ju, X. Z., Yang, J. M., Zhou, X. Y., Li, Z. T. and Wu, X. H. 2008. EMMPRIN expression as a prognostic factor in radiotherapy of cervical cancer. Clin Cancer Res, 14, 494- 501.

Kallakury, B. V., Yang, F., Figge, J., Smith, K. E., Kausik, S. J., Tacy, N. J., et al. 1996. Decreased levels of CD44 protein and mRNA in prostate carcinoma. Correlation with tumor grade and ploidy. Cancer, 78, 1461-9.

209

Kaname, T., Miyauchi, T., Kuwano, A., Matsuda, Y., Muramatsu, T. and Kajii, T. 1993. Mapping basigin (BSG), a member of the immunoglobulin superfamily, to 19p13.3. Cytogenet Cell Genet, 64, 195-7.

Katsanakis, K. D., Gorgoulis, V., Papavassiliou, A. G. and Zoumpourlis, V. K. 2002. The progression in the mouse skin carcinogenesis model correlates with ERK1/2 signaling. Molecular Medicine, 8, 624-37.

Ke, T., Jeong, E. K., Wang, X., Feng, Y., Parker, D. L. and Lu, Z. R. 2007. RGD targeted poly(L-glutamic acid)-cystamine-(Gd-DO3A) conjugate for detecting angiogenesis biomarker alpha(v) beta3 integrin with MRT, mapping. Int J Nanomedicine, 2, 191- 9.

Kearney, J. B., Ambler, C. A., Monaco, K. A., Johnson, N., Rapoport, R. G. and Bautch, V. L. 2002. Vascular endothelial growth factor receptor Flt-1 negatively regulates developmental blood vessel formation by modulating endothelial cell division. Blood, 99, 2397-407.

Kim, H. R., Wheeler, M. A., Wilson, C. M., Iida, J., Eng, D., Simpson, M. A., et al. 2004. Hyaluronan facilitates invasion of colon carcinoma cells in vitro via interaction with CD44. Cancer Res, 64, 4569-76.

Kim, H. S., Sung, W., Lee, S., Chang, S. G. and Park, Y. K. 2009. Lymphatic vessel densities of lymph node-negative prostate adenocarcinoma in Korea. Pathol Res Pract, 205, 249-54.

Kim, K. J., Li, B., Winer, J., Armanini, M., Gillett, N., Phillips, H. S., et al. 1993. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature, 362, 841-4.

Kim, Y.-M., Hwang, S., Kim, Y.-M., Pyun, B.-J., Kim, T.-Y., Lee, S.-T., et al. 2002. Endostatin blocks vascular endothelial growth factor-mediated signaling via direct interaction with KDR/Flk-1. Journal of Biological Chemistry, 277, 27872-9.

210

Kinoshita, J., Haga, S., Shimizu, T., Imamura, H., Watanabe, O. and Kajiwara, T. 1999. The expression of variant exon v7-v8 CD44 antigen in relation to lymphatic metastasis of human breast cancer. Breast Cancer Res Treat, 53, 177-83.

Kirk, P., Wilson, M. C., Heddle, C., Brown, M. H., Barclay, A. N. and Halestrap, A. P. 2000. CD147 is tightly associated with lactate transporters MCT1 and MCT4 and facilitates their cell surface expression. EMBO J, 19, 3896-904.

Klarmann, G. J., Hurt, E. M., Mathews, L. A., Zhang, X., Duhagon, M. A., Mistree, T., et al. 2009. Invasive prostate cancer cells are tumor initiating cells that have a stem cell-like genomic signature. Clin Exp Metastasis, 26, 433-46.

Klein, C. A., Seidl, S., Petat-Dutter, K., Offner, S., Geigl, J. B., Schmidt-Kittler, O., et al. 2002. Combined transcriptome and genome analysis of single micrometastatic cells. Nat Biotechnol, 20, 387-92.

Klingbeil, P., Marhaba, R., Jung, T., Kirmse, R., Ludwig, T. and Zoller, M. 2009. CD44 variant isoforms promote metastasis formation by a tumor cell-matrix cross-talk that supports adhesion and apoptosis resistance. Mol Cancer Res, 7, 168-79.

Koch, U. and Radtke, F. 2007. Notch and cancer: a double-edged sword. Cell Mol Life Sci, 64, 2746-62.

Koppe, M., Schaijk, F., Roos, J., Leeuwen, P., Heider, K. H., Kuthan, H., et al. 2004. Safety, pharmacokinetics, immunogenicity, and biodistribution of (186)Re-labeled humanized monoclonal antibody BIWA 4 (Bivatuzumab) in patients with early- stage breast cancer. Cancer Biother Radiopharm, 19, 720-9.

Koukourakis, M. I., Giatromanolaki, A., Harris, A. L. and Sivridis, E. 2006. Comparison of metabolic pathways between cancer cells and stromal cells in colorectal carcinomas: a metabolic survival role for tumor-associated stroma. Cancer Res, 66, 632-7.

Koul, D., Shen, R., Garyali, A., Ke, L. D., Liu, T.-J. and Yung, W. K. A. 2002. MMAC/PTEN tumor suppressor gene regulates vascular endothelial growth factor-

211

mediated angiogenesis in prostate cancer. International Journal of Oncology, 21, 469-75.

Kruh, G. D. and Belinsky, M. G. 2003. The MRP family of drug efflux pumps. Oncogene, 22, 7537-52.

Krupski, T., Harding, M. A., Herce, M. E., Gulding, K. M., Stoler, M. H. and Theodorescu, D. 2001. The role of vascular endothelial growth factor in the tissue specific in vivo growth of prostate cancer cells. Growth Factors, 18, 287-302.

Kuang, Y. H., Chen, X., Su, J., Wu, L. S., Li, J., Chang, J., et al. 2008. Proteome analysis of multidrug resistance of human oral squamous carcinoma cells using CD147 silencing. J Proteome Res, 7, 4784-91.

Kuang, Y. H., Chen, X., Su, J., Wu, L. S., Liao, L. Q., Li, D., et al. 2009. RNA interference targeting the CD147 induces apoptosis of multi-drug resistant cancer cells related to XIAP depletion. Cancer Lett, 276, 189-95.

Kubo, H., Cao, R., Brakenhielm, E., Makinen, T., Cao, Y. and Alitalo, K. 2002. Blockade of vascular endothelial growth factor receptor-3 signaling inhibits fibroblast growth factor-2-induced lymphangiogenesis in mouse cornea. Proc Natl Acad Sci U S A, 99, 8868-73.

Kuniyasu, H., Oue, N., Tsutsumi, M., Tahara, E. and Yasui, W. 2001. Heparan sulfate enhances invasion by human colon carcinoma cell lines through expression of CD44 variant exon 3. Clin Cancer Res, 7, 4067-72.

Kupelian, P. A., Kupelian, V. A., Witte, J. S., Macklis, R. and Klein, E. A. 1997. Family history of prostate cancer in patients with localized prostate cancer: an independent predictor of treatment outcome. J Clin Oncol, 15, 1478-80.

Laakkonen, P., Porkka, K., Hoffman, J. A. and Ruoslahti, E. 2002. A tumor-homing peptide with a targeting specificity related to lymphatic vessels. Nature Medicine, 8, 751-5.

212

Lai, E. C. 2004. Notch signaling: control of cell communication and cell fate. Development, 131, 965-73.

Lakshman, M., Subramaniam, V., Rubenthiran, U. and Jothy, S. 2004. CD44 promotes resistance to apoptosis in human colon cancer cells. Exp Mol Pathol, 77, 18-25.

Lamoreaux, W. J., Fitzgerald, M. E., Reiner, A., Hasty, K. A. and Charles, S. T. 1998. Vascular endothelial growth factor increases release of gelatinase A and decreases release of tissue inhibitor of metalloproteinases by microvascular endothelial cells in vitro. Microvascular Research, 55, 29-42.

Lee, J. T., Jr., Steelman, L. S. and Mccubrey, J. A. 2004. Phosphatidylinositol 3'-kinase activation leads to multidrug resistance protein-1 expression and subsequent chemoresistance in advanced prostate cancer cells. Cancer Res, 64, 8397-404.

Leong, K. G. and Gao, W. Q. 2008. The Notch pathway in prostate development and cancer. Differentiation, 76, 699-716.

Leroy, B. E. and Northrup, N. 2009. Prostate cancer in dogs: comparative and clinical aspects. Vet J, 180, 149-62.

Leung, D. W., Cachianes, G., Kuang, W. J., Goeddel, D. V. and Ferrara, N. 1989. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science, 246, 1306-9.

Li, J. L., Sainson, R. C., Shi, W., Leek, R., Harrington, L. S., Preusser, M., et al. 2007. Delta-like 4 Notch ligand regulates tumor angiogenesis, improves tumor vascular function, and promotes tumor growth in vivo. Cancer Res, 67, 11244-53.

Li, M., Zhai, Q., Bharadwaj, U., Wang, H., Li, F., Fisher, W. E., et al. 2006. Cyclophilin A is overexpressed in human pancreatic cancer cells and stimulates cell proliferation through CD147. Cancer, 106, 2284-94.

Li, Q. Q., Wang, W. J., Xu, J. D., Cao, X. X., Chen, Q., Yang, J. M., et al. 2007. Involvement of CD147 in regulation of multidrug resistance to P-gp substrate drugs and in vitro invasion in breast cancer cells. Cancer Sci, 98, 1064-9. 213

Li, R., Younes, M., Wheeler, T. M., Scardino, P., Ohori, M., Frolov, A., et al. 2004. Expression of vascular endothelial growth factor receptor-3 (VEGFR-3) in human prostate. Prostate, 58, 193-9.

Li, X., Liu, Y.-H., Lee, S.-J., Gardner, T. A., Jeng, M.-H. and Kao, C. 2008. Prostate- restricted replicative adenovirus expressing human endostatin-angiostatin fusion gene exhibiting dramatic antitumor efficacy. Clinical Cancer Research, 14, 291-9.

Li, X., Raikwar, S. P., Liu, Y.-H., Lee, S.-J., Zhang, Y.-P., Zhang, S., et al. 2006. Combination therapy of androgen-independent prostate cancer using a prostate restricted replicative adenovirus and a replication-defective adenovirus encoding human endostatin-angiostatin fusion gene. Molecular Cancer Therapeutics, 5, 676- 84.

Li, Y. and Cozzi, P. J. 2010. Angiogenesis as a strategic target for prostate cancer therapy. Med Res Rev, 30, 23-66.

Li, Y., Rizvi, S. M., Ranson, M. and Allen, B. J. 2002. 213Bi-PAI2 conjugate selectively induces apoptosis in PC3 metastatic prostate cancer cell line and shows anti-cancer activity in a xenograft animal model. Br J Cancer, 86, 1197-203.

Liao, Y. H., Jones, S. A., Forbes, B., Martin, G. P. and Brown, M. B. 2005. Hyaluronan: pharmaceutical characterization and drug delivery. Drug Deliv, 12, 327-42.

Lijnen, H. R., Ugwu, F., Bini, A. and Collen, D. 1998. Generation of an angiostatin-like fragment from plasminogen by stromelysin-1 (MMP-3). Biochemistry, 37, 4699- 702.

Lin, H. K., Hu, Y. C., Yang, L., Altuwaijri, S., Chen, Y. T., Kang, H. Y., et al. 2003. Suppression versus induction of androgen receptor functions by the phosphatidylinositol 3-kinase/Akt pathway in prostate cancer LNCaP cells with different passage numbers. J Biol Chem, 278, 50902-7.

214

Line, B. R., Mitra, A., Nan, A. and Ghandehari, H. 2005. Targeting tumor angiogenesis: comparison of peptide and polymer-peptide conjugates. J Nucl Med, 46, 1552-60.

Lipponen, P., Aaltomaa, S., Tammi, R., Tammi, M., Agren, U. and Kosma, V. M. 2001. High stromal hyaluronan level is associated with poor differentiation and metastasis in prostate cancer. Eur J Cancer, 37, 849-56.

Litvinov, I. V., De Marzo, A. M. and Isaacs, J. T. 2003. Is the Achilles' heel for prostate cancer therapy a gain of function in androgen receptor signaling? J Clin Endocrinol Metab, 88, 2972-82.

Liu, A. Y., Latray, L. and Van Den Engh, G. 2000. Changes in cell surface molecules associated with in vitro culture of prostatic stromal cells. Prostate, 44, 303-12.

Liu, A. Y., True, L. D., Latray, L., Ellis, W. J., Vessella, R. L., Lange, P. H., et al. 1999. Analysis and sorting of prostate cancer cell types by flow cytometry. Prostate, 40, 192-9.

Liu, C., Huang, H., Donate, F., Dickinson, C., Santucci, R., El-Sheikh, A. , et al. 2002. Prostate-specific membrane antigen directed selective thrombotic infarction of tumors. Cancer Res, 62, 5470-5.

Liu, C. M., Chang, C. H., Yu, C. H., Hsu, C. C. and Huang, L. L. 2009. Hyaluronan substratum induces multidrug resistance in human mesenchymal stem cells via CD44 signaling. Cell Tissue Res, 336, 465-75.

Liu, J. and Jiang, G. 2006. CD44 and hematologic malignancies. Cell Mol Immunol, 3, 359- 65.

Logothetis, C. J. 2002. Docetaxel in the integrated management of prostate cancer. Current applications and future promise. Oncology (Williston Park), 16, 63-72.

Lokeshwar, B. L., Lokeshwar, V. B. and Block, N. L. 1995. Expression of CD44 in prostate cancer cells: association with cell proliferation and invasive potential. Anticancer Res, 15, 1191-8. 215

Ma, J. J., Chen, B. L. and Xin, X. Y. 2009. Inhibition of multi-drug resistance of ovarian carcinoma by small interfering RNA targeting to MRP2 gene. Arch Gynecol Obstet, 279, 149-57.

Mackay, C. R., Terpe, H. J., Stauder, R., Marston, W. L., Stark, H. and Gunthert, U. 1994. Expression and modulation of CD44 variant isoforms in humans. J Cell Biol, 124, 71-82.

Macmillan, M. L., Couriel, D., Weisdorf, D. J., Schwab, G., Havrilla, N., Fleming, T. R., et al. 2007. A phase 2/3 multicenter randomized clinical trial of ABX-CBL versus ATG as secondary therapy for steroid-resistant acute graft-versus-host disease. Blood, 109, 2657-62.

Madigan, M. C., Kingsley, E. A., Cozzi, P. J., Delprado, W. J., Russell, P. J. and Li, Y. 2008. The role of extracellular matrix metalloproteinase inducer protein in prostate cancer progression. Cancer Immunol Immunother, 57, 1367-79.

Maeshima, Y., Manfredi, M., Reimer, C., Holthaus, K. A., Hopfer, H., Chandamuri, B. R., et al. 2001. Identification of the anti-angiogenic site within vascular basement membrane-derived tumstatin. J Biol Chem, 276, 15240-8.

Maglione, D., Guerriero, V., Viglietto, G., Delli-Bovi, P. and Persico, M. G. 1991. Isolation of a human placenta cDNA coding for a protein related to the vascular permeability factor. Proceedings of the National Academy of Sciences of the United States of America, 88, 9267-71.

Makinen, T., Veikkola, T., Mustjoki, S., Karpanen, T., Catimel, B., Nice, E. C., et al. 2001. Isolated lymphatic endothelial cells transduce growth, survival and migratory signals via the VEGF-C/D receptor VEGFR-3. EMBO J, 20, 4762-73.

Mamaeva, O. A., Kim, J., Feng, G. and Mcdonald, J. M. 2009. Calcium/calmodulin- dependent kinase II regulates notch-1 signaling in prostate cancer cells. Journal of Cellular Biochemistry, 106, 25-32.

216

Mamori, S., Nagatsuma, K., Matsuura, T., Ohkawa, K., Hano, H., Fukunaga, M., et al. 2007. Useful detection of CD147 (EMMPRIN) for pathological diagnosis of early hepatocellular carcinoma in needle biopsy samples. World J Gastroenterol, 13, 2913-7.

Marangoni, E., Lecomte, N., Durand , L., De Pinieux, G., Decaudin, D., Chomienne, C., et al. 2009. CD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenografts. Br J Cancer, 100, 918-22.

Marieb, E. A., Zoltan-Jones, A., Li, R., Misra, S., Ghatak, S., Cao, J., et al. 2004. Emmprin promotes anchorage-independent growth in human mammary carcinoma cells by stimulating hyaluronan production. Cancer Res, 64, 1229-32.

Martinez-Zaguilan, R., Seftor, E. A., Seftor, R. E., Chu, Y. W., Gillies, R. J. and Hendrix, M. J. 1996. Acidic pH enhances the invasive behavior of human melanoma cells. Clin Exp Metastasis, 14, 176-86.

Matsushima, H., Goto, T., Hosaka, Y., Kitamura, T. and Kawabe, K. 1999. Correlation between proliferation, apoptosis, and angiogenesis in prostate carcinoma and their relation to androgen ablation. Cancer, 85, 1822-7.

May, M., Kaufmann, O., Hammermann, F., Loy, V. and Siegsmund, M. 2007. Prognostic impact of lymphovascular invasion in radical prostatectomy specimens. BJU Int, 99, 539-44.

Mazzucchelli, R., Montironi, R., Santinelli, A., Lucarini, G., Pugnaloni, A. and Biagini, G. 2000. Vascular endothelial growth factor expression and capillary architecture in high-grade PIN and prostate cancer in untreated and androgen-ablated patients. Prostate, 45, 72-9.

Mcallister, J. C., Zhan, Q., Weishaupt, C., Hsu, M. Y. and Murphy, G. F. 2010. The embryonic morphogen, Nodal, is associated with channel-like structures in human malignant melanoma xenografts. J Cutan Pathol, 37 Suppl 1, 19-25.

217

Mccarty, M. F. and Whitaker, J. 2010. Manipulating tumor acidification as a cancer treatment strategy. Altern Med Rev, 15, 264-72.

Mccubrey, J. A., Steelman, L. S., Abrams, S. L., Lee, J. T., Chang, F., Bertrand, F. E., et al. 2006. Roles of the RAF/MEK/ERK and PI3K/PTEN/AKT pathways in malignant transformation and drug resistance. Adv Enzyme Regul, 46, 249-79.

Mcneal, J. E. 1981. The zonal anatomy of the prostate. Prostate, 2, 35-49.

Mcneel, D. G., Eickhoff, J., Lee, F. T., King, D. M., Alberti, D., Thomas, J. P., et al. 2005. Phase I trial of a monoclonal antibody specific for alphavbeta3 integrin (MEDI-522) in patients with advanced malignancies, including an assessment of effect on tumor perfusion. Clin Cancer Res, 11, 7851-60.

Melnyk, O., Zimmerman, M., Kim, K. J. and Shuman, M. 1999. Neutralizing anti-vascular endothelial growth factor antibody inhibits further growth of established prostate cancer and metastases in a pre-clinical model. Journal of Urology, 161, 960-3.

Mesiano, S., Ferrara, N. and Jaffe, R. B. 1998. Role of vascular endothelial growth factor in ovarian cancer: inhibition of ascites formation by immunoneutralization. Am J Pathol, 153, 1249-56.

Miele, L. 2006. Notch signaling. Clinical Cancer Research, 12, 1074-9.

Migita, T., Oda, Y., Naito, S., Morikawa, W., Kuwano, M. and Tsuneyoshi, M. 2001. The accumulation of angiostatin-like fragments in human prostate carcinoma. Clinical Cancer Research, 7, 2750-6.

Miletti-Gonzalez, K. E., Chen, S., Muthukumaran, N., Saglimbeni, G. N., Wu, X., Yang, J., et al. 2005. The CD44 receptor interacts with P-glycoprotein to promote cell migration and invasion in cancer. Cancer Res, 65, 6660-7.

Millauer, B., Shawver, L. K., Plate, K. H., Risau, W. and Ullrich, A. 1994. Glioblastoma growth inhibited in vivo by a dominant-negative Flk-1 mutant. Nature, 367, 576-9.

218

Millauer, B., Wizigmann-Voos, S., Schnurch, H., Martinez, R., Moller, N. P., Risau, W., et al. 1993. High affinity VEGF binding and developmental expression suggest Flk-1 as a major regulator of vasculogenesis and angiogenesis. Cell, 72, 835-46.

Millimaggi, D., Mari, M., D'ascenzo, S., Carosa, E., Jannini, E. A., Zucker, S., et al. 2007. Tumor vesicle-associated CD147 modulates the angiogenic capability of endothelial cells. Neoplasia, 9, 349-57.

Millimaggi, D., Mari, M., S, D. A., Giusti, I., Pavan, A. and Dolo, V. 2009. Vasculogenic mimicry of human ovarian cancer cells: role of CD147. Int J Oncol, 35, 1423-8.

Misra, S., Ghatak, S. and Toole, B. P. 2005. Regulation of MDR1 expression and drug resistance by a positive feedback loop involving hyaluronan, phosphoinositide 3- kinase, and ErbB2. J Biol Chem, 280, 20310-5.

Misra, S., Ghatak, S., Zoltan-Jones, A. and Toole, B. P. 2003. Regulation of multidrug resistance in cancer cells by hyaluronan. J Biol Chem, 278, 25285-8.

Misra, S., Hascall, V. C., De Giovanni, C., Markwald, R. R. and Ghatak, S. 2009. Delivery of CD44 shRNA/nanoparticles within cancer cells: perturbation of hyaluronan/CD44v6 interactions and reduction in adenoma growth in Apc Min/+ MICE. J Biol Chem, 284, 12432-46.

Miyauchi, T., Masuzawa, Y. and Muramatsu, T. 1991. The basigin group of the immunoglobulin superfamily: complete conservation of a segment in and around transmembrane domains of human and mouse basigin and chicken HT7 antigen. J Biochem, 110, 770-4.

Miyoshi, T., Kondo, K., Hino, N., Uyama, T. and Monden, Y. 1997. The expression of the CD44 variant exon 6 is associated with lymph node metastasis in non-small cell lung cancer. Clin Cancer Res, 3, 1289-97.

Mollinedo, F. and Gajate, C. 2003. Microtubules, microtubule-interfering agents and apoptosis. Apoptosis, 8, 413-50.

219

Morikawa, W., Yamamoto, K., Ishikawa, S., Takemoto, S., Ono, M., Fukushi, J. I., et al. 2000. Angiostatin generation by cathepsin D secreted by human prostate carcinoma cells. Journal of Biological Chemistry, 275, 38912-20.

Morisada, T., Oike, Y., Yamada, Y., Urano, T., Akao, M., Kubota, Y., et al. 2005. Angiopoietin-1 promotes LYVE-1-positive lymphatic vessel formation. Blood, 105, 4649-56.

Moschos, S. J., Sander, C. A., Wang, W., Reppert, S. L., Drogowski, L. M., Jukic, D. M., et al. 2010. Pharmacodynamic (phase 0) study using etaracizumab in advanced melanoma. J Immunother, 33, 316-25.

Moser, T. L., Stack, M. S., Asplin, I., Enghild, J. J., Hojrup, P., Everitt, L., et al. 1999. Angiostatin binds ATP synthase on the surface of human endothelial cells. Proceedings of the National Academy of Sciences of the United States of America, 96, 2811-6.

Mukhopadhyay, D., Tsiokas, L. and Sukhatme, V. P. 1995. Wild-type p53 and v-Src exert opposing influences on human vascular endothelial growth factor gene expression. Cancer Research, 55, 6161-5.

Mulgrew, K., Kinneer, K., Yao, X. T., Ward, B. K., Damschroder, M. M., Walsh, B., et al. 2006. Direct targeting of alphavbeta3 integrin on tumor cells with a monoclonal antibody, Abegrin. Mol Cancer Ther, 5, 3122-9.

Muramatsu, T. and Miyauchi, T. 2003. Basigin (CD147): a multifunctional transmembrane protein involved in reproduction, neural function, inflammation and tumor invasion. Histol Histopathol, 18, 981-7.

Nabeshima, K., Iwasaki, H., Koga, K., Hojo, H., Suzumiya, J. and Kikuchi, M. 2006. Emmprin (basigin/CD147): matrix metalloproteinase modulator and multifunctional cell recognition molecule that plays a critical role in cancer progression. Pathol Int, 56, 359-67.

220

Nabeshima, K., Suzumiya, J., Nagano, M., Ohshima, K., Toole, B. P., Tamura, K., et al. 2004. Emmprin, a cell surface inducer of matrix metalloproteinases (MMPs), is expressed in T-cell lymphomas. J Pathol, 202, 341-51.

Nagabhushan, M., Pretlow, T. G., Guo, Y. J., Amini, S. B., Pretlow, T. P. and Sy, M. S. 1996. Altered expression of CD44 in human prostate cancer during progression. Am J Clin Pathol, 106, 647-51.

Naor, D., Nedvetzki, S., Golan, I., Melnik, L. and Faitelson, Y. 2002. CD44 in cancer. Crit Rev Clin Lab Sci, 39, 527-79.

Naor, D., Sionov, R. V. and Ish-Shalom, D. 1997. CD44: structure, function, and association with the malignant process. Adv Cancer Res, 71, 241-319.

Nemeth, J. A., Harb, J. F., Barroso, U., Jr., He, Z., Grignon, D. J. and Cher, M. L. 1999. Severe combined immunodeficient-hu model of human prostate cancer metastasis to human bone. Cancer Res, 59, 1987-93.

Neufeld, G., Cohen, T., Gengrinovitch, S. and Poltorak, Z. 1999. Vascular endothelial growth factor (VEGF) and its receptors. FASEB Journal, 13, 9-22.

Newman, J. R., Gleysteen, J. P., Baranano, C. F., Bremser, J. R., Zhang, W., Zinn, K. R., et al. 2008. Stereomicroscopic fluorescence imaging of head and neck cancer xenografts targeting CD147. Cancer Biol Ther, 7, 1063-70.

Nishida, N., Yano, H., Komai, K., Nishida, T., Kamura, T. and Kojiro, M. 2004. Vascular endothelial growth factor C and vascular endothelial growth factor receptor 2 are related closely to the prognosis of patients with ovarian carcinoma. Cancer, 101, 1364-74.

Noguchi, M., Stamey, T. A., Mcneal, J. E. and Yemoto, C. M. 2000. Preoperative serum prostate specific antigen does not reflect biochemical failure rates after radical prostatectomy in men with large volume cancers. J Urol, 164, 1596-600.

221

Noguera-Troise, I., Daly, C., Papadopoulos, N. J., Coetzee, S., Boland, P., Gale, N. W., et al. 2006. Blockade of Dll4 inhibits tumour growth by promoting non-productive angiogenesis.[Reprint in Novartis Found Symp. 2007;283:106-20; discussion 121-5, 238-41; PMID: 18300417]. Nature, 444, 1032-7.

Noordzij, M. A., Van Steenbrugge, G. J., Schroder, F. H. and Van Der Kwast, T. H. 1999. Decreased expression of CD44 in metastatic prostate cancer. Int J Cancer, 84, 478- 83.

Noordzij, M. A., Van Steenbrugge, G. J., Verkaik, N. S., Schroder, F. H. and Van Der Kwast, T. H. 1997. The prognostic value of CD44 isoforms in prostate cancer patients treated by radical prostatectomy. Clin Cancer Res, 3, 805-15.

O'reilly, M. S., Boehm, T., Shing, Y., Fukai, N., Vasios, G., Lane, W. S., et al. 1997. Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell, 88, 277-85.

O'reilly, M. S., Holmgren, L., Shing, Y., Chen, C., Rosenthal, R. A., Moses, M., et al. 1994. Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell, 79, 315-28.

Ogawa, S., Oku, A., Sawano, A., Yamaguchi, S., Yazaki, Y. and Shibuya, M. 1998. A novel type of vascular endothelial growth factor, VEGF-E (NZ-7 VEGF), preferentially utilizes KDR/Flk-1 receptor and carries a potent mitotic activity without heparin-binding domain. Journal of Biological Chemistry, 273, 31273-82.

Ohashi, R., Takahashi, F., Cui, R., Yoshioka, M., Gu, T., Sasaki, S., et al. 2007. Interaction between CD44 and hyaluronate induces chemoresistance in non-small cell lung cancer cell. Cancer Lett, 252, 225-34.

Okamoto, I., Morisaki, T., Sasaki, J., Miyake, H., Matsumoto, M., Suga, M., et al. 1998. Molecular detection of cancer cells by competitive reverse transcription-polymerase chain reaction analysis of specific CD44 variant RNAs. J Natl Cancer Inst, 90, 307- 15.

222

Olofsson, B., Pajusola, K., Kaipainen, A., Von Euler, G., Joukov, V., Saksela, O., et al. 1996. Vascular endothelial growth factor B, a novel growth factor for endothelial cells. Proceedings of the National Academy of Sciences of the United States of America, 93, 2576-81.

Omara-Opyene, A. L., Qiu, J., Shah, G. V. and Iczkowski, K. A. 2004. Prostate cancer invasion is influenced more by expression of a CD44 isoform including variant 9 than by Muc18. Lab Invest, 84, 894-907.

Orian-Rousseau, V. 2010. CD44, a therapeutic target for metastasising tumours. Eur J Cancer, 46, 1271-7.

Ouhtit, A., Abd Elmageed, Z. Y., Abdraboh, M. E., Lioe, T. F. and Raj, M. H. 2007. In vivo evidence for the role of CD44s in promoting breast cancer metastasis to the liver. Am J Pathol, 171, 2033-9.

Overall, C. M. and Kleifeld, O. 2006. Tumour microenvironment - opinion: validating matrix metalloproteinases as drug targets and anti-targets for cancer therapy. Nat Rev Cancer, 6, 227-39.

Padera, T. P., Kuo, A. H., Hoshida, T., Liao, S., Lobo, J., Kozak, K. R., et al. 2008. Differential response of primary tumor versus lymphatic metastasis to VEGFR-2 and VEGFR-3 kinase inhibitors cediranib and vandetanib. Molecular Cancer Therapeutics, 7, 2272-9.

Palapattu, G. S., Wu, C., Silvers, C. R., Martin, H. B., Williams, K., Salamone, L., et al. 2009. Selective expression of CD44, a putative prostate cancer stem cell marker, in neuroendocrine tumor cells of human prostate cancer. Prostate, 69, 787-98.

Pang, X., Yi, Z., Zhang, X., Sung, B., Qu, W., Lian, X., et al. 2009. Acetyl-11-keto-beta- boswellic acid inhibits prostate tumor growth by suppressing vascular endothelial growth factor receptor 2-mediated angiogenesis. Cancer Research, 69, 5893-900.

223

Paradis, V., Eschwege, P., Loric, S., Dumas, F., Ba, N., Benoit, G., et al. 1998. De novo expression of CD44 in prostate carcinoma is correlated with systemic dissemination of prostate cancer. J Clin Pathol, 51, 798-802.

Patrawala, L., Calhoun-Davis, T., Schneider-Broussard, R. and Tang, D. G. 2007. Hierarchical organization of prostate cancer cells in xenograft tumors: the CD44+alpha2beta1+ cell population is enriched in tumor-initiating cells. Cancer Res, 67, 6796-805.

Patrawala, L., Calhoun, T., Schneider-Broussard, R., Li, H., Bhatia, B., Tang, S., et al. 2006. Highly purified CD44+ prostate cancer cells from xenograft human tumors are enriched in tumorigenic and metastatic progenitor cells. Oncogene, 25, 1696- 708.

Patterson, B. C. and Sang, Q. A. 1997. Angiostatin-converting enzyme activities of human matrilysin (MMP-7) and gelatinase B/type IV collagenase (MMP-9). J Biol Chem, 272, 28823-5.

Pedrero, J. M. G., Carracedo, D. G., Pinto, C. M., Zapatero, A. H., Rodrigo, J. P., Nieto, C. S., et al. 2005. Frequent genetic and biochemical alterations of the PI 3- K/AKT/PTEN pathway in head and neck squamous cell carcinoma. International Journal of Cancer, 114, 242-8.

Peehl, D. M. 2005. Primary cell cultures as models of prostate cancer development. Endocr Relat Cancer, 12, 19-47.

Peehl, D. M., Coram, M., Khine, H., Reese, S., Nolley, R. and Zhao, H. 2008. The significance of monoamine oxidase-A expression in high grade prostate cancer. J Urol, 180, 2206-11.

Pelicano, H., Martin, D. S., Xu, R. H. and Huang, P. 2006. Glycolysis inhibition for anticancer treatment. Oncogene, 25, 4633-46.

224

Pertega-Gomes, N., Vizcaino, J. R., Miranda-Goncalves, V., Pinheiro, C., Silva, J., Pereira, H., et al. 2011. Monocarboxylate transporter 4 (MCT4) and CD147 overexpression is associated with poor prognosis in prostate cancer. BMC Cancer, 11, 312.

Petrylak, D. P. 2005. Future directions in the treatment of androgen-independent prostate cancer. Urology, 65, 8-12.

Petrylak, D. P., Tangen, C. M., Hussain, M. H., Lara, P. N., Jr., Jones, J. A., Taplin, M. E., et al. 2004. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. N Engl J Med, 351, 1513-20.

Pinheiro, C., Longatto-Filho, A., Azevedo-Silva, J., Casal, M., Schmitt, F. C. and Baltazar, F. 2012. Role of monocarboxylate transporters in human cancers: state of the art. J Bioenerg Biomembr, 44, 127-39.

Pinheiro, C., Longatto-Filho, A., Ferreira, L., Pereira, S. M., Etlinger, D., Moreira, M. A., et al. 2008a. Increasing expression of monocarboxylate transporters 1 and 4 along progression to invasive cervical carcinoma. Int J Gynecol Pathol, 27, 568-74.

Pinheiro, C., Longatto-Filho, A., Scapulatempo, C., Ferreira, L., Martins, S., Pellerin, L., et al. 2008b. Increased expression of monocarboxylate transporters 1, 2, and 4 in colorectal carcinomas. Virchows Arch, 452, 139-46.

Pinheiro, C., Longatto-Filho, A., Simoes, K., Jacob, C. E., Bresciani, C. J., Zilberstein, B., et al. 2009. The prognostic value of CD147/EMMPRIN is associated with monocarboxylate transporter 1 co-expression in gastric cancer. Eur J Cancer, 45, 2418-24.

Pirie-Shepherd, S. R., Coffman, K. T., Resnick, D., Chan, R., Kisker, O., Folkman, J., et al. 2002. The role of angiostatin in the spontaneous bone and prostate cancers of pet dogs. Biochemical & Biophysical Research Communications, 292, 886-91.

225

Platt, V. M. and Szoka, F. C., Jr. 2008. Anticancer therapeutics: targeting macromolecules and nanocarriers to hyaluronan or CD44, a hyaluronan receptor. Mol Pharm, 5, 474- 86.

Pollard, M. 1998. Lobund-Wistar rat model of prostate cancer in man. Prostate, 37, 1-4.

Ponta, H., Sherman, L. and Herrlich, P. A. 2003. CD44: from adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol, 4, 33-45.

Postema, E. J., Borjesson, P. K., Buijs, W. C., Roos, J. C., Marres, H. A., Boerman, O. C., et al. 2003. Dosimetric analysis of radioimmunotherapy with 186Re-labeled bivatuzumab in patients with head and neck cancer. J Nucl Med, 44, 1690-9.

Powell, I. J. 2007. Epidemiology and pathophysiology of prostate cancer in African- American men. J Urol, 177, 444-9.

Pushkarsky, T., Yurchenko, V., Vanpouille, C., Brichacek, B., Vaisman, I., Hatakeyama, S., et al. 2005. Cell surface expression of CD147/EMMPRIN is regulated by cyclophilin 60. J Biol Chem, 280, 27866-71.

Pushkarsky, T., Zybarth, G., Dubrovsky, L., Yurchenko, V., Tang, H., Guo, H., et al. 2001. CD147 facilitates HIV-1 infection by interacting with virus-associated cyclophilin A. Proc Natl Acad Sci U S A, 98, 6360-5.

Quemener, C., Gabison, E. E., Naimi, B., Lescaille, G., Bougatef, F., Podgorniak, M. P., et al. 2007. Extracellular matrix metalloproteinase inducer up-regulates the urokinase- type plasminogen activator system promoting tumor cell invasion. Cancer Res, 67, 9-15.

Raikwar, S. P., Temm, C. J., Raikwar, N. S., Kao, C., Molitoris, B. A. and Gardner, T. A. 2005. Adenoviral vectors expressing human endostatin-angiostatin and soluble Tie2: enhanced suppression of tumor growth and antiangiogenic effects in a prostate tumor model. Molecular Therapy: the Journal of the American Society of Gene Therapy, 12, 1091-100.

226

Reese, David m., Fratesi, P., Corry, M., Novotny, W., Holmgren, E. and Small, Eric j. 2001. A Phase II Trial of Humanized Anti-Vascular Endothelial Growth Factor Antibody for the Treatment of Androgen-Independent Prostate Cancer. The Prostate Journal, 3, 65-70.

Reimers, N., Zafrakas, K., Assmann, V., Egen, C., Riethdorf, L., Riethdorf, S., et al. 2004. Expression of extracellular matrix metalloproteases inducer on micrometastatic and primary mammary carcinoma cells. Clin Cancer Res, 10, 3422-8.

Riethdorf, S., Reimers, N., Assmann, V., Kornfeld, J. W., Terracciano, L., Sauter, G., et al. 2006. High incidence of EMMPRIN expression in human tumors. Int J Cancer, 119, 1800-10.

Rizzo, S., Attard, G. and Hudson, D. L. 2005. Prostate epithelial stem cells. Cell Prolif, 38, 363-74.

Roberts, N., Kloos, B., Cassella, M., Podgrabinska, S., Persaud, K., Wu, Y., et al. 2006. Inhibition of VEGFR-3 activation with the antagonistic antibody more potently suppresses lymph node and distant metastases than inactivation of VEGFR-2. Cancer Research, 66, 2650-7.

Roehl, K. A., Han, M., Ramos, C. G., Antenor, J. A. and Catalona, W. J. 2004. Cancer progression and survival rates following anatomical radical retropubic prostatectomy in 3,478 consecutive patients: long-term results. J Urol, 172, 910-4.

Roma, A. A., Magi-Galluzzi, C., Kral, M. A., Jin, T. T., Klein, E. A. and Zhou, M. 2006. Peritumoral lymphatic invasion is associated with regional lymph node metastases in prostate adenocarcinoma. Mod Pathol, 19, 392-8.

Rosato, A., Banzato, A., De Luca, G., Renier, D., Bettella, F., Pagano, C., et al. 2006. HYTAD1-p20: a new paclitaxel-hyaluronic acid hydrosoluble bioconjugate for treatment of superficial bladder cancer. Urol Oncol, 24, 207-15.

227

Rosenfeld, P. J., Brown, D. M., Heier, J. S., Boyer, D. S., Kaiser, P. K., Chung, C. Y., et al. 2006. Ranibizumab for Neovascular Age-Related Macular Degeneration. N Engl J Med, 355, 1419-1431.

Rosenthal, E. L., Vidrine, D. M. and Zhang, W. 2006. Extracellular matrix metalloprotease inducer stimulates fibroblast-mediated tumor growth in vivo. Laryngoscope, 116, 1086-92.

Rosol, T. J., Tannehill-Gregg, S. H., Corn, S., Schneider, A. and Mccauley, L. K. 2004. Animal models of bone metastasis. Cancer Treat Res, 118, 47-81.

Rowehl, R. A., Crawford, H., Dufour, A., Ju, J. and Botchkina, G. I. 2008. Genomic analysis of prostate cancer stem cells isolated from a highly metastatic cell line. Cancer Genomics Proteomics, 5, 301-10.

Rubin, M. A., Dunn, R., Strawderman, M. and Pienta, K. J. 2002. Tissue microarray sampling strategy for prostate cancer biomarker analysis. Am J Surg Pathol, 26, 312-9.

Rudrabhatla, S. R., Mahaffey, C. L. and Mummert, M. E. 2006. Tumor microenvironment modulates hyaluronan expression: the lactate effect. J Invest Dermatol, 126, 1378- 87.

Rupp, U., Schoendorf-Holland , E., Eichbaum, M., Schuetz, F., Lauschner, I., Schmidt, P., et al. 2007. Safety and pharmacokinetics of bivatuzumab mertansine in patients with CD44v6-positive metastatic breast cancer: final results of a phase I study. Anticancer Drugs, 18, 477-85.

Ryan, C. J., Stadler, W. M., Roth, B., Hutcheon, D., Conry, S., Puchalski, T., et al. 2007. Phase I dose escalation and pharmacokinetic study of AZD2171, an inhibitor of the vascular endothelial growth factor receptor tyrosine kinase, in patients with hormone refractory prostate cancer (HRPC). Investigational New Drugs, 25, 445-51.

228

Sakr, W. A., Tefilli, M. V., Grignon, D. J., Banerjee, M., Dey, J., Gheiler, E. L., et al. 2000. Gleason score 7 prostate cancer: a heterogeneous entity? Correlation with pathologic parameters and disease-free survival. Urology, 56, 730-4.

Sauter, A., Kloft, C., Gronau, S., Bogeschdorfer, F., Erhardt, T., Golze, W., et al. 2007. Pharmacokinetics, immunogenicity and safety of bivatuzumab mertansine, a novel CD44v6-targeting immunoconjugate, in patients with squamous cell carcinoma of the head and neck. Int J Oncol, 30, 927-35.

Scappaticci, F. A., Contreras, A., Smith, R., Bonhoure, L., Lum, B., Cao, Y., et al. 2001. Statin-AE: a novel angiostatin-endostatin fusion protein with enhanced antiangiogenic and antitumor activity. Angiogenesis, 4, 263-8.

Scatena, C. D., Hepner, M. A., Oei, Y. A., Dusich, J. M., Yu, S. F., Purchio, T., et al. 2004. Imaging of bioluminescent LNCaP-luc-M6 tumors: a new animal model for the study of metastatic human prostate cancer. Prostate, 59, 292-303.

Scatena, M., Almeida, M., Chaisson, M. L., Fausto, N., Nicosia, R. F. and Giachelli, C. M. 1998. NF-kappaB mediates alphavbeta3 integrin-induced endothelial cell survival. J Cell Biol, 141, 1083-93.

Scavelli, C., Vacca, A., Di Pietro, G., Dammacco, F. and Ribatti, D. 2004. Crosstalk between angiogenesis and lymphangiogenesis in tumor progression. Leukemia, 18, 1054-8.

Scehnet, J. S., Jiang, W., Kumar, S. R., Krasnoperov, V., Trindade, A., Benedito, R., et al. 2007. Inhibition of Dll4-mediated signaling induces proliferation of immature vessels and results in poor tissue perfusion. Blood, 109, 4753-60.

Schlappack, O. K., Zimmermann, A. and Hill, R. P. 1991. Glucose starvation and acidosis: effect on experimental metastatic potential, DNA content and MTX resistance of murine tumour cells. Br J Cancer, 64, 663-70.

229

Schlessinger, J. 2000. New roles for Src kinases in control of cell survival and angiogenesis. Cell, 100, 293-6.

Schneiderhan, W., Scheler, M., Holzmann, K. H., Marx, M., Gschwend, J. E., Bucholz, M., et al. 2009. CD147 silencing inhibits lactate transport and reduces malignant potential of pancreatic cancer cells in in vivo and in vitro models. Gut, 58, 1391-8.

Scorey, N., Fraser, S. P., Patel, P., Pridgeon, C., Dallman, M. J. and Djamgoz, M. B. A. 2006. Notch signalling and voltage-gated Na+ channel activity in human prostate cancer cells: independent modulation of in vitro motility. Prostate Cancer & Prostatic Diseases, 9, 399-406.

Screaton, G. R., Bell, M. V., Jackson, D. G., Cornelis, F. B., Gerth, U. and Bell, J. I. 1992. Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc Natl Acad Sci U S A, 89, 12160-4.

Seftor, R. E., Seftor, E. A., Kirschmann, D. A. and Hendrix, M. J. 2002. Targeting the tumor microenvironment with chemically modified tetracyclines: inhibition of laminin 5 gamma2 chain promigratory fragments and vasculogenic mimicry. Mol Cancer Ther, 1, 1173-9.

Senger, D. R., Galli, S. J., Dvorak, A. M., Perruzzi, C. A., Harvey, V. S. and Dvorak, H. F. 1983. Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid. Science, 219, 983-5.

Senthil, D., Ghosh Choudhury, G., Bhandari, B. K. and Kasinath, B. S. 2002. The type 2 vascular endothelial growth factor receptor recruits insulin receptor substrate-1 in its signalling pathway. Biochemical Journal, 368, 49-56.

Shappell, S. B., Thomas, G. V., Roberts, R. L., Herbert, R., Ittmann, M. M., Rubin, M. A., et al. 2004. Prostate pathology of genetically engineered mice: definitions and classification. The consensus report from the Bar Harbor meeting of the Mouse Models of Human Cancer Consortium Prostate Pathology Committee. Cancer Res, 64, 2270-305.

230

Sharma, N., Seftor, R. E., Seftor, E. A., Gruman, L. M., Heidger, P. M., Jr., Cohen, M. B., et al. 2002. Prostatic tumor cell plasticity involves cooperative interactions of distinct phenotypic subpopulations: role in vasculogenic mimicry. Prostate, 50, 189-201.

Sheridan, C., Kishimoto, H., Fuchs, R. K., Mehrotra, S., Bhat-Nakshatri, P., Turner, C. H., et al. 2006. CD44+/CD24- breast cancer cells exhibit enhanced invasive properties: an early step necessary for metastasis. Breast Cancer Res, 8, R59.

Shirakawa, K., Tsuda, H., Heike, Y., Kato, K., Asada, R., Inomata, M., et al. 2001. Absence of endothelial cells, central necrosis, and fibrosis are associated with aggressive inflammatory breast cancer. Cancer Research, 61, 445-51.

Shirakawa, K., Wakasugi, H., Heike, Y., Watanabe, I., Yamada, S., Saito, K., et al. 2002. Vasculogenic mimicry and pseudo-comedo formation in breast cancer. International Journal of Cancer, 99, 821-8.

Shou, J., Ross, S., Koeppen, H., De Sauvage, F. J. and Gao, W. Q. 2001. Dynamics of notch expression during murine prostate development and tumorigenesis. Cancer Res, 61, 7291-7.

Shukla, S., Maclennan, G. T., Hartman, D. J., Fu, P., Resnick, M. I. and Gupta, S. 2007. Activation of PI3K-Akt signaling pathway promotes prostate cancer cell invasion. Int J Cancer, 121, 1424-32.

Shweiki, D., Itin, A., Soffer, D. and Keshet, E. 1992. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature, 359, 843- 5.

Sienel, W., Polzer, B., Elshawi, K., Lindner, M., Morresi-Hauf, A., Vay, C., et al. 2008. Cellular localization of EMMPRIN predicts prognosis of patients with operable lung adenocarcinoma independent from MMP-2 and MMP-9. Mod Pathol, 21, 1130-8.

231

Signoretti, S., Pires, M. M., Lindauer, M., Horner, J. W., Grisanzio, C., Dhar, S., et al. 2005. p63 regulates commitment to the prostate cell lineage. Proc Natl Acad Sci U S A, 102, 11355-60.

Silberman, M. A., Partin, A. W., Veltri, R. W. and Epstein, J. I. 1997. Tumor angiogenesis correlates with progression after radical prostatectomy but not with pathologic stage in Gleason sum 5 to 7 adenocarcinoma of the prostate. Cancer, 79, 772-9.

Sillanpaa, S., Anttila, M., Suhonen, K., Hamalainen, K., Turpeenniemi-Hujanen, T., Puistola, U., et al. 2007. Prognostic significance of extracellular matrix metalloproteinase inducer and matrix metalloproteinase 2 in epithelial ovarian cancer. Tumour Biol, 28, 280-9.

Silver, D. A., Pellicer, I., Fair, W. R., Heston, W. D. and Cordon-Cardo, C. 1997. Prostate- specific membrane antigen expression in normal and malignant human tissues. Clin Cancer Res, 3, 81-5.

Simon, R. A., Di Sant'agnese, P. A., Huang, L. S., Xu, H., Yao, J. L., Yang, Q., et al. 2009. CD44 expression is a feature of prostatic small cell carcinoma and distinguishes it from its mimickers. Hum Pathol, 40, 252-8.

Sircar, K., Yoshimoto, M., Monzon, F. A., Koumakpayi, I. H., Katz, R. L., Khanna, A., et al. 2009. PTEN genomic deletion is associated with p-Akt and AR signalling in poorer outcome, hormone refractory prostate cancer. Journal of Pathology, 218, 505-13.

Slomiany, M. G., Dai, L., Bomar, P. A., Knackstedt, T. J., Kranc, D. A., Tolliver, L., et al. 2009a. Abrogating drug resistance in malignant peripheral nerve sheath tumors by disrupting hyaluronan-CD44 interactions with small hyaluronan oligosaccharides. Cancer Res, 69, 4992-8.

Slomiany, M. G., Dai, L., Tolliver, L. B., Grass, G. D., Zeng, Y. and Toole, B. P. 2009b. Inhibition of Functional Hyaluronan-CD44 Interactions in CD133-positive Primary

232

Human Ovarian Carcinoma Cells by Small Hyaluronan Oligosaccharides. Clin Cancer Res, 15, 7593-7601.

Slomiany, M. G., Grass, G. D., Robertson, A. D., Yang, X. Y., Maria, B. L., Beeson, C., et al. 2009c. Hyaluronan, CD44, and emmprin regulate lactate efflux and membrane localization of monocarboxylate transporters in human breast carcinoma cells. Cancer Res, 69, 1293-301.

Soker, S., Takashima, S., Miao, H. Q., Neufeld, G. and Klagsbrun, M. 1998. Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell, 92, 735-45.

Sonveaux, P., Vegran, F., Schroeder, T., Wergin, M. C., Verrax, J., Rabbani, Z. N., et al. 2008. Targeting lactate-fueled respiration selectively kills hypoxic tumor cells in mice. J Clin Invest, 118, 3930-42.

Stacker, S. A., Caesar, C., Baldwin, M. E., Thornton, G. E., Williams, R. A., Prevo, R., et al. 2001. VEGF-D promotes the metastatic spread of tumor cells via the lymphatics. Nat Med, 7, 186-91.

Stamey, T. A., Mcneal, J. E., Yemoto, C. M., Sigal, B. M. and Johnstone, I. M. 1999. Biological determinants of cancer progression in men with prostate cancer. JAMA, 281, 1395-400.

Steelman, L. S., Bertrand, F. E. and Mccubrey, J. A. 2004. The complexity of PTEN: mutation, marker and potential target for therapeutic intervention. Expert Opinion on Therapeutic Targets, 8, 537-50.

Steinbild, S., Mross, K., Frost, A., Morant, R., Gillessen, S., Dittrich, C., et al. 2007. A clinical phase II study with sorafenib in patients with progressive hormone- refractory prostate cancer: a study of the CESAR Central European Society for Anticancer Drug Research-EWIV. Br J Cancer, 97, 1480-5.

233

Stern, R. 2005. Hyaluronan metabolism: a major paradox in cancer biology. Pathol Biol (Paris), 53, 372-82.

Stewart, R. J., Panigrahy, D., Flynn, E. and Folkman, J. 2001. Vascular endothelial growth factor expression and tumor angiogenesis are regulated by androgens in hormone responsive human prostate carcinoma: evidence for androgen dependent destabilization of vascular endothelial growth factor transcripts. Journal of Urology, 165, 688-93.

Stollman, T. H., Ruers, T. J., Oyen, W. J. and Boerman, O. C. 2009. New targeted probes for radioimaging of angiogenesis. Methods, 48, 188-92.

Strohmeyer, D., Rossing, C., Bauerfeind, A., Kaufmann, O., Schlechte, H., Bartsch, G., et al. 2000. Vascular endothelial growth factor and its correlation with angiogenesis and p53 expression in prostate cancer. Prostate, 45, 216-24.

Su, J., Chen, X. and Kanekura, T. 2009. A CD147-targeting siRNA inhibits the proliferation, invasiveness, and VEGF production of human malignant melanoma cells by down-regulating glycolysis. Cancer Lett, 273, 140-7.

Subramaniam, V., Vincent, I. R., Gilakjan, M. and Jothy, S. 2007. Suppression of human colon cancer tumors in nude mice by siRNA CD44 gene therapy. Exp Mol Pathol, 83, 332-40.

Sudhakar, A., Sugimoto, H., Yang, C., Lively, J., Zeisberg, M. and Kalluri, R. 2003. Human tumstatin and human endostatin exhibit distinct antiangiogenic activities mediated by alpha v beta 3 and alpha 5 beta 1 integrins. Proceedings of the National Academy of Sciences of the United States of America, 100, 4766-71.

Sugiura, T., Inoue, Y., Matsuki, R., Ishii, K., Takahashi, M., Abe, M., et al. 2009. VEGF-C and VEGF-D expression is correlated with lymphatic vessel density and lymph node metastasis in oral squamous cell carcinoma: Implications for use as a prognostic marker. Int J Oncol, 34, 673-80.

234

Sullivan, D. C. and Bicknell, R. 2003. New molecular pathways in angiogenesis. British Journal of Cancer, 89, 228-31.

Sun, B., Zhang, S., Zhao, X., Zhang, W. and Hao, X. 2004. Vasculogenic mimicry is associated with poor survival in patients with mesothelial sarcomas and alveolar rhabdomyosarcomas. Int J Oncol, 25, 1609-14.

Sun, J. and Hemler, M. E. 2001. Regulation of MMP-1 and MMP-2 production through CD147/extracellular matrix metalloproteinase inducer interactions. Cancer Res, 61, 2276-81.

Sun, L. C., Luo, J., Mackey, L. V., Fuselier, J. A. and Coy, D. H. 2007. A conjugate of camptothecin and a somatostatin analog against prostate cancer cell invasion via a possible signaling pathway involving PI3K/Akt, alphaVbeta3/alphaVbeta5 and MMP-2/-9. Cancer Lett, 246, 157-66.

Sun, T., Zhao, N., Zhao, X. L., Gu, Q., Zhang, S. W., Che, N., et al. 2010. Expression and functional significance of Twist1 in hepatocellular carcinoma: its role in vasculogenic mimicry. Hepatology, 51, 545-56.

Sung, V., Stubbs, J. T., 3rd, Fisher, L., Aaron, A. D. and Thompson, E. W. 1998. Bone sialoprotein supports breast cancer cell adhesion proliferation and migration through differential usage of the alpha(v)beta3 and alpha(v)beta5 integrins. J Cell Physiol, 176, 482-94.

Surace, C., Arpicco, S., Dufay-Wojcicki, A., Marsaud, V., Bouclier, C., Clay, D., et al. 2009. Lipoplexes targeting the CD44 hyaluronic acid receptor for efficient transfection of breast cancer cells. Mol Pharm, 6, 1062-73.

Taetz, S., Bochot, A., Surace, C., Arpicco, S., Renoir, J. M., Schaefer, U. F., et al. 2009. Hyaluronic acid-modified DOTAP/DOPE liposomes for the targeted delivery of anti-telomerase siRNA to CD44-expressing lung cancer cells. Oligonucleotides, 19, 103-16.

235

Takahashi, K., Stamenkovic, I., Cutler, M., Dasgupta, A. and Tanabe, K. K. 1996. Keratan sulfate modification of CD44 modulates adhesion to hyaluronate. J Biol Chem, 271, 9490-6.

Takahashi, S., Kimoto, N., Orita, S., Cui, L., Sakakibara, M. and Shirai, T. 1998. Relationship between CD44 expression and differentiation of human prostate adenocarcinomas. Cancer Lett, 129, 97-102.

Takaishi, S., Okumura, T., Tu, S., Wang, S. S., Shibata, W., Vigneshwaran, R., et al. 2009. Identification of gastric cancer stem cells using the cell surface marker CD44. Stem Cells, 27, 1006-20.

Tang, D. G., Patrawala, L., Calhoun, T., Bhatia, B., Choy, G., Schneider-Broussard, R., et al. 2007. Prostate cancer stem/progenitor cells: identification, characterization, and implications. Mol Carcinog, 46, 1-14.

Tang, W., Chang, S. B. and Hemler, M. E. 2004a. Links between CD147 function, glycosylation, and caveolin-1. Mol Biol Cell, 15, 4043-50.

Tang, W. and Hemler, M. E. 2004b. Caveolin-1 regulates matrix metalloproteinases-1 induction and CD147/EMMPRIN cell surface clustering. J Biol Chem, 279, 11112- 8.

Tang, Y., Kesavan, P., Nakada, M. T. and Yan, L. 2004. Tumor-stroma interaction: positive feedback regulation of extracellular matrix metalloproteinase inducer (EMMPRIN) expression and matrix metalloproteinase-dependent generation of soluble EMMPRIN. Mol Cancer Res, 2, 73-80.

Tang, Y., Nakada, M. T., Kesavan, P., Mccabe, F., Millar, H., Rafferty, P., et al. 2005. Extracellular matrix metalloproteinase inducer stimulates tumor angiogenesis by elevating vascular endothelial cell growth factor and matrix metalloproteinases. Cancer Res, 65, 3193-9.

236

Tannock, I. F., De Wit, R., Berry, W. R., Horti, J., Pluzanska, A., Chi, K. N., et al. 2004. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med, 351, 1502-12.

Tarui, T., Miles, L. A. and Takada, Y. 2001. Specific interaction of angiostatin with integrin alpha(v)beta(3) in endothelial cells. Journal of Biological Chemistry, 276, 39562-8.

Tefilli, M. V., Gheiler, E. L., Tiguert, R., Sakr, W., Grignon, D. J., Banerjee, M., et al. 1999. Should Gleason score 7 prostate cancer be considered a unique grade category? Urology, 53, 372-7.

Terman, B. I., Dougher-Vermazen, M., Carrion, M. E., Dimitrov, D., Armellino, D. C., Gospodarowicz, D., et al. 1992. Identification of the KDR tyrosine kinase as a receptor for vascular endothelial cell growth factor. Biochemical & Biophysical Research Communications, 187, 1579-86.

Thalmann, G. N., Anezinis, P. E., Chang, S. M., Zhau, H. E., Kim, E. E., Hopwood, V. L., et al. 1994. Androgen-independent cancer progression and bone metastasis in the LNCaP model of human prostate cancer. Cancer Res, 54, 2577-81.

Thompson, I. M., Pauler, D. K., Goodman, P. J., Tangen, C. M., Lucia, M. S., Parnes, H. L., et al. 2004. Prevalence of prostate cancer among men with a prostate-specific antigen level < or =4.0 ng per milliliter. N Engl J Med, 350, 2239-46.

Thurston, G., Noguera-Troise, I. and Yancopoulos, G. D. 2007. The Delta paradox: DLL4 blockade leads to more tumour vessels but less tumour growth. Nat Rev Cancer, 7, 327-31.

Tijink, B. M., Buter, J., De Bree, R., Giaccone, G., Lang, M. S., Staab, A., et al. 2006. A phase I dose escalation study with anti-CD44v6 bivatuzumab mertansine in patients with incurable squamous cell carcinoma of the head and neck or esophagus. Clin Cancer Res, 12, 6064-72.

237

Toole, B. P. 2004. Hyaluronan: from extracellular glue to pericellular cue. Nat Rev Cancer, 4, 528-39.

Toole, B. P. and Slomiany, M. G. 2008. Hyaluronan, CD44 and Emmprin: partners in cancer cell chemoresistance. Drug Resist Updat, 11, 110-21.

Trapeznikova, M. F., Shibaeva, A. N., Ianshin, A. A., Urenkov, S. B., Mironova, O. S., Kazantseva, I. A., et al. [Vascular endothelial growth factor and insulin-like-growth factors in prostate cancer. ]. Urologiia, 17-21.

Tredan, O., Galmarini, C. M., Patel, K. and Tannock, I. F. 2007. Drug resistance and the solid tumor microenvironment. J Natl Cancer Inst, 99, 1441-54.

Trojan, L., Michel, M. S., Rensch, F., Jackson, D. G., Alken, P. and Grobholz, R. 2004. Lymph and blood vessel architecture in benign and malignant prostatic tissue: lack of lymphangiogenesis in prostate carcinoma assessed with novel lymphatic marker lymphatic vessel endothelial hyaluronan receptor (LYVE-1). J Urol, 172, 103-7.

Tsai, W. C., Chao, Y. C., Lee, W. H., Chen, A., Sheu, L. F. and Jin, J. S. 2006. Increasing EMMPRIN and matriptase expression in hepatocellular carcinoma: tissue microarray analysis of immunohistochemical scores with clinicopathological parameters. Histopathology, 49, 388-95.

Turner, K. and Jones, A. 2000. Vascular endothelial growth factor in prostate cancer. Urology, 56, 183.

Underhill, C. 1992. CD44: the hyaluronan receptor. J Cell Sci, 103 ( Pt 2), 293-8.

Valdespino, V., Tsagozis, P. and Pisa, P. 2007a. Current perspectives in the treatment of advanced prostate cancer. Med Oncol, 24, 273-86.

Valdespino, V., Tsagozis, P., Pisa, P., Valdespino, V., Tsagozis, P. and Pisa, P. 2007b. Current perspectives in the treatment of advanced prostate cancer. Medical Oncology, 24, 273-86.

238

Van Bokhoven, A., Varella-Garcia, M., Korch, C., Johannes, W. U., Smith, E. E., Miller, H. L., et al. 2003. Molecular characterization of human prostate carcinoma cell lines. Prostate, 57, 205-25.

Van Brussel, J. P., Jan Van Steenbrugge, G., Van Krimpen, C., Bogdanowicz, J. F., Van Der Kwast, T. H., Schroder, F. H., et al. 2001. Expression of multidrug resistance related proteins and proliferative activity is increased in advanced clinical prostate cancer. J Urol, 165, 130-5.

Van Der, P., Vloedgraven, H., Papapoulos, S., Lowick, C., Grzesik, W., Kerr, J., et al. 1997. Attachment characteristics and involvement of integrins in adhesion of breast cancer cell lines to extracellular bone matrix components. Lab Invest, 77, 665-75.

Vercruysse, K. P. and Prestwich, G. D. 1998. Hyaluronate derivatives in drug delivery. Crit Rev Ther Drug Carrier Syst, 15, 513-55.

Villaronga, M. A., Bevan, C. L. and Belandia, B. 2008. Notch signaling: a potential therapeutic target in prostate cancer. Curr Cancer Drug Targets, 8, 566-80.

Wang, L., Chen, H., Pourgholami, M. H., Beretov, J., Hao, J., Chao, H., et al. 2011. Anti- MUC1 monoclonal antibody (C595) and docetaxel markedly reduce tumor burden and ascites, and prolong survival in an in vivo ovarian cancer model. PLoS One, 6, e24405.

Wang, L., Wu, G., Yu, L., Yuan, J., Fang, F., Zhai, Z., et al. 2006. Inhibition of CD147 expression reduces tumor cell invasion in human prostate cancer cell line via RNA interference. Cancer Biol Ther, 5, 608-14.

Wang, S., Gao, J., Lei, Q., Rozengurt, N., Pritchard, C., Jiao, J., et al. 2003. Prostate- specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell, 4, 209-21.

239

Wang, W., Lin, P., Han, C., Cai, W., Zhao, X. and Sun, B. 2010. Vasculogenic mimicry contributes to lymph node metastasis of laryngeal squamous cell carcinoma. J Exp Clin Cancer Res, 29, 60.

Wang, W. J., Li, Q. Q., Xu, J. D., Cao, X. X., Li, H. X., Tang, F., et al. 2008. Interaction between CD147 and P-glycoprotein and their regulation by ubiquitination in breast cancer cells. Chemotherapy, 54, 291-301.

Wang, Z., Li, Y., Banerjee, S., Kong, D., Ahmad, A., Nogueira, V., et al. 2010. Down- regulation of Notch-1 and Jagged-1 inhibits prostate cancer cell growth, migration and invasion, and induces apoptosis via inactivation of Akt, mTOR, and NF-kappaB signaling pathways. J Cell Biochem, 109, 726-36.

Wang, Z., Li, Y., Banerjee, S. and Sarkar, F. H. 2008. Exploitation of the Notch signaling pathway as a novel target for cancer therapy. Anticancer Res, 28, 3621-30.

Ware, J. L., Paulson, D. F., Mickey, G. H. and Webb, K. S. 1982. Spontaneous metastasis of cells of the human prostate carcinoma cell line PC-3 in athymic nude mice. J Urol, 128, 1064-7.

Warso, M. A., Maniotis, A. J., Chen, X., Majumdar, D., Patel, M. K., Shilkaitis, A., et al. 2001. Prognostic significance of periodic acid-Schiff-positive patterns in primary cutaneous melanoma. Clinical Cancer Research, 7, 473-7.

Weber, G. F., Bronson, R. T., Ilagan, J., Cantor, H., Schmits, R. and Mak, T. W. 2002. Absence of the CD44 gene prevents sarcoma metastasis. Cancer Res, 62, 2281-6.

Wegiel, B., Jiborn, T., Abrahamson, M., Helczynski, L., Otterbein, L., Persson, J. L., et al. 2009. Cystatin C is downregulated in prostate cancer and modulates invasion of prostate cancer cells via MAPK/Erk and androgen receptor pathways. PLoS One, 4, e7953.

240

Wei, C., Guomin, W., Yujun, L. and Ruizhe, Q. 2007. Cancer stem-like cells in human prostate carcinoma cells DU145: the seeds of the cell line? Cancer Biol Ther, 6, 763-8.

Weidner, N., Carroll, P. R., Flax, J., Blumenfeld, W. and Folkman, J. 1993. Tumor angiogenesis correlates with metastasis in invasive prostate carcinoma. American Journal of Pathology, 143, 401-9.

Wen, W., Lu, J., Zhang, K. and Chen, S. 2008. Grape seed extract inhibits angiogenesis via suppression of the vascular endothelial growth factor receptor signaling pathway. Cancer Prevention Research, 1, 554-61.

Weng, A. P. and Aster, J. C. 2004. Multiple niches for Notch in cancer: context is everything. Curr Opin Genet Dev, 14, 48-54.

Werynska, B., Dziegiel, P. and Jankowska, R. 2009. Role of lymphangiogenesis in lung cancer. Folia Histochem Cytobiol, 47, 333-42.

West, A. F., O'donnell, M., Charlton, R. G., Neal, D. E. and Leung, H. Y. 2001. Correlation of vascular endothelial growth factor expression with fibroblast growth factor-8 expression and clinico-pathologic parameters in human prostate cancer. British Journal of Cancer, 85, 576-83.

Whelan, J. T., Kellogg, A., Shewchuk, B. M., Hewan-Lowe, K. and Bertrand, F. E. 2009. Notch-1 signaling is lost in prostate adenocarcinoma and promotes PTEN gene expression. Journal of Cellular Biochemistry, 107, 992-1001.

Wilson, M. C., Meredith, D., Fox, J. E., Manoharan, C., Davies, A. J. and Halestrap, A. P. 2005. Basigin (CD147) is the target for organomercurial inhibition of monocarboxylate transporter isoforms 1 and 4: the ancillary protein for the insensitive MCT2 is EMBIGIN (gp70). J Biol Chem, 280, 27213-21.

241

Witte, M. H., Jones, K., Wilting, J., Dictor, M., Selg, M., Mchale, N., et al. 2006. Structure function relationships in the lymphatic system and implications for cancer biology. Cancer Metastasis Rev, 25, 159-84.

Wong, C. and Jin, Z.-G. 2005. Protein kinase C-dependent protein kinase D activation modulates ERK signal pathway and endothelial cell proliferation by vascular endothelial growth factor. Journal of Biological Chemistry, 280, 33262-9.

Wong, S. Y., Haack, H., Crowley, D., Barry, M., Bronson, R. T. and Hynes, R. O. 2005. Tumor-secreted vascular endothelial growth factor-C is necessary for prostate cancer lymphangiogenesis, but lymphangiogenesis is unnecessary for lymph node metastasis. Cancer Research, 65, 9789-98.

Xie, Z., Choong, P. F., Poon, L. F., Zhou, J., Khng, J., Jasinghe, V. J., et al. 2008. Inhibition of CD44 expression in hepatocellular carcinoma cells enhances apoptosis, chemosensitivity, and reduces tumorigenesis and invasion. Cancer Chemother Pharmacol, 62, 949-57.

Xu, J., Shen, Z. Y., Chen, X. G., Zhang, Q., Bian, H. J., Zhu, P., et al. 2007a. A randomized controlled trial of Licartin for preventing hepatoma recurrence after liver transplantation. Hepatology, 45, 269-76.

Xu, J., Xu, H. Y., Zhang, Q., Song, F., Jiang, J. L., Yang, X. M., et al. 2007b. HAb18G/CD147 functions in invasion and metastasis of hepatocellular carcinoma. Mol Cancer Res, 5, 605-14.

Xu, X., Jia, R., Zhou, Y., Song, X. and Fan, X. 2010. Investigation of vasculogenic mimicry in sebaceous carcinoma of the eyelid. Acta Ophthalmol, 88, e160-4.

Yadav, A. K., Mishra, P. and Agrawal, G. P. 2008. An insight on hyaluronic acid in drug targeting and drug delivery. J Drug Target, 16, 91-107.

Yagoda, A. and Petrylak, D. 1993. Cytotoxic chemotherapy for advanced hormone- resistant prostate cancer. Cancer, 71, 1098-109.

242

Yamada, Y., Nezu, J., Shimane, M. and Hirata, Y. 1997. Molecular cloning of a novel vascular endothelial growth factor, VEGF-D. Genomics, 42, 483-8.

Yamada, Y., Watanabe, M., Yamanaka, M., Hirokawa, Y., Suzuki, H., Takagi, A., et al. 2003. Aberrant methylation of the vascular endothelial growth factor receptor-1 gene in prostate cancer. Cancer Science, 94, 536-9.

Yamaguchi, A., Goi, T., Taguchi, S., Ohtaki, N., Seki, K., Hirose, K., et al. 1998. Clinical significance of serum levels of CD44 variant exons 8-10 protein in colorectal cancer. J Gastroenterol, 33, 349-53.

Yamasaki, M., Makino, T., Masuzawa, T., Kurokawa, Y., Miyata, H., Takiguchi, S., et al. 2011. Role of multidrug resistance protein 2 (MRP2) in chemoresistance and clinical outcome in oesophageal squamous cell carcinoma. Br J Cancer, 104, 707- 13.

Yan, L., Zucker, S. and Toole, B. P. 2005. Roles of the multifunctional glycoprotein, emmprin (basigin; CD147), in tumour progression. Thromb Haemost, 93, 199-204.

Yan, M. and Plowman, G. D. 2007. Delta-like 4/Notch signaling and its therapeutic implications. Clin Cancer Res, 13, 7243-6.

Yang, H., Zou, W., Li, Y., Chen, B. and Xin, X. 2007. Bridge linkage role played by CD98hc of anti-tumor drug resistance and cancer metastasis on cisplatin-resistant ovarian cancer cells. Cancer Biol Ther, 6, 942-7.

Yang, J., Wu, H. F., Qian, L. X., Zhang, W., Hua, L. X., Yu, M. L., et al. 2006. Increased expressions of vascular endothelial growth factor (VEGF), VEGF-C and VEGF receptor-3 in prostate cancer tissue are associated with tumor progression. Asian J Androl, 8, 169-75.

Yang, J. M., O'neill, P., Jin, W., Foty, R., Medina, D. J., Xu, Z., et al. 2006. Extracellular matrix metalloproteinase inducer (CD147) confers resistance of breast cancer cells to Anoikis through inhibition of Bim. J Biol Chem, 281, 9719-27.

243

Yang, J. M., Xu, Z., Wu, H., Zhu, H., Wu, X. and Hait, W. N. 2003. Overexpression of extracellular matrix metalloproteinase inducer in multidrug resistant cancer cells. Mol Cancer Res, 1, 420-7.

Yang, M., Jiang, P., Sun, F. X., Hasegawa, S., Baranov, E., Chishima, T., et al. 1999. A fluorescent orthotopic bone metastasis model of human prostate cancer. Cancer Res, 59, 781-6.

Yi, T., Yi, Z., Cho, S.-G., Luo, J., Pandey, M. K., Aggarwal, B. B., et al. 2008. Gambogic acid inhibits angiogenesis and prostate tumor growth by suppressing vascular endothelial growth factor receptor 2 signaling.[Erratum appears in Cancer Res. 2008 May 15;68(10):4012]. Cancer Research, 68, 1843-50.

Yoneda, T., Michigami, T., Yi, B., Williams, P. J., Niewolna, M. and Hiraga, T. 1999. Use of bisphosphonates for the treatment of bone metastasis in experimental animal models. Cancer Treat Rev, 25, 293-9.

Yoshida, S., Shibata, M., Yamamoto, S., Hagihara, M., Asai, N., Takahashi, M., et al. 2000. Homo-oligomer formation by basigin, an immunoglobulin superfamily member, via its N-terminal immunoglobulin domain. Eur J Biochem, 267, 4372-80.

You, J., Cozzi, P., Walsh, B., Willcox, M., Kearsley, J., Russell, P., et al. 2010. Innovative biomarkers for prostate cancer early diagnosis and progression. Crit Rev Oncol Hematol, 73, 10-22.

Yu, J. X., Liu, X. and Xu, B. 2010. [Docetaxel induces apoptosis and influences the expression of P-gp, BCL-2 and BAX protein in HL-60/ADR cells]. Zhongguo Shi Yan Xue Ye Xue Za Zhi, 18, 311-6.

Yurchenko, V., O'connor, M., Dai, W. W., Guo, H., Toole, B., Sherry, B., et al. 2001. CD147 is a signaling receptor for cyclophilin B. Biochem Biophys Res Commun, 288, 786-8.

244

Zayzafoon, M., Abdulkadir, S. A. and Mcdonald, J. M. 2004. Notch signaling and ERK activation are important for the osteomimetic properties of prostate cancer bone metastatic cell lines. Journal of Biological Chemistry, 279, 3662-70.

Zeng, Q., Li, S., Chepeha, D. B., Giordano, T. J., Li, J., Zhang, H., et al. 2005. Crosstalk between tumor and endothelial cells promotes tumor angiogenesis by MAPK activation of Notch signaling. Cancer Cell, 8, 13-23.

Zeng, Y., Opeskin, K., Baldwin, M. E., Horvath, L. G., Achen, M. G., Stacker, S. A., et al. 2004a. Expression of vascular endothelial growth factor receptor-3 by lymphatic endothelial cells is associated with lymph node metastasis in prostate cancer. Clin Cancer Res, 10, 5137-44.

Zeng, Y., Opeskin, K., Baldwin, M. E., Horvath, L. G., Achen, M. G., Stacker, S. A., et al. 2004b. Expression of vascular endothelial growth factor receptor-3 by lymphatic endothelial cells is associated with lymph node metastasis in prostate cancer. Clinical Cancer Research, 10, 5137-44.

Zeng, Y., Opeskin, K., Goad, J. and Williams, E. D. 2006. Tumor-induced activation of lymphatic endothelial cells via vascular endothelial growth factor receptor-2 is critical for prostate cancer lymphatic metastasis. Cancer Research, 66, 9566-75.

Zeng, Y., Opeskin, K., Horvath, L. G., Sutherland, R. L. and Williams, E. D. 2005. Lymphatic vessel density and lymph node metastasis in prostate cancer. Prostate, 65, 222-30.

Zhang, J., Dai, J., Qi, Y., Lin, D. L., Smith, P., Strayhorn, C., et al. 2001. Osteoprotegerin inhibits prostate cancer-induced osteoclastogenesis and prevents prostate tumor growth in the bone. J Clin Invest, 107, 1235-44.

Zhang, L. Z., Mei, J., Qian, Z. K., Cai, X. S., Jiang, Y. and Huang, W. D. 2010. The role of VE-cadherin in osteosarcoma cells. Pathol Oncol Res, 16, 111-7.

245

Zhang, Q., Zhou, J., Ku X. M., Chen, X. G., Zhang, L., Xu, J., et al. 2007. Expression of CD147 as a significantly unfavorable prognostic factor in hepatocellular carcinoma. Eur J Cancer Prev, 16, 196-202.

Zhang, W., Erkan, M., Abiatari, I., Giese, N. A., Felix, K., Kayed, H., et al. 2007. Expression of extracellular matrix metalloproteinase inducer (EMMPRIN/CD147) in pancreatic neoplasm and pancreatic stellate cells. Cancer Biol Ther, 6, 218-27.

Zhang, W., Matrisian, L. M., Holmbeck, K., Vick, C. C. and Rosenthal, E. L. 2006. Fibroblast-derived MT1-MMP promotes tumor progression in vitro and in vivo. BMC Cancer, 6, 52.

Zhang, Z., Bian, H., Feng, Q., Mi, L., Mo, T., Kuang, A., et al. 2006. Biodistribution and localization of iodine-131-labeled metuximab in patients with hepatocellular carcinoma. Cancer Biol Ther, 5, 318-322.

Zheng, D. Q., Woodard, A. S., Tallini, G. and Languino, L. R. 2000. Substrate specificity of alpha(v)beta(3) integrin-mediated cell migration and phosphatidylinositol 3- kinase/AKT pathway activation. Journal of Biological Chemistry, 275, 24565-74.

Zheng, H. C., Takahashi, H., Murai, Y., Cui, Z. G., Nomoto, K., Miwa, S., et al. 2006. Upregulated EMMPRIN/CD147 might contribute to growth and angiogenesis of gastric carcinoma: a good marker for local invasion and prognosis. Br J Cancer, 95, 1371-8.

Zhong, H., Chiles, K., Feldser, D., Laughner, E., Hanrahan, C., Georgescu, M. M., et al. 2000. Modulation of hypoxia-inducible factor 1alpha expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/AKT/FRAP pathway in human prostate cancer cells: implications for tumor angiogenesis and therapeutics. Cancer Research, 60, 1541-5.

Zhong, W. D., Han, Z. D., He, H. C., Bi, X. C., Dai, Q. S., Zhu, G., et al. 2008. CD147, MMP-1, MMP-2 and MMP-9 protein expression as significant prognostic factors in human prostate cancer. Oncology, 75, 230-6.

246

Zhong, W. D., Liang, Y. X., Lin, S. X., Li, L., He, H. C., Bi, X. C., et al. 2012. Expression of CD147 is associated with prostate cancer progression. Int J Cancer, 130, 300-8.

Zhu, H., Zhao, J., Zhu, B., Collazo, J., Gal, J., Shi, P., et al. 2012. EMMPRIN regulates cytoskeleton reorganization and cell adhesion in prostate cancer. Prostate, 72, 72-81.

Zhu, X.-F., Xie, B.-F., Zhou, J.-M., Feng, G.-K., Liu, Z.-C., Wei, X.-Y., et al. 2005. Blockade of vascular endothelial growth factor receptor signal pathway and antitumor activity of ON-III (2',4'-dihydroxy-6'-methoxy-3',5'-dimethylchalcone), a component from Chinese herbal medicine. Molecular Pharmacology, 67, 1444-50.

Zou, W., Yang, H., Hou, X., Zhang, W., Chen, B. and Xin, X. 2007. Inhibition of CD147 gene expression via RNA interference reduces tumor cell invasion, tumorigenicity and increases chemosensitivity to paclitaxel in HO-8910pm cells. Cancer Lett, 248, 211-8.

Zucker, S., Hymowitz, M., Rollo, E. E., Mann, R., Conner, C. E., Cao, J., et al. 2001. Tumorigenic potential of extracellular matrix metalloproteinase inducer. Am J Pathol, 158, 1921-8.

Zwaans, B. M. and Bielenberg, D. R. 2007. Potential therapeutic strategies for lymphatic metastasis. Microvasc Res, 74, 145-58.

247

Appendix 1 – The sequence of MISSION® pLKO.1-puro Non-Mammalian shRNA Control Plasmid DNA (targets no known mammalian genes) TTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCGGCTGCTCTGGGCGTGGTTCCG GGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTT CGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGG TTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAGCGCC AGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGA GAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCC GCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCA CCGACCTCTCTCCCCAGGGGGATCCACCGGAGCTTACCATGACCGAGTACAAGCCCACGGTGCGCCTCGC CACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGC CACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCG GGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAG CGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCC GCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCG TCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGC CGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTC GGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCG GTGCCTGACGCCCGCCCCACGACCCGCAGCGCCCGACCGAAAGGAGCGCACGACCCCATGCATCGGTACC TTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAA GGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGA TCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGT GCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCA GTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAAT GAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCAC AAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCT TATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGC CCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAG CTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGGACGTACCCAATTCGCCCTATAGTGAGTC GTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTT CCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGT GGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCT TCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGAT TTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCC CTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACT GGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATT GGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTA GGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGT ATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCA ACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACG CTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACA GCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCT ATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAG AATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTAT GCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAA GGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTG AATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAAC TATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGT TGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAG CGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAA GCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTT AAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCC ACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTG 248

CTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTT TTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAG GCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGC TGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGG TCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACC TACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGG CAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTC GGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAA ACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGC GTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGA ACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCG CGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAA CGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATG TTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCG CAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTATGCAATACTCTTG TAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCC GATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGG ACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCT CTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAAT AAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCT CAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGA AACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCG ACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGT ATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATA AATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAAC ATCACGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAC ATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAA GCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTC AGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTG AACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAAT AGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACG GTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGC AACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAG ATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGG ACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAA GAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGG CTGTGGTATATAAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTA CTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGA GGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATT AGTGAACGGATCTCGACGGTATCGATCACGAGACTAGCCTCGAGCGGCCGCCCCCTTCACCGAGGGCCTA TTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGA CTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGT TTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCT TTATATATCTTGTGGAAAGGACGAAACACCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTT CATCTTGTTGTTTTTGAATTCTCGACCTCGAGACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAG GGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGA ATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCACTTTGG CCGCGGCTCGAGGGGG

249