Identification of the Causal Agent of Bacterial Soft Rot of Potato and Its Management in Bangladesh Dissertation Presented in Pa

Identification of the Causal Agent of Bacterial Soft Rot of Potato and its Management in Bangladesh

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Ferdous-E-Elahi, M.S.

Graduate Program in Plant Pathology

The Ohio State University

2018

Dissertation Committee

Sally A. Miller, Adviser

Pierce A. Paul

M. Soledad Benitez Ponce

Melanie L. Lewis Ivey

Ferdous-E-Elahi

2018

Abstract

Although commercial potato production started in 1920 in Bangladesh, potatoes are severely affected by diseases, resulting in poor yields. The demand for potato is growing day by day and many approaches are being implemented to increase yields. From December 2014 to January 2015, a total of 15 bacterial isolates were recovered from potato tubers with symptoms of soft rot collected in ten major potato- growing areas of Bangladesh. Based on biochemical and physiological assays,

Pectobacterium carotovorum ssp. were identified as the causal agents of soft rot in potato tubers. The pathogens were further characterized with molecular methods including subspecies-specific PCR, 16s rRNA gene sequencing and multilocus sequence analysis (MLSA). Of the 15 isolates causing tuber soft rot, five of the isolates also caused blackleg symptoms in potato seedlings. PCR utilizing primer pair

EXPCCF and EXPCCR resulted in the amplification of 550-bp DNA sequences of P. carotovorum ssp. carotovorum from the 15 soft rot isolates. 16s rRNA gene sequencing confirmed the identity of Pectobacterium carotovorum ssp. carotovorum from potato tubers. Phylogenetic analysis of concatenated gene sequences from six housekeeping genes (acnA, gapA, icdA, mdh, pgi and proA) from in MLSA revealed two distinct clades among the Bangladeshi strains. Although the sample size is relatively low, it is likely that P. carotovorum ssp. carotovorum is a principle cause of soft rot of potato tubers in Bangladesh.

Blackleg has not yet been reported in Bangladesh. However, the finding that one third of the P. carotovorum ssp. carotovorum isolates recovered from potato tubers in Bangladesh could cause blackleg suggests that the disease could be a problem under appropriate environmental conditions. To develop an integrated blackleg management plan for potato producers in Bangladesh, several tactics were

i evaluated. Chitosan, Trichoderma harzianum and gypsum fertilizer were applied alone or in combination to assess their ability to suppress the disease. The highest level of disease reduction was recorded for tubers treated with chitosan 3% + T. harzianum BTH-N1. Ten BARI-released potato varieties exhibited different levels of soft rot severity when they were inoculated with the highly virulent soft rot causing strain Pectobacterium carotovorum ssp. carotovorum Pki2. BARI Alu 25 was the most resistant to soft rot, while the recently released potato varieties BARI Alu 72 and

BARI Alu 41 were the most susceptible. Calcium (p<0.05) but not dry matter percentage of tubers (p>0.05) was negatively correlated with soft rot ranking in these varieties.

Potential antagonism of 41 previously characterized Pseudomonas spp. strains against Pectobacterium carotovorum ssp. carotovorum was investigated. Five

Pseudomonas spp. were selected based on their performance in in vitro assays and previous history of disease reduction in other systems. However, there were no significant differences in reduction by any of the Pseudomonas strains in blackleg severity among the treatments (p<0.05). This may have been the result of physical separation of the Pseudomonas strains on tubers and the inoculation point for P. carotovorum ssp. carotovorum on stems. Further research is needed to determine the capacity of these Pseudomonas strains to suppress potato blackleg and tuber soft rot.

A survey was undertaken to assess the knowledge of the growers regarding potato production practices, production challenges and blackleg and soft rot disease management. A total of 348 respondents were interviewed in six main potato-growing districts in Bangladesh in 2016. Data were collected using a structured questionnaire with direct interviews. Results showed that growers were very aware of potato diseases and considered disease the second most important constraint to potato

ii production after market price. The majority of the growers identified late blight as the main field disease across the districts followed by yellow mosaic and soft rot as their main storage problem followed by dry rot. Potato growers across the districts cited fungicide application as the primary means of managing field diseases and sorting as the means of managing diseases in storage. None of the growers indicated that they used biological control methods to manage diseases in the field or in storage. Growers preferred high-yielding, disease-tolerant potato varieties. The results of this survey showed that an integrated blackleg and soft rot management program likely to be adopted by farmers in Bangladesh should integrate high yielding potato varieties, disease-free potato seeds, inoculum-free irrigation water, regular scouting, and roguing.

iii

Dedication

My supportive husband: Md. Mynul Islam

My son: Muntahin Faiqul Islam

And my entire family for their affection and love

Acknowledgements

I would like to express my sincere appreciation to my adviser Dr. Sally A. Miller for her advice, support and encouragement. Thanks for her continuous guidance and suggestions, without which it would have been very difficult to finish this work.

I am also grateful to my committee members Dr. Pierce Paul, Dr. Soledad Benitez

Ponce and Dr. Melanie L. Lewis Ivey for their helpful comments and suggestions. I am especially thankful to Dr. Pierce Paul for helping me to design and execute the biocontrol experiment in the growth chambers and Dr. Christopher G. Taylor for providing me the biocontrol Pseudomonas strains.

I thank the memebers of Dr. Miller’s lab. It has been really nice to know all of you.

Thank you Angela Nanes, Anna L. Testen, Cláudio Vrisman, Mafruha Afroz, Md.

Mynul Islam, Nitika Khatri, Xing Ma, Jhony Mera, Fulya Baysal-Gurel, Margaret

Moodispaw, Nick Rehm, Hugo Pantigoso, Francesca Rotondo and Nagendra Subedi.

I am grateful to my parents for the aspiration for my higher studies and continuous patience and support. I would like to thank A. K. M. Yousuf Harun, Deputy Director,

Bangladeh Agriultural Development Corporation (BADC) for helping me to complete the survey section, collect potato seeds from BADC and for all of the relevant help during the last year of my PhD program. I thank Dr. Tapan Kumar Dey for his kind suggestions and help in conducting experiments in Bangladesh. I thank Dr.

Shamsunnahar, Principle Scientific Officer, Horticultural Research Center (HRC),

Bangladesh Agricultural Research Institute (BARI) for providing me the strains

Trichoderma and Abul Kalam Azad, lab attendent of Plant Pathology lab, BARI. I would also like to acknowledge my funding agency Borlaug Higher Education

Agricultural Research and Development (BHEARD) for financial support.

Vita

2007 B.S. Agriculture, Sher-E-Bangla Agricultural University, Dhaka, Bangladesh 2009 M.S. Plant Pathology, Sher-E-Bangla Agricultural University, Dhaka, Bangladesh 2010-present Scientific officer, Division of Plant Pathology, Bangladesh Agricultural Research Institute 2013 USDA Borlaug Fellow in Borlaug Agricultural Science and Technology Fellowship program 2013 Scholarship recipient for PhD in USAID Borlaug Higher Education Agricultural Research and Development program

Publications

Vrisman, C. M., Testen, A. L., Elahi, F., and Miller, S. A. 2017. First report of tomato brown root rot complex caused by Colletotrichum coccodesand Pyrenochaeta lycopersici in Ohio. Plant Disease. 101:247.

Elahi, F., Mridha, M. A. U., and Aminuzzaman, F. M. 2013. Role of AMF on plant growth, nutrient uptake, arsenic toxicity and chlorophyll content of chili grown in arsenic amended soil. Bangladesh J. Agril. Res. 37:635-644.

Elahi, F., Islam, M., Humauan, M. R., Akter, B., Khalequzzaman, K. M., and Dey, T. K. 2011. First report on club root disease (Plasmodiophora brassicae) on mustard in Bangladesh. Bangladesh J. Plant Pathol. 27:71-72.

Elahi, F., Aminuzzaman, F. M., Mridha M. A. U., Begum, B., and Harun, A. K. M. Y. 2010. AMF inoculation reduced arsenic toxicity and increased growth, nutrient uptake and chlorophyll content of tomato grown in arsenic amended soil. Adv. Environ. Biol. 4:194-200.

Booklet:(In Bengali) a. Cucumber diseases and its control strategies b. Soil borne diseases of crops and its integrated management Fields of study

Major Field: Plant Pathology

Table of Contents Abstract ...... i Dedication ...... iv Acknowledgements ...... v Vita ...... vi List of Tables ...... ix List of Figures ...... xi Chapter 1: Introduction ...... 1 Introduction ...... 1 References ...... 11 Chapter 2: Distribution and Impact of Potato Blacleg and Soft Rot in Bangladesh .... 17 Introduction ...... 18 Materials and methods ...... 20 Results ...... 22 Discussion ...... 30 Acknowledgement ...... 35 References ...... 36 Chapter 3: Identification and Characterization of Potato Soft Rot and Blacleg Pathogen in Bangladesh ...... 58 Introduction ...... 59 Materials and Methods ...... 63 Results ...... 69 Discussion ...... 72 Acknowledgement ...... 75 References ...... 75 Chapter 4: Integrated Management of Blacleg of Potato and Evaluation of Potato Varieties for Resistance to Bacterial soft Rot caused by Pectobacterium carotovorum ssp. carotovorum ...... 95 Introduction ...... 96 Materials and Methods ...... 100 Results ...... 105 Discussion ...... 106 Acknowledgement ...... 111 References ...... 112 Chapter 5: Biological Control of Potato Blacleg Disease ...... 120 Introduction ...... 121 Materials and Methods ...... 124 Results ...... 128 Discussion ...... 130

vii

Acknowledgement ...... 133 References ...... 133 Chapter 6: Summary ...... 145 Bibliography ...... 149 Appendix A: Blackeg and soft rot survey questionnaire ...... 164

viii

List of Tables

Table 2.1. Question types and content regarding the distribution and impact of potato blackleg and soft rot in Bangladesh survey...... 40

Table 2.2. Descriptive summary of demographic information on potato growers and farm operations in six potato growing districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh...... 41

Table 2. 3. Local names for potato diseases provided by growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh. The English name and causal agent of each disease are shown...... 42

Table 2. 4. Percentage of potato growers (n=348) surveyed who reported that they rotated the indicated crops with potato in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh...... 43

Table 2. 5. Frequency (percentage) of potato field diseases cited by growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh. PVY = Potato virus Y, PLRV = Potato leaf roll virus...... 48

Table 2. 6. Diseases, disorders and injuries of potatoes in storage cited by growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh...... 49

Table 2. 7. Factors that limit profitability of potato production identified by growers (percentage) from six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh...... 53

Table 2. 8. Bangladeshi potato growers’ ranking of varieties for susceptibility to soft rot disease in storage. The ranking was based on a 1-4 scale. 1= resistant; 2= moderately resistant; 3= moderately susceptible; 4= susceptible. The numbers in the table are the numbers of growers of each district who assigned the ranking for each variety...... 54

Table 3. 1. Bacterial soft rot reference strains used in this study...... 83

Table 3. 2. Pectobacterium carotovorum ssp. carotovorum isolates recovered from cultivars of potato in Bangladesh...... 85

Table 3. 3. Primers used for subspecies-specific PCR, 16s rRNA gene sequencing and multilocus sequence analysis...... 86

Table 3. 4. Housekeeping gene sequences used in multilocus sequence analysis of Pectobacterium carotovorum ssp. carotovorum strains isolated from potato tubers in Bangladesh. Sequences used in the analyses are indicated with “+”, while sequences not used due to poor quality are indicated with “-“...... 88

Table 3. 5. Physiological and biochemical characteristics of Pectobacterium carotovorum ssp. carotovorum isolates collected from soft rot-infected potato tubers in Bangladesh. The symbols + and – indicate positive and negative responses, respectively, for the tested strains. Strain Sm171-10 (Ohio) is the positive control. Sterilized distilled water was used as a negative control in the tobacco hypersensitive reaction (HR) test...... 93

Table 4.1. Percent rotted tissue of Bangladesh Agricultural Research Institute (BARI)- released potato varieties after inoculation with Pectobacterium carotovorum ssp. carotovorum strain Pki2, and the percentages of calcium and dry matter for each variety. Potatoes were harvested at the same time during the 2017 season. Values for means followed by same letters are not significantly different in Tukey’s range test. 118 Table 5.1. Inhibition of Pectobacterium carotovorum ssp. carotovorum strain Pta2 in vitro by Pseudomonas spp. screened as potential biocontrol agents. Strains highlighted in grey were selected for further analysis...... 137

Table 5.2. Diameter of zones of inhibition caused by Pseudomonas spp. strains in an in vitro inhibition assay against 15 Bangladeshi Pectobacterium carotovorum ssp. carotovorum strains. Values are the means of inhibition zones of all 15 Pectobacterium strains...... 139

Table 5.3. Efficacy of biocontrol agents (Pseudomonas spp.) in control of blackleg severity of potato in growth chamber. Experiment 1 (combined result of two experiments) was conducted inoculating Pectobacterium carotovorum ssp. carotovorum strain Pmu6 and experiment 2 and 3 were conducted inoculating with Pectobacterium carotovorum ssp. carotovorum strain Pta2...... 140

Table 5.4. Populations of rifampicin-resistant Pseudomonas strains on potato tubers immediately and 2 weeks after tuber exposure to the bacteria. Results for the two time points were analyzed using permutation tests for all strains (p=0.075) for 15D11; p<0.05 for 36F3; p=0.002 for DARKE; p<0.05 for WOOD1 and p=0.006 for 88A6). Values in a column with the same letter are not statistically different in Tukey’s test...... 141

List of Figures

Figure 2.1. Map of Bangladesh showing the geographical locations of the surveyed districts...... 39

Figure 2.2. Frequency distribution of the potato varieties grown in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh. The numbers in the bars represent the number of growers who reported cultivating that variety within each district...... 44

Figure 2.3. Sources of seed potatoes in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh. Each ring represents a source of seeds: dealer, saved, market or Bangladesh Agricultural Development Corporation (BADC). Each part of ring represents the percentage of purchased or saved seed potatoes by growers in each district. The survey districts are shown by color in the legend...... 45

Figure 2.4. Potato growers (n=348) within six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh citing criteria influencing their choice of potato variety for cultivation on their farms (p<0.05)...... 46

Figure 2.5. Frequency (percentage) of potato growers using different types of irrigation water in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh...... 47

Figure 2.6. Percentage of potato growers citing their use of specific blackleg and soft rot management practices in the field in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh...... 50

Figure 2.7. Frequency (percentage) of growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh using crop protection products to manage blackleg disease in the field...... 51

Figure 2.8. Frequency (percentage) of potato growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh utilizing specified soft rot management practices...... 52

Figure 2.9. Frequency of potato tuber inspection (checking) in storage for diseases by growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh. Growers checked stored tubers after 0, 15, 30 and 45 days of storage...... 55

Figure 2.10. Percentage of post-harvest potato storage sites utilized by growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh. BADC = Bangladesh Agricultural Development Corporation...... 56

Figure 2.11. Points of sale of harvested potato tubers noted by growers from six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh. BADC = Bangladesh Agricultural Development Corporation...... 57

Figure 3. 1. Origins of bacterial soft rot of potato tuber isolates collected in Bangladesh...... 80

Figure 3. 2. Blackleg disease progress curves for potato seedlings inoculated with one of five Pectobacterium carotovorum ssp. carotovorum isolates at 108 CFU/mL, over a period of 6 days. DPI = days post inoculation...... 81

Figure 3. 3. Boxplot of blackleg disease progression in seedlings of the potato variety Russet Burbank inoculated with one of five Pectobacterium carotovorum ssp. carotovorum isolates shown as area under the disease progress curve (AUDPC) values. Diamonds represent the mean of the treatments ( p<0.05). Means that do not share a letter are significantly different. Horizontal lines indicate the median of the treatments...... 82

Figure 3. 4. Amplification of DNA sequences from Bangladeshi soft rot bacterial isolates by PCR using Pectobacterium carotovorum ssp. carotovorum (Pcc)-specific primer pair EXPCCF and EXPCCR. Bacterial strains: Ohio isolate SM171-10 was used as a positive control (lanes 1 and 13); lane 2 Pnm5; lane 3 pnm6; lane 4 Pim3; lane 5 Pjo; lane 6 Pki2; lane 7 Psri1; lane 8 Pdh; lane 9 Pke; lane 10 Pta1; lane 11 Pta2; lane 12 Pta3; lane 15 Pmu6; lane 17 Pbari7; lane 19 Pku and lane 23 Pja3. Lanes 14, 16, 18, 20 and 21 unidentified bacteria isolated from potato tubers in Bangladesh that did not cause tuber soft rot; lane 22 nuclease-free water (negative control). L denotes 1 kb-DNA ladder...... 89

Figure 3. 5. Phylogenetic tree showing evolutionary relationships among 15 Pectobacterium carotovorum ssp. carotovorum isolates based on 16s rRNA gene sequencing using the maximum likelihood method. The bootstrap consensus tree was inferred from 1000 replicates. Dickeya sp. and Ralstonia solanacearum were used as outgroups for this study. Bangladesh Pectobacterium carotovorum ssp. carotovorum isolates are labeled with black triangles. Pcb: Pectobacterium carototvorum ssp. brasiliensis; P. atrosepticum: Pectobacterium atrosepticum; D. solani: Dickeya solani; R. solanacearum: Ralstonia solanacearum...... 90

Figure 3. 6. Molecular phylogenetic analysis using the maximum likelihood method with concatenated sequences of the housekeeping genes acnA, gapA, icdA, mdh, pgi and proA. The number at each node is the bootstrap support value based on 1000 replicates. The names of Pectobacterium carotovorum subspecies carotovorum clades I-II are marked on vertical lines; Bangladesh isolates are labeled with a black triangle in the phylogenetic tree...... 91

Figure 3. 7. Relative virulence based on fresh weight of rotted potato tuber tissue caused by Pectobacterium carotovorum ssp. carotovorum Bangladeshi strains and comparison strain SM171-10 (Ohio; positive control). The error bars indicate standard errors for three replications. Bars with the same letters are not significantly different (p<0.05)...... 92

Figure 4.1. Mean diameter of zones of inhibition produced by three Trichoderma spp. against Pectobacterium carotovorum ssp. carotovorum strain Pmu6 in an overlay method. Bars with different letters are significantly different based on Tukey’s

xii method at P<0.05…... 117

Figure 4.2. Blackleg disease progression in seedlings of the potato variety BARI Alu 7 (Diamant), shown as area under the disease progress curve (AUDPC) values. Treatments included combinations of chitosan and/or gypsum soil amendments and/or Trichoderma harzianum isolate BTH-N1 applied to tubers. Seedlings were inoculated with Pectobacterium carotovorum ssp. carotovorum strain Pmu6. Diamonds represent the mean of the treatments; horizontal lines in the boxes are medians (p<0.05)...... 119

Figure 5.1. Growth curves for rifampicin-resistant strains and their wild-type counterparts, expressed as optical density (OD600) over time. Pseudomonas spp. wild type and rif+ strains A) P. fluorescens 36F3, P. protegens DARKE, and P. vranovensis 15D11; B) P. brassicacearum WOOD1 and P. rhodesiae 88A6 were grown on Pseudomonas F medium. The letter W after the strain name in the legend = wild type; the letter M after the strain name indicates rif+ mutant. Two-sample T-test results for each wt and respective rif+ strain based on growth are p=0.23 for 15D11; p= 0.891 for 36F3; p=0.910 for DARKE; p=0.131 for WOOD1 and p=0.780 for 88A6. 142

Figure 5.2. Boxplot of blackleg disease progression in seedlings of the potato variety of Russet Burbank shown as area under the disease progress curve (AUDPC) values. Treatments were P. vranovensis 15D11, P. rhodesiae 88A6, P. brassicaceraum WOOD1, P. protegens DARKE, P. fluorescens 36F3 and a water control applied to tubers. Seedling stems were inoculated with Pectobacterium carotovorum ssp. carotovorum Pmu6. Data are combined for two experiments. Diamonds represent the mean AUDPC values of the treatments; horizontal lines in the boxes are medians (p>0.05)...... 143

Figure 5.3. Boxplot of blackleg disease progression in seedlings of the potato variety of Russet Burbank shown as area under the disease progress curve (AUDPC) values. Five Pseudomonas spp. biocontrol agents Treatments were P. vranovensis 15D11, P. rhodesiae 88A6, P. brassicaceraum WOOD1, P. protegens DARKE, P. fluorescens 36F3 applied to tubers. Seedlings were inoculated with Pectobacterium carotovorum ssp. carotovorum strain Pta2. Diamonds represent the mean of the treatments and horizontal lines in the boxes are medians. A) Experiment A (p>0.05); B) repetition of experiment A (p>0.05)...... 144

xiii

Chapter 1

Introduction

Potato is consumed as a staple food in many developed nations. According to the

United Nations Food and Agriculture Organization and the International Potato Center (FAO and CIP 1995), developed nations consume approximately 37% of the world’s total potato production. It is an important crop in Bangladesh; however, it is mainly consumed as a vegetable. Potato is not only an important source of carbohydrates to consumers, but the crop also provides a very good source of income for growers. Potato is grown all over in

Bangladesh and the large amount of potato production stabilizes the vegetable market throughout the year in Bangladesh (Moazzem and Fujita 2004). The production of potato has increased over the last several years. In 2016, total potato production in Bangladesh was 9.47 million tons on 4.75 million hectares, compared to 9.25 million tons on 4.62 million hectares in

2015 (BBS 2016).

Potato is grown mainly in the northern, northeastern, and middle regions in Bangladesh.

Proper management, including the use of disease-free seed and fertilizer and favorable weather from sowing to harvesting has helped growers maintain substantial potato production (BBS

2015). However, several different biotic and abiotic problems hamper production and quality of potato tubers, and soft rot-causing pathogens Pectobacterium ssp. and Dickeya spp. cause severe yield losses both in the field and in storage. These bacteria secrete cellulases, proteases and pectate lyases that cause tissue maceration of plants and tubers (Perombelon 2002). Every year soft rot reduces tuber reserves approximately 37% under commercial and private storage conditions in Bangladesh (Rasul et al. 1999). Among the soft rot enterobacteria, most

Pectobacterium spp. have wide host ranges and are found worldwide (Perombelon 2002). Due

1 to continuing changes in climate, especially increasing temperature and rainfall, soft rot disease has the potential to increase in both incidence and severity globally (Toth et al. 2011).

Integrated management of soft rot and blackleg is a new concept in Bangladesh and programs have not been widely developed. To develop an effective program, current potato production practices, grower awareness and perceptions of plant diseases and possible disease management practices, availability of appropriate management inputs, and production challenges must be considered. Growers’ aspirations for new technologies and their capacity to adopt new methods should also be considered. Therefore, the first step is to determine the socio-economic conditions of growers, their perceptions of plant diseases, pest management practices, and constraints for potato production. Understanding these could significantly strengthen the practical knowledge of potato growing and blackleg and soft rot management in

Bangladesh.

The first goal of this study was to determine the distribution of potato diseases in

Bangladesh and to identify the challenges to developing an integrated disease management program for blackleg and soft rot of potato. The hypotheses were i) potato growers in

Bangladesh are aware of potato diseases, including soft rot and blackleg, and their management and ii) growers face difficulties in potato production, disease management and marketing. The objectives of this study were to i) determine the potato production system of the surveyed six districts ii) assess growers’ current knowledge regarding prevailing potato diseases in field and storage and iii) identify the challenges to growers of adopting an integrated disease management program. To fulfill the objectives, the growers were asked about their current potato production system, knowledge potato diseases they observed in field and storage and management options, the challenges they face during the potato production season and existing constraints to successful potato production.

A loss of 187,000 tons of potato tubers was recorded in Bangladesh in 2006 due to several diseases, including soft rot (Masum et al. 2013). Soft rot management has become an important issue for potato growers in Bangladesh. To manage soft rot, accurate pathogen identification is very important. Due to the limitations of molecular research facilities in

Bangladesh, only morphological and biochemical studies have been conducted to identify the soft rot pathogens. Based on morphological and biochemical tests, Rahman et al. (2012) reported that Pectobacterium subspp. and Dickeya chrysanthemi (renamed D. didantii by Toth et al. 2001) cause soft rot of potato tubers in Bangladesh.

The genus Pectobacterium, formerly known as Erwinia, is divided into several species and subspecies on the basis of molecular, biochemical and host range differences (Kwon et al.

1997). Pectinolytic Erwinia spp. have been reclassified into two genera: Dickeya and

Pectobacterium (Hauben et al. 1998; Gardan et al. 2003; Samson et al. 2005). Dickeya spp. cause disease under high temperature conditions in tropical and temperate regions

(Perombelon and Kelman 1980; Laurila et al. 2008). Depending on the pathovar and biovar classification, Dickeya is divided into six species, namely dianthicola (Pectobacterium chrysanthemi pv. dianthicola), didantii (P. chrysanthemi biovar 3), zeae (P. chrysanthemi biovar 8 and other strains of biovar 3), chrysanthemi bv. chrysanthemi (P. chrysanthemi bv. chrysanthemi), chrysanthemi bv. parthenii (P. chrysanthemi bv. parthenii) and paradisiaca

(Brenneria paradisiaca) (Samson et al. 2005). The Pectobacterium genus was classified into three species, including four subspecies of P. carotovorum: P. atrosepticum, P. wasabiae. P. carotovorum ssp. carotovorum, P. carotovorum ssp. odoriferum, P. carotovorum ssp. brasiliense and P. betavasculorum (Gardan et al. 2003; Duarte et al. 2004; Ma et al. 2007).

Pectobacterium carotovorum ssp. carotovorum is a facultatively anaerobic, peritrichously flagellated, gram-negative rod-shaped bacterium. It is catalase positive, oxidase negative and can ferment glucose, but does not produce acid from sorbitol. This pathogen has

3 pectolytic activity and produces deep pits on crystal violet pectate (CVP) medium (Cupples and Kelman 1974). These distinctive pits are the result of pectinase enzymes that degrade the pectate gel of CVP medium (Krttzman 1989). There are several methods available for the identification of P. carotovorum ssp. carotovorum including biochemical, serological and molecular techniques. Biochemical tests were used extensively in the past for the identification of P. carotovorum ssp. carotovorum. However, the methods are very time consuming and require pure bacterial cultures, and therefore have been replaced by or combined with other methods (Wright-Dobrzeniecka 1989). The polymerase chain reaction (PCR) technique is rapid, simple and sensitive compared to biochemical techniques. PCR-based assays can be used to detect and differentiate all soft rot enterobacteria. As PCR methods become more available and more widespread they may be used for plant epidemiological studies. If we know when soft rot- or blackleg- causing bacteria are likely to occur, yield loss can be avoided by using certain pathogen-free seed lots, harvesting the crop earlier or later to avoid spreading of pathogens and storing seed potatoes for several months that were harvested from specific areas

(Charkowski 2015). Subspecies-specific PCR is based on the amplification of a target DNA sequence uniquely present in the pathogen’s genome. This method is very effective, even to identify a low density of pathogens from infected plants or tubers (Minsavage et al. 1994).

PCR utilizing the primer pair EXPCCF and EXPCCR amplifies the same DNA sequence in P. carotovorum ssp. carotovorum and P. wasabiae (de Boer et al. 2012), but these subspecies differ in biochemical characteristics (Smith and Bartz 1990).

In recent years, 16s rRNA gene sequence data has been used to identify Pectobacterium at the species level and to determine phylogenetic relationships among Pectobacterium species, but it has limited sensitivity for the identification of subspecies (Toth et al. 2011). Variable copy number of 16s rRNA in the genomes of bacteria and different taxa with identical or very similar 16s rRNA gene sequences limit the utility of this approach. Multilocus sequence

4 analysis (MLSA) provides many phylogenetically important characters compared to single gene analysis (Ma et al. 2007). Multilocus sequence analysis is a method in which multiple housekeeping gene sequences are selected since they are present in all enterobacteria. Studies based on MLSA provide a better understanding of phylogenetic relationships than 16s rRNA genes sequences because the former method uses several concatenated gene sequences rather than single gene phylogenies (Ma et al. 2007).

The second goal of this study was to identify the soft rot-causing bacteria of potato tubers in Bangladesh. The hypothesis is that multiple genera of pectolytic plant pathogenic bacteria cause soft rot of potato in Bangladesh. The objectives were to utilize biochemical tests specific for soft rot bacteria identification, characterize the collected soft rot of potato pathogens utilizing subspecies-specific PCR, 16s rRNA gene sequencing and determine the genetic relationship of the strains with phylogenetic distribution of the strains by multilocus sequence analysis. These objectives were addressed through different biochemical tests for the identification of soft rot pathogen, comparing the sequences of the isolates with the available reference strains from GenBank and utilizing multilocus sequence analysis of six housekeeping genes to determine the genetic similarity of the strains with reference strains from other geographic locations.

Pectobacterium and Dickeya spp. cause blackleg in the stems of potato seedlings

(Perombelon 2002). Pectobacterium carotovorum ssp. carotovorum has a wide host range and infects both seedlings and tubers in tropical and temperate regions, whereas P. atrosepticum considered as the major balckleg pathogen in temperate regions (Czajkowski et al. 2009).

Blackleg causes inky black discoloration and soft rot in the stems of potato seedlings. Other symptoms of blackleg include yellow wilted leaves and stunting. The leaves of infected plants may also be stiff and small. Pathogens can be transmitted from infected mother tubers to

5 daughter tubers and may remain latent until environmental conditions are favorable for bacterial growth (Reiter et al. 2002).

Several attempts have been made to develop effective strategies to manage blackleg and soft rot in the field and in storage. Seed certification, crop rotation, and seed treatment with hot water have been utilized to manage these diseases (Czajkowski et al. 2015). Bonde and de

Souza (1954) reported that the antibiotic dihydro-streptomycin sulfate along with terramycin hypochloride immersion of tubers before planting reduced blackleg in the field and seed decay in storage. While streptomycin formulations are labeled for use in the United States for seed potato treatment to manage soft rot and blackleg, application of antibiotics for the management of most bacterial diseases is not allowed in Bangladesh. Recently the antibiotic product

KROSIN-AG 10SP (Streptomycin sulphate 9% + Tetracycline hydrochloride 1%, McDonald

Crop Care Ltd.) has received registration for use in Bangladesh to manage bacterial wilt of brinjal/eggplant caused by Ralstonia solanacearum. This is a systemic bactericide imported from India (Krishi Roshayan Exports Private Ltd., India; personal communication with agent,

McDonald Crop Care Ltd.). However, no information is available regarding the efficacy of this product against blackleg or soft rot of potato, or possible registration for use in crops in addition to brinjal in Bangladesh.

Chitosan, made from chitin of crab shells, supplies secondary metabolites to plant organs (O’Herlihy et al. 2003). In recent years, chitosan and their derivatives have received attention due to their interesting microbial and eliciting properties. These products can reduce disease levels and development and spread of pathogens, and thus increase crop yields (El

Hadrami et al. 2010). Researchers in many countries have started applying new biochemical and biocontrol agents along with certain elements to manage crop diseases in the field and in storage. Natural products like chitosan could be introduced into integrated disease management programs of potato crops (El Hadrami et al. 2010). Application of chitosan in the field along

6 with Streptomyces strains could effectively reduce scab incidence of potato in the field.

Moreover, chitosan may help to establish antagonistic actinomycetes in the progeny tubers of potato (Prévost et al. 2006). Chitosan has been shown to be effective against soft rot of stored potato tubers (Makhlouf and Abdeen 2014). They applied chitosan in different concentrations:

1%, 3% and 5% along with other biocontrol agents such as Trichoderma viridae and

Pseudomonas fluorescens, and significantly reduced soft rot incidence in potatoes for 20 weeks compared to the non-treated control. Kowalski et al. (2006) reported an experiment in which chitosan was added in different concentrations to semi-solid media and later transferred to the greenhouse. They found an increase in yield and tuber quality of micro-propagated greenhouse-grown potatoes. Another study conducted by Benhamou and Thériault (1992), chitosan foliar spray or root coating markedly reduced the number of root lesions of tomato caused by Fusarium oxysporum f. sp. radices-lycopersici and drastically increased the physical barriers in the infected roots.

Biological control of blackleg and soft rot could be an alternative or addition to physical and chemical control methods (Lal et al. 2016). This strategy involves use of antagonists against pathogens directly through antibiosis, or indirectly through induced resistance in the host and competition for nutrients (Howarth 2003). Trichoderma spp. are widely used biocontrol agents against plant pathogens. They have the capacity to induce plant defense responses and promoting plant growth and development, as well as acting as antagonists. Trichoderma spp. have been shown to re-program plant gene expression to change photosynthetic capacity and respiration (Harman et al. 2004; Shoresh et al. 2010). Some

Trichoderma spp. can infect and colonize plant roots, initiating morphological and physiological changes in the host tissue indicative of induced systemic resistance (ISR;

Leelavathi et al. 2014). Application on the root that results in reduced disease on foliage is considered a consequence of ISR in plants (Leelavathi ei al. 2014). For example, application of

T. harzianum strain T39 to downy mildew-susceptible grapevine roots in controlled greenhouse conditions resulted in resistance against downy mildew (Perazolii 2011).

Trichoderma harzianum reduced soft rot on potato tubers and also increased vegetative characteristics such as plant height, number of leaves per plant and yield (Abd-El-Khair et al.

2007). This species of Trichoderma, along with other Trichoderma species such as T. atroviridae, increased potato growth parameters such as stolon number and yield and also reduced the percentage of Rhizoctonia-infested stolons (Hicks et al. 2014).

Calcium fertilizer strengthens the texture and structure of potatoes in the growing period of tubers. It can significantly reduce blackleg and soft rot of tubers (McGuire and

Kelman 1984). Growers worldwide traditionally apply calcium fertilizer during land preparation for potato (Kratzke and Palta 1986). Calcium has been shown to alter the intracellular and extracellular metabolic processes of crops that result in softening of tissues and carbon dioxide and ethylene production, and also affects sugar and total acid content of post-harvest crops (Antunes et al. 2005). McGuire and Kelman (1986) reported that maceration is reduced in potato tubers when supplementary calcium was added to the plants. Calcium contributes to the structural integrity of plant cell walls and membranes, the target of pectinolytic enzymes produced by Pectobacterium spp., Dickeya spp. and related plant pathogens (McGuire and Kelman 1984). Calcium fertilization; Calcium nitrate [Ca(NO3)2] and calcium sulphate (CaSO4) applications significantly increased calcium content of potato tubers and leaves compared a non-treated control. Pretreatment of tubers with gypsum (CaSO4·2H2O) and [Ca(NO3)2] reduced soft rot severity of potato tubers. Calcium reduced tuber decay caused by P. carotovorum ssp. atrosepticum by 50% (McGuire and Kelman 1984).

Dry matter content of tubers has also been reported as an influential factor for resistance to bacterial soft rot of potato. Biehn et al. (1972) reported that the high dry matter content potato variety Katahdin was less susceptible to soft rot caused by Erwinia carotovora.

In another study conducted by Workman and Home (1984), potato bruising and soft rot was positively correlated with dry matter content in two of eight comparisons. Another study showed that while neither increased calcium content nor high tuber dry matter content alone could account for tuber resistance to bacterial soft rot; the combination of both of these factors was negatively correlated with potato cultivar ranking for resistance to soft rot (Tzeng et al.

1990). However, Kallai et al. (2007) found no direct correlation between dry matter content and resistance or susceptibility of potato tubers.

Improved potato varieties have been developed by the Bangladesh Agricultural

Research Institute (BARI), and are widely grown across the country, along with local varieties

(Uddin et al. 2010; Haque et al. 2012). However, none of these varieties were specifically bred for soft rot resistance, and little is known about the degree of resistance of these varieties to the disease. There are no commercial varieties known to be resistant to soft rot available on the market in Bangladesh. Availability of soft rot resistance information for potato varieties grown in Bangladesh would be very helpful to farmers in choosing varieties for production and storage, particularly in areas where soft rot is a serious problem.

The third goal of this study was to develop an integrated disease management (IDM) program for blackleg of potato, and also to evaluate BARI-released potato varieties for resistance to soft rot. The hypotheses were that i) combinations of management tactics will be more effective in suppressing disease than single tactics and ii) some of the BARI-released potato varieties will be at least moderately resistant to soft rot. The objectives were to i) determine the effect of chitosan of on soft rot suppression, ii) identify potential biocontrol agents antagonistic to P. carotovorum ssp. carotovorum and to determine their capacity suppress blackleg disease and iii) evaluate the effects of gypsum fertilizer alone and in combination with chitosan and/or a Trichoderma in blackleg disease suppression. To fulfill the objectives, chitosan was applied alone and in combination with gypsum fertilizer and

Trichoderma sp. in greenhouse pot trials of potatoes stem-inoculated with Pcc. Three

Trichoderma spp. isolates were screened in vitro as potential biocontrol agents and then were applied in the greenhouse. Ten BARI-released potato varieties were inoculated with Pcc to identify resistance to soft rot. Percent dry matter content and percent calcium content of potato varieties were determined to assess a potential relationships relationship to susceptibility to soft rot.

Several genera of bacteria have the capacity to serve as biocontrol agents against bacterial plant pathogens. One of the most studied groups includes fluorescent Pseudomonads, which contains numerous species of gram negative, rod shaped bacteria. Pseudomonas spp. have the capacity to multiply rapidly and colonize the roots of plants (Ganeshan and Kumar

2017). As a result, they can compete with plant pathogens in the rhizosphere. Both fluorescent and non-fluorescent Pseudomonas spp. have the capacity to survive in the soil and plant rhizospheres (Kastelein et al. 1999). Antagonistic fluorescent Pseudomonas spp. strains can reduce populations of soft rot and blackleg pathogens in plant roots and progeny tubers, as well as the periderm of tubers (Kloepper 1983). Pseudomonas fluorescens strain F113 produces 2,

4-diacetylphloroglucinol (DAPG) and can inhibit Pectobacterium atrosepticum (Pa) in plants and tubers, and also suppresses soil-borne plant pathogens in the rhizosphere (Cronin et al

1997; Kell et al. 1992).

Potato seed treatment with Pseudomonas was more effective against black scurf of potato than a soil drenching method (Basu 2009). Seed treatment with Pseudomonas spp. was effective against R. solani and increased tuber yield (Mohsin et al. 2010). The antagonism of

Pseudomonas spp. against Pectobacterium ssp. is the result of competition for iron, as well as

DAPG antibiotic synthesis via pseudobactin and pyoverdine production (De Weger et al.1986).

Pseudomonas spp. with biocontrol activity can degrade quorum-sensing signal molecules necessary for Pectobactobacterium ssp. to produce large amounts of pectolytic enzymes. As a

10 result, Pseudomonas spp. have the potential to be part of a useful strategy for soft rot and blackleg management of potato (Jafra et al. 2006).

The fourth goal of this study was to identify potential Pseudomonas sp. antagonists against P. carotovorum ssp. carotovorum. We hypothesized that certain biocontrol

Pseudomonas spp. strains can suppress balckleg in a controlled environment. The objectives of this study were to i) screen Pseudomonas spp. in vitro as potential biocontrol agents against P. carotovorum ssp. carotovorum and ii) assess the efficacy of selected Pseudomonas strains in suppressing blackleg in planta. The objectives were addressed through in vitro and in planta assays of Pseudomonas spp. against P. carotovorum ssp. carotovorum. Rifampicin resistant mutant Pseudomans spp. were produced to monitor their colonization of potato tubers.

References

Abd-El-Khair, H., and Karima, H. E. H. 2007. Application of some bactericides and bioagents for controlling the soft rot disease in potato. Res. J. Agril. and Biol. Sc. 3:463-473.

Anonymous. 2016. Bangladesh Bureau of Statistics (BBS). Yearbook of Agricultural Statistics of Bangladesh. 28thseries, available at http://bbs.portal.gov.bd/sites/default/files/files/bbs.portal.gov.bd/page/1b1eb817_9325_4354_a 756_3d18412203e2/Yearbook-2016-Final-19-06-2017.pdf.

Anonymous. 2015. Bangladesh Bureau of Statistics (BBS). Yearbook of Agricultural Statistics of Bangladesh. 27thseries, available at http://bbs.portal.gov.bd/sites/default/files/files/bbs.portal.gov.bd/page/1b1eb817_9325_4354_a 756_3d18412203e2/Yearbook-2015.pdf.

Anonymous. 1995. Potatoes in the 1990s: Situation and prospects of the world potato economy. Food and Agriculture Organization and International Potato Center (FAO/CIP). FAO, Rome, Italy. 39 pp.

Antunes, M. D. C., Panagopoulos, T., Rodrigues, S., Neves, N. and Curado, F. 2005. The effect of pre and postharvest calcium applications on ‘Hayward’ kiwi fruit storage ability. Acta Hortic. 682:909-916.

Basu, A. Employing eco-friendly potato disease management allows organic tropical Indian production systems to prosper. Asian J. Food Agro. Indust. Special Issue. 2009:80-87.

Benhamou, N., and Theriault, G. 1992. Treatment with chitosan enhances resistance of tomato plants to the crown and root rot pathogen Fusarium oxysporum f. sp. radicis-lycopersici. Physiol. Mol. Plant Pathol. 41:33-52.

Biehn, W. L., Sands, D. C., and Hankin, L. 1972. Relationship between percent dry matter content of potato tubers and susceptibility to bacterial soft rot. Phytopathology 62:747.

Bonde, R., and de Souza, P. 1954. Studies on the control of potato bacterial seed-piece decay and blackleg with antibiotics. Am. J. Potato Res. 31:311–316.

Charkowski, A. O. 2015. Biology and control of Pectobacterium in potato. Am. J. Potato Res. 92:223-229.

Cronin, D., Moenne-Loccoz, Y., Fenton, A., Dunne, C., Dowling, D. N., and O’Gara, F. 1997. Ecological interaction of a biocontrol Pseudomonas fluorescens strain producing 2,4- diacetylphloroglucinol with the soft rot potato pathogen Erwinia carotovora ssp. atroseptica. FEMS Microbio. Ecol. 23:95–106.

Cupples D., and Kelman, A. 1974. Evaluation of selective media for isolation of soft-rot bacteria from soil and plant tissue. Phytopathology 64:468-475.

Czajkowski, R., Perombelon, M., Jafra, S., Lojkowska, E., Potrykus, M., van der Wolf, J., and Sledz, W. 2015. Detection and identification of Pectobacterium and Dickeya species causing potato blackleg and tuber soft rot: a review. Anna. Appl. Biol. 166:18–38.

De Boer, S. H., Li, X., and Ward, L. J. 2012. Pectobacterium spp. associated with bacterial stem rot syndrome of potato in Canada. Phytopathology 102:937-947.

De Weger, L. A., van Boxtel, R., van der Burg, B., Gruters, R. A., Geels, F. P., Schippers, B., and Lugtenberg, B. J. J. 1986. Siderophores and outer membrane proteins of antagonistic, plant growth-stimulating root-colonizing Pseudomonas spp. J. Bacteriol. 165:585-594.

Duarte, V., De Boer, S. H., Ward, L. J., and De Oliveira, A. M. R. 2004. Characterization of atypical Erwinia carotovora strains causing blackleg of potato in Brazil. J. Appl. Microb. 96:535–545.

El Hadrami, A., Adam, L. R., El Hadrami, I., and Daayf, F. 2010. Chitosan in plant protection. Marine Drugs 8:968-987.

Ganeshan, G., and Manoj Kumar, A. 2005. Pseudomonas fluorescens, a potential bacterial antagonist to control plant diseases. J. Plant Interac. 1:123-134.

Gardan, L., Gouy, C., Christen, R., and Samson, R. 2003. Elevation of three subspecies of Pectobacterium carotovora to species level: Pectobacterium atrosepticum sp. nov., Pectobacterium betavasculorum sp. nov. and Pectobacterium wasabiae sp. nov. Int. J. Syst. Evol. Micr. 53:381–391.

Haque, M. A., Miah, M. M., Hossain, S., and Rahman, M. M. 2012. Profitability of BARI released potato (Solanum tuberosum L.) varieties in some selected locations of Bangladesh. Bangladesh J. Agril. Res. 37:149-158.

Harman, G. E., Howell, C. R., Viterbo, A., Chet, I., and Lorito, M. 2004. Trichoderma species- opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2: 43–56.

Hauben, L., Moore, E. R., Vauterin, L., Steenackers, M., Mergaert, J., Verdonck, L., and Swings, J. 1998. Phylogenetic position of phytopathogens within Enterobacteriaceae. Syst. Appl. Microbiol. 21:384–397.

Hicks, E., Bienkowski, D., Braithwaite, M., McLean, K., Falloon, R., and Stewart, L. 2014. Trichoderma strains suppress Rhizoctonia diseases and promote growth of potato. Phytopathologia Mediterranea 53:502-514.

Howarth, F. G. 2003. Environmental impacts of classical biological control. Annu. Rev. Entomology 36:485–509.

Jafra, S., Przysowa, J., Czajkowski, R., Michta, A., Garbeva, P., and van der Wolf, J. M. 2006. Detection and characterization of bacteria from the potato rhizosphere degrading N-acyl- homoserine lactone. Can. J. Microbiol. 52:1006-1015.

Kallai, M., Csitari, G., Sipos, E., and Polgar, Z. 2007. Examination of resistance of potato genotypes to Erwinia ssp. Commun. Agric. Appl. Biol. Sci. 72:813-7.

Kell, C., Schnider, U., Maurhofer, M., Voisard, C., Laville, J., Burger, U., Wirthner, P., Hass, D., and Defago, G. 1992. Suppression of root diseases by Pseudomonas fluorescens CHAO: Importance of the bacterial secondary metabolite 2,4 diacetylphloroglucinol. Molec. Plant Microbe Interact. 5:4-13.

Kloepper, J. W., Leong, J., Teintze, M., and Schroth, M. N. 1980. Enhancing plant growth by siderophores produced by plant growth-promoting rhizobacteria. Nature 286:885-886.

Kloepper, J. W. 1983. Effect of seed piece inoculation with plant growth promoting rhizobacteria on populations of Erwnia carotovora on potato roots and in daughter tubers. Phytopathology 73:217–9.

Kowalski, B., Jimenez, T. F., Herrera, L., and Agramonte Penalver, D. 2006. Application of soluble chitosan in vitro and in the greenhouse to increase yield and seed quality of potato minitubers. Potato Res. 49:167–176.

Kratzke, M. G., and Palta, J. P. 1986. Calcium accumulation in potato tubers: role of the basal roots. Hort. Sci. 21:1022-1024.

Krttzman, G. 1989. Detection, quantification and classification of soft rot Erwinias associated with potato tubers. Phytoparasitica 17: 205-219.

Kwon, S. W., Go, S. J., Kang, H. W., Ryu, J. C., and Jo, J. K. 1997. Phylogenetic analysis of Erwinia species based on 16S rRNA gene sequences. Int. J. Syst. Bacteriol. 47:1061-1067.

Lal, M., Yadav, S., Singh, V., and Nagesh M. 2016. The use of bio-agents for management of potato diseases, plant growth. IN: E. Rigobelo (Ed.), InTech. DOI: 10.5772/64853, available at https://www.intechopen.com/books/plant-growth/the-use-of-bio-agents-for-management-of- potato-diseases.

Leelavathi, M. S., Vani, L., and Reena, P. 2014. Antimicrobial activity of Trichoderma harzianum against bacteria and fungi. Int. J. Curr. Microbiol. Appl. Sci. 3:96-103.

Ma, B., Hibbing, M. E., Kim, H. S., Reedy, R. M., Yedidia, I., Breuer. J., Breuer. J., Glasner, J. D., Perna N. T., Kelman. A., and Charkowski, A. O. 2007. Host range and molecular phylogenies of the soft rot enterobacterial genera Pectobacterium and Dickeya. Phytopathology 97:1150-1163.

Makhlouf, A. H., and Abdeen. R. 2014. Investigation on the effect of chemical and biological control of bacterial soft rot disease of potato in storage. J. Biol. Agri. and Healthcare. 4:31-44.

Masum, M. M. I., Islam, S. M. M., Islam, M. S., and Kabir, M. H. 2013. Estimation of loss due to post harvest diseases of potato in markets of different districts in Bangladesh. Afr. J. Biotechnol. 10:11892-118902.

McGuire, R. G., and Kelman, A. 1986. Calcium in potato tuber cell walls in relation to tissue maceration by Erwinia carotovora pv. atroseptica. Phytopathology 76:401-406.

Minsavage, G. V., Thompson, C. M., Hopkins, D. L., Leite, R., and Stall, R. E. 1994. Development of polymerase chain reaction protocol for detection of Xylella fastidiosa in plant tissue. Phytopathology 84:456–461.

Moazzem, K. G., and Fujita, K. 2004. The potato marketing system and its changes in Bangladesh: From the perspective of a village study in Comilla district. The Developing Economies 42:63-94.

Mohsin, T., Yasmin, S., and Hafeez, F. Y. 2010. Biological control of potato black scurf by rhizospheric associated bacteria. Braz. J. Microbiol. 41:439-441.

Mondal, S., and Bose, B. 2014. An impact of seed priming on disease resistance: A review. In: Kharwar, R., Upadhyay, R., Dubey, N., and Raghuwanshi, R. (eds) Microbial Diversity and Biotechnology in Food Security. Springer, New Delhi.

O’Herlihy, E. A., Duffy, E. M., and Cassells, A. C. 2003. The effects of arbuscular mycorrhizal fungi and chitosan sprays on yield and late blight resistance in potato crops from microplants. Folia Geobotanica 38:201-207.

Perazzolli, M., Roatti, B., Bozza, E., and Pertot, I. 2011. Trichoderma harzianum T39 induces resistance against downy mildew by priming for defense without costs for grapevine. Bio. Control. 58:74–82.

Perombelon, M. C. M. 2002. Potato diseases caused by soft rot Erwinias: an overview of pathogenesis. Plant Pathol. 51:1-12.

Perombelon, M. C. M., and Kelman A. 1980. Ecology of the soft rot Erwinias. Annu. Rev. Phytopathology 18:361-387.

Prevost, K., Couture, G., Shipley, B., Brzezinski, Ryszard., and Carole, Beaulieu. 2006. Effect of chitosan and a biocontrol streptomycete on field and potato tuber bacterial communities. Bio.Control. 51:533-546.

Rahman, M. M., Ali, M. E., Khan, A. A., Hashim, U., Akanda, A. M., and Hakim, M. A. 2012. Characterization and identification of soft rot bacterial pathogens in Bangladeshi potatoes. Afr. J. Microbiol. Res. 6:1437-1445.

Rasul, M. G., Islam, M. S., and Sheikh, M. H. R. 1999. Storability of different potato varieties under natural condition. Bang. J. Sc. and Ind. Res. 34: 86-90.

Reiter, B., Pfeifer, U., Schwab, H., and Sessitsch, A. 2002. Response of endophytic bacterial communities in potato plants to infection with Erwinia carotovora ssp. atroseptica. Appl. Environ. Microbiol. 2261- 2268.

Samson, R., Legendre, J. B., Christen, R., Fischer-Le Saux, M., Achouak, W., and Gardan, L. 2005. Transfer of Pectobacterium chrysanthemi (Burkholder et al., 1953) Brenner et al., 1973 and Brenneria paradisiaca to the genus Dickeya gen. nov. known as Dickeya chrysanthemi comb. nov and Dickeya paradisiaca combi. nov. and delineation of four novel species, Dickeya dianthi sp nov., Dickeya dianthicola sp. nov., Dickeya dieffenbachiae sp. nov. and Dickeya zeae sp. nov. Int. J. Syst. and Evol. Microbiol. 55:1415–1427.

Schaad, N. W., Jones, J. B., and Chun, W (Eds.). 2001. Laboratory Guide for Identification of Plant Pathogenic Bacteria (Vol. 373). St. Paul, Minnesota: APS press.

Shoresh, M., Harman, G. E., and Mastouri, F. 2010. Induced systemic resistance and plant responses to fungal biocontrol agents. Annu. Rev. Phytopathol. 48:21–43.

Smith, C., and Bartz, J. A. 1990. Variation in the pathogenicity and aggressiveness of strains of Erwinia carotovora ssp. carotovora isolated from different hosts. Plant Dis. 74:505–509.

Toth, I. K., van der Wolf, J. M., Saddler, G., Lojkowska, E., Helias, V., Pirhonen, M., Tsror, L., and Elphinstone, J. G. 2011. Dickeya species: an emerging problem for potato production in Euro. J. Plant Pathol. 60:385–399.

Tzeng, K. C., McGuire, R. G. and Kelman, A. 1990. Resistance of tubers from different potato cultivars to soft rot caused by Erwinia carotovora ssp. atroseptica. Am. Potato J. 67: 287-305.

Workman, M., and Holm, D. G. 1984. Potato clone variation in blackspot and soft rot susceptibility, redox potential, ascorbic acid, dry matter and potassium. Am. J. Potato Res. 61:723-733. Wright-Dobrzeniecka, Sandra. 1989. A comparative study of methods for diagnosing bacterial stem and leaf rot of dieffenbachia and potato blackleg, and an evaluation of their possible application in the potato micro-propagation programme. Page 88. Sveriges lantbruksuniversitet, Institutionen för växt-och skogsskydd.

Chapter 2

Distribution and Impact of Potato Blackleg and Soft Rot in Bangladesh

Abstract. Potato production in Bangladesh is severely affected by diseases, resulting in poor yields in spite of the long history (1920) of commercial potato production in Bangladesh. The demand for potato is growing day by day and many approaches are being implemented to increase yield. A survey was undertaken to assess the knowledge and attitudes of growers regarding the presence and management of soft rot and blackleg, two major potato diseases caused by bacterial plant pathogens. The prevailing constraints to potato cultivation in

Bangladesh as well as availability of tools suitable for integrated disease management at all scales of potato production were also assessed. A total of 348 respondents were interviewed in six potato-growing districts in Bangladesh in 2016. Data were collected using questionnaire direct interviews. Results showed that growers were very aware of potato diseases and considered disease (48.1%) the second most important constraint to potato production after market price (72.9%). The majority of the growers identified late blight (Phytophthora infestans) (74.1%) as the main field disease across the districts followed by scab (Streptomyces scabies) (55.1%) and yellow mosaic virus (29.2%). Growers identified soft rot

(Pectobacterium carotovorum ssp.) (39.8%) as the main storage disease followed by dry rot

(Fusarium sp.) (31.6%). Potato growers across the districts cited fungicide application (44.7%) as the primary means of managing field diseases and sorting (46.2%) as the means of managing diseases in storage. No growers indicated that they used biological control methods to manage diseases in the field or in storage. Growers preferred high-yielding, disease-tolerant potato varieties. Growers generally bought seed potatoes from dealers and sold finished tubers to wholesalers. The results of this survey showed that it is necessary to develop an integrated blackleg and soft rot management package in Bangladesh considering chemical, cultural, and

17 biological methods and also integrating high yielding potato varieties, disease-free potato seeds, inoculum-free irrigation water, regular scouting, and roguing.

Introduction

Potato is a widely consumed and important vegetable crop in Bangladesh. Though in many nations potato is a staple food, in Bangladesh it is mainly consumed as a vegetable. It is not only a good source of carbohydrates for consumers, but also an important source of income for growers in Bangladesh. People consume potatoes throughout the year in many different dishes. A large amount of potato production stabilizes the vegetable market throughout the year in Bangladesh (Moazzem and Fujita 2004). Bangladesh currently ranks seventh worldwide in potato production, although yields per hectare lag behind those obtained in higher income countries (www.potatopro.com/world/potato-statistics). In 2016, total potato production in Bangladesh was 9.47 million tons on 4.75 million hectares (BBS 2016).

Potato is grown mainly in the northern, northeastern, and middle regions in Bangladesh.

During the past two decades, Bangladesh has made progress in potato production. Availability of insect- and disease-free seeds, fungicides and improved varieties, although limited, as well as improved potato production technology and promotional campaigns, have resulted in increased yields (Siddique et al. 2013).

However, potato yields are significantly reduced due to biotic and abiotic problems.

Soft rot is one of the most important diseases of potato worldwide (des Essarts et al. 2016). It reduces both yield and tuber quality in the field and in storage. Soft rot bacteria in the

Enterobacterioceae are considered among the ten most significant plant pathogens that can severely reduce quantity and quality of many crops (Mansfield et al. 2012). Every year soft rot of tubers reduces yield approximately 37% in commercial and private storage conditions in

Bangladesh (Rasul et al. 1999). All Pectobacterium spp. have wide host ranges and are found

18 worldwide (Perombelon 2002). Dickeya species are also important soft rot pathogens in

Europe, Japan, New Zealand and United States of America (USA) (Toth et al. 2011). These two major genera cause the soft rot/blackleg disease complex of potato. These pathogens can also survive in the soil for several months, and transform from a latent stage to the active stage depending on temperature and moisture (Perombelon 2002). Due to continuing changes in climate, especially increasing temperature soft rot pathogens have the potential to increase in importance globally (Toth et al. 2011).

In Bangladesh, inadequate product labeling and growers’ lack of knowledge often leads to overuse or misuse of fungicides (Dasgupta et al. 2005). Commonly used bactericides such as fixed copper compounds and antibiotics are marginally effective at best in managing blackleg and soft rot of potato (Czajkowski et al. 2011). Seed certification, crop rotation, and seed treatment with hot water have been utilized to manage these diseases (Czajkowski et al. 2015).

Management programs for potato soft rot and blackleg should integrate cropping practices that reduce the use of fungicides and bactericides, including deployment of disease-resistant varieties, cultural practices and effective biocontrol products (Midega et al. 2012). Integrated management of soft rot and blackleg is a new concept in Bangladesh, and programs have not been widely developed. To develop an effective program, integrated management programs must consider growers’ knowledge of current potato production practices, their awareness and perceptions of potato diseases and effective disease management practices, availability of disease management inputs, and other production challenges. Growers’ desire for new technologies and their capacity to adopt new methods should also be considered. Therefore, the first step is to determine the socio-economic conditions of growers, common field and storage diseases of potato, blackleg and soft rot management practices, and constraints for potato production. Understanding these could significantly strengthen educational efforts targeted at

19 improving practical knowledge of potato growing and blackleg and soft rot management in

Bangladesh.

The Borlaug Higher Education Agricultural Research and Development (BHEARD) program funded this study to assess Bangladeshi growers’ knowledge and perceptions of general potato production, field and storage diseases, especially blackleg and soft rot, and their use of disease management practices. This study also included assessment of preferred potato cultivars and sources of potato seeds in Bangladesh. It was undertaken to identify potential points for measures to be taken to develop integrated management programs for blackleg and soft rot for middle- to small-scale growers of Bangladesh. The main objectives of this survey were to i) record the diseases of potato in both field and storage in Bangladesh as reported by growers ii) examine growers’ current practices for blackleg and soft rot management, as well as practices that may affect disease development, and iii) identify the challenges to developing effective integrated management programs for blackleg and soft rot of potato.

Materials and methods

Study sites. The study was conducted between September and November 2016 in the six main potato-growing districts of Bangladesh shown in Fig 2.1. Surveys were conducted in a total of

15 upazillas (administrative and geographic regions within districts): Gobindaganj and

Shajahanpur from Bogra district, Homna from Comilla district, Sadar, Jhikaragacha,

Chowgacha and Kaliganj from Jessore district, Sadar and Sirajdikhan from Munshiganj district, Sadar from Panchagargh district, and Poba, Putia, Sadar, Shahmokhdum and

Ghodagari from Rajshahi district. Upazillas were selected based on the availability of growers during the cropping season. The main potato-growing season in these areas is winter, from

October to February.

Questionnaire and data collection. A questionnaire (Appendix A; Table 2.1) in Bengali was supplied to the growers and the data were collected with the help of personnel at the

Bangladesh Agricultural Development Corporation (BADC). This institution supplies quality agricultural inputs and irrigation facilities to growers. The questionnaire was not piloted prior to administering it. This survey method was reviewed and approved for exempt status by The

Ohio State University Institutional Review Board under protocol number 2016E0202.

Questionnaires were administered to potato growers attending a field day at a district BADC office in which information was disseminated regarding characteristics of newly released potato varieties and production tactics. Bangladesh Agricultural Development Corporation personnel contacted growers regarding the survey prior to the field days held in each district.

The author and BADC personnel were present during the event and instructed literate growers in completing the survey in writing. Responses of illiterate growers were taken by BADC personnel, who read each question to individual growers and recorded the responses in writing.

The surveys included dichotomous (yes/no), closed and open-ended, and multiple-choice questions regarding general crop production practices, grower demographics such as age, gender, education, size of farms and farm characteristics, potato productions constraints, questions about perceived blackleg and soft rot management options, and knowledge about disease identification. Land owned by the growers, land area under potato, sources of seeds, preference of cultivable potato variety, and yields were also recorded in this survey. Growers were also asked about their loss in percentage due to blackleg and soft rot. Growers were asked to use Bengali names of potato diseases. Refreshments (snacks) were provided for all of the participants of each district at the end of each survey.

Data analysis. Survey data were not coded for the purpose of analysis. Data were summarized and descriptive data were analyzed obtaining means, frequencies and percentage values to generate summaries and tables for different districts. To assess any differences among

21 variables within and among districts, Chi-square goodness of fit tests and Kruskal-Wallis one- way analysis of variance were done using MINITAB statistical software version 16. The significance level was set at 0.05. Correlations were determined with Spearman’s rank correlation coefficient using MINITAB 16.

Results

Potato grower demographic information. In total 348 surveys were completed. The number of respondents varied across the districts (n=75 in Bogra; n=61 in Jessore; n=29 in Rajshahi, n=62 in Comilla; n=67 in Panchagarh and n=54 in Munshiganj). All of the respondents in the six potato growing districts surveyed were male. Each grower required on average 45-60 min to complete the questionnaire. The majority of the respondents (55.2%) were in the 37-54 year- old age group whereas 18.1% were in the 19-36 year-old age group and 26.7 % were in the 55-

70 year-old group (Table 2.2). The percentage of illiterate respondents was 5.8%, whereas 35% of the respondents had undergone primary education, 28.9% had completed high school and

29.7% had undergone intermediate education. Moreover, there were significant differences in the level of education of growers in Bogra (χ²=8.65, DF=3, p=0.034) and Comilla (χ²=15.5,

DF=3, p=0.001) and there were no significant differences in Jessore (χ²=2.33, DF=3, p=0.505),

Munshiganj (χ²=3.72, DF=3, p=0.293), Panchagarh (χ²=0.64, DF=3, p=0.885) and Rajshahi

(χ²=0.61, DF=1, p=0.434). However, there was no significant association between level of education of the growers and their ability to name potato diseases (field and storage) (ρ<-0.20, p>0.05) across the six districts. The majority of the respondents (65.7%) had grown potatoes for

>7 years throughout the districts. The growers interviewed were typically smallholders (75.9%) with land sizes on average <2 ha. These growers (97.2%) used most of their land for potato production (Table 2.2). Most growers were reluctant to provide information on marital status, and the numbers of responses were insufficient for a statistical analysis (data not shown).

Growers mentioned all of the potato disease names in Bengali except black scurf (Table 2.3).

There was a statistically significant difference in the number potato diseases named by the growers in their field (p<0.05). The highest number of growers cited potato diseases in Bogra districts (n=235) and the lowest number of growers cited potato diseases in Munshiganj district

(n=52).

Production practices. Potato growers indicated that they rotated potatoes with vegetables, pulses, oil seeds, nut, sugarcane, rice, and jute (Table 2.4). Growers in each district cited preferred rotational crops, and the number of rotational crops did not vary significantly among districts ((χ²=12.08, DF=15, p=0.673).). The largest numbers of crops (16) were rotated with potato in Bogra district. The majority of growers (72%) rotated potato with rice whereas 20% of the growers rotated potato with maize. In Munshiganj only three crops were used for rotation; growers rotated potato with rice (32%), vegetables (21%) and jute (14%). In Jessore,

95% of the growers mentioned rotation of potato with jute followed by 85% with cucumber,

36% with sweet gourd and 3.8% growers with groundnut and blackgram. In Comilla, sesame was the preferred rotational crop (>80%), followed by maize (>72%), jute (32%) and wheat

(3%). In Panchagarh, growers rotated potato with maize (94%) sweet gourd (43%), rice (4%) chili and vegetables (3%). In Rajshahi district, 75% of the growers rotated potato with maize,

28% rotated with rice, 7% rotated with vegetables and 3.5% rotated with brinjal, jute and sugarcane.

Growers’ choices of potato varieties differed significantly across districts (χ²=191.5,

DF=9, p<0.05). The variety Diamant was preferred across all districts (Bogra, 45.3%; Comilla,

100%; Jessore, 100%; Rajshahi, 100%; Panchagarh, 58.2% and in Munshiganj (100%) it was the only cultivated potato variety (Figure 2.2). The variety Asterix was cultivated in Bogra

(52%), Comilla (13%), Jessore (65.6%), Rajshahi (32.1%), and Panchagarh (82.1%) districts, whereas Cardinal was grown in Bogra (58.4%), Jessore (98.4%), Rajshahi (75%) and

Panchagarh (50.7%). Bogra growers also cultivated all of the remaining varieties, with the

23 exception of ‘Sagitta’, including Courage (29.3%), Granola (39.3%), Laura (14.7%), Lady

Rosetta (2.7%), Musica (2.7%), Belini (1.3%), and Lal Pakri (4%). Sagitta was only cultivated on five farms (8%) in Comilla district.

Growers reported using seed potatoes from four different sources, including dealers

(who supply potato seeds), saved seeds (growers save their own potato seeds), the market and

BADC. The seed sources utilized varied significantly across Bogra, Comilla, Jessore, Rajshahi,

Panchagarh and Munshiganj (χ²=40.8, DF=3, p<0.05). The source for the majority of growers in all districts except Rajshahi was dealers. The majority of the growers (54.8%) in Rajshahi use their own saved seeds whereas growers in Comilla did not use saved seeds at all. In Bogra,

26.9% of the growers bought seeds from the market. BADC was the seed source for growers in

Rajshahi, Jessore, and Munshiganj districts. Nearly 20% of Rajshahi growers surveyed indicated that they bought seeds from BADC (Figure 2.3). There was no association between the source of potato seed tubers and frequency of potato diseases mentioned by growers in all six surveyed districts (ρ<0.20, p>0.05).

There were no significant differences between districts in criteria growers cited in choosing the potato varieties to cultivate on their farms (χ²=12.43, DF=13, p=0.492) (Figure

2.4). Growers (56.3%) cited high yield as their most important criterion for choosing a potato variety followed by disease free (48.3%). Across the districts, growers considered size (39.4%) and price (39.1%) are two important criterions in variety selection. The growers across the districts also mentioned taste (23.3%), market demand (20.7%), and tuber color (13.2%) as factors that influenced them to choose a potato variety. In addition, there were no differences among the criteria mentioned by the growers for choosing variety across the districts (p>0.05 at

90% confidence interval).

Growers cited several sources of irrigation water, but differences in water usage were not significant across the districts surveyed (χ²=2.42, DF=4, p=0.657). Shallow tube wells were

24 cited as irrigation sources by the majority of growers in Panchagarh (100%), Jessore (100%),

Comilla (85.2%), Rajshahi (55.1%) and Bogra (92%) (Figure 2.5). Deep tube wells were used by growers only in Rajshahi (41.3%) and in Comilla (13.1%). Tube wells are large accumulations of subsoil water, which is drawn out with a pump for the purpose of irrigation or shower. In Munshiganj, growers mainly used surface water from canals (83.6%), pond (70.9%) or rivers (16.4%) to irrigate their potato fields. There was a positive correlation between source of irrigation water and the number of potato diseases mentioned by growers in Bogra (ρ>0.5, p<0.05) and Comilla (ρ=0.3, p<0.05) but not in the other four districts.

Potato production constraints and disease management. The frequency of field diseases growers mentioned in the six districts differed significantly (χ²=798.5, DF=44, p<0.05). The number of diseases mentioned ranged from four in Munshiganj to 11 in Bogra (Table 2.5). The potato disease most commonly cited in this survey was late blight (causal agent Phytophthora infestans), mentioned by 74.1% of the respondents across the six districts. Scab was also cited by growers (55.1%) in all six districts. Growers in four of six districts mentioned virus diseases, with Yellow mosaic cited in Comilla (70.9%), Jessore (96.7%) and Rajshahi (44.8%), while Potato virus Y (PVY) (6.6%) and Potato leaf roll virus (PLRV) (34.6%) were noted in

Bogra. The frequency of the respondents across the surveyed districts for blackleg familiarity was not significantly different (R-Sq = 30.39%, p=0.079), whereas the frequency for soft rot familiarity was significantly different (R-Sq = 52.37%, p=0.012) between districts. Blackleg was mentioned by the growers in Bogra (30.6%) and Munshiganj (27.7%), while soft rot was only noted by growers in Panchagarh (10.4%). Early blight was mentioned mainly by the respondents of Bogra (25.3%) and Comilla (22.5%) while respondents in Bogra (44%) mentioned bacterial wilt as their major field disease. Another highly cited disease was black scurf, which was mentioned by (94%) respondents of Panchagarh.

On the other hand, the frequencies of storage diseases, disorders and injuries mentioned by growers did not vary significantly across the districts (χ²=10.38, DF=10, p=0.407) (Table

2.6). Soft rot was the most reported problem of potatoes in storage across the districts. The majority of the respondents of Panchagarh (94%), Jessore (98.3%), Comilla (83.8%) and Bogra

(62.6%) mentioned soft rot as a storage problem. Dry rot (Fusarium solani) was cited in

Jessore (98.3%), Panchagarh (2.9%) and Bogra (30.6%). Disorders such as blackheart (19.5%) and hollow heart (11.8%), as well as heat injury (4.3%), cold injury (3.7%) and mechanical injury (14.7%) were also mentioned as storage problems in Bogra, Jessore, Rajshahi and

Comilla districts.

No associations between level of education of growers and their choice of disease management options were found. Responses varied across districts concerning use of fungicides or other crop protection products to manage blackleg and soft rot in the field

(χ²=548.8, DF=17, p<0.05). All of the respondents (100%) in Panchagarh noted that they applied fungicides to manage these diseases, whereas only 1.3% of the growers in Bogra used this tactic. The majority of growers in Munshiganj (74.5%), nearly half of the growers in

Jessore (48%), and growers in Rajshahi (21.4%) and Comilla (23%) cited application of fungicides to manage the diseases in the field. Most growers in Jessore (58%) and 1.3% of growers in Bogra practiced roguing diseased plants from fields to manage blackleg and soft rot, but this practice was not cited by growers in any of the other four surveyed districts. Growers in Bogra noted using a number of non-fungicides tactics to manage soft rot and blackleg in the field, including sowing disease-free (37.3%) or spotless (9.3%) seeds, sorting rotten tuber seeds in the storage, and applying bleaching powder (2.7%) and lime (2.7%). Between 12%

(Bogra) and 78.5% (Rajshahi) of the growers in four districts took no action to manage blackleg or soft rot in the field (Figure 2.6).

Growers mentioned 13 different trade names (Bavistin, Acrobat, Carbendazim,

Antracol, Asataf, Diamant, Mancozeb, Penncozeb, Autostin, Indofil, Metalaxyl, Secure and

Dithane) for crop protection products they used to manage blackleg and soft rot in the field, including six active ingredients: dithiocarbamate (fungicide), metalaxyl (fungicide),

Dimethomorph (fungicide), benzimidazole (fungicide), organophospahte (insecticide) and fluazinam (fungicide) and an unspecified insecticide (Figure 2.7). In Jessore, Comilla and

Panchagarh all (100%) of the growers indicated that they applied dithiocarbamate. Only 2.6% growers in Munshiganj applied fluazinam while in Bogra growers (36%) applied insecticide to manage blackleg and did not know the name(s) of fungicides they applied in potato fields.

None of the respondents in any district reported hearing about biocontrol agents to manage soft rot in potatoes. The respondents across the districts practiced similar types of operations to improve yield of potato, including laddering, irrigation, fertilization, pesticide application, weeding, roguing, and soil drenching (data not shown).

There were significant differences among districts in the use of practices to prevent or manage potato soft rot in storage (χ²=384.9, DF=11, p<0.05). Almost all of the respondents in

Rajshahi (96.5%) and Munshiganj (98.1%), as well as 27.4% in Comilla, and 1.3% in Bogra stated that they took no action to prevent or manage soft rot in storage before the next seasons sowing (Figure 2.8). The primary soft rot management practice mentioned by the growers was sorting (removal of diseased tubers). All the growers (100%) in Panchagarh, 72.5% in Comilla,

61% in Jessore and 38.7% in Bogra practiced sorting. Few growers in Mushiganj (1.8%) and and Rajshahi (3.5%) reported using this practice. Bogra was the only district in which growers sprayed fungicides (10.7%) and/or used controlled humidity (21.3%) to manage soft rot in storage. The growers across the districts inspected (checked) potatoes in storage. There were significant differences in the frequency of checking potatoes in storage for diseases across the districts (χ²=441.38 DF=23, p<0.05). The majority of the growers in Jessore (95%) and Bogra

(37.3%) checked potato once in 30 days whereas the growers of Comilla (67.7%) and

Panchagarh (37.3%) checked potato at least in 45-day intervals. No growers in Munshiganj checked potatoes in storage before they sold them to the market or wholesaler (Figure 2.9).

The percent difference between districts regarding the sites in which harvested tubers were stored was statistically significant (χ²=243.6, DF=10, p<0.05) (Figure 2.10). The majority of the growers in Bogra (77.3%), Rajshahi (75.8%), Panchagarh (100%) and Comilla (87%) district and all the growers of Jessore district stored potatoes in cold storage (100%). Among the growers, 21.3% in Bogra, 14.9% in Panchagarh, 24% in Munshiganj and 6.4% in Comilla saved seeds in their homes. Only 10.3% respondents, from Rajshahi district, among 348 in total stored seeds in BADC cold storage.

Potato sales and profitability. The growers across the surveyed districts were not willing to provide information on potato yields or estimates of losses on their farms due to soft rot or blackleg. The main factors limiting profitability of potato production identified by growers in six districts in Bangladesh were market price, diseases, poor seed potatoes and insect pests.

The factors across the surveyed districts are statistically different (χ²=1246.20, DF=40, p<0.05). Market price was cited by the majority of the respondents in all six districts: Bogra

(53.3%), Jessore (98.4%), 54.5% of Munshiganj (54.5%), Panchagarh (92.5%), Comilla

(56.5%) and Rajshahi (82.1%). The majority of the growers in Comilla (88.7%) and Jessore

(85.2%) also mentioned diseases as limiting factors, as did 44% of the growers in Bogra,

32.7% in Munshiganj, 23.9% in Panchagarh and 14.3% in Rajshahi. Insect pests were cited as a limiting factor by 85.4% of the respondents from Comilla, while only 1.5% of the respondents from Panchagarh mentioned insect pests as a limiting factor. Poor quality (bad) seed was reported as another limiting factor by 79.1% of the respondents in Panchagarh and

60.7% of those in Rajshahi. The lack of cold storage was only mentioned as a limiting factor by 13.1% of the respondents from Jessore. Bad varieties, bad soil, weeds, and lack of

28 availability of insecticides were also noted as limiting factors in these potato-growing districts

(Table 2.7).

The percentage of the responses regarding differences across the districts in point of sale of harvested tubers was not significant (χ²=8.66, DF=5, p=0.123) (Figure 2.11). The majority of the growers sold their harvested potatoes to wholesalers in Comilla (88.5%),

Panchagarh (74.6%) and Rajshahi (53.5%) districts. Growers in only one of the six districts

(Rajshahi, 10.5%) sold them to BADC. In Jessore and Munshiganj districts, the majority of the growers (78.6% and 62.9%, respectively) sold potatoes to the city market. Local markets were noted as the point of sale by 30-50% of growers in Bogra, Comilla, Panchagarh and Rajshahi.

Fewer than 10% of the growers in Bogra also sold potatoes along the roadside or to a dealer

(Figure 2.10)

The respondents were asked to score their familiar potato varieties for susceptibility to soft rot. Among six surveyed districts, respondents from Jessore, Bogra, Rajshahi and

Panchagarh answered the questions. There were significant differences in medians among the graded cultivars for resistance to soft rot except in Bogra (p<0.05) (Table 2.8). In Bogra district, growers mentioned that Asterix (53.3%), Diamant (44%), Cardinal (10.6%), Courage

(12%), Granola (12%), Laura (10.6%) and Musica (1.3%) are the resistant potato varieties whereas Diamant (2.6%), Granola (1.3%), Laura (1.3%) and Lady Rosetta (1.3%) are the susceptible variety mentioned by the same growers. In Jessore, according to the growers,

Diamant (100), Cardinal (96.7%), Asterix (1.6%), and Courage (1.6%) all these varieties are susceptible to soft rot bacteria. In Panchagarh, growers evaluated Diamant (27.2%), Asterix

(54.5%), and Cardinal (18.1%) varieties against soft rot and they mentioned that these varieties were all resistant to soft rot. In addition, in Rajshahi district, the growers (24.1%) rated only two potato varieties as resistant and susceptible, namely Asterix and Courage, respectively.

Discussion

Blackleg and soft rot are common potato diseases that growers cannot manage effectively once they become established in the field (Charkowski 2015). However, no studies have been conducted in Bangladesh to understand the awareness of these diseases among potato growers and practices used to manage them in the field and in storage. We found that most growers were aware of soft rot as a disease problem in potato storage, but few (seven growers of 348 total) cited soft rot as a problem in the field. This was not due to lack of awareness of blackleg and soft rot in the field as most of the growers in the six districts responded that they were familiar with the diseases. During the growing season of potato, the temperature and humidity are usually relatively low; therefore severe symptoms of soft rot may be uncommon and minor rot symptoms may not be noticed.

Crop rotation choices can affect the persistence of the pathogens causing blackleg and soft of potatoes from season to season. For example, Dickeya solani is an aggressive pathogen of potato. It was likely to have been spread to potato in Europe from ornamental bulbs rotated with potatoes in the field. This hypothesis suggests that crop rotation promotes soft rot enterobacteria emergence in the field (Gross et al. 2014). We found that the majority of growers across the six surveyed districts rotated potatoes mainly with cereal crops including maize or rice. Pectobacterium spp. are generally considered to have wide host ranges, although there is a large amount of variation in host specificity among species and subspecies. Dickeya zeae was found to cause stalk rot of maize in Mexico (Martinez 2014). This pathogen can cause the disease under high temperatures and humidity. Bacterial foot rot of rice cuased by

Dickeya dadantii was reported in Japan in 1977 (Goto 1979). Therefore, these rotational crops might have contributed to an increase in soft rot bacteria in Bangladesh potato fields.

Among the 11 potato varieties cited by growers in the survey, Diamant was the most cultivated variety, followed by Cardinal and Asterix. This is congruent with the findings of

Khalil et al. (2013). They found that 100% of the growers from Munshiganj produced Diamant, while they also observed a preference among respondents from Munshiganj (82%) for this variety. Growers in Rangpur and Bogra also cultivated this variety widely. Asterix and Granola are also preferred varieties in Bangladesh based on their long dormancy, reduced weight loss, high tuber dry matter content, storage ability, and shelf life. These varieties are recommended for storage under ordinary storage conditions or growers’ practices in Bangladesh (Azad et al.

2017). Our findings from the survey are similar to these survey results. We found from the survey that growers preferred potato varieties Diamant and Cardinal. We also found that when the growers were asked to rank potato varieties based on their familiarity with soft rot diseases, growers of four districts answered and those of the other two districts left the questionnaires mostly blank. Some of the growers mentioned that they did not know how to evaluate the varieties (personal conversation with growers). This is an important knowledge gap among growers, which should be narrowed with outreach activities in the future.

Shahriar et al. (2013) found in their survey that growers in Rangpur and Munshiganj districts reported that seed potatoes purchased from BADC had higher germination and storage capacity than seed potato saved by growers. BADC has been the largest agricultural input supplier in Bangladesh for many years. However, we found that few growers in our surveyed districts purchased seed potatoes from BADC. While 30% of the growers in Munshiganj reported buying seed potatoes from BADC, no growers from the other five districts reported using BADC as a source of seed potatoes. There are some BADC seed sale centers under the seed distribution division of BADC in the surveyed districts. However, they are not in all the upazilla in those districts so they do not cover the whole potato growing areas. So this discrepancy may be due to lack of market penetration by BADC in these districts. The majority of the growers cited dealers and open markets as their sources of seed potatoes.

Growers in the surveyed districts cited yield, tuber size, disease tolerance and seed availability as important criteria in variety selection. Diamant is known to be a high yielding variety under production conditions typically found in Bangladesh (Haque et al. 2012) and has been widely adopted throughout the country (Uddin et al. 2010). Disease and insect pest problems are common in Bangladesh, a tropical country; therefore growers also considered disease and insect pest tolerance an important attribute for variety selection. Disease and insect pests were ranked as the most important problem in high yielding potato varieties in

Bangladesh in 2008/2009 (Uddin et al. 2010). Disease- and pest-free seed tubers are a vital contributor to high yield of potatoes. Tuber-borne diseases degenerate tubers and gradually reduce potato yield, and the rate of seed degeneration is higher in tropical than temperate countries (Allen et al. 1992). Hot and humid weather favor the development of disease and reduce yield and quality of crops. This survey was conducted based on close-ended questions so the growers’ answers were based on the survey questionnaire.

Haulm killing is the method of killing the potato vine 10-15 days prior to harvesting tubers. It is done to maintain tuber size and quality and also to obtain disease free seed tubers.

It also reduces the chance of damage during harvest. Though the growers did not mention haulm killing of potato, they usually practiced this operation only for seed potato production, not for the potatoes they consumed or directly sold after harvest (personal communication with some growers from six surveyed districts). All of the growers in our study irrigated their potato fields during the growing season. Most used water from shallow tube wells, which access water from underground aquifers. However, more than 90% of growers in one district,

Munshiganj, used surface water from rivers, canals or pounds to irrigate potatoes. Irrigation water is an important source of inoculum of soft rot and blackleg pathogens of potato. A study conducted in Colorado and Oregon determined that Erwinia carotovora ssp. carotovora inoculum could be found more in surface water than well water used for irrigation. In addition,

32 the strains were more divergent in surface water than well-water used for irrigation. The pathogen was also found in seed tubers, leaflets, foliage and diseased stems of potato irrigated with contaminated water (Cappaert et al. 1988). It is likely that growers in Mushinganj would have more soft rot and late blight disease problems due to use of surface water for irrigation than growers in the other districts who use tube wells. Two other water borne pathogens such as Pythium spp. and Phytophthora spp. could also cause disease problems in fields irrigated with surface water.

In our survey, growers in all six districts mentioned late blight of potato as one of the most important field diseases of potato. Potato scab, yellow mosaic virus and bacterial wilt are also major field diseases cited. Growers in Bogra, Munshiganj and Panchagarh mentioned blackleg among their field problems, along with other diseases including black scurf, leaf spot, crack, soft rot, leaf spot, foot rot, PVY, stem rot, early blight, PLRV, dry rot and root rot. There are 54 biotic and abiotic diseases of potato recorded in Bangladesh to date, and late blight caused by Phytophthora infestans is considered one of the most serious (Dey and Ali 1994).

Soft rot, early blight, scab and black scurf of potato also are serious diseases (Hossain et al.

2010; Naher et al. 2013 and Rahman et al. 2013). In this survey, growers in all districts considered soft rot of potato tubers the main storage problem. Soft rot, dry rot, and scab were reported as the main storage problems in another study (Khan et al. 1973), followed by black heart, hollow heart, and cold injury.

Surveyed growers cited several practices they typically undertook to manage blackleg and soft rot of potato. Pesticide application, roguing, and sowing disease-free seed potatoes were mentioned most often. The majority of growers across districts applied fungicides to manage diseases in potato fields. Dithiocarbamate fungicides, which are broad-spectrum protectants, were applied most often, although systemic fungicides such a metalxyl and carbendazim were also used. None of the fungicides are effective against blackleg or soft rot,

33 and no products with bactericidal activity such as fixed copper compounds or antibiotics were mentioned by growers. The majority of the growers in Bogra did not know the name of fungicides they applied, which reflects a lack of education in disease management. None of the growers had heard about biological controls for potato soft rot management. Initiatives should be undertaken at the policy level to promote more research on alternative disease management options such as biological control and thus strengthen integrated disease management in

Bangladesh. Parsa et al. (2014) also noted that insufficient attention to biological control is one of the possible reasons behind unsuccessful and poorly adopted integrated disease management programs in developing countries.

The two management practices cited most for soft rot management in tubers in storage were humidity control and tuber sorting. Sorting is analogous to roguing in the field, in that diseased plant material and thus sources of inoculum are removed. Controlling humidity in storage is another important strategy to manage soft rot. Aeration removes the film of water on tuber surfaces so that they remain dry, preventing soft rot bacteria from entering the tubers

(Koepsell 1978).

In our survey market price was the main profit-limiting factor for potato production, followed by diseases. Growers rarely received fair prices for potatoes and in some years cannot afford to pay for cold storage (personal conversation with the growers during the survey). The market price of potatoes is not uniform during the year in Bangladesh. Due to abundant supply soon after harvest, prices decline, and by the end of the year when supplies are low,

(November-December) prices increase (Hajong et al. 2014). Unavailability of high yielding varieties, disease- and insect-free seed potatoes, and low market price are considered the major potato production or profitability constraints in Bangladesh (Chowdhury and Chowdhury

2015). Our survey results are congruent with those of this study, in that we have found that low market price and disease are the profitability constrains of potato production in Bangladesh.

Some growers stored harvested potatoes in cold storage, however the total capacity of cold storage is insufficient to manage supply over the year and reduce price fluctuations.

Across the country only 420 cold storage facilities are available and cannot meet demand: only

44% cover this and the fee for storage is 0.06$/kg potato. High fees and fluctuating prices may result in recovery of as little as 30% of investment into a potato crop (Chowdhury and

Chowdhury 2015).

Naming the local names of diseases helps the researcher communicate with growers.

Growers also benefit from exchanging information and understanding the disease. Disease names are usually based on the symptoms of the disease (Bently et al. 2009). For example, soft rot disease means in bangla norom pocha rog (norom= soft, pocha=rotted, rog= disease), stem rot is kando pocha rog (kando= stem, pocha=rotted, rog= disease) etc. Name usage can change with formal education of the growers, for example, morok, meaning dying was used in the past for late blight, but now almost all growers use the name late blight of potato.

Our future aim is to conduct another survey including the growers from other potato growing districts with different economic conditions, female participants, more open-ended questions, and a more easily interpreted questionnaire. This study will provide the framework for future surveys on potato disease prevalence and distribution in Bangladesh.

Acknowledgement

This material is based upon work supported by the United States Agency for International

Development, as part of the Feed the Future initiative, under the CGIAR Fund, award number

BFS-G-11-00002, and the predecessor fund the Food Security and Crisis Mitigation II grant, award number EEM-G-00-04-00013 and by state and federal funds appropriated to the Ohio

Agricultural research and Development Center, The Ohio State University.

References

Ahmed, M. A. Z., Rayhan, S. J., and Hassan, M. 2013. Grower''s profitability of potato cultivation at rangpur district: the socio-economic context of Bangladesh. Russian J. Agril. Socio-Economic Sc. 19:7. Allen, E. J., O’brien, P. J., and Firman, D. 1992. Seed tuber production and management. The potato crop. Springer Netherlands 247-291. Anwar, M. M., Parveen, A., Hossain, M. M., Mahamud, N. U., and Roy, R. K. 2015. Efficacy of fungicides in controlling late blight of potato. Progressive Agriculture. 26:103-108. Azad, A. K., Kabir, H., Eaton, T. E. J., and Soren, E. B. 2017. Storage potentialities of some exotic potato varieties at growers’ condition in Bangladesh. Agricultural Sciences 8:183. Anonymous. 2016. Bangladesh Bureau of Statistics (BBS). Yearbook of Agricultural Statistics of Bangladesh. 28thseries, available at http://bbs.portal.gov.bd/sites/default/files/files/bbs.portal.gov.bd/page/1b1eb817_9325_4354_a 756_3d18412203e2/Yearbook-2016-Final-19-06-2017.pdf.

Bentley, J. W., Boa, E. R, Kelly, P., Harun-Ar-Rashid, M., Rahman, A. K. M., Kabeere, F., and Herbas, J. 2009. Ethnopathology: Local knowledge of plant health problems in Bangladesh, Uganda and Bolivia. Plant Pathol. 58:773-781. Cappaert, M. R., Powelson, M. L., Franc, G. D., and Harrison, M. D. 1988. Irrigation water as a source of inoculum of soft rot Erwinias for aerial stem rot of potatoes. Phytopathology 78:1668-1672. Charkowski, A. O. 2015. Biology and control of Pectobacterium in potato. Am. J. Potato Res. 92:223-229. Chowdhury, M. D., and Chowdhury, A. H. 2015. Problems and prospects of potato cultivation in Bangladesh. Asian Bus. Rev. 5:28-32. Dasgupta, S., Meisner, C., and Huq, M. 2005. Health effects and pesticide perception as determinants of pesticide use: evidence from Bangladesh (No. 3776). The World Bank. De Boer, S.H., 2004. Blackleg of potato. The Plant Health Instructor. Dey, T. K. and Ali, M. S. 1994. Pathological research on tuber crops in Bangladesh. In: Proc. of Workshop on Transf. of Tech. of CDP crops under Res. Extu. Linkage Progm., held on Oct. 22-27, BARI, Gazipur, Bangladesh. pp 159-165. Goto, M. 1979. Bacterial foot rot of rice caused by a strain of Erwinia chrysanthemi. Phytopathology 69:213-216.

Gross, D. C., Lichens-Park, A., and Kole, C. (Eds.). 2014. Genomics of Plant-Associated Bacteria (Vol. 283). Springer.

Hajong, Pradip., Moniruzzaman, Md., Idris Ali Mia, M., and Rahman, M. 2014. Storage system of potato in Bangladesh. Uni. j. Agril. Res. 2:11-17.

Haque, M. A., Miah, M. M., Hossain, S., and Rahman, M. M. 2012. Profitability of BARI Released potato (Solanum tuberosum L.) varieties in some selected locations of Bangladesh. Bangladesh J. Agril. Res. 37:149-158.

Hossain, M. T., Hossain, S. M. M., Bakr, M. K., Rahman, A. M., and Uddin, S. N. 2010. Survey on major diseases of vegetable and fruit crops in Chittagong region. Bangladesh J. Agril. Res. 35:423-429. Availabe at https://extension.psu.edu/sources-of-plant-disease-in- greenhouses

Khalil, M. I., Haque, M. E., and Hoque, M. Z. 2014. Adoption of BARI recommended potato (Solanum tuberosum) varieties by the potato growers of Bangladesh. The Agriculturists 11:79- 86.

Khan, A. A., Rahman, S., and Kamaluddin, G. 1973. A preliminary survey of the diseases of potatoes in cold-storage in Bangladesh. Bangladesh J. Biol. and Agril. Sc. 2:17-18.

Koepsell, P. A. Controlling bacterial soft rot and blackleg of potatoes. Extension plant pathologist, Oregon State University. https://ir.library.oregonstate.edu/xmlui/bitstream/handle/1957/24602/ECNO954.pdf?sequence= 1 Ma, B., Hibbing, M. E., Kim H. S., Reedy, R. M., Yedidia, I., Breuer. J., Breuer. J., Glasner, J. D., Perna N. T., Kelman. A., and Charkowski, O. A. 2007. Host range and molecular phylogenies of the soft rot enterobacterial genera Pectobacterium and Dickeya. Phytopathology 97:1150-1163.

Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., Verdier, V., Ber, S. V., Machado, M. A., Toth, I., Salmond, G., and Foster, G. D. 2012. Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 13:614-629.

Martinez-Cisneros, B. A., Juarez-Lopez, G., Valencia-Torres, N., Duran-Peralta, E., andMezzalama, M. 2014. First Report of Bacterial Stalk Rot of Maize Caused by Dickeya zeae in Mexico. Plant Dis. 98:1267-1267.

Moazzem, K. G., and Fujita, K. 2004. The potato marketing system and its changes in Bangladesh: From the perspective of a village study in Comilla district. The Developing Economies 42:63-94. Naher, N., Hossain, M., and Bashar, M. A. 2013. Survey on the incidence and severity of common scab of pottao in Bangladesh. J. Asia. Soc. of Bangladesh Science. 39:35-41. Parsa, S., Morse, S., Bonifacio, A., Chancellor, T. C., Condori, B., Crespo-Pérez, V., and Sherwood, S. G. 2014. Obstacles to integrated pest management adoption in developing countries. Proceedings of Nat. Aca.of Sc.. 111:3889-3894. Perombelon, M. C. M. 2002. Potato diseases caused by soft rot Erwinias: an overview of pathogenesis. Plant Pathol. 51:1-12. Rahman, M., Ali, M. A., Ahmad, M. U., and Dey, T. K. 2013. Effect of tuber-borne inoculum of Rhizoctonia solani on the development of stem canker and black scurf of potato. Bangladesh J. Plant Pathol. 29:29-32.

Rasul, M. G., Islam, M. S., and Sheikh, M. H. R. 1999. Storability of different potato varieties under natural condition. Bang. J. Sc. and Ind. Res. 34:86-90. Shahriar, S. M., Hasan, M. K., and Kamruzzaman, M. 2013. Farm level potato (Solanum tuberosum L.) cultivation in some selected sites of Bangladesh. Bangladesh J. Agril. Res. 38:455-466. Siddique, M. N. A., Sultana, J., Huda, M. S., Abdullah, M. R. and Chowdury M. A. 2015. Potato production and management with preference to seed potato supply chain, certification and actors involve in Bangladesh. Int. J.Bus.Man. and Soc. Res. 01:01-13.d. Toth, I. K., van der Wolf, J. M., Saddler, G., Lojkowska, E., Helias, V., Pirhonen, M., Tsror, L., and Elphinstone, J. G. 2011. Dickeya species: an emerging problem for potato production in Euro. J. Plant Pathol. 60:385–399.

Figure 2.1. Map of Bangladesh showing the geographical locations of the surveyed districts.

Table 2.1. Question types and content regarding the distribution and impact of potato blackleg and soft rot in Bangladesh survey.

Question type Content Demographics Gender, age, marital status, education, years in potato production, total land area, area under potato cultivation Potato production practices Crop rotation, variety, irrigation schedule, sources of seeds, source of irrigations, yield and price Potato production constraints Factors that limit profit, diseases in field and storage, and disease management management practices for diseases, storage facilities, economic loss (tk)

Variable Variable Distribution of responses explanation Bogra (n=75) Comilla (n- Jessore Munshiganj Panchagarh Rajshahi Mean 62) (n=54) (n=67) (n=67) (n=29) (n=348) Age (years) 19-36 33.3 17.7 0.0 14.0 12.9 12.5 18.1 37-54 54.7 61.2 67.2 46.0 35.5 66.6 55.2 55-70 12.0 19.3 32.7 40.0 55.5 20.8 30.1 Primary school 10.7 59.6 41.0 32.7 16.4 50.0 35.0 High school 45.3 1.6 23.0 43.6 31.1 - 28.9 Intermediate 40.0 29.0 29.5 14.5 26.2 39.3 29.7 Illiterate 2.7 8.0 6.6 - 11.5 - 5.7 Years in <7 34.6 27.4 - 52.7 46.3 10.7 34.3 potato 7 8.0 11.3 - 0.0 14.9 0.0 11.4 production >7 57.3 61.3 100 47.3 38.8 89.3 65.7 Total land <2 72.0 100 91.8 80.0 88.1 24.0 75.9 (hA) >2 28.0 - 8.2 20.0 11.9 4.0 14.4 Area under <2 94.7 100 100 100 95.5 93.1 97.2 potato >2 5.3 - - - 4.4 3.4 4.4 cultivatiopn

Table 2.3. Local names for potato diseases provided by growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh. The English name and causal agent of each disease are shown.

Disease or Disease (Bengali) name Causal agent disorder provided by growers Soft rot Norom pocha rog Pectobacterium sp., Pectobacterium carotovorum ssp. Dickeya spp.

Blackleg Kalo pa rog Pectobacterium sp., Pectobacterium carotovorum ssp. Dickeya spp.

Stem rot Kando pocha rog Sclerotium rolfsii

Dry rot Shukna pocha rog Fusarium sp.

Black scurf - Rhizoctonia solani

Early blight Agam dhosha Alternaria solani

Scab Dad Streptomyces scabies

Wilting Dhole pora rog Ralstonia solanacearum

Potato leafroll Pata morano virus Potato leafroll virus (PLRV)

Potato yellow Holud mosaic rog Potato yellow mosaic virus mosaic (PLYV)

Late blight Morok rog Phytophthora infestans

Black heart Kalo dag Abiotic problem

Hollow heart Fapa rog Abiotic problem *Growers did not mention English name of black scurf

Table 2.4. Percentage of potato growers (n=348) surveyed who reported that they rotated the indicated crops with potato in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh.

Crop Bogra Comilla Jessore Munshiganj Panchagarh Rajshahi Maize 20.0 72.5 - - 94.0 75.0 Brinjal 2.7 - - - - 3.5 Jute 2.7 32.2 95.0 14.5 - 3.5 Rice 72.0 - - 32.7 4.4 28.5 Chili 1.3 - - - 2.9 - Wheat 4.0 3.2 - - - - Mustard 1.3 - - - - - Safflower 1.3 - - - - - Tomato 2.7 - - - - - Sugarcane 2.7 - - - - 3.5 Vegetable 12.0 - - 21.8 2.9 7.2 Sesame - 80.6 - - - - Cucumber - - 85.2 - 1.4 - Groundnut - - 3.3 - - - Blackgram - - 3.3 - - - Sweetgourd - - 36.0 - 43.2 -

300

39 250

200

61 Panchagarh

150 Rajshahi 34

No. of of No. growers Jessore 55 54 21 Munshiganj 100 9 Comilla 60 40 62 Bogra 50 8 14 39 44 34 37 22 0 11 2 2 1 3 5

Potato variety

97.1 1.8 2.9

4.9 23.1 Dealer 1.6 Saved seeds 1.6 8.9 98.4 Market

19.4 11.5 BADC 89.3 54.8 26.9

82 25.8

Bogra Comilla Jessore Rajshahi Munshiganj Panchagarh

250

200

150

100 No. of of No. growers

Factors influenced in variety selelction

Figure 2.5. Frequency (percentage) of potato growers using different types of irrigation water in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh.

Munshiganj

Panchagarh Shallow tube well

jessore

regions Deep tube well

Comilla Canal

Surveyed Pond Rajshahi River Bogra

0 20 40 60 80 100 120 Frequency of growers using each irrigation water source

Table 2.5. Frequency (percentage) of potato field diseases cited by growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh. PVY = Potato virus Y, PLRV = Potato leaf roll virus.

Diseases Bogra Comilla Jessore Rajshahi Panchagarh Munshiganj

Yellow 1 44 59 13 - - mosaic virus (YMV)

Root rot 1 43 - - - -

Blackleg 21 - - 2 1 15

Dry rot 23 - - - 2 -

Black 1 - - 4 63 - scurf

Late blight 54 45 61 23 60 15

PLRV 26 - 1 4 - -

Bacterial 33 - - 1 39 - wilt

Early 19 14 - 12 - 8 blight

Stem rot 9 - - 11 - -

PVY 5 - 8 - - -

Leaf spot - 44 - - 15 -

Foot rot - - - - 60 -

Scab 42 24 60 13 42 12

Soft rot - - - - 7 -

Crack* - - - - - 2

*Crack is an abiotic problem caused by water stress during the growing season of potato

Table 2.6. Diseases, disorders and injuries of potatoes in storage cited by growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh.

Diseases Bogra Comilla Jessore Rajshahi Panchagarh Munshiganj

Hollow heart 31 - 2 8 - -

Black heart 25 - 30 13 - -

Black spot 1 3 - - - -

Dry rot 15 - 60 - 20

Heat injury 14 - - - - 1

Pink rot 1 - - - - -

Scab 4 - - - 3

Soft rot 47 52 60 16 63 1

Cold injury 13 - - - - -

Late blight 2 - - - - -

Mechanical - 51 - - - - injury

100.0 90.0 Bogra 80.0 70.0 Comilla 60.0 Jessore 50.0 Munshiganj

40.0 Panchagarh 30.0 Rajshahi 20.0

Percentage of potato growers potatoof Percentage 10.0 0.0

Management practice appplied

Munshiganj

Jessore Dithiocarbamate Bogra

Metalaxyl Surveyed Surveyed districts Dimethomorph Comilla Benzimidazole Panchagarh Organophosphate

Fluazinum Rajshahi

0.0 20.0 40.0 60.0 80.0 100.0 Frequency of growers applying crop protection products

Figure 2.8. Frequency (percentage) of potato growers in six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh utilizing specified soft rot management practices.

Humidity control

No action Rajshahi practice Panchagarh

Munshiganj

Pesticides Jessore management

rot Comilla

Soft Bogra Seed sorting

0 20 40 60 80 100

Frequency of potato growers

Table 2.7. Factors that limit profitability of potato production identified by growers (percentage) from six districts (Bogra, Jessore, Rajshahi, Comilla, Panchagarh and Munshiganj) in Bangladesh.

Factors Bogra Comilla Jessore Rajshahi Panchagarh Munshiganj

Insect 41.3 85.4 34.4 28.6 1.5 23.6 Bad seed 42.7 1.3 36.1 60.7 79.1 14.5 Market price 53.3 56.5 98.4 82.1 92.5 54.5 Bad variety 28.0 0.0 11.5 35.7 95.5 0.0 Bad soil 26.7 4.8 3.3 0.0 1.5 0.0 Disease 44.0 88.7 85.2 14.3 23.9 32.7 Weed 1.3 43.5 0.0 0.0 0.0 0.0 Insecticide 1.3 0.0 1.6 0.0 0.0 5.5 Lack of cold 0.0 0.0 13.1 0.0 0.0 0.0 storage

*0.0 = Growers did not mention the limitation

Table 2.8. Bangladeshi potato growers’ ranking of varieties for susceptibility to soft rot disease in storage. The ranking was based on a 1-4 scale. 1= resistant; 2= moderately resistant; 3= moderately susceptible; 4= susceptible. The numbers in the table are the numbers of growers of each district who assigned the ranking for each variety.

Variety Bogra Jessore Panchagarh Rajshahi

1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4

6 2 Diamant 33 14 10 2 - - - 3 - - - 1 - 2 1 8 2 Asterix 40 13 1 - - - - 1 6 1 - 1 - 1 - 1 5 Cardinal 18 6 3 - - - - 2 7 - - - 1 - 2 9

Courage 9 39 6 - - - - 1 - - - - 2 - - -

Granola 9 19 3 1 ------

Luara 8 6 2 1 ------

Sonali 1 ------

Lady - - - 1 ------Rosetta

Musica 1 ------

- - 1 ------Belini

- 1 ------Surjou- mokhi

p value 0.007 >0.05 >0.05 >0.05

Bogra

Rajshahi

Panchagarh 0 days

15 days Munshiganj 30 days

45 days Surveyed districts Surveyed Jessore

Comilla

0 20 40 60 80 Frequency of growers who checked potatoes

Jessore

Bogra

Rajshahi

Home Panchagarh

Cold storage

Surveyed districts Surveyed Munshiganj BADC

Comilla

0 20 40 60 80 100 Percentage of potato growers

100

70 Local Market response

60 City Market Wholesaler 50 Dealer 40

Percentage of grower Roadside 30 BADC 20

0 Bogra Comilla Panchagarh Rajshahi Munshiganj Jessore District

Chapter 3

Identification and Characterization of Potato Soft Rot and Blackleg Pathogens in

Bangladesh

Abstract. From December 2014 to January 2015, a total of 15 bacterial isolates were recovered from potato tubers with symptoms of soft rot collected in ten major potato-growing areas of Bangladesh. Based on biochemical and physiological assays, Pectobacterium carotovorum ssp. associations were found in the soft rot in potato tubers. The isolates were further characterized using subspecies-specific PCR, 16s rRNA gene sequencing and multilocus sequence analysis. Artificial inoculation of potato tubers generated the same symptoms, from which the same bacteria were re-isolated. All 15 isolates caused soft rot in pathogenicity tests and five of isolates caused both soft rot and blackleg symptoms. All the isolates were identified as Pectobacterium carotovorum ssp. carotovorum based on P. carotovorum ssp. carotovorum- specific PCR and 16s rRNA gene sequencing. The strains were >75% similar to reference P. carotovorum ssp. carotovorum strains. Phylogenetic analysis of six concatenated housekeeping gene sequences (acnA, gapA, icdA, mdh, pgi and proA) of P. carotovorum ssp. carotovorum was conducted. Due to poor quality sequences of the six housekeeping genes for P. carotovorum ssp. carotovorum strains Pnm5 and Pta2, these were not included in the analysis. In the phylogenetic tree, the 13 strains were divided into two distinct clades, in which Bangladeshi soft rot strains shared similar genotypes with the strains from the Netherlands, USA, Brazil and Israel. This study revealed that P. carotovorum ssp. carotovorum is the principle pathogen causing soft rot of potato tubers in Bangladesh.

Introduction

Bacteria in the genera Pectobacterium and Pseudomonas cause soft rot of crops in the field and in storage (Agrios 2005). The genus Pectobacterium (Kwon et al. 1997), formerly known as Erwinia, was divided into several species and subspecies on the basis of molecular, biochemical and host range differences. Pectinolytic Erwinia spp. were reclassified into two species: E. carotovorum and E. chrysanthemi, and now they have been incorporated into

Pectobacterium and Dickeya genera, respectively (Hauben et al. 1998; Gardan et al. 2003;

Samson et al. 2005). The Pectobacterium genus is divided into P. carotovorum ssp. carotovorum (Pcc), P. atrosepticum (Pa), P. wasabiae (Pw), P. carotovorum ssp. odoriferum

(Pco), P. carotovorum ssp. brasiliense (Pcb) and P. betavasculorum (Pbv) (Gardan et al.

2003; Duarte et al. 2004; Ma et al. 2007).

Pectobacterium atrosepticum usually causes blackleg in temperate regions, though this pathogen can cause disease in tropical regions if the seed tubers are imported from temperate climates (Perombelon 2002; Czajkowski et al. 2011). In contrast, bacteria belonging to the subspecies carotovorum have the ability to infect many crops and survive in a range of environmental conditions and in numerous non-crop hosts (Sledz et al. 2000). de Haan et al.

(2008) reported that potato plants grown from tubers vacuum-infiltrated with strains of P. carotovorum ssp. carotovorum developed blackleg symptoms in temperate countries in

Europe. Pectobacterium wasabiae has been identified as the causal agent of blackleg in Iran,

New Zealand, Poland, Germany and Ireland (Baghaee-Ravari et al. 2011; Slawiak et al.

2013). Moreover, an atypical Pectobacterium subspecies was identified in Brazil and South

Africa and eventually named P. carotovorum ssp. brasiliense (Duarte et al. 2004; van der

Merwe et al. 2010). This subspecies has been reported to cause soft rot and blackleg in potato

59 seed production fields in Minnesota and North Dakota, USA (McNally et al. 2017).

Pectobacterium carotovorum ssp. odoriferum has been reported in different vegetables such as carrot and onion (Waleron et al. 2014). Pectobacterium betavasculorum was reported exclusively on sugar beet (Ma et al. 2007). In another study, P. atrosepticum, P. carotovorum ssp. brasiliense, P. carotovorum ssp. carotovorum and P. wasabiae all were detected from blackleg-diseased potato plants in Canada (De Boer et al. 2012). In this study, both species and subspecies-specific PCR and multilocus sequence analysis (MLSA), along with biochemical and physiological characterization, were used to confirm the presence of these pathogens in infected potato stems.

Dickeya spp. were thought to cause disease only in warm and tropical climates

(Perombelon and Kelman 1980). Depending on the pathovar and biovar classification,

Dickeya is divided into six species namely, D. dianthicola (Pectobacterium chrysanthemi pv. dianthicola), D. didantii (P. chrysanthemi biovar 3), D. zeae (P. chrysanthemi biovar 8 and other strains of biovar 3), D. chrysanthemi bv. chrysanthemi (P.chrysanthemi bv. chrysanthemi), D. chrysanthemi bv. parthenii (P. chrysanthemi bv. parthenii) and D. paradisiaca (Brenneria paradisiaca) (Samson et al. 2005). Dickeya dianthicola has been identified as the causal agent of soft rot and black leg in the temperate European countries of

Poland, Finland and Switzerland (Slawiak et al. 2008; Lauria et al. 2006 and Cazelles and

Schwarzel 1992) and recently it has also been reported for the first time in Maine, USA (Jiang et al. 2016). Dickeya dianthicola-affected potato plants were found throughout the Mid-

Atlantic region of USA originating from seed tubers imported from the state of Maine.

Consistantly higher temperatures (>77ºF) during the potato-growing season favored the development of blackleg and total loss has occurred in some fields due to the aggressive nature of D. dianthicola (Wyenandt 2016). Since 2005, another species of Dickeya (biovar 3, proposed name D. solani) has been isolated in the Netherlands and Israel (Toth et al. 2011).

This pathogen was also identified as a causal agent of blackleg in Brazil in 2013 for the first time in plants raised from the seed tubers imported from Europe (Cardoza et al. 2017). In addition, D. dadantii has been identified as the causal agent of soft rot of potato in Zimbabwe and Peru (Ngadze et al. 2010; De Lindo 1978).

Pectobacterium carotovorum ssp. carotovorum is a facultatively anaerobic, peritrichously flagellated, gram-negative, rod-shaped bacterium. It is catalase positive, oxidase negative and can ferment glucose, but does not produce acid from sorbitol (Schaad et al. 2001). This pathogen has pectolytic activity and produces deep pits on crystal violet pectate (CVP) medium (Cupples and Kelman 1974). Pectobacterium carotovorum ssp. carotovorum is considered the most genetically diverse subspecies and it has a broad host range including potato, eggplant, pepper, carrot, cabbage, cucumber, tomato and ornamental plants (Avrova et al. 2002). It is a major causal organism of several diseases of potato including aerial stem rot, blackleg and soft rot (Golkhandan et al. 2013). To reduce yield loss efficiently, preventative and cultural strategies along with rapid and specific pathogen identification at the minimum level of infectivity should be taken (Kang et al. 2003).

There are several methods available for the identification of Pectobacterium carotovorum ssp. carotovorum including biochemical, serological and molecular techniques.

Biochemical tests were used extensively in the past for the identification of P. carotovorum ssp. carotovorum (Ma et al. 2007). However, the methods are very time consuming and require pure bacterial cultures, and therefore have been replaced by or combined with other methods (Wright-Dobrzeniecka 1989). Serological tests encorporating monoclonal and/or polyclonal antibodies can be used to detect P. carotovorum at the species level. However, due to serological heterogeneity and cross reactivity within and between subspecies, this method has limited use in the identification of Pectobacterium subspecies (De Boer et al. 1987; Kang et al. 2003).

The polymerase chain reaction (PCR) technique is rapid, simple and sensitive compared to biochemical techniques (Kang et al. 2003). To differentiate subspecies of

Pectobacterium, cellular fatty acid profiling and randomly amplified polymorphic DNA

(RAPD) PCR were suggested by Hadas et al. (2001) and Parent et al. (1996). However, fatty acid profiling has already proven not so useful to identify Pectobacterium at the subspecies level. In RAPD PCR, DNA amplicons are the result of exponential amplification of random

DNA sequences, and minor errors in amplification efficiencies could result in false bands and unreliable results. So optimizing a standard protocol for RAPD-PCR is particularly important when it is used for disease diagnosis. Restriction fragment length polymorphism (RFLP)-PCR and specific amplified fragment length polymorphism (AFLP)-PCR both have been used to accurately identify Pectobacterium subspecies (Toth et al. 2001). AFLP-PCR was used to characterize a majority of the species and subspecies of Pectobacterium and Dickeya including P. carotovorum ssp. carotovorum, P. atrosepticum, P. wasabiae and P. betavasculorum, P. carotovorum ssp. odoriferum (Avrova et al. 2002). RFLP-PCR was used to differentiate between Pectobacterium and Dickeya species using two groups of genes: housekeeping genes and virulence factor genes (Czajkowski et al. 2014). Subspecies-specific

PCR is based on the amplification of a target DNA sequence uniquely present in the pathogen’s genome. This method is very effective to identify the presence of a small density of pathogens from infected plants or tubers (Minsavage et al. 1994). Subspecies-specific PCR is used to identify different subspecies of Pectobacterium and species of Dickeya. The primer pair EXPCCF and EXPCCR has been used to identify Pectobacterium carotovorum ssp. carotovorum and Pectobacterium wasabiae but it does not differentiate them (de Boer et al.

2012). PCR utilizing this primer pair produces a single amplicon for P. carotovorum ssp. carotovorum and P. wasabiae, but they differ in biochemical tests (Smith and Bartz 1990).

In recent years, 16s rRNA gene sequence data has been used to identify

Pectobacterium at the species level and to determine phylogenetic relationships among

Pectobacterium species, but it has limited sensitivity for the identification of subspecies (Toth et al. 2001). Variable copy number of 16s rRNA in the genomes of bacteria and different taxa with identical or very similar 16s rRNA gene sequences limit the utility of this approach.

Multilocus sequence analysis (MLSA) is considered more informative than single gene analysis (Ma et al. 2007). Housekeeping genes selected for MLSA are responsible for bacterial metabolism, conserved within taxonomic groups and present in most enterobacteria.

Studies based on MLSA provide a better understanding of phylogenetic relationships than 16s rRNA genes sequences because the former method uses several concatenated gene sequences rather than single gene phylogenies. This method identifies more genetic variability within taxa and can divide the same subspecies of P. carotovorum ssp. carotovorum into distinct clades that contain strains from different hosts (Ma et al. 2007).

Due to the limitations of molecular research facilities in Bangladesh, only morphological and biochemical studies have been conducted to identify the soft rot pathogens. Based on morphological and biochemical tests, Rahman et al. (2012) reported that

Pectobacterium ssp. and Dickeya chrysanthemi (renamed D. didantii by Toth et al. 2001) cause soft rot of potato tubers in Bangladesh. However, morphological and biochemical tests cannot adequately differentiate related species and subspecies (Czajkowski et al. 2015).

The aims of this study are to identify and characterize the pathogens causing potato soft rot and/or blackleg in Bangladesh, from genus to subspecies levels utilizing molecular tools and biochemical tests.

Materials and Methods

Soft rot isolates. Fifteen isolates of bacteria suspected to be soft rotters were recovered from

63 symptomatic potato tubers collected from ten regions in Bangladesh. Potatoes (25 samples per location) were collected from storage facilities or the market place from December 2014 to

January 2015 (Figure 3.1). The tuber samples were transported to the laboratory of the

Department of Plant Pathology, BARI, Bangladesh and culturing was initiated within 1 day of collection. Tubers were cut and a small section (2.5 cm) of rotting tissue was removed with a sterile scalpel. Bacterial suspensions were made by macerating the sections in sterilized distilled water (5 mL) and the extract (100 L) was streaked on crystal violet pectate (CVP) medium (Cupples and Kelman 1974). Bacteria that produced characteristic deep pits on CVP were purified twice by selecting a single colony and re-streaking on Luria-Bertani (LB) agar medium (Sigma-Aldrich, St. Louis, MO, US), incubated each time at 28°C for 3 days. Convex creamy-translucent colonies were selected for further tests. Single pure colonies from each isolate were maintained in 1 mL of sterilized distilled water at 4°C for short-term (at least one month) preservation. All of the Bangladeshi isolates (Table 3.2) were sent to the US for characterization (USDA APHIS permit P526P-13-03465). Bacterial cell suspensions were centrifuged at 7000 RPM for 10 min in sterile tubes, followed by pouring off the supernatant.

The pellet was re-suspended in 1 mL of sterilized distilled water and the suspension was stored at 4°C. In addition, for long-term preservation, bacterial cell suspensions were stored at

-80° C in 1 mL of LB broth containing 500 L of glycerol).

Pathogenicity assay. Pathogenicity assays were conducted as described by Lojkowska and

Kelman (1994). Susceptible potato cultivar Russet Burbank tubers were sanitized by submerging them in sodium hypochlorite (0.5%) for 10 minutes and air-drying them on sterile paper towels in a laminar flow hood for 15 minutes. A solution of 95% ethanol was then sprayed onto each tuber and dried for ten minutes. Tubers were aseptically cut into 5 mm- thick slices and placed in Petri dishes containing a sterilized moistened paper towel. A 5 mm- diameter filter paper disk was placed in the center of each cut slice of tuber. Bacterial

64 suspensions were prepared in sterilized distilled water from 2-day-old cultures of each isolate growing in LB broth and adjusted to an optical density of 0.2 (OD600). Bacterial concentrations were confirmed by dilution plating (108 CFU/mL). A 25 µL aliquot of the inoculum was dropped onto each disk. Petri dishes contained inoculated or non-inoculated control tuber slices were placed on moistened paper towels in closed containers in a Biosafety

Containment Level 2 Lab to ensure high relative humidity for 3 days at 28ºC in constant darkness. The inoculated tuber slices that showed discoloration of tissues and soft rotted decay were considered positive for pathogenicity.

The ability of isolates to cause blackleg symptoms was determined by stem inoculation.

Russet Burbank potatoes were planted in 15cm diameter pots containing steam-sterilized field soil in a biosafety containment growth chamber at 18ºC and 70% RH with 12 hr alternate light and dark conditions for 4 weeks, until the seedlings were about 20 cm in height. Plants were watered twice daily and plants were also monitored for thrips and mites. Avid 0.15 EC was applied twice at 7 days interval for 2 weeks in the seedlings to control mite infestations. A drop (15 µL) of aqueous cell suspension (prepared as described above) (108 CFU/mL) of each isolate was placed in the lowest leaf axil. Sterilized 200 µL pipette tips were inserted through the drops into the center of the stem of the lowest leaf axil. The tips were removed after introducing the inoculum into the stems. Plants were maintained for two weeks more to observe the symptoms of blackleg. In each experiment, soft rot isolates were arranged in randomized complete block design (RCBD) with three replications. Tuber slices mock inoculated with sterile water served as negative controls and each experiment was conducted twice. Disease severity was scored based on blackleg symptoms: blackening from the lower part of the seedlings and progressing upward, yellow leaves and vascular discoloration. The disease severity scale ranged from 0-3, where 0= no symptoms, 1= 50% of the plant had blackleg symptoms, 2= > 50% of the plant had blackleg symptoms and 3= plant completely

65 dead. The area under the disease progress curve (AUDPC) was calculated for each isolate using this disease severity scale. Area under the disease progress curve values were calculated

(풙풊+풙풊−ퟏ) according to the formula: ∑([ ]) (푡푖 − 푡푖 − 1), where x is the rating at each evaluation ퟐ i time and (t -t ) is the number of days between evaluations (Madden et al. 2007). i i-1

Subspecies-specific PCR. Pure cultures of the isolates were grown overnight at 28ºC on LB agar (Sigma-Aldrich, St. Louis, MO, US) medium. Bacterial suspensions were prepared in sterilized distilled water and DNA was extracted from bacterial suspensions using a Wizard genomic DNA purification kit (Promega Corporation, Madison, WI, USA) and stored at -

20ºC. For the subsequent PCR, DNA of 15 samples was quantified using a NanoDrop spectrophotometer at 260 nm and DNA of the samples ranged from 50-1000 ng/L. All soft rot isolates were subjected to a subspecies-specific PCR assay using the primer set

EXPCCF/EXPCCR for the identification of P. carotovorum ssp. carotovorum, with some modifications in PCR reaction cycles and temperatures (Kang et al. 2003). DNA from isolate

SM 171-10 (Miller lab) was used as the positive control and sterilized distilled water was used as negative control. PCR was performed in a 25 µL reaction mixture containing 1 µL DNA template, 1 µL of each primer (10M), 12.5 µL GoTaq Green Master Mix (DNA polymerase

2X Green GoTaq Reaction Buffer; pH 8.5, 400M dNTP and 3mM MgCl2) from Promega

Corporation, Madison, WI, US. and 9.5 µL deionized water. The reaction cycles used in a

C1000 TouchTM (BIORAD) thermal cycler were as follows: initial denaturation for 5 min at

95ºC, 40 cycles at 95ºC for 30 s, 72 ºC for 30s and a final extension at 72ºC for 4 min (De Boer et al. 2012). Nuclease-free water was used as a negative control. Electrophoresis was performed in a 1.5% agarose gel with TAE buffer at 110 volts for 15 minutes. The gel was stained with GelRed™ nucleic acid gel stain (15 L stain/50mL) (Biotium Inc, Fremont, CA,

USA) and photographed under UV light.

16s rRNA gene sequencing. DNA was extracted from bacterial suspensions (108 CFU/mL) using a Wizard genomic DNA purification kit (Promega Corporation, Madison, WI, USA).

Each 25 µL reaction mixture contained 1 µL DNA template (50-1000 ng/L), 1 µL of each primer (10 M), 12.5 µL GoTaq Green Master Mix (DNA polymerase 2× Green GoTaq

Reaction Buffer; pH 8.5, 400 M dNTP and 3mM MgCl2) from Promega Corporation,

Madison, WI, US, and 9.5 µL deionized water. PCR was performed following these conditions: one cycle denaturation for 5 min at 94ºC, 30 cycles at 94ºC for 60 s, 54ºC for 45 s,

70ºC for 60s and a final extension at 70ºC for 8 min (Benitez et al. 2009). Nuclease-free water was used as a negative control. Electrophoresis was performed in a 1.5% agarose gel with

TAE buffer at 110 volts for 15 minutes. The gel was stained with GelRed™ nucleic acid gel stain (15L stain/50mL) (Biotium Inc, Fremont, CA, USA) and photographed under UV light.

Amplicons were purified using Wizard SV gel and PCR cleanup system (Promega

Corporation, Madison, WI, US). Amplified products were sequenced (Sanger sequencing) in both directions by the OSU-OARDC Molecular and Cellular Imaging Center (MCIC). Due to poor quality of the reverse sequences, only forward sequences of all of the isolates were used for phylogenetic analysis. Sequences were manually edited using Chromas lite 2.1.1

(Technelysium, PtyLimited, Australia).

MEGA 7 software (http://www.megasoftware.net/) was used to align, trim and analyze the sequences. Maximum likelihood method was used to make a phylogenetic tree using the bootstrap method with 1000 replications. Gaps were completely excluded from this study.

Evolutionary distances were computed using the Tamura-Nei model.

Multilocus sequence analysis (MLSA). Concatenated sequences of six informative housekeeping genes acnA (300-bp), gapA (450-bp), icdA (520-bp), mdh (460-bp), pgi (520- bp) and proA (630-bp) were examined to determine genetic diversity and relationships among

Pectobacterium isolates from Bangladesh (Ma et al. 2007; Nabhan et al. 2011). Primers for amplification of the six housekeeping genes are listed in Table 3.2. Reaction mixtures contained 1 µL DNA template (50-1000ng/L), 1 µL of each primer (10M) (Table 3.3), 12.5

µL GoTaq Green Master Mix (DNA polymerase 2× Green GoTaq Reaction Buffer; pH 8.5,

400M dNTP and 3mM MgCl2) from Promega Corporation, Madison, WI, US. and 9.5 µL deionized water. PCR assays were carried out using the conditions described by Ma et al.

(2007). The identity of the isolates was confirmed by sequencing the six genes of

Pectobacterium isolates by the MCIC, and comparing sequences with publicly available sequences of homologous genes of reference Pectobacterium ssp. strains. The sequences were retrieved from the National Center for Biotechnology Information (NCBI) GenBank (Table

3.1). Amplicons were purified using a Wizard SV gel and PCR cleanup system (Promega

Corporation, Madison, WI, US). For sequencing the DNA template was prepared at a concentration of 0.6 ng/L per 100 bp of PCR product. All six housekeeping gene sequences were aligned with ClustalW and analyzed using MEGA 7. The Kimura-2 model was used to make a phylogenetic tree based on the Maximum likelihood method with a bootstrapping value of 1000 replications. For each individual gene 500 replications for the bootstrap analysis were done and bootstrap supports <50% were not included. Chromas lite 2.1.1

(Technelysium, PtyLimited, Australia) was used to edit the chromatograms. The tree was rooted using sequences of Dickeya didantii strains Ech586 and Ech1591 and Yersinia pestis strains YpCo92 and Yp91001 were retrieved from GenBank to use as an outgroup species

(Table 3.1).

Virulence of soft rot pathogens. Potato cultivar Russet Burbank tubers were sanitized with

0.5% sodium hypochlorite for 20 min, rinsed with distilled sterile water, sprayed with 95% ethanol and allowed to dry on sterilized wet paper towels for 1 hour in a laminar flow hood.

Tubers were cut in half longitudinally, and 5 mm-deep wells were made in the center 2 hours

68 prior to inoculation. A 50 µL bacterial suspension was prepared from a 1-day-old culture of each isolate grown on LB broth, adjusted to an optical density of 0.2 @ 600nm and confirmed by dilution plating (108 CFU/mL). The suspension was dispensed into each well. The tubers were placed on sterilized wet filter paper and incubated in a biosafety containment growth chamber for three days at 28ºC in closed containers with optimum humidity. Rotted tuber tissue was separated from healthy tissue with a spatula and the fresh weight (g) of the rotted and non-rotted portions were recorded and converted to percentage (Pasco et al. 2006). Each assay for the isolates was replicated three times and the experiment was repeated once.

Percentage of rotted tuber tissue was used as the indicator of virulence in this assay. Data from these two experiments were combined since in Levene’s test indicated no significant differences (p>0.05).

Physiological and biochemical characterization of isolates. Each isolate was characterized using the following tests according to Schaad et al. (2001): gram reaction (3% KOH), oxidase disk (Sigma-Aldrich, St. Louis, MO, US), hypersensitive reaction (HR) on tobacco (Nicotiana tabacum) leaves, ability to grow at 37ºC, pits on CVP, sugar reduction from sucrose, lactose and sorbitol, fluorescence on Pseudomonas semi-selective PF medium (Sigma-Aldrich, St.

Louis, MO, US), arginine dehydrogenase activity and anaerobic growth (Hugh-Leifson test).

Results

Pathogenicity tests. Three days after inoculation all of the inoculated tuber slices showed soft rot symptoms on the tubers. Five isolates (Pmu6, Psri1, Pta2, Pke and Pta3) also caused blackleg symptoms on potato seedlings. Symptoms included external blackening of the stem progressing upwards on the plants, wilting and yellowing of leaves and eventually collapsing of the rotted stems. Tuber slices and stems mock-inoculated with water did not develop symptoms. Bacteria re-isolated from inoculated tubers and plants produced characteristic deep

69 pits on CVP medium. All of the blackleg-causing soft rot isolates developed blackleg symptoms 3 days after inoculation with 108 CFU/mL bacterial suspensions. With time enlarged blackleg lesions developed and some of the seedlings inoculated with strains Psri,

Pmu6 and Pke reached 60% disease severity (Figure 3.2). All of the isolates produced significantly more symptoms than the negative control (p<0.05). The AUDPC of Pmu6-, Pke-

, Psri1-, Pta2- and Pta3-inoculated seedlings were significantly higher than non-inoculated control treatment (Figure 3.3). The seedlings inoculated with the strains Psri1 and Pta2 had significantly higher AUDPC than those inoculated with strain Pke. However, there was no significant correlation among the five blackleg-causing isolates in blackleg severity measured by AUDPC and soft rot severity (p= 0.090).

Subspecies-specific PCR. Bacterial isolates recovered from potato tubers in Bangladesh were further characterized by subspecies-specific PCR utilizing primers EXPCCF and EXPCCR for P. carotovorum ssp. carotovorum (Kang et al. 2003; De Boer et al. 2012). PCR with primer pair EXPCCF and EXPCCR resulted in amplification of a 550-bp sequence for 15 isolates that caused soft rot on potato tubers (Figure 3.4). There was no amplification of DNA from bacterial isolates from potato that did not cause soft rot on tubers (lanes 14, 16, 18, 20 and 21) or from the water control.

16s rRNA gene sequencing. PCR amplification of the partial sequence of the 16s rRNA gene of 15 Bangladeshi isolates that caused tuber soft rot and tested positive for P. carotovorum ssp. carotovorum by subspecies specific PCR resulted in approximately1400-bp amplicons for each of the isolates. The Bangladeshi isolates clustered into two clades (Figure 3.5). Eleven putative P. carotovorum ssp. carotovorum isolates collected in Bangladesh formed a cluster with P. carotovorum ssp. carotovorum reference strains from China including BGZ-1, DQ and RY31 with a bootstrap value of 77%. This cluster also contained two P. carotovorum ssp.

70 brasiliense strains, Kbs-1 and AGpim1G (Table 3.1). Moreover, the analysis placed two

Malaysian P. carotovorum ssp. carotovorum reference strains, Sp2 and Sp3, with four

Bangladeshi isolates in another clade with bootstrap support of 82%. Dickeya sp. strains

A27G3 and NCPPB 4575, and Ralstonia solanacearum strain LYP were used as outgroups.

MLSA. Due to poor quality of some housekeeping gene sequences, isolates Pta2 and Pnm5 were not included in MLSA and some isolates were analyzed with missing sequences (Table

3.4). Two genes, namely acnA and ProA, were used for analysis of all 13 Bangladeshi soft rot isolates. Individual trees for each gene were made with the isolates and in every case P. carotovorum ssp. carotovorum isolates Pki2, Pke and Pta1 were grouped together. Multilocus sequence analysis demonstrated that the 13 Bangladeshi Pectobacterium isolates clustered in two clades: I and II (Figure 3.6). In clade I, ten Bangladeshi soft rotting Pectobacterium isolates clustered with P. carotovorum ssp. carotovorum reference strains from the

Netherlands, USA, Israel, and Brazil. Moreover, three Bangladeshi Pectobacterium isolates formed together with a 100% bootstrap value-supported group with P. carotovorum ssp. carotovorum reference strain WPP161 from the USA. Pectobacterium carotovorum subspecies carotovorum reference strain Ec106 from Israel grouped with the remaining

Bangladeshi P. carotovorum ssp. carotovorum strains in clade II. The phylogenetic tree placed P. carotovorum ssp. atrosepticum isolate Eca6 separately between clade I and clade II, while two Dickeya outgroup strains Ech586 and Ech1591 clustered together with two other

Yersinia pestis outgroup strains YpCO92 and Yp91001 with a bootstrap value of 100%. In addition, P. carotovorum ssp. brasiliensis strain Ecbr1692 from Israel was placed in clade I with P. carotovorum ssp. carotovorum strains from Bangladesh and reference strains from the

Netherlands, Israel, USA and Brazil.

Virulence of soft rot isolates. All of the 15 isolates caused soft rot on tubers 3 days after inoculation; no soft rot was observed in controls mock-inoculated with sterile water. Mean

71 rotted percentage of potato tubers ranged from 2.7 % to 70 % (Figure 3.7). Pectobacterium carotovorum ssp. carotovorum isolate Pki2 caused a significantly higher percentage (70 %) of tuber rot than all isolates except Pke and the un-inoculated control (P<0.05). Isolates Pke,

Pta1, Pim3, Pnm6, Pjo and Pnm5 also caused significantly more tuber rot than the water control. Eight isolates (Pta2, Pmu6, Pja3, Pta3, Pdh, Pbari7, Psri1 and Pku) as well as the

Ohio isolate, caused less than 20% soft rot of inoculated tubers, which was not significantly different than the water control.

Physiological and biochemical characterization. The results of biochemical and physiological characterization tests for all the isolates are provided in Table 3.5. All were gram negative and oxidase negative and also caused a hypersensitive reaction (HR) on tobacco leaves. They were facultative anaerobes based on the Hugh-Leifson test and negative for arginine dehydrogenase. These isolates produced acid from lactose but not from sorbitol, and did not reduce substances from sucrose. They also were not fluorescent under UV light

(312nm) and were negative for arginine dehydrogenase.

Discussion

Bacterial isolates causing soft rot of potato tubers were collected from Bangladesh and identified and characterized using biochemical, physiological and molecular techniques.

There was significant variation in mean tuber maceration among strains (p<0.05). This study supports the previous study of Laurila et al. (2008), where they found that potato tubers inoculated with soft rot bacteria, some of the strains produced typical soft rot symptoms while some other did not show any symptoms or showed symptoms but did not develop further.

Significant difference was found in their virulence for rotting tubers (p<0.0001).

Though biochemical and phenotypic traits are not accurate in differentiating closely related Pectobacterium ssp. (Toth et al. 1999), in this case all Bangladeshi isolates identified

72 as P. carotovorum ssp. carotovorum in biochemical and physiological tests (Schaad et al.

2001). The isolates were also identified as P. carotovorum ssp. carotovorum based on DNA sequencing methods. Universal rice primer pair EXPCCF and EXPCCR was developed by

Kang et al. (2003) based on repetitive sequences in the rice genome. This primer pair accurately identified all 15 Bangladeshi soft rot isolates as P. carotovorum ssp. carotovorum, although DeBoer et al. (2012) reported that PCR with this primer pair can also amplify P. carotovorum subsp wasabiae (Pcw). 16S rRNA sequence analysis separated the Bangladeshi isolates into two groups, all of which contained P. carotovorum ssp. carotovorum reference strains. One of the groups also contained reference strains of P. carotovorum ssp. brasiliense.

This observation is in agreement with results of a previous study (Meng et al. 2017), in which partial sequence of the 16s rRNA gene could not discriminate the subspecies of

Pectobacterium. In that study, strains of P. carotovorum ssp. brasiliense grouped with P. carotovorum ssp. carotovorum strains.

Housekeeping genes such as aconitate hydrase 1 (acnA), glyceraldehyde-3-phosphate dehydrogenase A (gapA), isocitrate dehydrogenase, specific for NADP+ (icdA), malate dehydrogenase (mdh), glucose-6-phosphate isomerase (pgi) and Gamma-glutamylphosphate reductase (proA) have been shown to differentiate Pectobacterium subspecies into multiple clades (Ma et al. 2007). In MLSA of Bangladeshi isolates, strains from the Netherlands, the

USA, Brazil and Israel were grouped with the Bangladeshi soft rot isolates in two clades.

These results are congruent with those of of Ma et al. (2007), who observed P. carotovorum ssp. carotovorum isolates collected from different locations grouped closely with each other.

They collected isolates from Wisconsin, USA, Brazil and Israel, which clustered in the same clade in MLSA analysis. In this study, a reference strain of Pectobacterium carotovorum ssp. atrosepticum, Eca6, isolated in Canada, located between clade I and clade II and did not group with any of the Bangladeshi soft rot-causing P. carotovorum ssp. carotovorum strains. This

73 finding is similar to the MLSA analysis of Ma et al. (2007). They used P. carotovorum ssp. carotovorum strain Eca6 as a reference strain for analysis of soft rot-causing enterobacterial genera Pectobacterium and Dickeya strains. This strain did not group with any of the

Pectobacterium strains that were collected from different parts of the world.

In previous studies, based on biochemical assays, P. carotovorum ssp. carotovorum and D. dadantii were identified as the causal agents of bacterial soft rot of potato and postharvest soft rot of fruits in Bangladesh (Rahman et al. 2012; Himel et al. 2016). In this study, phylogenetic analysis based on MLSA, grouped the Bangladeshi Pectobacterium isolates in different clades with reference strains originated from Asia, North and South America, Israel and Europe from various host plants including potato, wasabi, cucumber, chicory, pepper, ornamentals, wormwood, and tobacco. This finding confirms that P. carotovorum ssp. carotovorum causes soft rot in a wide range of crops, geographically distributed in different parts of the world. Therefore the presence of this pathogen in soft rotted potato tubers in

Bangladesh is expected and may have economic impacts on production of potato tubers in the future. From the results above based on the morphology, biochemical and physiological characteristics, and molecular analysis, it is likely that P. carotovorum subspecies carotovorum is a major cause of potato soft rot in Bangladesh, although due to the small sample size (15 isolates), it is possible that certain other genera or P. carotovorum subspecies may also have a role in potato tuber soft rot.

Some of the Bangladeshi P. carotovorum ssp. carotovorum strains also caused blackleg symptoms in this study. Blackleg has not yet been reported in Bangladesh, but these results indicate a potential for blackleg under environmental conditions favorable to disease development. To our knowledge this is the first molecular study to identify and characterize the causal agents of bacterial soft rot of potato in Bangladesh.

Acknowledgement

This material is based upon work supported by the United States Agency for International

Development, as part of the Feed the Future initiative, under the CGIAR Fund, award number

BFS-G-11-00002, and the predecessor fund the Food Security and Crisis Mitigation II grant, award number EEM-G-00-04-00013 and by state and federal funds appropriated to The Ohio

Agricultural Research and Development Center, The Ohio State University.

References

Agrios, G. N. 2005. Plant Pathology. 5th Eds. New York: Academic Press, Harcourt Brace Jonanovich, Publishers. Avrova, A. O., Hyman L. J., Toth R. L., and Toth I. K. 2002. Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi. Appl. Environ. Microbiol. 68:1499. Baghaee-Ravari, S., Rahimian, H., Shams-Bakhsh, M., Lopez-Solanilla, E., Antunez-Lamas, M., and Rodriguez-Palenzuela, P. 2011. Characterization of Pectobacterium species from Iran using biochemical and molecular methods. Euro. J. Plant Pathol. 129:413-425. Anonymous. 2011. Bangladesh Bureau of Statistics (BBS). Yearbook of Agricultural Statistics of Bangladesh. Chapter 02: Summary crop statistics and crop indices. http://www.bbs.gov.bd/userfiles/Image/ArgYearBook11/Chapter-2.pdf. Benitez, M. S., and Gardener, B. B. McSpadden. 2009. Linking sequence to function in soil bacteria: sequence-directed isolation of novel bacteria contributing to soilborne plant disease suppression. Appl. Environ. Microbiol. 75:915-924. Cardoza, Y. F., Duarte, V., and Lopes, C. A. 2017. First report of blackleg of potato caused by Dickeya solani in Brazil. Plant Dis. 101:243-243. Cazelles, O., and Schwarzel, R. 1992. Survey of bacterial diseases caused by Erwinia in seed potato fields in western Switzerland. Revue Suisse d’ Agriculture. 24:215–8. Cupples D., and Kelman, A. 1974. Evaluation of selective media for isolation of soft-rot bacteria from soil and plant tissue. Phytopathology 64: 468-475.

Czajkowski, R., Perombelon, M., Jafra, S., Lojkowska, E., Potrykus, M., van der Wolf, J., and Sledz, W. 2015. Detection, identification and differentiation of Pectobacterium and Dickeya species causing potato blackleg and tuber soft rot: a review. Anna. Appl. Biol. 166:18-38.

De Boer, S. H., Verdonck, L., Vruggink, H., Harju, P., Bang, H. O., and Ley, J. D. 1987. Serological and biochemical variation among potato strains of Erwinia carotovora ssp.

75 atroseptica and their taxonomic relationship to other E. carotovora strains. J. Appl. Bacteriol. 63:487–495.

De Boer, S. H., Li, X., and Ward, L. J. 2012. Pectobacterium spp. associated with bacterial stem rot syndrome of potato in Canada. Phytopathology 102:937-947. de Haan E. G., and Van Den Bovenkamp, G. W. 2009. Test development in Erwinia at the NAK: BioPlex real-time PCR. Gewasbescherming 40:172-175. De Lindo, L., French, E. R., and Kelman, A. 1978. Erwinia spp. pathogenic to potatoes in Peru. Am. Potato J. 55:383 (abstract). Duarte, V., De Boer, S. H., Ward, L. J., and De Oliveira, A. M. R. 2004. Characterization of atypical Erwinia carotovora strains causing blackleg of potato in Brazil. J. Appl. Microb. 96:535–545. Eden, P. A., Schmidt, T. M., Blakemore, R. P., and Pace, N. R. 1991. Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction-amplified 16S rRNA- specific DNA. Int. J. Syst. Bacteriol. doi:10.1099/00207713-41-2-324. PMID 1854644.

Fujimoto, T., Yasuoka, S., Aono, Y., Nakayama, T., Ohki, T. Sayama, M., and Maoka, T. 2017. First report of potato blackleg caused by Pectobacterium carotovorum ssp. brasiliense in Japan. Plant Dis. 101:241-242. Gardan, L., Gouy, C., Christen, R., and Samson, R. 2003. Elevation of three subspecies of Pectobacterium carotovora to species level: Pectobacterium atrosepticum sp. nov., Pectobacterium betavasculorum sp. nov. and Pectobacterium wasabiae sp. nov. Int. J. Syst. Evol. Micr. 53:381–391. Gillis, A., Santana, M. A., Rodrigue, M., and Romay, G. 2017. First report of bell pepper soft rot caused by Pectobacterium carotovorum ssp. brasiliense in Venezuela. Plant Dis. https://doi.org/10.1094/PDIS-03-17-0361-PDN. Golkhandan, E., Kamaruzaman, S., Sariah, M., Abidin, M. A. Z., and Nasehi, A. 2013. Characterization of Malaysian Pectobacterium spp. from vegetables using biochemical, molecular and phylogenetic methods. Euro. J. Plant Pathol. 137:431-443. Golkhandan, E., Kamaruzaman, S., Sariah, M., Zainal Abidin, M. A., and Nasehi, A. 2013. Characterization of Pectobacterium carotovorum causing soft rot on Kalanchoe gastonis- bonnierii in Malaysia. Arch. Phytopathol. and Plant Pro. 46:1809-1815. Hadas, R., Kritzman, G., Gefen, T., and Manulis, S. 2001. Detection, quantification and characterization of Erwinia carotovora ssp. carotovora contaminating pepper seeds. Plant Pathol. 50:117–123. Hauben, L., Moore, E. R., Vauterin, L., Steenackers, M., Mergaert, J., Verdonck, L., and Swings, J. 1998. Phylogenetic position phytopathogens within Enterobacteriaceae. Syst. Appl. Microbiol. 21:384–397. Himel, R. M., khan, A. A., Akanda, A. M., and Karim, M. 2016. Characterization and identification of soft rot bacterial pathogens of different fruits in Bangladesh. Intl. J. Biosci. 9:1-9.

Jiang, H. H., Hao, J. J., Johnson, S. B., and Brueggeman, R. S., and Secor, G. 2016. First report of Dickeya dianthicola causing blackleg and bacterial soft rot on potato in Maine. Plant Dis. 100:2320. Kang, H. W., Kwon, S. W., and Go, S. J. 2003. PCR based specific and sensitive detection of Pectobacterium carotovorum ssp. carotovorum by primers generated from a URP PCR fingerprinting derived polymorphic band. Plant Pathol. 52:127-133. Kwon, S. W., Go, S. J., Kang, H. W., Ryu, J. C., and Jo, J. K. 1997. Phylogenetic analysis of Erwinia species based on 16S rRNA gene sequences. Int. J. Syst. Bacteriol. 47:1061–1067. Li, P., Wu, X. X., Wang, Z. Y., Ho, H. H., Wu, Y. X., Mao, Z. C. and He,Y. Q. 2012. First Report of Ralstonia solanacearum causing bacterial wilt of yacon in china. Plant Dis. 96:904.

Laurila, J., Ahola, V., Lehtinen, A., and Pirhonen. M. 2008. Characterization of Dickeya strains isolated from potato and river water samples in Finland. Euro. J. Plant Pathol. 122:213–25. Li, G .J., Dong, Q. E., Ma, L., Huang, Y., Zhu ,M. L., Ji, Y. P., Wang, Q. H., Mo, M. H. and Zhang, K. Q. 2014. Management of Meloidogyne incognita on tomato with endophytic bacteria and fresh residue of Wasabia japonica. J. Appl. Microbiol. 117:1159-1167. Lojkowska, E., and Kelman, A. 1994. Comparison of the effectiveness of different methods of screening for bacterial soft rot resistance of potato tubers. Am. J. potato Res. 71:99–113.

McNally, R. R., Webster, R. D., and Robinson, A. P. 2017. First report of Pectobacterium carotovorum ssp. brasiliensis causing blackleg and stem rot in commercial and seed potato fields in Minnesota and North Dakota. Plant Dis. 101:1672.

Ma, B., Hibbing, M. E., Kim H. S., Reedy, R. M., Yedidia, I., Breuer. J., Breuer. J., Glasner, J. D., Perna N. T., Kelman. A., and Charkowski, O. A. 2007. Host range and molecular phylogenies of the soft rot enterobacterial genera Pectobacterium and Dickeya. Phytopathology 97:1150-1163.

Madden, L. V., Hughes, G., and van den Bosch, F. 2007. The study of plant disease epidemics. St. Paul: American Phytopathological Society. Masum, M. M. I., Islam, S. M. M., Islam, M. S., and Kabir, M. H. 2013. Estimation of loss due to post harvest diseases of potato in markets of different districts in Bangladesh. Afr. J. Biotechnol. 10:11892-11902. Meng, X.-L., Xie, X.-W., Shi, Y.-X., Chai, A.-L., Ma, Z.-H. and Li, B.-J. 2017. Evaluation of a loop-mediated isothermal amplification assay based on hrpZ gene for rapid detection and identification of Pseudomonas syringae pv. lachrymans in cucumber leaves. J. Appl. Microbiol. 122:441–449. Minsavage, G. V., Thompson, C. M., Hopkins, D. L., Leite, R., and Stall, R. E. 1994. Phytopathology 84:456–461. Nabhan, S., Wydra, K., Linde, M. and Debener, T. 2011. The use of two complementary DNA assays, AFLP and MLSA for epidemic and phylogenetic studies of pectolytic enterobacterial strains with focus on the heterogeneous species Pectobacterium carotovorum. Plant Pathol. 61:498–508.

Ngadze, E., Coutinho, T. A., and van der Waals, J. E. 2010. First report of soft rot potatoes caused by Dickeya dadantii in Zimbabwe. Plant Dis. 94:1263. Parent, J.-G., Lacroix, M., Page, D., and Vezina. L. 1996. Identification of Erwinia carotovora from soft rot diseased plants by random amplified polymorphic DNA (RAPD) analysis. Plant Dis. 80:494–499. Pasco, C., Bozec, M., Ellisseche, D., and Andrivon, D. 2006. Resistance behavior of potato cultivars and advanced breeding clones to tuber soft rot caused by Pectobacterium atrosepticum. Potato Res. 49:91-98. Perombelon, M. C. M. 2002. Potato diseases caused by soft rot Erwinias: an overview of pathogenesis. Plant Pathol. 51:1-12. Perombelon, M. C. M., and Kelman A. 1980. Ecology of the soft rot Erwinias. Annu. Rev. Phytopathol. 18:361-387. Rahman, M. M., Ali, M. E., Khan, A. A., Hashim, U., Akanda, A. M., and Hakim, M. A. 2012. Characterization and identification of soft rot bacterial pathogens in Bangladeshi potatoes. Afr. J. Microbiol. Res. 6:1437-1445. Rasul, M. G., Islam, M. S., and Sheikh, M. H. R. 1999. Storability of different potato varieties under natural condition. Bang. J. Sc. and Ind. Res. 34:86-90. Samson, R., Legendre, J. B., Christen, R., Fischer-Le Saux, M., Achouak, W. and Gardan, L. 2005. Transfer of Pectobacterium chrysanthemi (Burkholder et al., 1953) Brenner et al., 1973 and Brenneria paradisiaca to the genus Dickeya gen. nov. known as Dickeya chrysanthemi comb. nov and Dickeya paradisiaca combi. nov. and delineation of four novel species, Dickeya dianthi sp nov., Dickeya dianthicola sp. nov., Dickeya dieffenbachiae sp. nov. and Dickeya zeae sp. nov. Int. J. Syst. and Evol Microbiol. 55:1415–1427. Schaad, N. W., Jones, J. B., and Chun, W (Eds.). 2001. Laboratory guide for identification of plant pathogenic bacteria (Vol. 373). Minnesota: APS press. She, X. M., He, Z. F., Tang, Y. F., du, Z. G., and G. B. Lan. 2013. First report of potato blackleg disease caused by Pectobacterium atrosepticum in Guangdong China. Plant Dis. 97:1652. Slawiak, M., van Doorn, R., Szemes, M., Speksnijder, A. G. C. L., Waleron, M., van der Wolf, J. M., Lojkowska, E., and Schoen, C. D. 2013. Multiplex detection and identification of bacterial pathogens causing potato blackleg and soft rot in Europe, using padlock probes. Ann. Appl. Biol. 163:378–393. Sledz, W., Jafra, S., Waleron, M., and Lojkowska, E. 2000. Genetic diversity of Erwinia carotovora strains isolated from infected plants grown in Poland. EPPO Bulletin. 30:403–407. Smith, C., and Bartz, J. A. 1990. Variation in the pathogenicity and aggressiveness of strains of Erwinia carotovora ssp. carotovora isolated from different hosts. Plant Dis. 74:505–509. Tamura, K., J. Dudley., M. Nei., and S. Kumar. 2007. MEGA 4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596–1599.

Tian, Y., Zhao, Y., Xie, H., Wang, X., Fan, J., and Hu, B. 2015. First report of bacterial soft rot of Seleng wormwood caused by Pectobacterium carotovorum ssp. carotovorum in China. Plant Dis. 99:1175. Toth, I. K., van der Wolf, J. M., Saddler, G., Lojkowska, E., Helias, V., Pirhonen, M., Tsror, L., and Elphinstone, J. G. 2011. Dickeya species: an emerging problem for potato production in Euro. J. Plant Pathol. 60:385–399. van der Merwe, J. J., Coutinho, T. A., Korsten, L., and van der Waals, J. E. 2010. Pectobacterium carotovorum ssp. brasiliensis causing blackleg on potatoes in South Africa. Euro. J. Plant Pathol. 126:175–185. Van Der Wolf, J. M., Nijhuis, E. H., Kowalewska, M. J., Saddler, G. S., Parkinson, N., Elphinstone, J. G., and Waleron, M. 2014. Dickeya solani sp. nov., a pectinolytic plant- pathogenic bacterium isolated from potato (Solanum tuberosum). Int. J. Syst. Evol. Microbiol. 64: 768-74.

Waleron, M., Waleron, K., and Lojkowska, E. 2014. Characterization of Pectobacterium carotovorum ssp. odoriferum causing soft rot of stored vegetables. Euro. J. Plant Pathol. 139:457–469. Wright-Dobrzeniecka, Sandra. 1989. A comparative study of methods for diagnosing bacterial stem and leaf rot of dieffenbachia and potato blackleg, and an evaluation of their possible application in the potato micro-propagation programme. Page 88. Sveriges lantbruksuniversitet, Institutionen för växt-och skogsskydd, Wyenandt, Andy. 2016. Plant and pest advisory, Rutgers cooperative extension. https://plant- pest-advisory.rutgers.edu/dickeya-dianthicola-update-81016. Xia, Z. Y., and Mo, X. H. 2007. Occurrence of blackleg disease of tobacco caused by Pectobacterium carotovorum ssp. carotovorum in China. Plant Pathol. 56:348.

Figure 3.1. Origins of bacterial soft rot of potato tuber isolates collected in Bangladesh.

Figure 3.2. Blackleg disease progress curves for potato seedlings inoculated with one of five Pectobacterium carotovorum ssp. carotovorum isolates at 108 CFU/mL, over a period of 6 days. DPI = days post inoculation.

50 Psri1 40 Pmu6 severity severity (%) 30 Pta3 Pke

20 Disease Pta2 10 Control

0 1DPI 2DPI 3DPI 4DPI 5DPI 6DPI

Disease progress curves were developed based on disease severity, using a 0-3 scale where 0 = no symptoms, 1= 50% of the plant had blackleg symptoms, 2= > 50% of the plant had blackleg symptoms and 3= plant completely dead.

Figure 3.3. Boxplot of blackleg disease progression in seedlings of the potato variety Russet Burbank inoculated with one of five Pectobacterium carotovorum ssp. carotovorum isolates shown as area under the disease progress curve (AUDPC) values. Diamonds represent the mean of the treatments (p<0.05). Means that do not share a letter are significantly different. Horizontal lines indicate the median of the treatments.

600 ab a a

e 500 ab

s s 400

g b

e 300

r 200

r 100 A c

Control Pke Pmu6 Psri1 Pta2 Pta3 Pectobacterium carotovorum subsp. carotovorum isolate

Area under disease progress curve (AUDPC) was based on disease severity on a scale of 0-3, where 0= no symptoms, 1= 50% of the plant had blackleg symptoms, 2= > 50% of the plant had blackleg symptoms and 3= plant completely dead. Area under the disease progress curve (AUDPC) was calculated for each isolate using this disease severity scale. Area under the disease progress curve values were calculated according to the (풙풊+풙풊−ퟏ) formula: ∑([ ]) (푡푖 − 푡푖 − 1), where x is the rating at each evaluation time and (t -t ) is the number of ퟐ i i i-1 days between evaluations (Madden et al. 2007).

Table 3.1. Bacterial soft rot reference strains used in this study.

Source/host Reference or Strain Location Accession no. plant source

Wasabia Ry31 China KC790298 Li et al. (2014) japonica

Nicotiana Xia and Mo DQ China DQ333384 tabacum (2007)

Solanum P1 China KC695819 She et al. (2013) tuberosum

Solanum P2 China KC695820 She et al. (2013) tuberosum

Golkhandan et Sp2 Cucumis sativus Malaysia KC189038 al. (2013)

Golkhandan et Sp3 Cucumis sativus Malaysia KC189039 al. (2013)

Solanum Fujimoto et al. Kbs-1 Japan LC146474 tuberosum (2017)

Artemisia Tian et al. BGZ-1 China absinthium KP274903 (2015)

Capsicum Gillis et al. AGpim1G Venezuela KY711431 annum (2017)

Ozturk and A27G3 Solanum Turkey tuberosum KY114490 Aksoy (2017) Van Der Wolf et NCPPB 4575 Solanum Netherland al. (2014) tuberosum KF639914

Smallanthus LYP China HQ 176322 Li et al. (2012) sonchifolius Solanum Ecc71 Netherland Ma et al. (2007) tuberosum EF550936

Solanum Ecbr1692 Brazil EF550943 Ma et al. (2007) tuberosum

Solanum Ec87 Israel Ma et al. (2007) tuberosum EF550959

Solanum Ecc380 USA Ma et al. (2007) tuberosum HM157150

Solanum Wpp161 USA Ma et al. (2007) tuberosum EF550950

Solanum Eca6 Canada Ma et al. (2007) tuberosum EF550939

Orthinogalum Ec106 Israel Ma et al. (2007) spp. EF550957

Philodendron Ech586 USA Ma et al. (2007) schott CP001836

Ech1591 Zea mays USA CP001655 Ma et al. (2007)

YpCO92 Yersinia pestis USA CP009973 Ma et al. (2007)

Yp91001 Yersinia pestis USA EF550896 Ma et al. (2007)

Table 3.2. Pectobacterium carotovorum ssp. carotovorum isolates recovered from cultivars of potato in Bangladesh.

No. Strain Source Potato Location GenBank cultivar accession no.

1 Pnm5 Market Lal pakri Mymensingh KX098362

2 Pnm6 Market Lal pakri Mymensingh KX098363

3 Pim3 Storage Lal pakri Mymensingh KX280717

4 Pjo Storage Khati lal Joypurhat KX098355

5 Pki2 Market Lal pakri kishoreganj KX098357

6 Psri1 Storage Diamant Srimangal KX098364

7 Pdh Market Diamant Dhaka KX098353

8 Pke Market Diamant Dhaka KX098356

9 Pta1 Storage Asterix Tangail KX098365

10 Pta2 Storage Courage Tangail KX098366

11 Pta3 Storage Diamant Tangail KX098367

12 Pja3 Market Asterix Jamalpur KX098354

13 Pmu6 Market Asterix Munshiganj Ku945635

14 Pbari7 Storage Diamant Jessore KX098352

15 Pku Market Asterix Kushtia KX098358

Table 3.3. Primers used for subspecies-specific PCR, 16s rRNA gene sequencing and multilocus sequence analysis.

Primer Sequence (5'-3') Expected Reference band size

Subspecies- EXPCCF GAA CTT CGC ACC GCC GAC 550-bp Kang et al. specific CTT CTA (2003) PCR EXPCCR GCC GTA ATT GCC TAC CTG 550-bp Kang et al. CTT AAG (2003)

16s rRNA 8F AGAGTTTGATCCTGGCTCAG 1400-bp Eden et al. gene (1991) sequencing 1492R GGTTACCTTGTTACGACTT 1400-bp Eden et al. (1991)

Multilocus acnA3F CMA GRG TRT TRA TGC ARG 300-bp Ma et al. sequence AYT TTA C (2007) analysis acnA3R GAT CAT GGT GGT RTG SGA 300-bp Ma et al. RTC VGT (2007)

gapA326 ATC TTC CTG ACC GAC GAA 450-bp Ma et al. F ACT GC (2007)

gapA845 ACG TCA TCT TCG GTG TAA 450-bp Ma et al. R CCC AG (2007)

icdA400 GGT GGT ATC CGT TCT CTG 520-bp Ma et al. F AAC G (2007)

icdA977 TAG TCG CCG TTC AGG TTC 520-bp Ma et al. R ATA CA (2007)

mdh86F CCC AGC TTC CTT CAG GTT 460-bp Ma et al. CAG A (2007)

mdh628R CTG CAT TCT GAA TAC GTT 460-bp Ma et al. TGG TCA (2007)

pgi815F TGG GTC GGC GGC CGT TAC 520-bp Ma et al. TC (2007)

pgi1396R TGC CTT CGA ATA CTT TGA 520-bp Ma et al. ACG GC (2007)

Primer Sequence (5'-3') Expected Reference band size proAF1 CGG YAA TGC GGT GAT TCT 630-bp Ma et al. GCG (2007) proAR1 GGG TAC TGA CCG CCA CTT C 630-bp Ma et al. (2007)

Table 3.4. Housekeeping gene sequences used in multilocus sequence analysis of Pectobacterium carotovorum ssp. carotovorum strains isolated from potato tubers in Bangladesh. Sequences used in the analyses are indicated with “+”, while sequences not used due to poor quality are indicated with “-“.

Strain acnA gapA icdA mdh pgi proA

Pnm6 + + - - + +

Pim3 + + + + - +

Pjo + + + - + +

Pki2 + + + + - +

Psri1 + + + + + +

Pdh + + + + - +

Pke + + + + - +

Pta1 + + + + - +

Pta3 + + + - + +

Pja3 + + + + - +

Pmu6 + + + + + +

Pbari7 + + + + + +

Pku + + - + + +

Figure 3.4. Amplification of DNA sequences from Bangladeshi soft rot bacterial isolates by PCR using Pectobacterium carotovorum ssp. carotovorum (Pcc)-specific primer pair EXPCCF and EXPCCR. Bacterial strains: Ohio isolate SM171-10 was used as a positive control (lanes 1 and 13); lane 2 Pnm5; lane 3 pnm6; lane 4 Pim3; lane 5 Pjo; lane 6 Pki2; lane 7 Psri1; lane 8 Pdh; lane 9 Pke; lane 10 Pta1; lane 11 Pta2; lane 12 Pta3; lane 15 Pmu6; lane 17 Pbari7; lane 19 Pku and lane 23 Pja3. Lanes 14, 16, 18, 20 and 21 unidentified bacteria isolated from potato tubers in Bangladesh that did not cause tuber soft rot; lane 22 nuclease- free water (negative control). L denotes 1 kb-DNA ladder.

Expected band 550-bp

Figure 3.5. Phylogenetic tree showing evolutionary relationships among 15 Pectobacterium carotovorum ssp. carotovorum isolates based on 16s rRNA gene sequencing using the maximum likelihood method. The bootstrap consensus tree was inferred from 1000 replicates. Dickeya sp. and Ralstonia solanacearum were used as outgroups for this study. Bangladesh Pectobacterium carotovorum ssp. carotovorum isolates are labeled with black triangles. Pcb: Pectobacterium carototvorum ssp. brasiliensis; P. atrosepticum: Pectobacterium atrosepticum; D. solani: Dickeya solani; R. solanacearum: Ralstonia solanacearum.

Clade I

Clade II

Figure 3.6. Molecular phylogenetic analysis using the maximum likelihood method with concatenated sequences of the housekeeping genes acnA, gapA, icdA, mdh, pgi and proA. The number at each node is the bootstrap support value based on 1000 replicates. The names of Pectobacterium carotovorum subspecies carotovorum clades I-II are marked on vertical lines; Bangladesh isolates are labeled with a black triangle in the phylogenetic tree.

Clade I

Clade II

Figure 3.7. Relative virulence based on fresh weight of rotted potato tuber tissue caused by Pectobacterium carotovorum ssp. carotovorum Bangladeshi strains and comparison strain SM171-10 (Ohio; positive control). The error bars indicate standard errors for three replications. Bars with the same letters are not significantly different (p<0.05).

a 70

60 ab 50 bc (%) 40 bcd bcd

tissue 30 cde cdefdefg defg 20 defg Rotted efg efg 10 efg efg fg fg g 0

Isolate

Table 3.5. Physiological and biochemical characteristics of Pectobacterium carotovorum ssp. carotovorum isolates collected from soft rot-infected potato tubers in Bangladesh. The symbols + and – indicate positive and negative responses, respectively, for the tested strains. Strain Sm171-10 (Ohio) is the positive control. Sterilized distilled water was used as a negative control in the tobacco hypersensitive reaction (HR) test.

Pectobacterium Potato Blackleg Gram Oxidase Tobacco Growth at Pits carotovorum soft rot reaction hypersensitivity 37ºC on ssp. (3% (24 hr after CVP carotovorum KOH) inoculation) isolates Pki2 + - - - + + + Pta1 + - - - + + + Pim3 + - - - + + + Pnm6 + - - - + + + Pke + - - - + + + Pjo + - - - + + + Pnm5 + - - - + + + Pja3 + - - - + + + Pdh + - - - + + + Pbari7 + - - - + + + Pku + + - - + + + Pmu6 + + - - + + + Psri1 + + - - + + + Pta2 + + - - + + + Pta3 + + - - + + + Sm171-10 + + - - + + + Continued

Table 3.5. Continued

Pectobacterium Lactose Sucrose Sorbitol Fluorescent Arginine Hugh- Subspecies carotovorum utili- utili- utili- on dehydroge Leifson -specific ssp. zation zation zation Pseudomonas -nase test test PCR carotovorum agar F (PF) isolates medium Pki2 + - - - - + + Pta1 + - - - - + + Pim3 + - - - - + + Pnm6 + - - - - + + Pke + - - - - + + Pjo + - - - - + + Pnm5 + - - - - + + Pja3 + - - - - + + Pdh + - - - - + + Pbari7 + - - - - + + Pku + - - - - + + Pmu6 + - - - - + + Psri1 + - - - - + + Pta2 + - - - - + + Pta3 + - - - - + + Sm171-10 + - - - - + +

Chapter 4

Integrated Management of Blackleg of Potato and Evaluation of Potato Varieties for Resistance to Bacterial Soft Rot Caused by Pectobacterium carotovorum ssp. carotovorum

Abstract. To develop an integrated blackleg management program for Bangladesh, two concentrations (3% and 5%) of chitosan combined with two concentrations (3g/3kg soil and

5g/3kg soil) of gypsum (CaSo4) fertilizer and Trichoderma harzianum BTH-N1were applied in greenhouse trials in the Department of Plant Pathology, Bangladesh Agricultural Research

Institute (BARI), Gazipur, Bangladesh. The widely grown potato variety BARI Alu 7

(Diamant) was used as the test variety. Trichoderma harzianum BTH-N1 was screened in in vitro against the blackleg pathogen Pectobacterium carotovorum ssp. carotovorum strain

Pmu6. Treatment of tubers with T. harzianum BTH-N1 reduced blackleg severity compared to the non-treated control when applied alone or in combination with chitosan (3%) or gypsum

(3g/3kg soil). The highest level of disease reduction was recorded for tubers treated with chitosan 3% + T. harzianum BTH-N1. Ten BARI-released potato varieties exhibited different levels of soft rot severity when they were inoculated with the highly virulent soft rot causing strain Pectobacterium carotovorum ssp. carotovorum Pki2. BARI Alu 25 was the most resistant to soft rot, while the recently released potato varieties BARI Alu 72 and BARI Alu

41 were the most susceptible. Calcium (p<0.05) but not dry matter percentage of tubers was correlated with soft rot ranking in these varieties. A regression analysis involving both calcium percentage and dry matter percentage showed that rotted tissue percentage varies with the increases and decreases of calcium percentage (p<0.05) but not with the dry matter percentage changes.

Introduction

Potato tuber soft rot causes yield losses both in field and storage in Bangladesh (Rasul et al. 1999). This disease is characterized by tuber and/or stem degradation by pectinolytic bacteria in the genera Pectobacterium, Dickeya, Pseudomonas and Clostridium. Rotted tissue is initially white in color and creamy, later turning brown due to oxidation. A characteristic foul odor typically develops, related to secondary bacterial colonization (Perombelon 1992;

Perombelon et al. 1979). Pectobacterium and Dickeya spp. can cause blackleg in the stems of potato seedlings (Perombelon 2002). The three main blackleg-causing pathogens are

Pectobacterium carotovorum ssp. carotovorum, Pectobacterium atrosepticum and Dickeya spp. (van der wolf and De Boer 2007). These gamma-proteobacteria bacteria are pectinolytic, gram negative, facultative anaerobic, and rod shaped. Pectobacterium carotovorum ssp. carotovorum has a wide host range and infects both seedlings and tubers in tropical and temperate regions, whereas P. atrosepticum only infects plants in temperate regions. While blackleg has not been reported to date in Bangladesh, the potential for the disease in potato- growing areas is real; one-third of Pectobacterium carotovorum ssp. carotovorum isolates recovered from soft-rotted potatoes from multiple regions of Bangladesh also caused blackleg symptoms in growth chamber trials (Chapter 3).

Blackleg causes inky black discoloration and soft rot in the stem of potato seedlings.

Other symptoms of blackleg include yellow wilted leaves and stunting. The leaves of infected plants may also be stiff and small. Pathogens can be transmitted from infected mother tubers to daughter tubers and may remain latent until environmental conditions are favorable for bacterial growth (Reiter et al. 2002). Different genera of pectinolytic bacteria can be isolated from a single sample. Blackleg pathogens penetrate host plants through wounds or lenticels.

The bacteria move in surface water on tubers and disseminate by aerosols and irrigation water

(Perombelon 1992).

Several attempts have been made to develop effective strategies to manage blackleg in the field. Seed certification approaches can be highly effective, however certification systems are lacking in many countries. Some other approaches such as environment management in storage and sanitation in the field reduce bacterial inoculum from the tubers. Crop rotations for up to 3-8 years can eliminate pathogens from the soil (Czajkowski et al. 2012). Effective management requires reliable, inexpensive tactics readily available to growers. However, due to lack of availability of appropriate inputs and information, growers in Bangladesh have few options to manage blackleg bacteria in the field and storage. Physical seed treatments such as hot water treatment have been used to kill superficial pathogens but may negatively affect tuber health and shoot emergence. According to Mackay and Shipton (1983), P. carotovorum ssp. carotovorum and P. atrosepticum were not detected in tuber peels after treatment of potato tubers in water for 10 min at 55ºC, and in a field experiment plants from treated tubers did not show blackleg symptoms. However, depending on potato variety and physiology, sprouting could be delayed or tubers could be killed outright; as a result yield reduction might occur (Robinson and Foster 1987). Bonde and de Souza (1954) reported that the antibiotic dihydro-streptomycin sulfate along Terramycin hypochloride immersion of tubers before planting reduced blackleg in the field and seed decay in storage. While streptomycin formulations are labeled for use in the United States for seed potato treatment to manage soft rot and blackleg (http://www.cdms.net/ldat/ld315001.pdf), application of antibiotics for the management of most bacterial diseases is not allowed in Bangladesh. Recently the antibiotic product KROSIN-AG 10SP (Streptomycin sulphate 9% + Tetracycline hydrochloride 1%,

McDonald Crop Care Ltd.) has received registration for use in Bangladesh to manage bacterial wilt of brinjal (eggplant). This is a systemic bactericide imported from India (Krishi

Roshayan Exports Private Ltd., India; personal communication with agent, McDonald Crop

Care Ltd.). However, no information is available regarding the efficacy of this product against

97 blackleg or soft rot of potato, or possible registration for use in crops in addition to brinjal in

Bangladesh.

Researchers in many countries have started applying new biochemical and biocontrol agents along with certain elements to manage this disease in the field and in storage (El

Hadrami et al. 2010; Colyer and Mount 1984). Chitosan, made from chitin of crab shells, supplies secondary metabolites to plant organs (O’Herlihy et al. 2003). Chitosan has been shown to be effective against soft rot of stored potato tubers (Makhlouf and Abdeen 2014).

Helander et al. (2001) reported that chitosan can disrupt the intracellular layer of enterobacteria and increase cellular leakage.

Biological control of blackleg and soft rot could be an alternative to physical and chemical control methods (Lal et al. 2016). Biocontrol agents such as Pseudomonas fluorescens, Bacillus subtilis and Rahnella aquatilis singly or in combination reduced blackleg severity under both greenhouse and field conditions (Hendawy et al. 2016).

According to des Essarts et al. (2016), a combination of Pseudomonas putida strain PA14H7 and P. fluorescens strains PA3G8 and PA4C2 repeatedly decreased severity of blackleg and also decreased D. dianthicola on progeny tubers. Bacteria such as fluorescent and non- fluorescent Pseudomonas, Bacillus and Rhodococcus spp. can break down N-acyl homoserine lactonases (AHL) that are responsible for quorum sensing in P. carotovorum sub. carotovorum (Jafra et al. 2006). Some other antagonistic properties of Pseudomonas spp. are iron competition, 2, 4-diacetylphloroglucinol (DAPG), antibiotic synthesis via pyoverdine and pseudobactin relevant receptor production (De Weger et al. 1986; Cronin et al. 1997). Species of the biocontrol fungus Trichoderma also have been used to control post-harvest diseases of fruits and vegetables. Trichoderma harzianum reduced soft rot on potato tubers and also increased vegetative characteristics such as plant height, number of leaves per plant and yield

(Abd-El-Khair et al. 2007). This species of Trichoderma, along with other Trichoderma

98 species such as T. atroviridae, increased potato growth parameters such as stolon number and yield and reduced the percentage of Rhizoctonia-infested solons (Hicks et al. 2014). Elad et al.

(1980) reported that T. harzianum had lytic activity against mycelia and significantly reduced bean diseases caused by Sclerotium rolfsii and Rhizoctonia solani. To manage blackleg and soft rot in the field and storage, sustainable integrated management strategies including biocontrol as a component should be developed.

Calcium fertilizer strengthens the texture and structure of potatoes in the growing period of tubers. It can significantly reduce blackleg and soft rot of tubers (McGuire and

CO2 and ethylene production, sugar content and also total acid content of post-harvest crops

(Antunes et al. 2005). However, calcium is not equally distributed through potato plants, and tubers especially have low levels of calcium (Dunn and Rost 1945). Gypsum (CaSO4) added to soil-increased resistance against not only blackleg of plants but also soft rot of daughter tubers (Bain et al. 1996). Some studies have shown that tubers with higher calcium content have lower soft rot potential than tubers with lower calcium content (Bartz et al. 1992;

McGuire and Kelman 1984).

Conventional screening could be the best way to identify sources of resistance to soft rot to incorporate into potato breeding programs in Bangladesh. However, there are many factors that influence the resistance of potato to soft rot, including water potential, ambient oxygen status, reducing sugar content, electrolyte leakage, dry matter content, age of tubers and storage conditions (Gnanamanickam 2006). Dry matter content is an important factor that determines the resistance to soft rot bacteria in tubers (McGuire and Kelman 1984; Tzeng et al. 1990). Earlier studies showed that increased calcium content reduced the probability of

99 potato soft rot incidence in storage (Tzeng et al. 1990). However, little is known about the resistance of Bangladeshi potato varieties and there are no soft rot-resistant commercial varieties available on the market. This research will identify the degree of resistance in potato varieties currently available in Bangladesh to bacterial soft rot bacteria. Potato breeders can then include moderately resistant or resistant potato germplasm in varietal improvement programs. In this project, calcium concentration and dry matter content of tubers was quantified to determine any correlation with susceptibility of tubers to soft rot caused by P. carotovorum ssp. carotovorum. The objectives of this study were:

1. To determine the effect of different treatments, alone and in combination, on blackleg

development and severity in potato;

2. To assess the level of resistance to soft rot caused by P. carotovorum ssp.

carotovorum in Bangladesh Agricultural Research Institute (BARI)-released potato

varieties; and

3. To determine the impact of calcium and dry matter content on the resistance of potato

tubers to soft rot.

Materials and Methods

Bacterial strains. Two strains of P. carotovorum ssp. carotovorum recovered from potato tubers in Bangladesh in 2015 were used in this study. The identity of the strains as P. carotovorum ssp. carotovorum was confirmed using a combination of biochemical, molecular and plant-based tests (Chapter 2). Strain P. carotovorum ssp. carotovorum Pmu6 causes both soft rot of potato tubers and blackleg and was selected for blackleg management experiments.

Strain P. carotovorum ssp. carotovorum Pki2 is highly virulent on potato tubers, causing soft rot, and was selected to evaluate potato varieties for soft rot resistance.

100

In vitro antagonism assay. Three Trichoderma spp., namely T. harzianum BTH-N1, T. viridae BTV-N1 and T. virens BTVI-N1) were provided by the Plant Pathology section of the

Horticulture Research Centre (HRC) of Bangladesh Agricultural Research Institute (BARI).

Trichoderma harzianum strain BTH-N1 has been shown to be antagonistic towards the soil borne pathogens Sclerotium rolfsii, Pythium sp., Rhizoctonia sp., Fusarium sp. and root knot nematodes in cabbage (Nahar et al. 2012). Antagonism of these biocontrol agents against P. carotovorum ssp. carotovorum Pmu6 was evaluated using a confrontation assay

(Arunachalam and Sharma 2012). Pectobacterium carotovorum ssp. carotovorum Pmu6 was grown on Luria-Bertani agar (LBA) medium for 2 days. Bacterial suspensions were prepared and adjusted with sterile water to an optical density (OD) of 0.2 at 600nm (108 Colony

Forming Units (CFU)/mL) and concentrations were checked by dilution plating on LBA medium (Subedi, 2015). Bacterial lawns were prepared by spreading 50 µL bacterial inoculum on LBA medium. Trichoderma spp. were grown on potato dextrose agar (PDA) medium for 7 days, then 5-mm disks were cut from the periphery of the colonies. After bacterial lawns were dried in a laminar flow hood for 5 min, one disk of Trichoderma spp. was placed in the center of each lawn and incubated in the dark for 5 days at 28ºC. Bacterial lawns without Trichoderma served as controls. After 5 days of incubation, the diameter of the clear inhibition zone around the Trichoderma plug was measured. Each assay was replicated three times and the experiment was repeated once. Data for the two experiments are combined since in Levene’s test for equality of variances was not significant (p>0.05).

Preparation of Trichoderma harzianum inoculum. Prior to inoculation potato tubers were surface sterilized with 0.5 % sodium hypochlorite and dried for 2 hrs. Pre-sprouted potato tubers were cut and tubers were mixed with T. harzianum BTH-N1 prepared as follows: A 10 mL suspension (107conidia/mL) was prepared by adding sterilized distilled water to 7-days- old T. harzianum BTH-N1 cultures grown on PDA, incubated at 28° C for 7 days. Wheat

101 grains were, previously sterilized by autoclaving at 121°C twice and 15 lbs. They were dried and grounded to fine powder followed by filling in autoclavable bags. Inoculum containing

PDA was cut into small pieces and added with the fine wheat powder. The inoculum was mixed with potato tubers at the rate of 10g BTH-N1/kg tuber (Srivastava et al. 2016).

Preparation of chitosan solution. Water-soluble chitosan was sourced online from China

(Qingdao Yuda Century Economy and Trade Co. Ltd, China). Sterilized distilled water was used to make 3% and 5% chitosan solutions (3g/100mL, 5g/100mL), which were kept for 12 hours at room temperature to form a uniform solution (pH 5.5). Full size sprouted potato tubers were surface sterilized (using 70% ethanol for two min) and were dried under laminar air flow for 10 min. Potato tubers were cut into half and submerged in the chitosan solution for 30 min, then air-dried and sown in steam-sterilized loamy soil.

Gypsum fertilizer. Different doses (3g and 5 g) of gypsum (CaSO4) fertilizer were added to 3 kg soil per pot along with basal doses of fertilizers (1.2 g N, P and K). The treatments were as follows: T1= gypsum 3g/3kg soil; T2= gypsum 5g/3 kg soil; T3= T. harzianum BTH-N1;

T4= gypsum 3g/3 kg soil+ BTH-N1; T5= chitosan 3%; T6= chitosan 5%; T7= chitosan 3%+

BTH-N1; T8= gypsum 3g/3 kg soil + BTH-N1 + chitosan 3% and T9= Non-amended control.

Experimental site. This experiment was conducted in the greenhouse of the Division of Plant

Pathology, BARI, Gazipur in January 2017. Temperatures ranged from 17-25°C. The widely grown Bangladeshi soft rot susceptible potato variety BARI Alu -7 (Diamant) was used as the test variety. Nine treatments were evaluated in a randomized complete block design (RCBD) with three replications, with four pots containing three seedlings each per replication. The pots were overhead irrigated twice regularly using a hose during the growing period. After 4 weeks, all three seedlings in each pot were inoculated in the base of the stem with

Pectobacterium carotovorum ssp. carotovorum strain Pmu6 as described in Chapter 2. The

102 experiment was repeated once. Data for the two experiments are combined since in Levene’s test for equality of variances was not significant (p>0.05).

Disease incidence and severity: The blackening of the shoot of the potato seedlings that originate from mother tubers is the main symptom of blackleg of potato (Perombelon and

Kelman 1980). Disease severity percentage was assessed based on a scale developed by

Wright et al. (2005) and data were recorded from 3 to 12 days after pathogen inoculation at 3 day intervals. In the scale 0= no symptoms of blackening on the stem, 1= less than 50% of the stems have blackening symptoms, 2= more than 50% of the stems have blackening symptoms, and 3= plants are dead. Area under the disease progress curves (AUDPC) was calculated

(풙풊+풙풊−ퟏ) based on blackleg percent severity according to the formula: ∑([ ]) (푡푖 − 푡푖 − 1), where ퟐ

푥푖 is the rating at each evaluation time and (ti-ti-1) is the number of days between evaluations.

Evaluation of potato varieties for resistance to soft rot caused by Pectobacterium carotovorum ssp. carotovorum

Bacterial inoculum preparation and tuber inoculation. Pectobacterium carotovorum ssp. carotovorum Pki2 was streaked on LBA medium and incubated at 28° C for 48 hours. Several single colonies were picked from pure cultures and inoculated into 5 mL LB broth medium and incubated at 28° C for 48 hours. The concentrations of bacterial suspensions were adjusted to 108 CFU/mL and checked by dilution plating as described above. Tubers of ten

BARI potato varieties harvested at the same time in February 2017 were collected from storage, where the potatoes are kept at 2.5° C, in June 2017. Twelve randomly selected tubers from each variety were washed with 0.5% sodium hypochlorite. Bacterial inoculum was stirred with a magnetic stirrer to avoid sedimentation. Two wells, 5 mm in diameter x 5 mm deep, were made in different sites on each tuber using a sterilized metal screw. A 50 µL aliquot of P. carotovorum ssp. carotovorum Pki2 inoculum was placed in each well and the

103 wells were wrapped with parafilm. Four randomly selected tubers from each variety mock- inoculated with sterilized distilled water served as a negative control. After inoculation, tubers were placed in moistened plastic containers in the dark for 3 days at 28° C (Pasco et al. 2006;

Reeves et al. 1999). After incubation tubers were weighed, rotted tuber tissue was separated from healthy tissue with a spatula and the fresh weight of the rotten portion was measured in grams and later converted to percentage (Pasco et al. 2006). The experiment was replicated three times and repeated once. Data from the two experiments were combined since in

Levene’s test for equality of variances was not significant (p>0.05).

Determination of calcium and dry matter content of potato tubers. Four tubers from each potato variety were peeled, cut into thin slices, weighed and dried at room temperature. Potato slices were oven dried at 65° C for 2 days and mixed all the replications sample of each variety together to make sufficient sample. Samples were digested with H2SO4 and H2O2

(Thomas et al. 1967) weighed. Dry matter percentage was calculated following the formula:

Dry matter % = (dry weight/fresh weight) x100

Dried potato samples were sent to the Department of Soil Science, BARI, Bangladesh to measure the percentage of calcium in medullar tissues using flame atomic absorption spectrometry following a wet digestion method (Habib et al. 2004).

Data analysis. Data were tested to ensure that they met normality requirements. MINITAB

16 software was used for the general linear model where rotted tissue was the response and variety was the model. Differences in means were assessed using Tukey’s range test with an error rate of α=0.05. To see the correlation between percent tuber calcium concentration/percent dry matter of tuber and soft rotted potato tuber (%), Pearson’s correlation coefficient was done. Regression analysis equation was generated considering both percent dry matter and percent calcium conc. on soft rot severity.

104

Results

In vitro antagonism of P. carotovorum ssp. carotovorum by Trichoderma spp. Trichoderma harzianum BTH-N1, T. viridae BTV-N1 and T. virens BTVI-N1 produced zones of inhibition significantly larger than the non-challenged control on lawns of P. carotovorum ssp. carotovorum Pmu6 in vitro (Figure 4.1). Inhibition of Pmu6 was significantly higher by T. harzianum BTH-N1 than by T. virens BTVI-N1 but similar to that of T. viridae BTV-N1.

Integrated management of blackleg of potato. Treatments containing T. harzianum BTH-

N1 alone or combined with gypsum (3g/3kg soil), or with chitosan (3%) significantly reduced the AUDPC for blackleg severity compared to the non-treated control (Figure 4.2).

Treatments with either rate of gypsum were also effective in reducing blackleg severity.

Neither rate of chitosan alone nor chitosan (3%) combined with the low rate of gypsum and

BTH-N1 reduced blackleg severity compared to the control. There were no significant differences in blackleg severity among the effective treatments.

Susceptibility of BARI potato varieties to soft rot of potato. All ten potato varieties tested showed tuber soft rot damage 3 days after inoculation. There were statistically significant differences among the potato varieties in soft rot disease severity (p<0.05) (Table 4.1). Mean soft rot of potato tuber tissue ranged from 7.7% (BARI Alu 25) to 38.5% (BARI Alu 72).

BARI Alu 25 exhibited significantly less damage than observed in the four most susceptible varieties (BARI Alu 53, BARI Alu 63, BARI Alu 41 and BARI Alu 72), but percentage soft rot was statistically similar to that observed in varieties BARI Alu 08, BARI Alu 07, BARI

Alu 62, BARI Alu 46 and BARI Alu 73.

The percentage of tuber calcium ranged from 0.8 – 1.2% in the ten potato varieties tested, and differences among varieties were significant (p=0.001) (Table 4.1). Eight varieties contained statistically similar calcium percentages ranging from 0.9 – 1.2%, while calcium

105 content was lowest for BARI Alu 63 and BARI Alu 46 at 0.8%. In an analysis of the relationship of percentage of rotted tissue and percentage of tuber calcium, the correlation coefficient (r=-0.506) was statistically significant (p<0.05).

Percentage tuber dry matter ranged from 15.0 (BARI Alu 62) – 22.3% (BARI Alu 41), and differences among varieties were significant. BARI Alu 7, BARI Alu 63, BARI Alu 25,

BARI Alu 8 and BARI Alu 72 were relatively high in dry matter percentage, whereas the

BARI Alu 53, BARI Alu 46 and BARI Alu 73 were relatively low in dry matter percentage.

However, the correlation coefficient (r=0.278) for the relationship of rotted tissue and dry matter was not statistically significant (p=0.137). The regression model considering both calcium and dry mater percentage was significant (p<0.05) at 5 % significance level.

The regression model is: Rotted tissue (%) = 22.7 + 0.819 Dry matter (%) - 23.6 Ca%

Discussion

Pectobacterium species and subspecies cause blackleg on potato stems and soft rot of tubers. Blackleg is characterized by decay and discoloration at the base of the plants. Once the pathogens become established in plants, they may propagate through vascular vessels to daughter tubers (Czajkowski et al. 2012). With the aim of developing an integrated management package for blackleg of potato, the biocontrol agent T. harzianum isolate BTH-

N1, chitosan and gypsum fertilizer, singly or in combination, were tested for efficacy in reducing disease severity after inoculation of potato stems with a strain of P. carotovorum ssp. carotovorum (Pmu6) that causes both soft rot and black leg in potato.

Trichoderma spp., including the three species evaluated in this study, are known to have biocontrol activity against soil borne plant pathogens (Mukherjee et al. 1995). Highly toxic hydrolytic enzymes (antibiotics) have been identified in Trichoderma spp., however, a

106 recent study indicated that antibiosis may not the primary mechanism of biocontrol. The biochemical cross-talk between Trichoderma spp. and plant roots also plays a significant role in reducing plant diseases. Trichoderma spp. produces bioactive metabolites that induce a degree of resistance against pathogens (Lorito et al. 2010). In this study, Trichoderma harzianum strain BTH-N1 was used but little information is available about its mode of action. This isolate has been shown to reduce losses in cabbage seedbeds to soil borne fungal and oomycetes pathogens when applied with compost, but the mechanism of biocontrol was not determined (Nahar et al. 2012). We demonstrated antagonism of T. harzianum BTH-N1 against P. carotovorum ssp. carotovorum in the form of a zone of inhibition of bacterial growth in vitro. However, the mechanism of antagonism, such as antibiotic production, competition, parasitism, or production of cell wall degrading enzymes (Chaur-Tsuen Lo.1998) was not determined. Since a significant reduction in blackleg severity was demonstrated in plants inoculated with P. carotovorum ssp. carotovorum Pmu6 in stems that emerged from tubers previously inoculated with T. harzianum BTH-N1, it is possible and perhaps likely that induced resistance is also involved in the disease suppression observed. Further studies to assess the role of induced resistance in potato plants in this interaction could include transcriptome and proteome analysis (Harman 2005).

In this study, all three Trichoderma species (T. harzianum, T. viridae and T. virens) tested in vitro caused a zone of inhibition in lawns of P. carotovorum ssp. carotovorum.

Trichoderma spp. are widely applied to crop plants worldwide to manage plant diseases as well as to promote plant growth (Lorito et al. 2010). Numerous application methods have been developed, including seed bio priming, seedling dip, soil application and wound drenching (Srivastava et al. 2016). Though the zone of inhibition of Trichoderma harzianum

BTH-N1 was not significantly different than BTV-N1, in both tricho-compost and tricho- leachate form, this biocontrol Trichoderma agent BTH-N1 reduced 98% seedling mortality of

107 cabbage caused by Sclerotium rolfsii and in BTH-N1 treated seedbed only Pythium has been detected as soil-borne pathogen whereas in the untreated control plot had several pathogens such as, Rhizoctonia, Sclerotium and Fuasarium along with Pythium (Nahar et al. 2012).

However, no information regarding the efficacy of BTV-N1 was available in published literature.

Inhibition zone on lawns of P. carotovora ssp. carotovora by T. harzianum BTH-N1 was larger than T. virens BTVI-N1. Trichoderma harzianum is a very effective biocontrol agent that can increase seed emergence, plant height, and seed vigor indices of vegetables

(Uddin et al. 2011). According to Lorito et al. (2010), Trichoderma enhances nutrient availability in soil and helps with nutrient uptake for the plants. It also increases plant respiration and thus increases photosynthetic activity. Trichoderma spp. were found to be effective against bacterial species at various concentrations (Leelavathi et al. 2014).

Trichoderma harzianum in combination with chitosan was shown to inhibit spore germination and colony formation of fungi (Chittenden and Singh 2009). In addition, in acidic conditions

(

(Pectobacterium) and increases defense responses including phytoalexin accumulation in plants (Rabea et al. 2003). It has been reported that chitosan increases the permeability of outer and inner bacterial membranes and as a result bacterial cell wall damage occurs (Hui et al. 2004). However, in this study no treatments containing chitosan reduced blackleg severity compared to the non-treated control while all the treatments containing gypsum alone or in combination with T. harzianum BTH-N1 reduced disease severity compared to non-amended control. Trichoderma species singly or in combination with other Trichoderma species or other amendments perform better with respect to yield-contributing characters and plant disease such as diseased stolons of potato and seedling damping off of cotton (Howell et al.

2007; Hicks et al. 2014).

108

Calcium plays important role in blackleg and soft rot development. High calcium content in plants often provides protection against bacterial diseases including blackleg

(Ngadze et al. 2014). Higher calcium content in potato seed tubers resulted in lower blackleg and soft rot incidence caused by P. atrosepticum (McGuire and Kelman, 1984). In this experiment, we also found that treatments including gypsum alone or in combination with T. harzianum BTH-N1 decreased blackleg disease progress compared to the non-treated control.

This finding is supported by those of Berry et al. (1988), in which the severity of bacterial canker of tomato was negatively correlated with calcium at 100 ppm or higher dose in the nutrient solution.

Since disease free and or disease-resistant potato varieties, true potato seed, good aeration in storage, and roguing during the growing season are also critical in reducing disease severity in the field and storage, application of chitosan, calcium fertilizer and the biocontrol agent Trichoderma alone cannot be expected to manage blackleg and soft rot at economically acceptable levels. However, they can contribute to an integrated disease management program. Beausejour et al. (2003) reported that the combination of chitosan with Streptomyces melanosporofaciens strain EF-76 was an effective method of controlling scab of potato in the field. This treatment reduced scab incidence and symptoms in field conditions. Another study conducted by Walker et al. (2004) reported that chitosan application was used successfully to manage powdery mildew of tomato and increased yield of tomato by 20%. Since biochemical chitosan did not perform well in this study, it could be used to determine any effect on growth- and yield-contributing characters of potato. According to Kowalski et al. (2007) application of soluble chitosan to potato plants in in vitro and ex vitro increase total number of mini tubers and yield.

We observed variation in the susceptibility of tubers of ten different varieties of potatoes released from the BARI breeding program. This variation in susceptibility is

109 supported by the previous work of Reeves et al. (1999) who reported that different level soft rot incidence and weight reduction in potato tubers when they were inoculated with soft rot pathogens. In our study, no varieties were fully resistant to soft rot. Naturally soft rot-immune potato varieties are not known; rather some partially resistant potato cultivars are available

(Lyon 1989). This may be due to a narrow range of genetic variation in the tubers (Tzeng et al. 1990). According to Hijmans and Spooner (2001), a large amount of useful genetic material present in more than 200 wild Solanum species of Europe, and North and South

America, which includes resistance to soft rot bacteria, could be used to develop soft rot resistant potato cultivars. Therefore a wide range of potato varieties and potential resistance sources should be included in future screening programs. In addition, disease resistance of potato varieties varies season to season (Perombelon and Salmond 1995). Field evaluations over several consecutive years may be needed to identify potato varieties with meaningful levels of resistance to soft rot (Pasco et al. 2006). The ability to identify blackleg and soft rot resistance reliably depends on many factors such as inoculation method, presence or absence of oxygen, and laboratory and field conditions, as well as weather conditions in different seasons (Czajkowski et al. 2011).

Calcium is an integral part of the cell wall and membrane of potato tubers and tubers with higher calcium content are less susceptible to pectinolytic bacteria than those with low calcium content (McGuire and Kelman 1986). In this study a significant negative correlation was found between tuber susceptibility and calcium percentage in tubers. This observation is supported by those of Pagel and Heitefuss (1989), who indicated that there is a consistent relationship between calcium content of tissues and soft rot susceptibility of potato cultivars.

Other factors such as sugar content, oxygen level (McGuire and Kelman 1984; 1986) and starch content should also be studied to determine their relationship to resistance to soft rot.

110

Dry matter percentage of potato tubers may be a source of variability in the evaluation process of potato varieties for resistance to soft rot (Tzeng et al. 1990). Biehn et al. (1972) reported that potato varieties with a relatively high amount of dry matter were generally less susceptible to soft rot than those with lower dry weights. In another study, Wright et al.

(2010) reported that soft rot severity increased with increasing dry matter content in the tuber.

In our study, there was no significant correlation between dry matter content and severity of soft rot was recorded. Although this type of information is helpful for breeders, and the varieties that show partial resistance could be used in varietal evaluation programs, information on additional factors such as water status on the tuber surface, high relative humidity and temperature, anaerobic condition of storages (Bourne et al. 1981) are needed. A multiple regression analysis was generated including both percentage of calcium conc. and percentage of dry matter. Here we found that percent calcium conc. has negative significant association whereas percent dry matter has positive non-significant association with percent rotted tissue.

This study was conducted twice in one season with a limited number of potato varieties. Nevertheless, as there is no previous information regarding the resistance of BARI potato varieties against soft rot of tubers, the information will be useful to potato growers in

Bangladesh. It may be suggested that the use of partially resistant potato varieties combined with T. harzianum BTH-N1 tuber inoculation and gypsum fertilizer can contribute to effective integrated blackleg and soft rot management in the region.

Acknowledgement

This material is based upon work supported by the United States Agency for International

Development, as part of the Feed the Future initiative, under the CGIAR Fund, award number

BFS-G-11-00002, and the predecessor fund the Food Security and Crisis Mitigation II grant,

111 award number EEM-G-00-04-00013 and by state and federal funds appropriated to the Ohio

Agricultural research and Development Center, The Ohio State University.

References

Abd-El-Khair, H., and Karima, H. E. H. 2007. Application of some bactericides and bioagents for controlling the soft rot disease in potato. Res. J. Agril. and Biol. Sc. 3:463-473.

Antunes, M. D. C., Panagopoulos, T., Rodrigues, S., Neves, N., and Curado, F. 2005. The effect of pre and postharvest calcium applications on ‘Hayward’ kiwi fruit storage ability. Acta Hortic. 682:909-916.

Arunachalam, M. K., and Sharma, P. 2012. Confrontation assay for Trichoderma as a potential biocontrol agent against Pythium aphanidermatum and Sclerotinia sclerotiorum. Pest Management in Horticultural Ecosystem 18:74-77.

Bain, R., Millard, P., and Perombelon, M. 1996. The resistance of potato plants to Erwinia carotovora ssp. atroseptica in relation to their calcium and magnesium content. Potato Res. 39:185–93.

Bartz, J. A., Locascio, S. J., and Weingartner, D. P. 1992. Calcium and potassium fertilization of potatoes grown in North Florida. II. Effect on the bacterial soft rot potential in the tubers. Am. Potato J. 69:39-50.

Beausejour J., Clermont N., and Beaulieu, C. 2003. Effect of Streptomyces melanosporofaciens strain EF-76 and of chitosan on common scab of potato. Plant and Soil. 256: 463–468.

Berry, S. Z., Madumadu, G. G., and Uddin, R. M. 1988. Effect of calcium and nitrogen nutrition on bacterial canker disease of tomato. Plant and Soil. 112:113–20.

Biehn, W. L., Sands, D. C., Hankin, L. 1972. Relationship between percent dry matter content of potato tubers and susceptibility to bacterial soft rot. Phytopathology 62:747 (Abstract).

Bonde, R., and de Souza, P. 1954. Studies on the control of potato bacterial seed-piece decay and blackleg with antibiotics. Am. J. Potato Res. 31:311–6.

Bourne, W. E., McCalmont D.C., and Wastie, R. L. 1981. Assessing potato tubers for susceptibility to bacterial soft rot (Erwinia carotovora subsp, atroseptica). Potato Res. 24:409-15.

Colyer, P. D., and Mount, M. S. 1984. Bacterization of potatoes with Pseudomonas putida and its influence on postharvest soft rot diseases. Plant Dis. 68:703-706.

Cronin, D., Moenne-Loccoz, Y., Fenton, A., Dunne, C., Dowling, D. N., and O’Gara, F. 1997. Ecological interaction of a biocontrol Pseudomonas fluorescens strain producing 2,4-

112 diacetylphloroglucinol with the soft rot potato pathogen Erwinia carotovora ssp. atroseptica. FEMS Microbiol. Ecol. 23:95-106. Czajkowski, R., Perombelon, M. C. M., van Veen, J. A., and van der Wolf, J. M. 2012. Control of blackleg and tuber soft rot of potato caused by Pectobacterium and Dickeya species: a review. Plant Pathol. 60:999-1013.

Des Essarts, Y. R., Cigna, J., Quetu-Laurent, A., Caron, A., Munier, E., Beury-Cirou, A., Helias, V., and Faure, D., 2016. Biocontrol of the potato blackleg and soft rot diseases caused by Dickeya dianthicola. Appl. Environ. Microbiol. 82:268-278.

De Weger, L. A., van Boxtel, R., Van derr Burg, B., Gruters, R. A., Geels, F. P., Schippers, B., Lugtenberg, B. 1986. Siderophores and outer membrane proteins of antagonistic, plant growth-stimulating root colonizing Pseudomonas spp. J. Bacteriol. 165:585-594.

Dunn, L., and Rost, C. 1945. Effect of fertilizers on the quality of potatoes grown in the Red River Valley of Minnesota. Am. J. Potato Res. 22:173–87.

El Hadrami, A., Adam, L. R., El Hadrami, I., and Daayf, F. 2010. Chitosan in plant protection. Marine Drugs. 8:968-987.

Elad, Y., Chet, I., and Henis, Y. 1979. Trichoderma harzianum: A biocontrol agent effective against Sclorotium rolfsii and Rhizoctonia solani. Phytopathology 70:119-121.

El-Hendawy, H. H., and Abo-Elyousr, K. A. M. 2016. Combination of different antagonistic bacteria to control of potato blackleg disease caused by Pectobacterium atrosepticum under greenhouse and field conditions. Int. J. Phytopathol. 1:35-43.

Essarts, Y. R., Cigna, J., Quetu-Laurent, A., Caron, A., Munier, E., Beury-Cirou, A., Helias, V., and Faure, D. 2016. Biocontrol of the potato blackleg and soft rot diseases caused by Dickeya dianthicola. Appl. and Environ. Microbiol. 82:268-278.

Gnanamanickam, S. S. (Ed.). 2006. Plant-associated bacteria (Vol. 1). Netherlands: Springer.

Habib, A., Abdulnour, J., and Donnelly, D. J. 2004. Potato Res. 47:139. https://doi- org.proxy.lib.ohio-state.edu/10.1007/BF02735980.

Harman, G. E. 2006. Overview of mechanisms and uses of Trichoderma spp. Phytopathology 96:190-194.

Helander, I. M., Nurmiaho-Lassila, E. L., Ahvenainen, R., Rhoades, J., and Roller, S. 2001. Chitosan disrupts the barrier properties of the outer membrane of Gram-negative bacteria. Int. J. Food Microbiol. 71:235–244.

Hicks, E., Bienkowski, D., Braithwaite, M., Mc Lean, K., Falloon, R., and Stewart, L. 2014. Trichoderma strains suppress Rhizoctonia diseases and promote growth of potato. Phytopathologia Mediterranea 53:502-514.

Hijmans, R. J., and Spooner, D. M. 2001. Geographic distribution of wild potato species. Am. J. Botany. 88:2101–12.

113

Howell, C. R. 2007. Effect of seed quality and combination fungicide–Trichoderma spp. seed treatments on pre- and postemergence damping-off in cotton. Phytopathology 97:66-71

Jafra, S., Przysowa, J., Czajkowski, R., Michta, A., Garbeva, P., and van der Wolf, J.M. 2006. Detection and characterization of bacteria from the potato rhizosphere degrading N-acyl- homoserine lactone. Can. J. Microbiol. 52:1006–15.

Kastelein, P., Schepel, E., Mulder, A., Turkensteen, L., and Van Vuurde, J. 1999. Preliminary selection of antagonists of Erwinia carotovora ssp. atroseptica (Van Hall) dye for application during green crop lifting of seed potato tubers. Potato Res. 42:161-71. Kowalski, B., Terry, F. J., Herrera, L., and Penalver, D. A. Potato Res. 2006. 49: 167. https://doi.org/10.1007/s11540-006-9015-0.

Kratzke, M. G., and Palta, J. P. 1986. Calcium accumulation in potato tubers: role of the basal roots. Hor.t Science. 21:1022-1024.

Lal, M., Yadav, S., Singh, V., and Nagesh, M. 2016. The use of bioagents for management of potato diseases. In. Plant Growth. InTech. DOI: 10.5772/64853. Available at: https://www.intechopen.com/books/plant-growth/the-use-of-bio-agents-for-management-of- potato-diseases.

Leelavathi, M. S., Vani, L., and Reena, Pascal. 2014. Antimicrobial activity of Trichoderma harzianum against bacteria and fungi. Intl. J. Cur. Micro. and Appl. Sc. 3:96-103.

Lo, C. 1998. General mechanisms of action of microbial biocontrol agents. Plant Pathology Bulletin. 7:155-166.

Lorito, M., Woo, S. L., Harman, G. E., and Monte, E. 2010. Translational research on Trichoderma: from 'omics to the field. Annu. Rev. Phytopathol. 48:395–417. Lyon, G. D., Lund, B. M., Bayliss, C. E., and Wyatt, G. M. 1975. Resistance of potato tubers to Erwinia carotovora and formation of rishitin and phytuberin in infected tissue. Physiol. Plant Pathol. 6:43-50. Mackay, J. M., and Shipton, P. J. 1983. Heat treatment of seed tubers for control of potato blackleg (Erwinia carotovora ssp. atroseptica) and other diseases. Plant Pathol. 32:385-393. Makhlouf, A. H., and Abdeen. R. 2014. Investigation on the effect of chemical and biological control of bacterial soft rot disease of potato in storage. J. Biol. Agri. and Healthcare. 4:31-44.

McGuire, R, G., and Kelman, A. 1986. Calcium in potato tuber cell walls in relation to tissue maceration by Erwinia carotovora pv. atrosepticum. Phytopathology 76:401-406.

McGuire, R. G., and Kelman, A. 1984. Reduced severity of Erwinia soft rot in potato tubers with increased calcium content (Doctoral dissertation, University of Wisconsin Madison).

Mukherjee, P. K., Mukhopadhyay, A. N., Sharma, D. K., and Shrestha, S. M. 1995. Comparative antagonistic properties of Gliocladium virens and Trichoderma harzianum on Sclerotium rolfsii and Rhizoctonia solani, its relevances to understanding the mechanisms of biocontrol. J. Phytopathol. 143:275-279.

114

Nahar, M. S., Rahman, M. A., Kibria, M. G., Rezaul Karim, A. N. M., and Miller, S. A. 2012. Use of Trichocompost and Tricho-leachate for management of soil-borne pathogens and production of healthy cabbage seedlings. Bangladesh J. Agril. Res. 37:653-664.

Ngadze, E., Brady, C. L., Coutinho, T. A., and van der Waals, J. E. 2012. Pectinolytic bacteria associated with potato soft rot and blackleg in South Africa and Zimbabwe. Euro. J. plant pathol. 134:533-549.

Pagel, W., and Heitefuss, R., 1989. Calcium content and cell wall polygalacturonans in potato tubers of cultivars with different susceptibilities to Erwinia carotovora ssp. atroseptica. Physiol. Mol. Plant Path. 35:11-21.

Perombelon, M. C. M. 2002. Potato diseases caused by soft rot Erwinias: an overview of pathogenesis. Plant Pathol. 51:1–12.

Perombelon, M. C. M., and Salmond, G. P. C. 1995. Bacterial soft rots. In:Singh US, Singh RP, Kohmoto K, eds. Pathogenesis and Host Specificity in Plant Diseases, Vol. 1. Prokaryotes. Oxford, UK: Pergamon. 1–20.

Perombelon, M. C. M. 1992. Potato blackleg: epidemiology, host-pathogen interaction and control. Neth. J. Plant Pathol. 98:135–146.

Perombelon, M. C. M., and A. Kelman. 1980. Ecology of the soft rot Erwinias. Annu. Rev. Phytopathol. 18:361–387.

Perombelon, M. C. M., Gullings-Handley, J., and Kelman, A. 1979. Population dynamics of Erwinia carotovara and pectolytic Clostridia in relation to decay of potatoes. Phytopathology 69:167-173.

Rasul, M. G., Islam, M. S., and Sheikh, M. H. R. 1999. Storability of different potato varieties under natural condition. Bang. J. Sc. and ind. Res. 34:86-90.

Reeves, A. F., Olanya, O. M., Hunter, J. H., and Wells, J. M. 1999. Evaluation of potato varieties and selections for resistance to bacterial soft rot. Am. J. Potato Res. 76:183-189.

Robinson, K., and Foster, G. 1987. Control of potato blackleg by tuber pasteurisation: the determination of time-temperature combinations for the inactivation of pectolytic erwinia. Potato Res. 30:121–5.

115

Srivastava, M., Kumar, B. Shahid, M., Pandey, S., and Singh, A. 2016. Trichoderma- a potential and effective bio fungicide and alternative source against notable phytopathogens: A review. Afr. J. Aca. Res. 11:310-316.

Subedi, N. 2015. Characterization and management of Ralstonia solanacearum populations in South Asia (Doctoral dissertation, The Ohio State University).

Thomas, R. L., Sheard, R. W., and Moyer, J. R. 1967. Comparison of conventional and automated procedures for nitrogen, phosphorus, and potassium analysis of plant material using a single digestion. Agronomy Journal 59:240-243.

Tzeng, K-C., McGuire, R., and Kelman, A. 1990. Resistance of tubers from different potato cultivars to soft rot caused by Erwinia carotovora ssp. atroseptica. Am. J. Potato Res. 67:287–305.

Uddin, M. M., N. Akhtar., Islam, M. T., and Faruq, A. N. 2011. Effect of soil application with Trichoderma harzianum and some selected soil amendments against damping-off disease complex of potato and chili. The Agriculturists 9:106-116. van der Wolf, J. M., and De Boer, S. H. 2007. Bacterial pathogens of potato. In: Vreugdenhil D, ed. Potato Biology and Biotechnology: Advances and Perspectives. Delft, the Netherlands: Elsevier 595-617.

Walker R., Morris S., Brown P., and Gracie, A. 2004. Evaluation of potential for chitosan to enhance plant defense. A Report for the Rural Industries Research and Development Corporation, Australia, RIRDC Publication No. 04.

Wright, P. J., Triggs, C. M., and Anderson, J. A. D. 2005. Effects of specific gravity and cultivar on susceptibility of potato (Solanum tuberosum) tubers to blackspot bruising and bacterial soft rot. New Zeal. J. Crop and Hort. 33:353-361.

116

a ab

20 b ) 15 10 c 5 0

BTH-N1 BTV-N1 BTVI-N1 Control Inhibition zone (mm zone Inhibition

Pectobacterium carotovorum subsp. carototvorum

117

Variety Percent rotted tissue Percent tuber calcium Percent dry matter

BARI Alu 63 21.3 bc 0.8 c 21.2 ab BARI Alu 53 18.4 bcd 1.0 abc 18.7 bc BARI Alu 08 10.1 de 1.2 a 20.7 ab BARI Alu 62 11.9 cde 1.0 abc 15.0 d BARI Alu 25 7.7 e 1.1 ab 20.9 ab BARI Alu 41 26.5 b 1.0 abc 22.3 a BARI Alu 72 38.5 a 0.9 abc 20.4 ab BARI Alu 46 12.6 cde 0.8 bc 17.3 cd BARI Alu 73 13.9 cde 1.2 a 16.9 cd BARI Alu 07 10.2 de 0.9 abc 21.5 a p value <0.05 <0.05 <0.05

118

e abc ab a abcd

v r 550 bcde u de

c 500 bcde s cde

r 450 e

r 400

e 350

e 300

l l l

r i i % 1 % o o o % 1 1

e N r N N 3 - 5 t s s 3 - - d n n H n o g g n H H n a T a k k a T T s B s C 3 3 s B B u / /

o o o it + it g g it + a h % h 5 3 h il e C 3 C C o r m m s n u u + A s g sa s p 1 k o p y N 3 it y G - / h G H g C T 3 B m + u il s so yp G kg /3 g 3 m su yp Treatment G

119

Chapter 5

Biological Control of Potato Blackleg Disease

Abstract. Potential antagonism of 41 previously characterized Pseudomonas spp. strains against Pectobacterium carotovorum ssp. carotovorum was investigated and five

Pseudomonas spp. strains were selected based on in vitro inhibition of P. carotovorum ssp. carotovorum growth and their previous performance on disease reduction. To assess the colonization on potato tubers by selected Pseudomonas strains, rifampicin-resistant mutants were developed and their stability was confirmed by sequential passages on antibiotic-free medium. There were no significant differences among the growth curves of wild-type (wt) and rif+ mutants (p>0.05), but there were statistically significant differences between the populations (log10 CFU/g) of the rif+ mutants and their wild types immediately and 2 weeks after bacterization (p<0.05). Pseudomonas spp. were tested for ability to suppress blackleg of potato; plants were inoculated at 4 weeks old with two blackleg-causing P. carotovorum ssp. carotovorum strains, Pmu6 and Pta2. In first two experiments, where P. carotovorum ssp. carotovorum strain Pmu6 was inoculated, there were no significant differences in reduction of blackleg severity among the treatments (p=0.132). In two other experiments, where P. carotovorum ssp. carotovorum strain Pta2 was inoculated, no significant differences were also observed among the means of the treatments (p=0.568 and p=0.978 respectively).

120

Introduction

Pectobacterium species cause soft rot, blackleg and stem rot of many crops including potato and a wide range of vegetables and ornamentals (Charkowski 2015). Multiple

Pectobacterium species infect potato plants and more than one species can be found in potato plants or in fields at a time (Kim et al. 2009). These diseases cause serious economic losses to potato seed and production industries. The total amount of losses annually may amount to $50

- 100 million on a worldwide basis (Perombelon and Kelman 1980). Pectobacterium causes characteristic decay symptoms in plants by secreting enzymes that degrade the cell wall and middle lamella of leaves, stems, tubers and roots. Blackleg inoculum originates from infected seed tubers, and high temperatures and rainfall favor the development of this disease. The disease proliferates very quickly; plant tissues break down and heavy loss of the standing potato crop are incurred (Bhat et al. 2010). The pathogen moves to progeny tubers through the vascular system but these bacteria do not necessarily cause blackleg in the next generation; they can survive in the latent form (Czajkowski et al. 2011). Blackleg of potato also can be initiated from airborne inoculum sources such as insect vectors and aerosols produced by rain impaction on infected plants (Perombelon 1992). Blackleg pathogens also survive in surface water used for irrigation and can be transmitted through mechanical means. Most importantly, contamination occurs during grading and handling of commercially produced tubers diseased tubers prior to and during storage, which may result in transmission of the pathogen (Laurila et al. 2008; Perombelon and van der Wolf 2002).

Several approaches have been practiced to manage blackleg but the results are variable. Blackleg can be reduced using disease-free potato tubers, sanitation, physical methods (hot water treatment, steam treatment) and certain fungicides. The mother tuber is an

121 important source of blackleg and soft rot bacteria. To minimize the loss due to these diseases, in vitro minituber production has been emphasized. Minitubers are grown in controlled environments in aeroponic, hydroponic or other artificial soil systems in order to prevent contamination by soft rot pathogens (Stead 1999). Pectobacterium spp. may survive in weeds, soil and surface water (Charkowski 2015). Roguing is suggested to eliminate weeds, infected plants or tubers during the growing season.

Crop rotation can effectively reduce the incidence of diseases. Three to eight years crop rotation helps to eliminate blackleg and soft rot pathogens from soil (Czajkowski et al.

2011). Crop rotation is most effective when potatoes are rotated with a leguminous crop or grain crop such as corn (Ma et al. 2007). Hot water and steam treatment are simple and easy techniques to reduce pathogen infection and have been used in many countries, but this method is not suitable to treat thousands of kg of seed potatoes (Czajkowski et al. 2011). Soil fumigants such as methyl bromide and antibiotic treatment of tubers have been used to manage blackleg of potato. However, fumigants have deleterious effects on the environment and methyl bromide has been banned in many potato-producing regions. Treatment with antibiotics gave promising results but the risk of development of resistant bacterial pathogens is high and a threat to human and animal health (Guan et al. 2005). Copper sprays can reduce the spread of soft rot bacteria and the severity of blackleg caused by Pectobacterium during the growing season (Kubheka et al. 2013). Once the disease is established in the field, however, options for management are limited.

Potato seed certification has been followed for more than a century in Europe and is common in other developed regions to minimize disease transmission. However, this method is unpredictable for blackleg and heavily dependent on the prevailing environment during the potato-growing season. Latent infection of potato tubers from symptomless plants can occur, and depending on the weather conditions the plants may not develop any symptoms

122

(Czajkowski 2011). In addition, still there are no commercially available potato cultivars highly resistant to blackleg or soft rot.

Biological control of plant diseases is the result of one or more types of antagonism of an agent against the causal pathogens. Mechanisms of antagonism include antibiotic production, competition, parasitism, or production of cell wall degrading enzymes (Lo 1998).

Initial identification of potential antagonists is usually based on in vitro screening of bacteria to identify strains that inhibit pathogen growth. These selected bacterial agents are then applied in vivo and disease suppression is assessed (Czajkowski et al. 2011). Fluorescent and non-fluorescent Pseudomonas spp. have the capacity to survive in the soil and in plant rhizospheres (Kastelein et al. 1999). Fluorescent Pseudomonas strains can reduce populations of bacteria causing soft rot and blackleg in plant roots and progeny tubers. They can also reduce populations of these pathogens in the periderm of tubers (Kloepper 1983). According to Cronin et al. (1997), Pseudomonas fluorescens strain F113, which produces 2, 4- diacetylphloroglucinol (DAPG), can inhibit Pectobacterium atrosepticum in plants and tubers through antibiosis. Pseudomonas fluorescens could be used for contamination reduction in cracked tubers. These bacteria colonize cracked tubers and protect wounds from infection by

Pectobacterium atrosepticum, preventing both soft rot and blackleg of potato (Kasteline et al.

1999). Fluorescent Pseudomonas-treated seed potatoes were shown to be less likely to be infected with soft rot causing pathogens than non-treated seed. According to Kloepper (1983), populations of Pectobacterium ssp. were 95-100% lower in the roots of potatoes grown from seed pieces treated with fluorescent Pseudomonas strains than in the roots of plants grown from non-treated seed pieces. The Pseudomonas strains also reduced daughter tuber infestation 28-92% compared to control plants. Plant growth promoting rhizobacterium

(PGPR) Pseudomonas sp. strain B10, which produces the fluorescent siderophore pseudobactin, suppressed the population of Pectobacterium on potato plants roots by up to

123

100%; tuber infection was also reduced (Kloepper 1983). Fluorescent Pseudomonas spp. have been used as biocontrol agents for decades due to their potential to produce growth-promoting substances as well as improve plant growth status.

Colonization of plant tissues by biological control agents is crucial for the reduction of plant disease and promotion of plant growth (Schroth and Handcok 1982). To confirm the presence of biocontrol bacteria on tubers or in the rhizosphere after application, a means of monitoring the bacteria is required. Spontaneous antibiotic-resistance mutations can serve as markers allowing assessment of colonization in the plant root system (Compeau et al. 1988;

Vogler et al. 2002). Antibiotic resistance has been widely used to track bacteria in the environment (Glandorf et al. 1992). Another important issue is the stability of the markers for the duration of the experiment. The ability of mutants to survive in the medium can be confirmed using in vitro assays; however, it is not known to what extent the edaphic factors will allow the mutants to survive or modify the characters (Compeau et al. 1988).

The objectives of this study were to identify potential Pseudomonas sp. antagonists against P. carotovorum ssp. carotovorum in vitro and test their ability to suppress blackleg of potato in a controlled environment.

Materials and Methods

Bacterial strains. Forty-one previously characterized Pseudomonas strains were sourced from Dr. Christopher Taylor, The Ohio State University, OARDC (Aly et al 2009;

McSpadden Gardener et al. 2005) (Table 5.1). Strains were tested as potential biocontrol agents against 15 P. carotovorum ssp. carotovorum strains isolated in Bangladesh from rotted potato tubers (Chapter 3). All fifteen strains caused soft rot on potato tubers and six strains also caused blackleg symptoms on potato plants. All of the Pseudomonas and Pectobacterium strains were stored in -80°C on fluorescent Pseudomonas (PF) agar medium.

124

In vitro antagonism assay. Pseudomonas spp. strains were grown on fluorescent

Pseudomonas (PF) agar medium for 2 days and bacterial suspensions were prepared and adjusted to 108 colony forming units (CFU)/mL with sterilized distilled water. The concentrations of the bacterial suspensions were adjusted to an optical density (OD) of 0.2 at

600nm and final concentrations were checked by dilution plating (Subedi 2015).

Pectobacterium carotovorum ssp. carotovorum strain Pta2 was tested against the 41

Pseudomonas strains on PF plates. Pectobacterium carotovorum ssp. carotovorum strain Pta2 was grown for 48 hr. on Luria Bertani agar (LBA) (Sigma-Aldrich, St. Louis, MO, US) medium at 28°C and adjusted to a final concentration of 108 CFU/mL with sterilized distilled water. Lawns of P. carotovorum ssp. carotovorum Pta2 were prepared by spreading a 100 µL suspension of the bacteria on the plates with sterilized glass beads and drying them in a laminar flow hood for 5 minutes. Three 2.5 µL aliquots of each Pseudomonas strain were dropped onto each P. carotovorum ssp. carotovorum Pta2 lawn. The diameter of a clear zone of pathogen growth inhibition surrounding the Pseudomonas colony, if present, was measured after incubation for 2 days at 28°C. Each assay was repeated once with three replications.

Fifteen Pseudomonas strains (CLINTON, WAYNE, DARKE, 15G2, 38G2, 36F3, 88A6,

93F8, 14B2, 48D1, 36B3, 38D4, 36D4, 15D11 and WOOD1) were selected to screen again against 15 additional P. carotovorum ssp. carotovorum strains from Bangladesh (Table 3.2;

Chapter 3) as described above. This experiment was conducted twice and data for the two experiments are presented separately since Levene’s test for equality of variances was significant (p<0.05) (Table 5.2).

Five Pseudomonas strains were selected based on antagonistic activity in the screen and on previous performance against pathogens including Ralstonia solanacearum,

Rhizoctonia solani, Pythium ultimum (Subedi 2015; Mavrodi et al. 2012).

125

Production of rifampicin-resistant mutants. Spontaneous rifampicin-resistant mutants of the five selected Pseudomonas sp. strains were generated on fluorescent Pseudomonas (PF) medium. Strains were grown in nutrient broth (Sigma-Aldrich, St. Louis, MO, US) medium for 24 hours. Cultures were centrifuged for 10 minutes at 4500 RPM, supernatants were discarded and the bacterial pellets were suspended in 5 mL of sterile water. Rifampicin at

100μg/mL was added to the medium after autoclaving and cooling to 55°C. A 100 μL aliquot of bacteria was spread onto PF medium with rifampicin. Plates were incubated in the dark for

3 days at 28°C. To determine the stability of the spontaneous-rifampicin resistant mutants, each mutant was sequentially passaged seven times on PF without antibiotic and finally cultured on PF with 50 μg/mL rifampicin (modified from Testen 2010).

Pseudomonas strains growth. Both wt and rif+ strains were grown in PF medium for 24 hrs. at 28ºC and 100 µL suspensions of each bacterium were inoculated into 200 mL flasks containing 100 mL NB. Bacteria were then allowed to grow for 42 hours at 28ºC on a shaker at 120 RPM. Optical density (OD) was recorded at 600nm. The first data was taken at zero time and in later stages, OD values were recorded at different time intervals up to death phase of each bacterium. Three replications per strain were used for this experiment.

Every mutant Pseudomonas strain was evaluated against with their wild type counterpart for growth in vitro. A permutation test (two-sample t-test) was conducted to compare growth for each wt and rif+ form of the five Pseudomonas spp. (Figure 5.1).

Colonization of potato tubers by Pseudomonas strains. Pseudomonas strains were grown in NB with 50 μg/mL rifampicin for 2 days at 28°C, then three replicate tubers were immersed in each suspension for 2 hours. After drying the tubers in a laminar flow hood for 30 min, they were incubated in a biosafety level 2 (BSL2) growth chamber in the dark for 2 weeks in plastic boxes filled with steam-sterilized muck soil at 28°C in 70% relative humidity.

126

Rifampicin-resistant strains were cultured from immersed tubers on PF medium containing

50μg/mL rifampicin immediately after bacterization (30 min. after bacterization). Each tuber was peeled with a sterilized potato peeler and 1 g tuber peel was blended for 10 seconds in 5 mL sterilized distilled water. Extracts were streaked from the bacterial suspensions to PF medium containing 50μg/mL rifampicin after adjusted to an optical density (OD) of 0.2 at

600nm and final concentrations were checked by dilution plating (Subedi 2015). The plates were incubated at 28°C in 70% relative humidity. Two weeks after bacterization, sprouted tubers were peeled and suspensions were prepared and plated on rifampicin-amended PF medium after 10-fold serial dilution as described above (Testen 2010). This experiment was established in a randomized complete block design (RCBD) with three replications, and was conducted twice. Three bacterized tubers were used for each replication. Differences in means were assessed using Tukey’s range test with an error rate of α =0.05. Permutation test (two- sample t-test) was conducted to determine the difference between rif+ bacterial populations at two different time points; immediately and 2 weeks after bacterization (Table 5.4).

Blackleg suppression by Pseudomonas strains. Pre-sprouted Russet Burbank potato tubers

° were grown in 8 inch pots in BSL2 growth chambers at 22 C with 80% RH for 7 weeks with

12 hr alternating light and dark periods. Potato tubers were immersed for 30 minutes in 700 ml of a 109 CFU/mL suspension of one of five rif+ Pseudomonas strains: (P. fluorescens

36F3, P. protegens DARKE, P. brassicaceraum WOOD1, P. vranovensis 15D11and P. rhodesiae 88A6). Tubers were then air-dried separately (Makhlouf and Abedin 2012). Two bacterized tubers were planted in each pot at 3.5 cm soil depth in (8 inch) pots. One seedling per pot and five seedlings per treatment were inoculated with P. carotovorum ssp. carotovorum strains Pmu6 or Pta2, both causing blackleg symptoms in potato. A 15 µL drop of aqueous cell suspension (1x108 CFU/mL) of P. carotovorum ssp. carotovorum strains

Pmu6 and Pta2 was inoculated in the lowest leaf axil of 4-week-old potato seedlings (Chapter

127

3). Each treatment and a non-treated control consisted of five seedlings with three replications. Plants mock-inoculated with sterile water served as negative controls. Disease severity was recorded using a visual rating scale of 0-3, in which 0= no symptoms, 1= 25%

(1-50% of stems with blackening symptoms), 2= 75% (> 50% of stems with blackening symptoms), and 3= 100% 100% plants dead (Wright et al. 2006). Area under the disease progress curves (AUDPC) were calculated using the following formula:

(풙풊+풙풊−ퟏ) ∑([ ]) (푡푖 − 푡푖 − 1), where 푥푖 is the rating at each evaluation time and (ti-ti-1) is the ퟐ number of days between evaluations.

This experiment was set up in a randomized complete block design (RCBD) with three replications and was conducted twice. Data from the two experiments with P. carotovorum ssp. carotovorum Pmu6 were combined since Levene’s test of equality of variances was not significant (p>0.05). For P. carotovorum ssp. carotovorum strain Pta2, two experiments were considered separately as Levene’s test of equality of variances was significant (p=0.050)

(Table 5.3).

Results

In vitro antagonism of Pseudomonas strains. Zones of inhibition caused by 41

Pseudomonas strains in lawns of P. carotovorum ssp. carotovorum Pta2 48 hrs after challenge ranged from 0.0 - 9.4 mm in diameter (Table 5.1). Fifteen strains, including eight that were highly inhibitory to P. carotovorum ssp. carotovorum Pta2 (inhibition zone of 6-9.4 mm) (P. rhodesiae 88A6, P. fluorescens 36F3, 36B3 and 48D1, P. protegens 15G2 and 38G2, P. brassicaceraum WOOD1 and 36D4), three moderately inhibitory strains (inhibition zone 3-

5.9 mm) (P. protegens 14B2, DARKE and CLINTON ), one weakly inhibitory strain

(inhibition zone 1.2 mm) (P. protegens WAYNE), and three non-inihibitory strains (P.

128 vranovensis, 15D11 and P. brassicacearum 38D4 and 93F8) were selected for further in vitro antagonism assessment against 15 Bangladeshi soft rot causing Pectobacterium strains.

In experiment 1 (Table 5.2) there were significant differences among P. carotovorum ssp. carotovorum strains in growth inhibition by the 15 Pseudomonas strains tested (P<0.05).

Mean zones of inhibition ranged from 0.3-17.3 mm (Table 5.2). All six P. protegens strains tested were highly antagonistic to the P. carotovorum ssp. carotovorum strains. Pseudomonas protegens WAYNE and CLINTON produced significantly higher zones of inhibition on P. carotovorum ssp. carotovorum lawns than five of the least antagonistic strains, which include three (P. brassicacearum 38D4, 36D4 and WOOD1) of the four P. brassicacearum strains evaluated. Pseudomonas fluorescens 36B3 and P. vranovensis 15D11 were also among the least antagonistic strains against the 15 P. carotovorum ssp. carotovorum strains, as observed in the initial experiments against P. carotovorum ssp. carotovorum Pta2 (Table 5.1). Results for experiment 2 were also significantly different regarding the means of the strains. There was similar trend observed like experiment 1 with a few minor exceptions. Most notably, the inhibition zone caused by P. fluorescens 48D1 in P. carotovorum ssp. carotovorum strains was significantly smaller than the inhibition zone caused by P. protegens WAYNE in experiment 2, whereas antagonistic activity of these two strains was statistically similar in experiment 1.

Growth in in vitro of rifampicin-resistant mutants of five Pseudomonas strains. All of the rif+ Pseudomonas strains (P. fluorescens 36F3, P. protegens DARKE, P. vranovensis 15D11,

P. brassicacearum WOOD1 and P. rhodesiae 88A6) exhibited colony morphology similar to their wild type on PF agar medium. Each rif+ strain exhibited growth on PF broth medium comparable to its wt counterpart; there were no significant differences in growth between wt and rif+ versions of each strain (Figure 5.1).

129

Tuber colonization by rif+ Pseudomonas strains. Rifampicin-resistant Pseudomonas strains were recovered from tubers immediately after bacterization and 2 weeks after bacterization from tuber periderm tissue are significantly different at Tukey’s range test (p<0.05) (Table

5.4). Populations of all the strains except P. vranovensis 15D11 (p=0.075) decreased over time.

Blackleg suppression by Pseudomonas strains. Five Pseudomonas biocontrol agents were selected to reduce blackleg severity of potato. The results presented in table 5.3 indicated that there were no treatment significantly reduced disease severity over control in all four experiments inoculated with both P. carotovorum ssp. carotovorum strains Pmu6 and Pat2

(p>0.05). Blackleg disease progress was not affected by bacterization of potato tubers by any

Pseudomonas strain in plants stem-inoculated with P. carotovorum ssp. carotovorum Pmu6

(p=0.132, data combined for two experiments Figure 5.2) or Pta2 (p = 0.568 (Experiment A) and p = 0.978 (Experiment B) (Figure 5.3).

Discussion

The main potato blackleg-causing bacteria are Pectobacterium carotovorum ssp. carotovorum, Pectobacterium atrosepticum and Dickeya spp. (van der Wolf and De Boer

2007). These bacteria secrete a variety of enzymes that infiltrate and macerate cell walls and middle lamellae of plants. Effective management of blackleg, as well as soft rot, of potato is hindered in the field and storage by the lack of highly resistant varieties and bactericides, inadequate seed certification programs and environmental conditions increasingly conducive to these diseases due to climate change. Biological control is a management option that may help to maintain soft rot and blackleg at economically acceptable levels if used in combination with other appropriate measures. To this end, a collection of 41 Pseudomonas strains previously shown (Aly 2009, Mavrodi et al. 2012; McSpadden Gardener et al. 2005, Subedi

130

2015) to have antagonistic activity against other plant pathogens were evaluated as potential biocontrol agents against P. carotovorum ssp. carotovorum.

Based on inhibition of P. carotovorum ssp. carotovorum in this study or previous performance (Subedi 2015; Mavrodio et al. 2012), five Pseudomonas strains were selected and tested for suppression of blackleg of potato. Although P. brassicacearum WOOD1 and P. vranovensis 15D11 were not highly inhibitory against P. carotovorum ssp. carotovorum in this study, Mavrodi et al. (2012) observed that wheat seed treatment with P. brassicacearum

WOOD1 reduced seedling damage caused by Rhizoctonia solani. Pseudomonas vranovensis strain 15D11 did not reduce disease incidence but increased shoot length and root weight of wheat seedlings compared to no-bacterium controls. In addition, Subedi (2015) found that both P. brassicacearum WOOD1 and P. vranovensis 15D11 reduced bacterial wilt caused by

Ralstonia solanacearum in partially resistant tomato plants. Pseudomonas vranovensis 15D11 was highly inhibitory against R. solanacearum in vitro, but P. brassicacearum strain WOOD1 was moderately inhibitory against the pathogen. Three additional Pseudomonas strains, P. fluorescens strain 36F3, P. protogens strain DARKE and P. rhodesiae strain 88A6 were selected based on their capacity to produce large zones of inhibition against P. carotovorum ssp. carotovorum strains.

Antibiotic resistant mutant bacteria are commonly used for the purpose of population studies in soil and the environment, including bacterial survival and population dynamics. It is understood that the wild and antibiotic-resistant mutant will behave similarly in the absence of the antibiotic (Glandorf et al. 1992). This was also observed in our study, where rif+ strains of five Pseudomonas spp. did not differ in growth from their wt strains. Antibiotic resistant strains can be isolated preferentially from non-sterile substrates and in the presence of other similar bacteria. In this study, rif+ Pseudomonas strains were applied to potato tubers before sowing and maintained in the soil for 2 weeks. Significant differences were observed among

131 in colonizing capacity on potato tubers 2 weeks after bacterization. Insufficient bioocntrol population cannot reduce pathogens from the plants roots. Biocontrol efficacy is population dependent (Raaijmakers and Weller, 1998), so might be due to lack of sufficient population the Pseudomonas rif+ strains could not have provided support to reduce disease severity when applied with potato tuber for the reduction of blackleg of potato.

According to Kloepper (1983), application of fluorescent Pseudomonas species to tubers reduced populations of blackleg and soft rot pathogens on tubers, roots and also progeny of tubers. In another study, P. fluorescens PB92B1OE successfully reduced Botrytis cinerea in petunia up to 77% (Gould et al. 1996). According to Grosch et al. (2005), P. fluorescens strains suppressed bacterial wilt in potato up to 25% and increased yield by 12%.

However, in the current study, none of the five Pseudomonas strains tested significantly suppressed blackleg in potato compared to the non-treated control. The physical separation of the point of inoculation of the lower stems with P. carotovorum ssp. carotovorum from the site of bacterization (tubers) may have precluded any interaction between antagonist and pathogen. Further, it is unknown if the Pseudomonas strains survived on tubers more than 2 weeks or colonized the stems. The strains may be more effective against soft rot of tubers, where antagonist and pathogen may be in close proximity, than against blackleg. Our future aims are to collect native biocontrol Pseudomonas spp. from the rhizosphere of potato plants in Bangladesh and screen them against soft rot- and blackleg-causing bacteria both in planta and in vitro assays. Future studies will include evaluation of suppression of soft rot after tuber bacterization, as well as determination of long-term colonization of potato tubers and stems by antagonistic pseudomonads.

132

Acknowledgement

This material is based upon work supported by the United States Agency for International

Development, as part of the Feed the Future initiative, under the CGIAR Fund, award number

BFS-G-11-00002, and the predecessor fund the Food Security and Crisis Mitigation II grant, award number EEM-G-00-04-00013 and by state and federal funds appropriated to the Ohio

Agricultural Research and Development Center, The Ohio State University.

References

Aly, H. 2009. Role of Pseudomonas produced hydrogen cyanide in biological control of plant-parasitic nematodes. PhD dissertation submitted to University of Missouri-St. Louis.

Anilkumar, T. B., and Chakravarti, B. P. 1970. Factors affecting survival of Erwinia carotovora, causal organism of stalk rot of maize, in soil. Acta Phytopathologica Academiae Scientarium Hungaricae 5:333–40.

Bhat, K. A., Massod, S. D., Bhat, N. A., Bhat, M. A., Razvi, S. M., Mir, M. R., Akthar, S., Wani, N., and Habib, M., 2010. Current status of post-harvest soft rot in vegetables: A Review. Asian J. Plant Sci. 9:200-208.

Brockwell, J., Schwinghamer, E. A., and Gault, R. R. 1977. Ecological studies of root-nodule bacteria introduced into field environments. V. A critical examination of the stability of antigenic and streptomycin-resistance markers for identification of strains of Rhizobium trifolii. Soil Biol. Biochem. 9:19-24.

Charkowski, O. A. 2015. Biology and control of Pectobacterium in potato. Am. J. Potato Res. 92:223-229.

Lo, C. 1998. General mechanisms of action of microbial biocontrol agents. Plant Pathology Bulletin. 7:155-166.

Compeau, G., Al-Chi, B. J., Platsouka, E., and Levy, S. B. 1988. Survival of rifampin- resistant mutants of Pseudomonas fluorescens and Pseudomonas putida in soil systems. Appl. Environ. Microbiol. 54:2432-2438.

133

Czajkowski, R., Perombelon, M. C. M., van Veen, J. A., and van der Wolf, J. M. 2011. Control of blackleg and tuber soft rot of potato caused by Pectobacterium and Dickeya species: a review. Plant Pathol. 60:999–1013.

Frost, K. E., Groves, R. L., and Charkowski, A. O. 2013. Integrated control of potato pathogens through seed potato certification and provision of clean seed potatoes. Plant Dis. 97:1268–1280.

Glandorf, D. C. M., Brand, I., Bakker, P. A. H. M., and Schippers, B. 1992. Stability of rifampicin resistance as a marker for root colonization studies of Pseudomonas putida in the field. Plant Soil. 147:135- 142.

Gould, A. B., Kobayashi, D. Y., and Bergen, M. S. 1996. Identification of bacteria for biological control of Botrytis cinerea on petunia using a petal disk assay. Plant Dis. 80:1029- 1033.

Grosch, R., Faltin, F., Lottmann, J., Kofoet, A., and Berg, G. 2005. Effectiveness of three antagonistic bacterial isolates to control Rhizoctonia solani Kuhn on lettuce and potato. Can. J. Microbiol. 51:345-353. Guan, T. T., Blank, Y. G., and R. A. Holley. 2005. Survival of pathogenic bacteria in pesticide solutions and on treated tomato plants. J. Food Protect. 68:296–304.

James, J., Farrar, J., and Davis, R. M. 2009. Losses due to lenticel rot are an increasing concern for Karen county potato growers. Calif. Agr. 63:127-130.

Kastelein, P., Schepel, E. G., Mulder, A., Turkensteen, L. J., Van Vuurde, J. W. L. 1999. Preliminary selection of antagonists of Erwinia carotovora ssp. atroseptica (Van Hall) Dye for application during green crop lifting of seed potato tubers. Potato Res. 42:161–17.

Kim, H.-S., Ma, B., Perna, N. T., and A.O. Charkowski, A. O. 2009. Prevalence and virulence of natural type III secretion system deficient Pectobacterium strains. Appl. Environ. Microbiol. 75:4539–4549.

Kloepper, J. W. 1983. Effect of seed piece inoculation with plant growth promoting rhizobacteria on populations of Erwnia carotovora on potato roots and in daughter tubers. Phytopathology 73:217–9.

Kloepper, J. W., Leong, J., Teintze, M., and Schroth, M. N 1980. Enhancing plant growth by siderophores produced by plant growth-promoting rhizobacteria. Nature 286:885-886.

Kubheka, G. C., Coutinho, T. A., Moleleki, N. and Moleleki. L. N. 2013. Colonization patterns of an mCherry-tagged Pectobacterium carotovorum ssp. brasiliense strain in potato plants. Phytopathology 103:1268–1279.

134

Laurila, J., Hannukkala, A., Nykyri, J., Pasanen, M., Helias, V., Garlant, L., and Pirhonen, M. 2010. Symptoms and yield reduction caused by Dickeya spp. strains isolated from potato and river water in Finland. Eur. J. Plant Pathol. 126:249–262.

Makhlouf, A. H., and Abdeen R. 2014. Investigation on the effect of chemical and biological control of bacterial soft root disease of potato in storage. J. Biol. Agric. Healthcare. 4:31–44.

Mavrodi, O. V., Walter, N., Elateek, S., Taylor, C. G., and Okubara, P. A. 2012. Suppression of Rhizoctonia and Pythium root rot of wheat by new strains ofmPseudomonas. Biol. Control. 62:93-102.

McSpadden Gardener, B., Gutierrez, L. J., Joshi, R., Edema, R., and Lutton, E. 2005. Distribution and biocontrol potential of phlD+ Pseudomonads in corn and soybean field. Phytopathology 95:715-724.

Perombelon, M. C. M. 1992. Potato blackleg: epidemiology, host-pathogen interaction and control. Neth. J. Plant Pathol. 98:135–146.

Perombelon, M. C. M., and Kelman, A. 1980. Ecology of the soft rot erwinias. Annu. Rev. of Phytopathol. 18:361–87.

Raaijmakers, J. M., and Weller, D. M., 1998. Natural plant protection by 2,4- diacetylphloroglucinol-producing Pseudomonas spp. in take-all decline soils. Mol. Plant Microbe Interact. 11:144–152.

Subedi, N. 2015. Characterization and management of Ralstonia solanacearum populations in South Asia (Doctoral dissertation, The Ohio State University).

Testen, L. A. 2012. Microbial approaches to support Andean Quinoa production. (Master’s thesis, The Pennsylvania State University).

Toth, I. K., Sullivan, L., Brierley, J. L., Avrova, A. O., Hyman, L. J., Holeva, M., Broadfoot, L., Perombelon, M. C. M., and McNicol, J. 2003. Relationship between potato seed tuber contamination by Erwinia carotovora ssp. atroseptica, blackleg disease development and progeny tuber contamination. Plant Pathology 52:119–126.

Turner, J. T., and Backman, P. A. 1991. Factors relating to peanut yield increases after seed treatment with Bacillus subtilis. Plant Dis. 75:347–353.

Perombelon, M. C. M., and van der Wolf, J. M. 2002. Methods for the Detection and Quantification of Erwinia carotovora ssp. atroseptica (Pectobacterium carotovorum ssp. atrosepticum) on Potatoes: A Laboratory Manual. Invergowrie, UK: Scotish Crop Research Institute: Occasional Publication No. 10.

135 van der Wolf, J. M., and De Boer, S. H. 2007. Bacterial pathogens of potato. In: Vreugdenhil D, ed. Potato Biology and Biotechnology, Advances and Perspectives. Oxford, UK: Elsevier, 595–619.

Vogler, A. J., Busch, J. D., Percy-Fine, S., Tipton-Hunton, C., Smith, K., and Keim, P. 2002. Molecular analysis of Rifampin resistance in Bacillus anthracis and Bacillus cereus. Antimi. Agents and Chemo. 46:511-513.

Wichterman, R. 2012. The biology of Paramecium. Springer Science & Business Media.

Xu, G. W., and Gross, D. C. 1986. Field evaluations of the interactions among fluorescent Pseudomonads, Erwinia carotovora, and potato yields. Phytopathology 76:423-430.

136

Table 5.1. Inhibition of Pectobacterium carotovorum ssp. carotovorum strain Pta2 in vitro by Pseudomonas spp. screened as potential biocontrol agents. Strains highlighted in grey were selected for further analysis.

Strain name Source Genbank Pseudomonas Zone of accession no. species inhibition (mm)a 1B1 Mississippi KT695804 P. protegens 3.8 River 1C5 Mississippi KT695805 P. protegens 0.0 River 12H11 Mississippi KT695806 P. protegens 5.6 River 14B11 Mississippi KT695807 P. chlororaphis 1.2 River 14B2 Mississippi KT695808 P. protegens 5.9 River 14D6 Mississippi KT695809 P. chlororaphis 0.0 River 15D11 Mississippi KT695810 P. vranovensis 0.0 River 15G2 Mississippi KT695811 P. protegens 7.6 River 15H3 Mississippi KT695812 P. protegens 7.0 River 2F9 Mississippi KT695813 P. fluorescens 7.0 River 24D3 Herbarium KT695814 P. fluorescens 4.1 28B5 Herbarium KT695815 P. fluorescens 4.2 29G9 Herbarium KT695816 P. poae 3.6 36B3 Wyoming Soil KT695817 P. fluorescens 6.8 36B7 Wyoming Soil KT695818 P. brassicacearum 0.0 36C6 Wyoming Soil KT695819 P. frederiksbergensis 6.8 36C8 Wyoming Soil KT695820 P. poae 5.2 36D4 Wyoming Soil KT695821 P. brassicacearum 3.8 36F3 Wyoming Soil KT695822 P. fluorescens 7.8 36A2 Wyoming Soil KT695823 P. fluorescens 0.0 37A10 Wyoming Soil KT695824 P. frederiksbergensis 0.0 37D10 Wyoming Soil KT695825 P. brassicacearum 0.0 38D4 Wyoming Soil KT695826 P. brassicacearum 0.0 38D7 Wyoming Soil KT695827 P. brassicacearum 0.0 38F7 Wyoming Soil KT695828 P. frederiksbergensis 0.0 38G2 Wyoming Soil KT695829 P. protegens 7.4 39A2 Wyoming Soil KT695830 P. frederiksbergensis 0.0 48B8 Wisconsin Soil KT695831 P. chlororaphis 4.0

137

Strain name Source Genbank Pseudomonas Zone of accession no. species inhibition (mm)a 48C10 Wisconsin Soil KT695832 P. lini 0.0 48D1 Wisconsin Soil KT695833 P. fluorescens 6.3 48G9 Wisconsin Soil KT695834 P. chlororaphis 5.6 48H11 Wisconsin Soil KT695835 P. brassicacearum 3.4 88A6 Missouri Soil KT695836 P. rhodesiae 9.4 89F1 Missouri Soil KT695837 P. fluorescens 5.6 90D7A Missouri Soil KT695838 P. fluorescens 5.2 90F12-1 Missouri Soil KT695839 P. rhodesiae 4.2 90F12-2 Missouri Soil KT695840 P. fluorescens 4.4 93F8 Missouri Soil KT695841 P. brassicacearum 0.0 94G2 Missouri Soil KT695842 P. frederiksbergensis 4.2 WOOD1 Ohio Soil KT695843 P. brassicaceraum 0.0 WOOD3 Ohio Soil KT695844 P. brassicacearum 4.3 WAYNE Ohio Soil KT695845 P. protegens 4.0 DELAWARE Ohio Soil KT695846 P. brassicacearum 7.6 CLINTON Ohio Soil KT695847 P. protegens 3.0 DARKE Ohio Soil KT695848 P. protegens 4.2 # All strains except Pseudomonas protegens strains CLINTON, DARKE, DELAWARE, WOOD1 and WOOD3 (McSpadden et al. 2005) were first described by Aly et al. (2009). aMean zone of inhibition (mm) of three replicates of P. carotovorum ssp. carotovorum strain Pta2 2 days after inoculation with 41 biocontrol agents.

138

Zone of inhibition (mm) Pseudomonas spp. strain Experiment 1 Experiment 2 P. protegens CLINTON 17.3 a 19.6 ab P. protegens WAYNE 17.3 a 20.5 a P. protegens DARKE 16.4 ab 19.1 ab P. protegens 15G2 16.0 ab 18.6 ab P. protegens 38G2 15.5 ab 17.5 ab P. fluorescens 36F3 14.8 ab 16.4 abc P. rhodesiae 88A6 13.8 ab 15.8 abc P. brassicacearum 93F8 13.5 abc 16.2 abc P. protegens 14B2 13.2 abc 15.7 abc P. fluorescens 48D1 13.1 abc 14.9 bc P. fluorescens 36B3 12.2 bc 14.4 bcd P. brassicacearum 38D4 9.2 cd 11.2 cd P. brassicacearum 36D4 7.0 d 9.4 d P. vranovensis 15D11 0.6 e 0.8 e P. brassicaceraum WOOD1 0.3 e 0.6 e p value <0.05 <0.05

139

Treatment Experiment 1 Experiment 2 Experiment 3 (Pmu6) (Pta2) (Pta2) Control 315.8 a 308.3 a 285.0 a P. fluorescens 36F3 301.9 a 275.3 a 273.0 a P. protegens DARKE 298.9 a 305.3 a 285.0 a P. brassicaceraum WOOD1 293.6 a 301.5 a 300.0 a P. vranovensis 15D11 287.0 a 293.3 a 285.8 a P. rhodesiae 88A6 286.5 a 289.5 a 294.8 a p value >0.05 >0.05 >0.05

140

Strain Immediate After 2 weeks Permutation test

(Log10 (Log10(CFU/g)) (p value) (CFU/g))

P. brassicacearum WOOD1M 9.9 a 7.6 bc <0.05

P. fluorescens 36F3M 10.1 a 7.2 c <0.05

P. vranovensis 15D11M 7.0 b 7.8 b 0.075

P. rhodesiae 88A6M 9.8 a 8.5 a 0.006

P. protegens DARKEM 9.5 a 7.8 b 0.002

p value <0.05 <0.05

141

3.5 P. brassicacearum A 3 WOOD1W P. brassicacearum 2.5 . WOOD1M

2 P. rhodesiae 88A6W

OD600 1.5 P. rhodesiae 1 88A6M

0.5 P. vranovensis 15D11M 0 0 10 20 30 40 50 P. vranovensis 15D11W Hours

1.6 B. 1.4 P. fluorescens 1.2 36F3M

1 P. fluorescens

0.8 36F3W OD600 0.6 0.4 P. protegens DARKEM 0.2

0 P. protegens 0 10 20 30 40 50 DARKEW Hours

142

v 350

e r 325

a 300

d 275

r A 250

11 6 1 KE F3 L D 8A D R 6 RO 5 8 OO A s3 T is1 iae W sD n N ns s m n ce CO e de ru ge es ov o a te or n .rh ce ro lu ra P ca p .f .v si P. P P as br P. Treatment

143

e 400

c 375

g 350

e 325

s i 300

d 275

e 250

1 6 1 E 3 L 1 K F D 8A D R 6 O 5 8 O 3 R 1 e O A s T s a sD n N si i W n e O n s m e c C e e u g s v d r e re o o a t o n rh e o u a . c r fl r P ca .p . .v i P P P ss ra .b P Treatment

B. Treatments were P. vranovensis 15D11, P. rhodesiae 88A6, P. brassicaceraum WOOD1, P.

e 400

e 350

e 300

r 250

a 200

1 6 1 E 3 L 1 K F A D 6 O 5D 88 O R 3 R 1 e O A s T s a sD n N si i W n e O n s m e c C e e u g s v d r e re o o a t o n rh e o u a . c r fl r P ca .p . .v i P P P ss ra .b P

Treatment

144

Chapter 6

Summary

The overall goals of this study were to identify the soft rot pathogen or pathogens of potato tubers in Bangladesh and design and test disease management strategies utilizing chemical, biochemical and biological tactics. Fifteen soft rot soft rot bacterial strains were recovered from potato-growing regions in Bangladesh between December 2014 and January 2015. The bacterial colonies were characterized using biochemical tests including gram reaction and tests for oxidase, arginine dehydrogenase, anaerobic growth and carbon source (sorbitol, sucrose and lactose) utilization. Pathogenicity assays were conducted on potato tubers and seedlings. Subspecies-specific PCR, 16s rRNA gene sequencing and multilocus sequence analysis (MLSA) were also conducted to identify the isolates to subspecies and determine their taxonomic relatedness.

All 15 pathogenic isolates were gram negative, facultative anaerobes that were oxidase negative, able to utilize lactose but not sorbitol and sucrose, not able to grow on Pseudomonas specific agar medium (PF), and negative for arginine dehydrogenase. The isolates produced deep pits on crystal violet pectate medium. PCR utilizing the subspecies-specific primer pair

EXPCCF and EXPCCR resulted in amplification of a 550-bp sequence characteristic of

Pectobacterium carotovorum ssp. carotovorum for all 15 pathogenic isolates but none of the non-pathogenic isolates recovered from tubers. The 15 P. carotovorum ssp. carotovorum strains were divided into two clades by 16s rRNA gene sequencing. Thirteen P. carotovorum ssp. carotovorum soft rot strains clustered in two clades by MLSA (two strains not analyzed).

Five of the fifteen soft rot strains also caused blackleg symptoms on potato seedlings. While the collection of soft rot-causing isolates used in this study represents a relatively small

145 sample size, it is likely that P. carotovorum ssp. carotovorum is a principle cause of soft rot of potatoes in the field and storage in Bangladesh. This information will be useful for potato breeding programs and for development of integrated disease management strategies.

Experiments were conducted at the Bangladesh Agricultural Research Institute

(BARI) using chitosan, gypsum fertilizer and a biocontrol agent, alone or in combination, to investigate tactics that may be used in a soft rot disease management program. Soft rot- and blackleg-causing P. carotovorum ssp. carotovorum strain Pmu6 was used to inoculate seedlings of the potato variety Diamant. The correlation between percent tuber calcium concentration or percent dry matter of tubers and percentage of tuber soft rot was determined.

The highest level of disease reduction was recorded for tubers treated with chitosan 3% + T. harzianum BTH-N1. Ten BARI-released potato varieties exhibited different levels of soft rot severity when they were inoculated with the highly virulent strain P. carotovorum ssp. carotovorum Pki2. BARI Alu 25 was the most resistant to soft rot, while the recently released potato varieties BARI Alu 72 and BARI Alu 41 were the most susceptible. Calcium (p<0.05) but not dry matter percentage of tubers was negatively correlated with soft rot ranking in these varieties.

Potential biocontrol Pseudomonas spp. were screened in vitro for antagonism to P. carotovorum ssp. carotovorum strains from Bangladesh and then applied to potato tubers.

Rifampicin-resistant Pseudomonas mutants were also developed to evaluate tuber colonization. Populations of Pseudomonas strains increased, descreased or remained the same on tubers depending on the strain. No Pseudomonas treatments significantly reduced blackleg severity (p>0.05) over the non-treated control. This may have been the result of the physical separation between Pseudomonas strains on tubers and the P. carotovorum ssp. carotovorum strain inoculated in stems, if the mode of action of the Pseudomonas sp. is competition or antibiosis. Additional research is needed to assess the potential of these Pseudomonas strains

146 for biocontrol of soft rot caused by P. carotovorum ssp. carotovorum.

A survey was undertaken to assess the knowledge of Bangladeshi potato growers regarding potato production practices, production challenges and blackleg and soft rot disease management. A total of 348 respondents were interviewed in six main potato-growing districts in Bangladesh in 2016. Data were collected using a structured questionnaire with direct interviews. Most growers were very aware of potato diseases and considered disease the second most important constraint to potato production after market price. The majority of the growers identified late blight (Phytophthora infestans) as the main field disease across the districts and soft rot (Pectobacterium carotovorum ssp.) as the main storage disease. Potato growers across the districts cited fungicide application as the primary means of managing field diseases and sorting as the means of managing diseases in storage. No growers indicated that they used biological control methods to manage diseases in the field or in storage.

Growers preferred high-yielding, disease-tolerant potato varieties and generally bought seed potatoes from dealers and sold finished tubers to wholesalers. The results of this survey showed that an integrated blackleg and soft rot management program likely to be adopted by farmers in Bangladesh should integrate high yielding potato varieties, disease-free potato seeds, inoculum-free irrigation water, regular scouting, and roguing. Specific options include:

 Replacing the popular but soft rot-susceptible potato variety (BARI-Alu 7) Diamant

with less susceptible (BARI-Alu 25) Asterix variety (Chapter 4)

 Applying the biocontrol agent Trichoderma harzianum BTH-N1 in combination with

chitosan and conventional doses of gypsum fertilizer

 Avoiding mechanical injury as soft rot/blackleg bacteria enter tubers through wounds

 Roguing during the potato growing season to eradicate blackleg-infected seedlings,

should they occur, and discard diseased plants by burying

147

 Avoiding open water sources such as ponds, rivers and canals and using shallow or

deep tube well water for irrigation

 Sorting out the rotten potatoes in storage as high humidity and temperature favor the

development of soft rot bacteria

 Increasing grower access to educational programs to improve their knowledge of

chemical and biological crop protection products, improve disease management, and

reduce the misuse of pesticides

148

Bibliography

Abd-El-Khair, H., and Karima, H. E. H. 2007. Application of some bactericides and bioagents for controlling the soft rot disease in potato. Res. J. Agril. and Biol. Sc. 3:463-473.

Agrios, G. N. 2005. Plant Pathology. 5th Eds. New York: Academic Press, Harcourt Brace Jonanovich, Publishers. Ahmed, M. A. Z., Rayhan, S. J., and Hassan, M. 2013. Grower''s profitability of potato cultivation at rangpur district: the socio-economic context of Bangladesh. Russian J. Agril. Socio-Economic Sc. 19:7.

Allen, E. J., O’brien, P. J., and Firman, D. 1992. Seed tuber production and management. The potato crop. Springer Netherlands 247-291. Aly, H. 2009. Role of Pseudomonas produced hydrogen cyanide in biological control of plant-parasitic nematodes. PhD dissertation submitted to University of Missouri-St. Louis.

Anonymous. 1995. Potatoes in the 1990s: Situation and prospects of the world potato economy. Food and Agriculture Organization and International Potato Center (FAO/CIP). FAO, Rome, Italy. 39 pp.

Anonymous. 2016. Bangladesh Bureau of Statistics (BBS). Yearbook of Agricultural Statistics of Bangladesh. 28thseries, available at http://bbs.portal.gov.bd/sites/default/files/files/bbs.portal.gov.bd/page/1b1eb817_9325_4354_ a756_3d18412203e2/Yearbook-2016-Final-19-06-2017.pdf.

Anonymous. 2011. Bangladesh Bureau of Statistics (BBS). Yearbook of Agricultural Statistics of Bangladesh. Chapter 02: Summary crop statistics and crop indices. http://www.bbs.gov.bd/userfiles/Image/ArgYearBook11/Chapter-2.pdf. Antunes, M. D. C., Panagopoulos, T., Rodrigues, S., Neves, N. and Curado, F. 2005. The effect of pre and postharvest calcium applications on ‘Hayward’ kiwi fruit storage ability. Acta Hortic. 682:909-916. Anwar, M. M., Parveen, A., Hossain, M. M., Mahamud, N. U., and Roy, R. K. 2015. Efficacy of fungicides in controlling late blight of potato. Progressive Agriculture. 26:103-108. Arunachalam, M. K., and Sharma, P. 2012. Confrontation assay for Trichoderma as a potential biocontrol agent against Pythium aphanidermatum and Sclerotinia sclerotiorum.

149

Pest Management in Horticultural Ecosystem 18:74-77.

Avrova, A. O., Hyman L. J., Toth R. L., and Toth I. K. 2002. Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi. Appl. Environ. Microbiol. 68:1499.

Azad, A. K., Kabir, H., Eaton, T. E. J., and Soren, E. B. 2017. Storage potentialities of some exotic potato varieties at growers’ condition in Bangladesh. Agricultural Sciences 8:183. Baghaee-Ravari, S., Rahimian, H., Shams-Bakhsh, M., Lopez-Solanilla, E., Antunez-Lamas, M., and Rodriguez-Palenzuela, P. 2011. Characterization of Pectobacterium species from Iran using biochemical and molecular methods. Euro. J. Plant Pathol. 129:413-425. Bain, R., Millard, P., and Perombelon, M. 1996. The resistance of potato plants to Erwinia carotovora ssp. atroseptica in relation to their calcium and magnesium content. Potato Res. 39:185–93.

Basu, A. Employing eco-friendly potato disease management allows organic tropical Indian production systems to prosper. Asian J. Food Agro. Indust. Special Issue. 2009:80-87. Beausejour J., Clermont N., and Beaulieu, C. 2003. Effect of Streptomyces melanosporofaciens strain EF-76 and of chitosan on common scab of potato. Plant and Soil. 256: 463–468.

Benitez, M. S., and Gardener, B. B. McSpadden. 2009. Linking sequence to function in soil bacteria: sequence-directed isolation of novel bacteria contributing to soilborne plant disease suppression. Appl. Environ. Microbiol. 75:915-924.

Berry, S. Z., Madumadu, G. G., and Uddin, R. M. 1988. Effect of calcium and nitrogen nutrition on bacterial canker disease of tomato. Plant and Soil. 112:113–20.

Biehn, W. L., Sands, D. C., and Hankin, L. 1972. Relationship between percent dry matter content of potato tubers and susceptibility to bacterial soft rot. Phytopathology 62:747.

Bonde, R., and de Souza, P. 1954. Studies on the control of potato bacterial seed-piece decay and blackleg with antibiotics. Am. J. Potato Res. 31:311–316.

150

Bourne, W. E., McCalmont D.C., and Wastie, R. L. 1981. Assessing potato tubers for susceptibility to bacterial soft rot (Erwinia carotovora subsp, atroseptica). Potato Res. 24:409-15.

Cappaert, M. R., Powelson, M. L., Franc, G. D., and Harrison, M. D. 1988. Irrigation water as a source of inoculum of soft rot Erwinias for aerial stem rot of potatoes. Phytopathology 78:1668-1672.

Cardoza, Y. F., Duarte, V., and Lopes, C. A. 2017. First report of blackleg of potato caused by Dickeya solani in Brazil. Plant Dis. 101:243-243.

Cazelles, O., and Schwarzel, R. 1992. Survey of bacterial diseases caused by Erwinia in seed potato fields in western Switzerland. Revue Suisse d’ Agriculture. 24:215–8.

Charkowski, A. O. 2015. Biology and control of Pectobacterium in potato. Am. J. Potato Res. 92:223-229.

Chowdhury, M. D., and Chowdhury, A. H. 2015. Problems and prospects of potato cultivation in Bangladesh. Asian Bus. Rev. 5:28-32.

Colyer, P. D., and Mount, M. S. 1984. Bacterization of potatoes with Pseudomonas putida and its influence on postharvest soft rot diseases. Plant Dis. 68:703-706.

Compant, S., Duffy, B., Nowak, J., Clement, C., and Barka, E. A. 2005. Use of plant growth- promoting bacteria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects. Appl. Environ. Microb. 71:4951–9Compeau, G., Al-Chi, B. J., Platsouka, E., and Levy, S. B. 1988. Survival of rifampin-resistant mutants of Pseudomonas fluorescens and Pseudomonas putida in soil systems. Appl. Environ. Microbiol. 54:2432-2438.

Cupples D., and Kelman, A. 1974. Evaluation of selective media for isolation of soft-rot bacteria from soil and plant tissue. Phytopathology 64:468-475.

Czajkowski, R., Grabe, G. J., and van der Wolf, J. M. 2009. Distribution of Dickeya spp. and Pectobacterium carotvorum subsp. carotovorum in naturally infecetd seed potatoes. Euro. J. Plant Pathol. 125: 263-275. Czajkowski, R., Perombelon, M. C. M., van Veen, J. A., and van der Wolf, J. M. 2011. Control of blackleg and tuber soft rot of potato caused by Pectobacterium and Dickeya species: a review. Plant Pathol. 60:999–1013.

151

Dasgupta, S., Meisner, C., and Huq, M. 2005. Health effects and pesticide perception as determinants of pesticide use: evidence from Bangladesh (No. 3776). The World Bank. De Boer, S. H., Li, X., and Ward, L. J. 2012. Pectobacterium spp. associated with bacterial stem rot syndrome of potato in Canada. Phytopathology 102:937-947. De Boer, S.H., 2004. Blackleg of potato. The Plant Health Instructor.

De Boer, S. H., Verdonck, L., Vruggink, H., Harju, P., Bang, H. O., and Ley, J. D. 1987. Serological and biochemical variation among potato strains of Erwinia carotovora ssp. atroseptica and their taxonomic relationship to other E. carotovora strains. J. Appl. Bacteriol. 63:487–495. de Haan E. G., and Van Den Bovenkamp, G. W. 2009. Test development in Erwinia at the NAK: BioPlex real-time PCR. Gewasbescherming 40:172-175. De Lindo, L., French, E. R., and Kelman, A. 1978. Erwinia spp. pathogenic to potatoes in Peru. Am. Potato J. 55:383 (abstract). De Weger, L. A., van Boxtel, R., van der Burg, B., Gruters, R. A., Geels, F. P., Schippers, B., and Lugtenberg, B. J. J. 1986. Siderophores and outer membrane proteins of antagonistic, plant growth-stimulating root-colonizing Pseudomonas spp. J. Bacteriol. 165:585-594.

Dey, T. K. and Ali, M. S. 1994. Pathological research on tuber crops in Bangladesh. In: Proc. of Workshop on Transf. of Tech. of CDP crops under Res. Extu. Linkage Progm., held on Oct. 22-27, BARI, Gazipur, Bangladesh. pp 159-165.

Duarte, V., De Boer, S. H., Ward, L. J., and De Oliveira, A. M. R. 2004. Characterization of atypical Erwinia carotovora strains causing blackleg of potato in Brazil. J. Appl. Microb. 96:535–545.

Dunn, L., and Rost, C. 1945. Effect of fertilizers on the quality of potatoes grown in the Red River Valley of Minnesota. Am. J. Potato Res. 22:173–87.

Eden, P. A., Schmidt, T. M., Blakemore, R. P., and Pace, N. R. 1991. Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction-amplified 16S rRNA- specific DNA. Int. J. Syst. Bacteriol. doi:10.1099/00207713-41-2-324. PMID 1854644.

El Hadrami, A., Adam, L. R., El Hadrami, I., and Daayf, F. 2010. Chitosan in plant protection. Marine Drugs 8:968-987.

Elad, Y., Chet, I., and Henis, Y. 1979. Trichoderma harzianum: A biocontrol agent effective against Sclorotium rolfsii and Rhizoctonia solani. Phytopathology 70:119-121.

152

Frost, K. E., Groves, R. L., and Charkowski, A. O. 2013. Integrated control of potato pathogens through seed potato certification and provision of clean seed potatoes. Plant Dis. 97:1268–1280.

Ganeshan, G., and Manoj Kumar, A. 2005. Pseudomonas fluorescens, a potential bacterial antagonist to control plant diseases. J. Plant Interac. 1:123-134.

Gillis, A., Santana, M. A., Rodrigue, M., and Romay, G. 2017. First report of bell pepper soft rot caused by Pectobacterium carotovorum ssp. brasiliense in Venezuela. Plant Dis. https://doi.org/10.1094/PDIS-03-17-0361-PDN.

Gnanamanickam, S. S. (Ed.). 2006. Plant-associated bacteria (Vol. 1). Netherlands: Springer.

Golkhandan, E., Kamaruzaman, S., Sariah, M., Abidin, M. A. Z., and Nasehi, A. 2013. Characterization of Malaysian Pectobacterium spp. from vegetables using biochemical, molecular and phylogenetic methods. Euro. J. Plant Pathol. 137:431-443.

Golkhandan, E., Kamaruzaman, S., Sariah, M., Zainal Abidin, M. A., and Nasehi, A. 2013. Characterization of Pectobacterium carotovorum causing soft rot on Kalanchoe gastonis- bonnierii in Malaysia. Arch. Phytopathol. and Plant Pro. 46:1809-1815.

Goto, M. 1979. Bacterial foot rot of rice caused by a strain of Erwinia chrysanthemi. Phytopathology 69:213-216. Gould, A. B., Kobayashi, D. Y., and Bergen, M. S. 1996. Identification of bacteria for biological control of Botrytis cinerea on petunia using a petal disk assay. Plant Dis. 80:1029- 1033.

153

Grosch, R., Faltin, F., Lottmann, J., Kofoet, A., and Berg, G. 2005. Effectiveness of three antagonistic bacterial isolates to control Rhizoctonia solani Kuhn on lettuce and potato. Can. J. Microbiol. 51:345-353. Gross, D. C., Lichens-Park, A., and Kole, C. (Eds.). 2014. Genomics of Plant-Associated Bacteria (Vol. 283). Springer.

Guan, T. T., Blank, Y. G., and R. A. Holley. 2005. Survival of pathogenic bacteria in pesticide solutions and on treated tomato plants. J. Food Protect. 68:296–304.

Habib, A., Abdulnour, J., and Donnelly, D. J. 2004. Potato Res. 47:139. https://doi- org.proxy.lib.ohio-state.edu/10.1007/BF02735980.

Hadas, R., Kritzman, G., Gefen, T., and Manulis, S. 2001. Detection, quantification and characterization of Erwinia carotovora ssp. carotovora contaminating pepper seeds. Plant Pathol. 50:117–123.

Hajong, Pradip., Moniruzzaman, Md., Idris Ali Mia, M., and Rahman, M. 2014. Storage system of potato in Bangladesh. Uni. j. Agril. Res. 2:11-17.

Harman, G. E. 2006. Overview of mechanisms and uses of Trichoderma spp. Phytopathology 96:190-194.

Harman, G. E., Howell, C. R., Viterbo, A., Chet, I., and Lorito, M. 2004. Trichoderma species-opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2: 43–56.

Hicks, E., Bienkowski, D., Braithwaite, M., Mc Lean, K., Falloon, R., and Stewart, L. 2014. Trichoderma strains suppress Rhizoctonia diseases and promote growth of potato. Phytopathologia Mediterranea 53:502-514.

Hijmans, R. J., and Spooner, D. M. 2001. Geographic distribution of wild potato species. Am. J. Botany. 88:2101–12. Himel, R. M., khan, A. A., Akanda, A. M., and Karim, M. 2016. Characterization and identification of soft rot bacterial pathogens of different fruits in Bangladesh. Intl. J. Biosci. 9:1-9.

154

Howarth, F. G. 2003. Environmental impacts of classical biological control. Annu. Rev. Entomology 36:485–509.

Howell, C. R. 2007. Effect of seed quality and combination fungicide–Trichoderma spp. seed treatments on pre- and postemergence damping-off in cotton. Phytopathology 97:66-71.

Jafra, S., Przysowa, J., Czajkowski, R., Michta, A., Garbeva, P., and van der Wolf, J. M. 2006. Detection and characterization of bacteria from the potato rhizosphere degrading N- acyl-homoserine lactone. Can. J. Microbiol. 52:1006-1015.

James, J., Farrar, J., and Davis, R. M. 2009. Losses due to lenticel rot are an increasing concern for Karen county potato growers. Calif. Agr. 63:127-130.

Kallai, M., Csitari, G., Sipos, E., and Polgar, Z. 2007. Examination of resistance of potato genotypes to Erwinia ssp. Commun. Agric. Appl. Biol. Sci. 72:813-7.

Kang, H. W., Kwon, S. W., and Go, S. J. 2003. PCR based specific and sensitive detection of Pectobacterium carotovorum ssp. carotovorum by primers generated from a URP PCR fingerprinting derived polymorphic band. Plant Pathol. 52:127-133.

Khalil, M. I., Haque, M. E., and Hoque, M. Z. 2014. Adoption of BARI recommended potato (Solanum tuberosum) varieties by the potato growers of Bangladesh. The Agriculturists 11:79-86.

Khan, A. A., Rahman, S., and Kamaluddin, G. 1973. A preliminary survey of the diseases of potatoes in cold-storage in Bangladesh. Bangladesh J. Biol. and Agril. Sc. 2:17-18. Kim, H.-S., Ma, B., Perna, N. T., and A.O. Charkowski, A. O. 2009. Prevalence and virulence of natural type III secretion system deficient Pectobacterium strains. Appl. Environ. Microbiol. 75:4539–4549.

155

Kloepper, J. W. 1983. Effect of seed piece inoculation with plant growth promoting rhizobacteria on populations of Erwnia carotovora on potato roots and in daughter tubers. Phytopathology 73:217–9.

Kloepper, J. W., Leong, J., Teintze, M., and Schroth, M. N 1980. Enhancing plant growth by siderophores produced by plant growth-promoting rhizobacteria. Nature 286:885-886.

Koepsell, P. A. Controlling bacterial soft rot and blackleg of potatoes. Extension plant pathologist, Oregon State University. Available at https://ir.library.oregonstate.edu/xmlui/bitstream/handle/1957/24602/ECNO954.pdf?sequence =1 Kowalski, B., Jimenez, T. F., Herrera, L., and Agramonte Penalver, D. 2006. Application of soluble chitosan in vitro and in the greenhouse to increase yield and seed quality of potato minitubers. Potato Res. 49:167–176. Kowalski, B., Terry, F. J., Herrera, L., and Penalver, D. A. Potato Res. 2006. 49: 167. https://doi.org/10.1007/s11540-006-9015-0.

Kratzke, M. G., and Palta, J. P. 1986. Calcium accumulation in potato tubers: role of the basal roots. Hort. Sci. 21:1022-1024.

Krttzman, G. 1989. Detection, quantification and classification of soft rot Erwinias associated with potato tubers. Phytoparasitica 17: 205-219.

Kwon, S. W., Go, S. J., Kang, H. W., Ryu, J. C., and Jo, J. K. 1997. Phylogenetic analysis of Erwinia species based on 16S rRNA gene sequences. Int. J. Syst. Bacteriol. 47:1061–1067.

Laurila, J., Ahola, V., Lehtinen, A., and Pirhonen. M. 2008. Characterization of Dickeya strains isolated from potato and river water samples in Finland. Euro. J. Plant Pathol. 122:213–25.

Leelavathi, M. S., Vani, L., and Reena, P. 2014. Antimicrobial activity of Trichoderma harzianum against bacteria and fungi. Int. J. Curr. Microbiol. Appl. Sci. 3:96-103. Li, G .J., Dong, Q. E., Ma, L., Huang, Y., Zhu ,M. L., Ji, Y. P., Wang, Q. H., Mo, M. H. and Zhang, K. Q. 2014. Management of Meloidogyne incognita on tomato with endophytic bacteria and fresh residue of Wasabia japonica. J. Appl. Microbiol. 117:1159-1167.

156

Li, P., Wu, X. X., Wang, Z. Y., Ho, H. H., Wu, Y. X., Mao, Z. C. and He,Y. Q. 2012. First Report of Ralstonia solanacearum causing bacterial wilt of yacon in china. Plant Dis. 96:904.

Lo, C. 1998. General mechanisms of action of microbial biocontrol agents. Plant Pathology Bulletin. 7:155-166.

Lojkowska, E., and Kelman, A. 1994. Comparison of the effectiveness of different methods of screening for bacterial soft rot resistance of potato tubers. Am. J. potato Res. 71:99–113.

Lorito, M., Woo, S. L., Harman, G. E., and Monte, E. 2010. Translational research on Trichoderma: from 'omics to the field. Annu. Rev. Phytopathol. 48:395–417. Lyon, G. D., Lund, B. M., Bayliss, C. E., and Wyatt, G. M. 1975. Resistance of potato tubers to Erwinia carotovora and formation of rishitin and phytuberin in infected tissue. Physiol. Plant Pathol. 6:43-50. Ma, B., Hibbing, M. E., Kim H. S., Reedy, R. M., Yedidia, I., Breuer. J., Breuer. J., Glasner, J. D., Perna N. T., Kelman. A., and Charkowski, O. A. 2007. Host range and molecular phylogenies of the soft rot enterobacterial genera Pectobacterium and Dickeya. Phytopathology 97:1150-1163.

Mackay, J. M., and Shipton, P. J. 1983. Heat treatment of seed tubers for control of potato blackleg (Erwinia carotovora ssp. atroseptica) and other diseases. Plant Pathol. 32:385-393. Madden, L. V., Hughes, G., and van den Bosch, F. 2007. The study of plant disease epidemics. St. Paul: American Phytopathological Society. Makhlouf, A. H., and Abdeen R. 2014. Investigation on the effect of chemical and biological control of bacterial soft root disease of potato in storage. J. Biol. Agric. Healthcare. 4:31–44.

Mavrodi, O. V., Walter, N., Elateek, S., Taylor, C. G., and Okubara, P. A. 2012. Suppression of Rhizoctonia and Pythium root rot of wheat by new strains ofmPseudomonas. Biol. Control. 62:93-102.

McGuire, R. G., and Kelman, A. 1986. Calcium in potato tuber cell walls in relation to tissue maceration by Erwinia carotovora pv. atroseptica. Phytopathology 76:401-406.

McGuire, R. G., and Kelman, A. 1984. Reduced severity of Erwinia soft rot in potato tubers with increased calcium content (Doctoral dissertation, University of Wisconsin Madison).

157

McSpadden Gardener, B., Gutierrez, L. J., Joshi, R., Edema, R., and Lutton, E. 2005. Distribution and biocontrol potential of phlD+ Pseudomonads in corn and soybean field. Phytopathology 95:715-724.

Meng, X.-L., Xie, X.-W., Shi, Y.-X., Chai, A.-L., Ma, Z.-H. and Li, B.-J. 2017. Evaluation of a loop-mediated isothermal amplification assay based on hrpZ gene for rapid detection and identification of Pseudomonas syringae pv. lachrymans in cucumber leaves. J. Appl. Microbiol. 122:441–449. Minsavage, G. V., Thompson, C. M., Hopkins, D. L., Leite, R., and Stall, R. E. 1994. Development of polymerase chain reaction protocol for detection of Xylella fastidiosa in plant tissue. Phytopathology 84:456–461.

Moazzem, K. G., and Fujita, K. 2004. The potato marketing system and its changes in Bangladesh: From the perspective of a village study in Comilla district. The Developing Economies 42:63-94.

Mohsin, T., Yasmin, S., and Hafeez, F. Y. 2010. Biological control of potato black scurf by rhizospheric associated bacteria. Braz. J. Microbiol. 41:439-441.

Nabhan, S., Wydra, K., Linde, M. and Debener, T. 2011. The use of two complementary DNA assays, AFLP and MLSA for epidemic and phylogenetic studies of pectolytic enterobacterial strains with focus on the heterogeneous species Pectobacterium carotovorum. Plant Pathol. 61:498–508. Nahar, M. S., Rahman, M. A., Kibria, M. G., Rezaul Karim, A. N. M., and Miller, S. A. 2012. Use of Trichocompost and Tricho-leachate for management of soil-borne pathogens and production of healthy cabbage seedlings. Bangladesh J. Agril. Res. 37:653-664.

Naher, N., Hossain, M., and Bashar, M. A. 2013. Survey on the incidence and severity of common scab of pottao in Bangladesh. J. Asia. Soc. of Bangladesh Science. 39:35-41. Ngadze, E., Brady, C. L., Coutinho, T. A., and van der Waals, J. E. 2012. Pectinolytic bacteria associated with potato soft rot and blackleg in South Africa and Zimbabwe. Euro. J. plant pathol. 134:533-549.

Ngadze, E., Coutinho, T. A., and van der Waals, J. E. 2010. First report of soft rot potatoes caused by Dickeya dadantii in Zimbabwe. Plant Dis. 94:1263.

158

Parent, J.-G., Lacroix, M., Page, D., and Vezina. L. 1996. Identification of Erwinia carotovora from soft rot diseased plants by random amplified polymorphic DNA (RAPD) analysis. Plant Dis. 80:494–499. Parsa, S., Morse, S., Bonifacio, A., Chancellor, T. C., Condori, B., Crespo-Pérez, V., and Sherwood, S. G. 2014. Obstacles to integrated pest management adoption in developing countries. Proceedings of Nat. Aca.of Sc.. 111:3889-3894.

Pasco, C., Bozec, M., Ellisseche, D., and Andrivon, D. 2006. Resistance behavior of potato cultivars and advanced breeding clones to tuber soft rot caused by Pectobacterium atrosepticum. Potato Res. 49:91-98. C alcium content and potat Perazzolli, M., Roatti, B., Bozza, E., and Pertot, I. 2011. Trichoderma harzianum T39 induces resistance against downy mildew by priming for defense without costs for grapevine. Bio. Control. 58:74–82.

Perombelon, M. C. M. 2002. Potato diseases caused by soft rot Erwinias: an overview of pathogenesis. Plant Pathol. 51:1-12.

Perombelon, M. C. M. 1992. Potato blackleg: epidemiology, host-pathogen interaction and control. Neth. J. Plant Pathol. 98:135–146.

Perombelon, M. C. M., and A. Kelman. 1980. Ecology of the soft rot Erwinias. Annu. Rev. Phytopathol. 18:361–387.

Perombelon, M. C. M., Gullings-Handley, J., and Kelman, A. 1979. Population dynamics of Erwinia carotovara and pectolytic Clostridia in relation to decay of potatoes. Phytopathology 69:167-173.

159

Raaijmakers, J. M., and Weller, D. M., 1998. Natural plant protection by 2,4- diacetylphloroglucinol-producing Pseudomonas spp. in take-all decline soils. Mol. Plant Microbe Interact. 11:144–152.

Rahman, M., Ali, M. A., Ahmad, M. U., and Dey, T. K. 2013. Effect of tuber-borne inoculum of Rhizoctonia solani on the development of stem canker and black scurf of potato. Bangladesh J. Plant Pathol. 29:29-32.

Rasul, M. G., Islam, M. S., and Sheikh, M. H. R. 1999. Storability of different potato varieties under natural condition. Bang. J. Sc. and Ind. Res. 34: 86-90.

Reeves, A. F., Olanya, O. M., Hunter, J. H., and Wells, J. M. 1999. Evaluation of potato varieties and selections for resistance to bacterial soft rot. Am. J. Potato Res. 76:183-189.

Schaad, N. W., Jones, J. B., and Chun, W (Eds.). 2001. Laboratory Guide for Identification of Plant Pathogenic Bacteria (Vol. 373). St. Paul, Minnesota: APS press.

Shahriar, S. M., Hasan, M. K., and Kamruzzaman, M. 2013. Farm level potato (Solanum tuberosum L.) cultivation in some selected sites of Bangladesh. Bangladesh J. Agril. Res. 38:455-466. She, X. M., He, Z. F., Tang, Y. F., du, Z. G., and G. B. Lan. 2013. First report of potato blackleg disease caused by Pectobacterium atrosepticum in Guangdong China. Plant Dis. 97:1652. Shoresh, M., Harman, G. E., and Mastouri, F. 2010. Induced systemic resistance and plant responses to fungal biocontrol agents. Annu. Rev. Phytopathol. 48:21–43.

Siddique, M. N. A., Sultana, J., Huda, M. S., Abdullah, M. R. and Chowdury M. A. 2015. Potato production and management with preference to seed potato supply chain, certification and actors involve in Bangladesh. Int. J.Bus.Man. and Soc. Res. 01:01-13.d.

160

Slawiak, M., van Doorn, R., Szemes, M., Speksnijder, A. G. C. L., Waleron, M., van der Wolf, J. M., Lojkowska, E., and Schoen, C. D. 2013. Multiplex detection and identification of bacterial pathogens causing potato blackleg and soft rot in Europe, using padlock probes. Ann. Appl. Biol. 163:378–393. Sledz, W. 2015. Detection and identification of Pectobacterium and Dickeya species causing potato blackleg and tuber soft rot: a review. Anna. Appl. Biol. 166:18–38.

Sledz, W., Jafra, S., Waleron, M., and Lojkowska, E. 2000. Genetic diversity of Erwinia carotovora strains isolated from infected plants grown in Poland. EPPO Bulletin. 30:403–407. Smith, C., and Bartz, J. A. 1990. Variation in the pathogenicity and aggressiveness of strains of Erwinia carotovora ssp. carotovora isolated from different hosts. Plant Dis. 74:505–509.

Subedi, N. 2015. Characterization and management of Ralstonia solanacearum populations in South Asia (Doctoral dissertation, The Ohio State University).

Tamura, K., J. Dudley., M. Nei., and S. Kumar. 2007. MEGA 4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596–1599.

Testen, L. A. 2012. Microbial approaches to support Andean Quinoa production. (Master’s thesis, The Pennsylvania State University).

Turner, J. T., and Backman, P. A. 1991. Factors relating to peanut yield increases after seed treatment with Bacillus subtilis. Plant Dis. 75:347–353.

Tzeng, K-C., McGuire, R., and Kelman, A. 1990. Resistance of tubers from different potato cultivars to soft rot caused by Erwinia carotovora ssp. atroseptica. Am. J. Potato Res. 67:287–305.

161

Uddin, M. A., Yasmin, S., Rahman, M. L., Hossain, S. M. B., and Chowdhury, R. U. 2010. Challenges of potato cultivation in Bangladesh and developing digital databases of potato. Bangladesh J. Agril. Res. 35:453-463. Uddin, M. M., N. Akhtar., Islam, M. T., and Faruq, A. N. 2011. Effect of soil application with Trichoderma harzianum and some selected soil amendments against damping-off disease complex of potato and chili. The Agriculturists 9:106-116. van der Merwe, J. J., Coutinho, T. A., Korsten, L., and van der Waals, J. E. 2010. Pectobacterium carotovorum ssp. brasiliensis causing blackleg on potatoes in South Africa. Euro. J. Plant Pathol. 126:175–185. Van Der Wolf, J. M., Nijhuis, E. H., Kowalewska, M. J., Saddler, G. S., Parkinson, N., Elphinstone, J. G., and Waleron, M. 2014. Dickeya solani sp. nov., a pectinolytic plant- pathogenic bacterium isolated from potato (Solanum tuberosum). Int. J. Syst. Evol. Microbiol. 64: 768-74. van der Wolf, J. M., and De Boer, S. H. 2007. Bacterial pathogens of potato. In: Vreugdenhil D, ed. Potato Biology and Biotechnology: Advances and Perspectives. Delft, the Netherlands: Elsevier 595-617. van der Wolf, J. M., and De Boer, S. H. 2007. Bacterial pathogens of potato. In: Vreugdenhil D, ed. Potato Biology and Biotechnology, Advances and Perspectives. Oxford, UK: Elsevier, 595–619.

Waleron, M., Waleron, K., and Lojkowska, E. 2014. Characterization of Pectobacterium carotovorum ssp. odoriferum causing soft rot of stored vegetables. Euro. J. Plant Pathol. 139:457–469. Walker R., Morris S., Brown P., and Gracie, A. 2004. Evaluation of potential for chitosan to enhance plant defense. A Report for the Rural Industries Research and Development Corporation, Australia, RIRDC Publication No. 04. Wichterman, R. 2012. The biology of Paramecium. Springer Science & Business Media.

Workman, M., and Holm, D. G. 1984. Potato clone variation in blackspot and soft rot susceptibility, redox potential, ascorbic acid, dry matter and potassium. Am. J. Potato Res. 61:723-733. Wright, P. J., Triggs, C. M., and Anderson, J. A. D. 2005. Effects of specific gravity and cultivar on susceptibility of potato (Solanum tuberosum) tubers to blackspot bruising and bacterial soft rot. New Zeal. J. Crop and Hort. 33:353-361. Wright-Dobrzeniecka, Sandra. 1989. A comparative study of methods for diagnosing bacterial stem and leaf rot of dieffenbachia and potato blackleg, and an evaluation of their possible application in the potato micro-propagation programme. Page 88. Sveriges lantbruksuniversitet, Institutionen för växt-och skogsskydd. Wyenandt, Andy. 2016. Plant and pest advisory, Rutgers cooperative extension. https://plant- pest-advisory.rutgers.edu/dickeya-dianthicola-update-81016.

162

Xia, Z. Y., and Mo, X. H. 2007. Occurrence of blackleg disease of tobacco caused by Pectobacterium carotovorum ssp. carotovorum in China. Plant Pathol. 56:348. Xu, G. W., and Gross, D. C. 1986. Field evaluations of the interactions among fluorescent Pseudomonads, Erwinia carotovora, and potato yields. Phytopathology 76:423-430.

163

Appendix A: Blackeg and soft rot survey questionnaire

Date of Interview______Enumerator’s Name______

Region______Division______Upazilla______

Ward______Village______

Sex Age Marital status Educational level Female 18-33 Single No formal education Male 34-49 Married Primary school 50-65 Widowed Secondary Tertiary

1. How many years have been growing potatoes? ______2. How much land do you have? ______3. How much land for potato production? ______4. What crops do you rotate with?______5. What potato cultivars do you grow?______6. Are the potatoes irrigated? ______How often? ______7. Where do you get seeds? ☐Dealer ☐saved own seeds ☐local market ☐other, specify 8. How do you select cultivars? ☐ Yield ☐Tuber size ☐ Tuber shape ☐Taste ☐ Disease resistance ☐ Insect resistance ☐Availability of seeds ☐ Drought resistance ☐other, specify 9. What are the five most important things you would prefer when collect seeds of potato?______10. What is the yield and price of potatoes (tons and $)? ☐In a good year- ______☐in a bad year ______11. Where do you sell your potatoes? ☐Village market ☐neighbors ☐roadside ☐ middle man ☐other, specify

164

12. What are the intercultural operations you do in the field?______

13. Which of the following limits your profit from potato the most? (Pick 3)

☐Weeds ☐ Insects ☐Diseases ☐Unproductive Soils ☐Unproductive Varieties ☐Poor Seeds ☐Drought ☐Postharvest Loss ☐Market Access ☐Other, Specify______

14. What are the five most important diseases you notice in the field? ______

15. What are the diseases you notice in the storage? ______

16. Are you familiar with blackleg?______

17. Are you familiar with soft rot of potato? ______

18. What do you do to manage blackleg/soft rot in field?______

19. What do you spray and how often?

20. What do you do to manage soft rot in storage? ______

21. What do you do with the tuber after harvesting?

22. What are the sources of water? ☐Nearby canal ☐river ☐ponds ☐ deep tube well

23. Where do you store tuber?______

24. How often do you examine the potatoes for soft rot disease? Fortnightly ☐ once in a month ☐ More than a month ☐ never

25. Have you heard about any biocontrol agents or bio chemical compound to control soft rot disease? ______

If yes, what is the name of that agent or compound______

26. Please evaluate the potato cultivars that you are familiar with for their susceptibility to soft rot disease?

1= resistant; 2= moderately resistant; 3= moderately susceptible; 4= susceptible

165

Cultivar Soft rot (post Blackleg (in the Soft rot (post harvest) planting) field)

27. What are the estimated yield losses (in $ or %) of potatoes due to soft rot?

Diseases Yield Loss ($) Yield Loss (%) a. Soft rot (seed piece decay, post planting) b. Blackleg (in the field) c. Soft rot (in the filed and post harvest)

166