Carcinogenesis AdvanceCarcinogenesis Access published May 19, 2012
Dynamic activation of the key pathways: linking colitis to colorectal cancer in a mouse model
Journal:For Carcinogenesis Peer Review Downloaded from Manuscript ID: CARCIN 2012 00193.R1
Manuscript Type: Original Manuscript
Date Submitted by the Author: 29 Apr 2012
Complete List of Authors: Tang, Anliu; The Third Xiangya Hospital of Central South University, http://carcin.oxfordjournals.org/ Department of Gastroenterology Li, Nan; The Third Xiangya Hospital of Central South University, Department of Gastroenterology Li, XiaYu; The Third Xiangya Hospital of Central South University, Department of Gastroenterology Yang, Hongyuan; The Third Xiangya Hospital of Central South University, Department of Gastroenterology; Weifang People's Hospital, Department of Infection Wang, Wei; The Third Xiangya Hospital of Central South University, Department of Gastroenterology by guest on November 20, 2015 Zhang, Liyang; Central South University, Cancer Research Institute Li, Gui Yuan; Center South University, Cancer Research Institute Xiong, Wei; Central South University, Cancer Research Institute Ma, Jian; Central South University, Cancer Research Institute Shen, Shou; Central South University, Department of Digestive, The Third Affiliated Hospital of Xiang Ya School of Medicine
Keywords: colitis associated cancer, NF κB, STAT3, p38 MAPK, Wnt/β catenin
Page 1 of 98 Carcinogenesis
1 1
2 3 4 Dynamic activation of the key pathways: linking colitis to colorectal 5 6 cancer in a mouse model 7 8 9 Anliu Tang1,2*, Nan Li1,2*, Xiayu Li1,2, Hongyuan Yang1,2§, Wei Wang1,2, Liyang Zhang3, 10 11 Guiyuan Li2,3, Wei Xiong2,3, Jian Ma2,3#, and Shourong Shen1,2 # 12 13 14 1Department of Gastroenterology, The Third Xiangya Hospital of Central South University, 15 16 Changsha, Hunan, China 17 18 For Peer Review 19 2Hunan Key Laboratory of Nonresolving Inflammation and Cancer Downloaded from 20 21 3 22 Cancer Research Institute, Central South University; Key Laboratory of Carcinogenesis, 23
24 Ministry of Health; Key Laboratory of Carcinogenesis and Cancer Invasion, Ministry of http://carcin.oxfordjournals.org/ 25 26 Education, Changsha, Hunan, China. 27 28 29 *These two authors equally contributed to this work. 30 31 §Current address: Department of Infection, Weifang People's Hospital, Weifang, Shandong, 32
33 by guest on November 20, 2015 China. 34 35 36 Number of the text page: 24 37 38 39 Number of figures: 5 40 41 Running title: Key pathways in colitis-associated cancer 42 43 #To whom correspondence should be addressed. Jian Ma. Tel& Fax: +86 731 82355401; 44 45 46 Email: [email protected]. Correspondence may also be addressed to Shourong Shen. Tel: +86 47 48 731 84805383; Email: [email protected] 49 50
51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 2 of 98
2 1
2 3 Abstract 4 5 6 7 An association between carcinogenesis and inflammation has long been appreciated. 8 9 10 Chemically induced colitis-associated cancer (CAC) is a classical mouse model for 11 12 13 investigating “inflammation-cancer link” in the intestine. Diverse mechanisms behind this 14 15 16 nonresolving inflammation model have been reported before, most of them were emphasized 17 18 For Peer Review 19 on key cancer genes, cytokines, and signal transduction abnormality based on prior Downloaded from 20 21 22 knowledge. In the present study, we dynamically and globally dissect the alteration of key 23
24 http://carcin.oxfordjournals.org/ 25 pathways in the development from colitis to colorectal cancer. Striking evidence from gene 26 27 expression profiling, serum cytokines detection, and immunohistochemistry analysis all 28 29 30 reveals that different key pathways (NF-κB, STAT3, p38 MAPK and Wnt/β-catenin signaling) 31 32 33 and their target genes are hyperactive in different phases of the inflammation-cancer link. NF- by guest on November 20, 2015 34 35 36 κB and STAT3 signalings are hyperactive in the whole process, while p38 MAPK and Wnt/β- 37 38 39 catenin signaling are only hyperactive in the beginning and ending, respectively. Through this 40 41 42 unbiased system biological approach, we provide strong evidence that different key pathways 43 44 45 are specifically involved in different phases which bridge the gap between inflammation and 46 47 48 cancer. 49 50 51 Keywords: nonresolving inflammation, colitis-associated cancer, NF-κB, STAT3, p38 52 53 54 MAPK, Wnt/β-catenin 55 56 57 58 Running title: Key pathways in colitis-associated cancer 59 60 Page 3 of 98 Carcinogenesis
3 1
2 3
4 5 6 7 8 9 Introduction 10 11 12 Inflammation plays important roles at different stages of carcinogenesis, from cancer 13 14 initiation, to invasion and metastasis (1). Nonresolving inflammation makes individuals 15 16 susceptible to many forms of cancer (2). “Inflammation-cancer link” is a complex and 17 18 multistep process.For Global dissection Peer of this process Review in different disease models could promote 19 Downloaded from 20 our understanding on inflammation and cancer, as well as improve medical professional’s 21 22 awareness on inflammation prevention and treatment. 23
24 http://carcin.oxfordjournals.org/ 25 Colitis-associated cancer (CAC), arising as a result of the “inflammation-dysplasia- 26 27 carcinoma” sequence (3), has been widely studied as a model for inflammation-cancer link. 28 29 Key oncogenes and tumor suppressor genes mutations (p53, k-RAS, APC etc), hyper- 30 31 activation of inflammation cytokines (IL-6, IL-1 and TNF-α) and pathways (NF-κB and 32
33 STAT3) (4,5,6,7), have been revealed and confirmed to be distinct important in CAC by guest on November 20, 2015 34 35 development. Abnormal signal transduction contributes substantially to the hallmarks of 36 37 cancer (8) as well as inflammation. In this study, by using a chemically induced CAC mouse 38 39 model, we dynamically and globally dissected the alteration of key pathways in the 40 41 “inflammation-low grade dysplasia-high grade dysplasia-carcinoma” sequence, and found 42 43 that different key pathways (NF-κB, STAT3, p38 MAPK and Wnt/β-catenin signaling) and 44 45 their target genes were hyperactive in different phases of the inflammation-cancer link, both 46 47 in mRNA levels and protein levels. Even the serum protein levels of signaling molecules that 48 49 participate in these specific pathways also altered in different phases. NF-κB and STAT3 50 51 signalings are hyperactive in the whole process, while p38 MAPK and Wnt/β-catenin 52 53 signaling are only hyperactive in the beginning and ending, respectively. Gene expression 54 55 profiling revealed that the most dramatic changes happened in the beginning of the 56 57 inflammation-cancer link, which may imply that on the resolution of inflammation, the 58 59 60 Carcinogenesis Page 4 of 98
4 1
2 3 beginning programs the end. The current study provides new insights into the dynamic 4 5 molecular and signaling changes in the development of colitis-associated cancer and suggests 6 7 8 that alteration of key pathways links colitis to colorectal cancer. 9 10 Materials and methods 11 12 13 Animals and Experimental procedure 14 15 16 Five-week-old male ICR mice were intraperitoneal injected with a single dose of 10 mg/kg 17 18 AOM (Sigma-Aldrich,For St. Louis,Peer MO) on Day Review 1, followed by three cycles of DSS (MP 19 Downloaded from 20 Biomedicals, Solon, OH. MW 36-50 kDa) administration (cycle 1: 2%, 7 days; cycle 2: 1.5%, 21 22 5 days, and cycle 3: 1.5%, 5 days), then distilled water until the end of the experiment on Day 23
24 140. Two groups of mice were sequentially sacrificed randomly at day 14, 28, 42, 56 and 140 http://carcin.oxfordjournals.org/ 25 26 (at the end of the 2nd, 4th, 6th, 8th, and 20th week), and each time point at least 5 mice were 27 28 sacrificed for each group. Experimental procedure was shown in Figure 1A. All mice 29 30 procedures were performed in accordance with institutional guidelines. 31 32
33 Sample preparation by guest on November 20, 2015 34 35 36 Serum from each mouse was collected for inflammatory cytokines detection. The large 37 38 bowels were removed and cut open longitudinally along the main axis and flushed with saline. 39 40 The masses, inflamed and normal colonic mucosae were cut and immediately placed in 5 41 42 volumes of RNAlater (Ambion, Austin, TX), then stored in liquid nitrogen for RNA 43 44 extraction. The other part of the large bowel was fixed as Swiss-roll in 4% paraformaldehyde 45 46 overnight. Paraffin-embedded sections (4 m) of the large bowel were then made by routine 47 48 procedures for histopathological analysis and Immunohistochemistry. 49 50 51 RNA extraction and purification 52 53 Total RNA was isolated using Trizol or PureLink RNA Mini Kit (Invitrogen, Carlsbad, CA) 54 55 following manufacturer recommendations. Quality of RNA was examined by gel 56 57 electrophoresis and the Agilent 2100 bioanalyzer (Agilent, Santa Clara CA). 58 59 60 Page 5 of 98 Carcinogenesis
5 1
2 3 Quantitative Real-time reverse transcription PCR (qPCR) 4 5 6 qPCR was performed using SYBR Green Master Mix. The primers for Il6, Il10, csf3, Il1b, 7 8 Cxcl1, Cxcl2, Mmp3, Mmp9, Spp1, S100a8, S100a9, Saa3, Cxcl5, Mmp7 and Postn were 9 10 synthesized as shown in Supplementary Table 1. qPCR was performed on the IQ5 Real-Time 11 12 PCR detection System (Bio-Rad, Hercules, CA). The data were analyzed using IQ5 software. 13 14 The relative gene expression was quantified based on the threshold cycle value and 15 16 normalized to the housekeep gene Gapdh (n≥5). 17 18 For Peer Review 19 cDNA Microarray analysis Downloaded from 20 21 22 For each group, at each time point, three mice’s RNAs were detected for gene expression 23
24 profiling separately. Biotinylated cRNA were prepared according to the standard Affymetrix http://carcin.oxfordjournals.org/ 25 26 (Affymetrix, Santa Clara, CA) protocol from 1 g total RNA. Following fragmentation, 15 g 27 28 of cRNA were hybridized for 16 hr at 45°C on GeneChip mouse 430 2.0 Genome Array (with 29 30 45,101 probes). GeneChips were scanned using the GeneChip Scanner 3000. The data were 31 32 analyzed with Microarray Suite version 5.0 using Affymetrix default analysis settings and
33 by guest on November 20, 2015 34 global scaling as normalization method. The trimmed mean target intensity of each array was 35 36 arbitrarily set to 500. These data along with design parameters have been deposited in NCBI’s 37 38 Gene Expression Omnibus and are accessible through GEO Series accession number 39 40 GSE30016 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE31106 ). 41 42 43 Identification and bioinformatic analysis of differentially expressed transcripts 44 45 46 Group differences in the tested samples were analyzed with the SAM (Significance Analysis 47 48 of Microarrays) 3.11 algorithm (http://www-stat.stanford.edu/~tibs/SAM/). Unsupervised 49 50 hierarchical clustering of filtered, normalized, and mean-centered log2-transformed data was 51 52 performed by using Gene Cluster 3.0 with an average linkage clustering method, and viewed 53 54 by using TreeView version 1.60. We used GSEA (Gene Set Enrichment Analysis) (9) 55 56 (http://www.broadinstitute.org/gsea/index.jsp) to compute gene set enrichment for gene 57 58 ontology annotations of our data, and visualized the enrichment results as an Enrichment Map 59 60 Carcinogenesis Page 6 of 98
6 1
2 3 (10) (http://baderlab.org/Software/EnrichmentMap/), a Cytoscape (11) 4 5 (http://www.cytoscape.org/) plugin for functional enrichment visualization. Moreover, to 6 7 8 compare our data to the data that based on the human inflammatory bowel disease and 9 10 colorectal cancer, or search on the similarities of the gene expression of DSS only treated 11 12 mice, we downloaded two datasets from the NCBI’s GEO with the GEO Series accession 13 14 number GSE4183 and GSE 22307 15 16 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE4183, 17 18 http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE22307).For Peer Review Finally, Kyoto 19 Downloaded from 20 Encyclopedia of Genes and Genomes (KEGG) database were used for signaling pathway 21 22 analysis on differentially expressed genes by CapitalBio Molecule Annotation System (MAS) 23
24 V3.0. P-value heatmap was generated for visulizing the pathway enrichment analysis. http://carcin.oxfordjournals.org/ 25 26 27 Histopathological analysis and Immunohistochemistry 28 29 Paraffin-embedded sections were stained with hematoxylin and eosin. Colonic mucosa 30 31 dysplasia (low and high grade) and adenocarcinomas were diagnosed according to the criteria 32
33 by guest on November 20, 2015 described by Boivin et al (12). Immunohistochemistry was carried out on 4-µm-thick 34 35 paraffin-embedded sections from the colorectums in mice. The deparaffinized sections were 36 37 38 incubated with primary antibody at 4°C overnight followed by incubation with Biotinylated 39 40 Goat Anti-Rabbit or Mouse IgG Antibody (Vector Laboratories, Burlingame, CA) for 30 min. 41 42 Primary antibodies were purchased from the listed vendors: p65 (Santa Cruz, CA); p-STAT3, 43 44 β-catenin, PCNA, Bcl-xL and COX-2 (Cell Signaling Technology, Danvers, MA); p52 and p- 45 46 p38 (Boster, Wuhan, China). Omission of the primary antibody was used as negative control. 47 48 The immunostained slides were observed under a microscope. Images were taken by a digital 49 50 camera and semi-quantity of the signal was analyzed by counting mean density of the 51 52 immunoreactivities against all primary antibodies. Brown or yellow was regarded as positive 53 54 signal. Image data were analyzed with NIS-Elements AR 3.0 software (Nikon, Japan). 55 56 57 Inflammatory protein array 58 59 60 Page 7 of 98 Carcinogenesis
7 1
2 3 Comprehensive analysis of inflammatory protein levels were performed by using 4 5 commercially available RayBio Mouse Inflammation Antibody Array 1 (40) (RayBiotech Inc. 6 7 8 Norcross, GA) as previously discribed (13). Briefly, for each sample one nitrocellulose 9 10 membrane, each containing 40 different antibodies in duplicate spots, were blocked, 11 12 incubated with appropriately diluted sera (pooled of 5 mice blood per group, the initiate 13 14 amount of pooled blood was 250 l), washed, and then incubated with a cocktail of biotin- 15 16 conjugated antibodies specific for the different proteins. The chemiluminescent signal was 17 18 detected using aFor CCD imaging Peer system (Alpha Review Innotek FluoChem, San Leandro, CA). The 19 Downloaded from 20 resulting images were analyzed using Quantity One software (Bio-Rad) to measure 21 22 expression of various cytokines. Positive control spots and negative control spots within the 23
24 membranes were used to normalize the results from different membranes being compared. http://carcin.oxfordjournals.org/ 25 26 27 28 29 Results 30 31 32 1. Gene set enrichment analysis depicted a dynamic molecular and functional landscape
33 by guest on November 20, 2015 34 of the link between inflammation and cancer 35 36 Many previous studies on AOM/DSS-induced CAC mouse model focused on some 37 38 oncogenes and tumor suppressor genes, cytokines and chemokines, as well as key signalings. 39 40 Indeed, this model presented “inflammation - low grade dysplasia - high grade dysplasia - 41 42 43 carcinoma” sequential pathological process (Figure 1C), and with a relatively high level of 44 45 Disease Activity Index (14) compared with their normal littermates (Figure 1D). These 46 47 pathology processes closely mimicked human ulcerative colitis and CAC. So we used it to 48 49 dynamically dissecting the molecular events which links the colitis and CAC through a global 50 51 and unbiased approach by means of high-throughput gene expression profiling at different 52 53 time points of the inflammation-cancer link. 54 55 Gene expression profiling was performed on colon tissues from five time points (at the end 56 57 of the 2nd, 4th, 6th, 8th and 20th week, respectively) of AOM/DSS treated cohorts, and one 58 59 60 Carcinogenesis Page 8 of 98
8 1
2 3 time point (at the end of the 2nd week) from control cohorts (see experimental procedure in 4 5 Figure 1A). At each time point, three mice’s sample had been analyzed for expression 6 7 8 profiling by Affymetrix mouse 430 2.0 Genome Array (45,101 probes). 9 10 Histopathological changes of each sample were identified under microscope with H&E 11 12 staining. Corresponding to each time point, samples collected at the end of the 2nd week were 13 14 pure inflamed mucosae, the 4th week were low grade dysplasias, the 6th week were high 15 16 grade dysplasias, the 8th week high grade dysplasias with moderate to severe inflammation, 17 18 and the 20th weekFor were adenocarcinomas Peer (Figure Review 1B, C and D). 19 Downloaded from 20 SAM algorithm was used to analyze gene expression profiles changes in the different time 21 22 points. Probe sets with q-value(%) ≤ 5 and fold change ≥2 or ≤0.5 were chosen for further 23
24 analysis. Compared with normal colon mucosa, a storm of gene expression changing burst at http://carcin.oxfordjournals.org/ 25 26 the end of the 2nd week of AOM/DSS group (i.e. acute inflammation period), as 2245 probe 27 28 sets showed significantly elevated expression and 2294 probe sets were down-regulated in the 29 30 inflamed mucosae. This changing was extremely greater than other time points. The number 31 32 of probe sets up/down regulation between each group had been shown in Supplementary 33 by guest on November 20, 2015 34 Figure S2A. Some of the significantly expressed genes (il6, csf3, Cxcl1, Mmp3, S100a8, 35 36 Postn, et al.) had been validated by qPCR (Supplementary Figure S2B). 37 38 39 Since little changes occurred among the last three time points, with related pathological 40 41 diagnosis with high grade dysplasia and adenocarcinoma, the CAC carcinogenesis process 42 43 was divided into three distinguished phases in our study, named “inflammatory phase” (the 44 45 2nd week), “low grade dysplastic phase” (the 4th week), and “high grade 46 47 dysplastic/cancerous phase” (the 6th~20th week). The latter two collectively named 48 49 “neoplastic phase”. 50 51 To define a integrity view of the gene ontology (biological processes, molecular function, 52 53 and cellular component) changes among the inflammation-cancer link, we used GSEA to 54 55 compare gene set enrichment for inflammatory phase (the 2nd week) and neoplastic phase 56 57 (the 6th week), then visualized the gene set enrichment results as a single integrated 58 59 60 Page 9 of 98 Carcinogenesis
9 1
2 3 enrichment map (10) (Figure 2), as to simplify identification both similarities and differences 4 5 between inflammation and tumor. The node center and node border color represents the 6 7 8 enrichment obtained for the inflammatory phase and the neoplastic phase, respectively. 9 10 Uniform up-regulation of biological processes such as Apoptosis, Neural system development, 11 12 Actin cytoskeleton organization, and down-regulation of Transmembrane transporter activity, 13 14 Generation of precursor metabolites and energy, Oxidoreductase activity were observed in 15 16 both inflammatory and neoplastic phase. The differentially expressed genes in Apoptosis 17 18 annotated to the ForGO terms Positive Peer regulation Reviewof apoptosis process and Negative regulation 19 Downloaded from 20 of apoptosis process compared to the normal controls at each time point were shown in 21 22 Supplementary Figure S3. 23
24 Other gene sets enriched in this map mainly activated in the inflammatory phase, such as http://carcin.oxfordjournals.org/ 25 26 Protein kinase cascade, in which components of MAPK and NF-κB signaling were 27 28 significantly elevated in this phase, suggesting these pathways were highly activated from the 29 30 very start. Gene sets included Response to external stimulus, Inflammatory response and 31 32 Response to wounding were persistent till the neoplastic phase, while Regulation of response 33 by guest on November 20, 2015 34 to stimulus and Regulation of immune response seems failed after tumors formed. 35 36 Homeostatic process was an erratic one, as the Hemostasis, Cellular cation homeostasis, 37 38 Homeostasis of number of cells, and Regulation of body fluid level/blood pressure activated in 39 40 the inflammatory phase, they became nonresponsive in the neoplastic phase. Further, the 41 42 signaling pathways that regulate these biological effects brought to our attention. 43 44 45 46 47 2. Sequential activated key pathways drove the initiation and progression of CAC 48 49 Signaling pathways are the main ways for genes to perform a variety of biological functions. 50 51 As we found the functional gene sets changed between inflammation and cancer, we presume 52 53 that chronic inflammation and cancer arise from dysfunction of multiple key pathways. 54 55 Differentially altering pathways in each time point were analyzed by Molecule Annotation 56 57 System (MAS) 3.0 (http://bioinfo.capitalbio.com/mas3/) based on Kyoto Encyclopedia of 58 59 60 Carcinogenesis Page 10 of 98
10 1
2 3 Genes and Genomes (KEGG) database. Pathway enrichment analysis was shown as a p-value 4 5 heatmap, which implied changed activity of the specific interested pathways that play a 6 7 8 distinct role at different stages of CAC (Figure 3). The representative gene lists of the 9 10 activated pathways in each time point were shown in Supplementary Table S2. 11 12 Pathways such as Cytokine-cytokine receptor interaction, Cell communication, 13 14 Complement and coagulation cascades, Hematopoietic cell lineage, and Leukocyte 15 16 transendothelial migration were activated from inflammation to cancer, highlighted the key 17 18 roles of inflammationFor and immunePeer system inReview tumorigenesis. Toll-like receptor signaling 19 Downloaded from 20 pathway and VEGF signaling pathway were activated mainly in the inflammatory phase. 21 22 Although Jak-STAT signaling pathway only significantly activated at very early time point in 23
24 mRNA level, we detected persistent activation of STAT3 by immunohistochemistry (see http://carcin.oxfordjournals.org/ 25 26 below, as well as Supplementary Figure S4). Most noteworthy was Wnt signaling pathway, 27 28 though appeared activated in early stage, the inhibitors of this pathway, WIF and SFRPs, were 29 30 also activated significantly before high grade dysplasitic phase, which implies Wnt signaling 31 32 is hyperactive only when high grade dysplasia presented. Some signaling pathways related to 33 by guest on November 20, 2015 34 carcinoma, such as Basal cell carcinoma, Melanoma and Colorectal cancer, et al. were 35 36 dramatically changed in tumors as well (data not shown). NF-κB signaling pathway is not an 37 38 independent pathway in the KEGG database, so, it has not been shown in the heatmap, 39 40 however, the downstream target genes of this pathway were strikingly differentially expressed 41 42 in the whole process of CAC carcinogenesis, such as Cxcl1 (15), Il1b (16), Il6 (17), Csf3 (18), 43 44 Vcam1, Icam1 (19), Egfr (20), S100a8, S100a9 (21), Cd40 (22), etc. p38 MAPK signaling 45 46 was up-regulated in the inflammatory and low grade dysplastic phases, but backed to normal 47 48 level in the high grade dysplastic and cancerous phase. 49 50 51 Further more, expression levels at each time points of the genes involved in the Cytokine- 52 53 cytokine receptor interaction and Wnt signaling pathway were shown in Figure 3B. Some of 54 55 the important genes were confirmed by qPCR (Figure 3C and Supplementary Figure S2). The 56 57 target genes of NF-κB pathway, STAT3 pathway, p38 MAPK pathway and Wnt signaling 58 59 60 Page 11 of 98 Carcinogenesis
11 1
2 3 pathway were listed in the Supplementary Table S3~S6, respectively, and discussed in Figure 4 5 5. 6 7 8 As shown in the Supplementary Table S2, multiple and different pathways were 9 10 hyperactive in different disease phases, while in different phases, the genes (i.e. differentially 11 12 expressed genes compared with control group) involved in the same pathways are varied, 13 14 which implicated the regulatory outcomes of the same signaling pathway may varied in 15 16 different phases and may have different functions among the link between inflammation and 17 18 cancer. For Peer Review 19 Downloaded from 20 21 22 3. Key molecules of specific signaling pathways in protein level in the colorectum with 23
24 http://carcin.oxfordjournals.org/ different pathological stages 25 26 27 Proteins are the ultimate enforcer of signaling pathways. To confirm the signaling 28 29 abnormality observed in mRNA levels, we tested the related protein levels in different time 30 31 points along the inflammation-cancer progression. We assayed five signaling pathways 32
33 enriched in the mRNA expression profiles, the canonical NF-κB pathway, alternative NF-κB by guest on November 20, 2015 34 35 pathway, STAT3 pathway, p38 MAPK pathway and Wnt/β-catenin signaling pathway 36 37 through immunohistochemistry detection of p65, p52, p-STAT3, p-p38, and β-catenin, 38 39 respectively (Supplementary Figure S4). 40 41 Expression of p65 and p-STAT3 were increased in both epithelial cells and stromal cells. 42 43 The expression level and localization of p65 and p-STAT3 changed along with the course of 44 45 colitis-associated carcinoma development, implied persistent activation of canonical NF-κB 46 47 and STAT3 signaling in both epithelial cells and stromal cells. Alternative NF-κB signaling 48 49 pathway were mainly activated in the inflammatory cells as the immunopositive staining of 50 51 p52 located in nuclears of stromal cells infiltrated in the mucosa and submucosa. No p52 52 53 staining was observed in normal/transformed epithelial cells, which suggested alternative NF- 54 55 κB signaling is only hyperactive in the inflammatory cells. Phosphorylated p38 (p-p38) was 56 57 highly expressed both in the nuclears of epithelial cells and stromal cells in the inflammatory 58 59 60 Carcinogenesis Page 12 of 98
12 1
2 3 phase. Whereas p-p38 was moderately expressed by dysplastic colonic epithelium, 4 5 adenocarcinoma showed dramatically reduced expression by the malignant epithelial cells, 6 7 8 implied that p38 MAPK signaling is back to normal levels when cancer had been established 9 10 in this model. β-catenin was restricted to cell membrane in noncancerous epithelial cells 11 12 whereas carcinoma cells and part of early phase inflammatory cells showed cytoplasmic 13 14 redistribution and exclusive nuclear staining, suggested that Wnt signaling was mainly up- 15 16 regulated in the late phase of the inflammation-cancer link. 17 18 The graduallyFor strengthened Peer immunopositivity Review in the nucleus of proliferating cell nuclear 19 Downloaded from 20 antigen (PCNA), reflected both DNA synthesis and DNA repair were increased during the 21 22 process of inflammation to cancer. In addition, the crucial downstream targets of both p65 23
24 and STAT3 signaling, COX-2 and Bcl-xL, also elevated significantly during this process same http://carcin.oxfordjournals.org/ 25 26 to the above observation on p65 and p-STAT3. 27 28 29 30 31 4. Serum signaling protein expression profiles validated the major pathways activated 32
33 during colitis-associated carcinogenesis by guest on November 20, 2015 34 35 Striking changes of the key signalings happened in the intestine revealed their importance in 36 37 colitis-associated carcinogenesis. We hypothesized that the characteristic changes of 38 39 inflammation cytokines and chemokines in blood could reflect the disease status, generating a 40 41 detectable stage-specific molecular phenotype. For this reason, we measured 40 cytokines and 42 43 chemokines levels in the blood samples of AOM/DSS treated mice and controls at serial time 44 45 points with the RayBio Mouse Inflammation Antibody Array. 46 47 Surprisingly, NF-κB, STAT3 and/or p38 MAPK signaling pathway dependent cytokines, 48 49 such as IL-1β, IL-6, KC/CXCL1 (23,24,25), Eotaxin (26) and Eotaxin-2, were especially up- 50 51 regulated in the inflammatory phase, the cytokines that activated or regulated by both Wnt/β- 52 53 catenin signaling and NF-κB, such as granulocyte-macrophage colony stimulating factor 54 55 (GM-CSF) (27), granulocyte colony stimulating factor (G-CSF) (28), SDF-1/CXCL12 (29), 56 57 RANTES/CCR5 (30) were up-regulated in different phases of CAC, but especially in the high 58 59 60 Page 13 of 98 Carcinogenesis
13 1
2 3 grade dyspliastic/cancerous phase (Figure 5). These results well matched pathway changes 4 5 detected in the intestine (Figure 3 and Supplementary Figure S4), and also confirmed 6 7 8 dynamic activation of the key pathways link inflammation and cancer in the CAC model. 9 10 11 12 5. Cross-species expression profiles comparison of mouse and human intestine diseases 13 14 As a mutagen, the role of single low dose of AOM treatment in inflammation promoted 15 16 carcinogenesis has not been shown. So we compared the inflammation phase (DSS treated at 17 18 day 7) For of ourPeer data Review with another research data 19 Downloaded from 20 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE22307), which was derived from 21 22 the C57BL/6J mice’s colon tissue treated with 3% DSS on day 6. The enriched gene sets were 23
24 http://carcin.oxfordjournals.org/ surprisingly similar (Supplementary Figure S5), which indicated this model has good stability 25 26 and reproducibility. What is more, the carcinogen AOM may minimally affect the molecular 27 28 29 function in the inflammatory phase. 30 31 We next used GSEA to compare the expression profiles of mouse model with human 32
33 beings, by using expression profile dataset GSE4183 of human inflammatory bowel disease by guest on November 20, 2015 34 35 (IBD) and sporadic colorectal carcinoma (SCC) 36 37 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE4183). Due to more serious 38 39 inflammation, the current CAC mouse model presented more obvious gene sets variation, 40 41 though most gene sets were, on the whole, the same as human IBD, e.g. Response to external 42 43 stimulus, Cytokine Activity, Homeostasis, Apoptosis, Angiogenesis and Protein kinase 44 45 cascade (Supplementary Figure S6A). On the other hand, only part of gene sets such as 46 47 Apoptosis, Angiogenesis and Protein dimerization activity were up-regulated in both mouse 48 49 CAC model and human SCC, gap between these two process was widening, as Response to 50 51 stimulus, Cell-cell signaling, Homeostasis, Kinase regulator activity, et al. (Supplementary 52 53 Figure S6B) were highly enrichment in the CAC mouse model but unremarkable in human 54 55 SCC. 56 57 58 59 60 Carcinogenesis Page 14 of 98
14 1
2 3 This expression profiles comparison revealed the CAC mouse model can well mimic 4 5 human IBD. Otherwise, the molecular mechanism underlying IBD-associated cancer is 6 7 8 different from the SCC. We presumed the obvious differences between CAC and SCC mostly 9 10 due to the inflammatory background existed in the CAC mouse model. 11 12 13 14 Discussion 15 16 Nonresolving inflammation like IBD is associated with an increased incidence of colorectal 17 18 cancer (31). It hasFor been widely Peer accepted that inflammationReview plays a critical role in colorectal 19 Downloaded from 20 cancer initiation, promotion and progression. As a multistage disease that has been defined as 21 22 an “inflammation-low grade dysplasia-high grade dysplasia-carcinoma” sequence, 23
24 http://carcin.oxfordjournals.org/ mechanisms underlying CAC development seems complicated for there is no clear genetic 25 26 basis has been identified to explain colorectal cancer predisposition in IBD. 27 28 29 AOM/DSS induced CAC mouse model has been used to elucidate the mechanisms and test 30 31 the therapeutic effects of CAC. By taking advantage of this chemically induced CAC mouse 32
33 model, we employed a global view and a time-course manner to dissect the molecular events by guest on November 20, 2015 34 35 bridging the gap between inflammation and cancer. 36 37 Gene expression profiling and GSEA of different time points found that different key 38 39 pathways were dynamically altered during the “colitis-low grade dysplasia-high grade 40 41 dysplasia-carcinoma” process. What’s more, the different downstream targets of the same 42 43 pathway may also express differently in each disease stages, implying the same pathway can 44 45 have different outcomes in distinct pathological environment. 46 47 In response to attack, the body activated a complex series of responses that lead to the 48 49 50 local and systemic induction of a broad spectrum of defenses. p38 MAPK, NF-κB, and 51 52 STAT3 signaling were mainly involved in early stages when external stimulation occurs. 53 54 Stimuli from chemical (such as DSS) and intestinal microbiota forced the body came into an 55 56 emergency status with a huge amount of genes expression been changed, especially the genes 57 58 involved in inflammatory response and immune defense (“inflammation cytokines storm”), to 59 60 Page 15 of 98 Carcinogenesis
15 1
2 3 protect body from excessive damage. Indeed, with enterocyte-specific deletion of IKKβ, mice 4 5 showed more severe inflammatory damage when treated by DSS than littermate controls (32). 6 7 8 However, under the persistent stimulation (three cycles of DSS treatment), inflammation 9 10 and immune response were prolonged, leading to repeated destruction and reproduction. Self- 11 12 adjustment capability such as regulation of apoptosis (both positive and negative) was strong 13 14 at an early stage, but prompted to be unbalanced to favor transformed cell survival with 15 16 disease progression (Supplementary Figure S3). Under this condition, inflammation turned to 17 18 be chronic and For nonresolved. Peer In both gene expression Review profiling and immunohistochemistry 19 Downloaded from 20 analysis, MAPK signaling activated through p38 protein from the inflammatory phase to the 21 22 low grade dysplastic phase. p38 MAPK can promote inflammation and crosstalk with NF-κB 23
24 and STAT pathway as well (33). These pathways would activate the transcription of http://carcin.oxfordjournals.org/ 25 26 inflammation-related molecules. As our data shown, Cytokine-cytokine receptor interaction 27 28 signaling pathway had an extremely significant p-value at every stage of CAC, containing 29 30 abundant up-regulated cytokines, chemokines, growth factors and their receptors (Figure 3B- 31 32 a). The chemokine (C-X-C motif) ligand 1(Cxcl1) and Cxcl5 were up-regulated at the top 33 by guest on November 20, 2015 34 level in several phases(Figure 3C), and both of them plays important role in neutrophil 35 36 migration. Cxcl1 is co-regulated by the NF-κB and STAT3 signaling, and its overexpression 37 38 in inflammatory and high-grade dysplastic phases suggested that it may function as a tumor 39 40 initiator (34). Cxcl5 can activate MAPK, NF-κB and Jak-STAT signaling pathways, then 41 42 promote tumor cells proliferation. It also can recruit the marrow deprived suppressor cells, 43 44 45 play important role in carcinogenisis and tumor metastasis (35). 46 47 Immunohistochemistry staining showed that Bcl-xL and COX-2, were clearly up-regulated 48 49 in the inflamed, dysplastic and cancerous tissues. Most of the above molecules can activate 50 51 NF-κB, STAT3, and MAPK signaling pathways (36), or play an important role in 52 53 inflammatory response as target genes of NF-κB and STAT3 (37,38,39,40), thus created a 54 55 proinflammatory microenvironment. For instance, IL-1 and IL-6 release leads to further 56 57 activation and proliferation of these epithelial cells by NF-κB, STAT3, or MAPK dependent 58 59 60 Carcinogenesis Page 16 of 98
16 1
2 3 manner (41). Although these signaling activations can benefit the host from acute 4 5 inflammation attack, the prolonged and unsolved pathway activations are the main reason for 6 7 8 “inflammation-cancer link”. 9 10 As mentioned above, Wnt/β-catenin signaling pathway activated most notably at high 11 12 grade dysplasitic/cancerous phase (Figure 3B-b). This result is in conformity with the 13 14 function of Wnt/β-catenin signaling pathway, such as stimulating proliferation, maintaining 15 16 stem cell characteristics and promotes tumor development. In the protein level, nuclear 17 18 accumulation ofFor β-catenin firstPeer appeared in theReview inflammatory cells, then appeared in the 19 Downloaded from 20 transformed epithelial cells, which suggested that β-catenin activated in the inflammatory 21 22 cells played a role in the formation of a tumor-favorable microenvironment. In the late stage 23
24 of CAC, Wnt/β-catenin signaling had been activated in transformed cells. For instance, matrix http://carcin.oxfordjournals.org/ 25 26 metallopeptidase 7 (MMP-7) was overexpressed in the neoplastic phase in this study, which 27 28 may induced by the Wnt/β-catenin signaling pathway (42). High MMP-7 expression 29 30 associated with poor prognosis of colorectal cancer patients (43). The fact that extensive 31 32 connection exists between Wnt signaling and p53 signaling, NF-κB signaling and MAPK 33 by guest on November 20, 2015 34 signaling brought about the inflammatory environment maintenance, cell-cycle regulation, 35 36 cell growth and proliferation, anti-apoptosis and angiogenesis outcomes in colitis-associated 37 38 carcinogenesis. Moreover, The downstream targets of one pathway may activated the other 39 40 pathways, ended by accumulation of cytokines, chemokines and growth factors, that promote 41 42 the transformed cells survival and proliferation (Figure 5). 43 44 45 In conclusion, we presented a global view of molecular events happened in the process of 46 47 colitis-associated carcinogenesis in a mouse model. NF-κB and STAT3 signalings are 48 49 hyperactive in the whole inflammation-cancer link, while p38 MAPK and Wnt/β-catenin 50 51 signaling are only hyperactive in the beginning and ending, respectively. Striking changes of 52 53 the key pathways in the different time points confirm a solid link between inflammation and 54 55 cancer and suggest the possibility that the epithelial cells undergo malignant transformation 56 57 by taking advantage of the nonresolving inflammation environment or direct stimulation from 58 59 60 Page 17 of 98 Carcinogenesis
17 1
2 3 the cancer-favorable inflammation environment. The massive information obtained from 4 5 high-throughput technology provided new insights into the understanding the actual space and 6 7 8 temporal sequence of the key signaling pathways in the “colitis-dysplasia-carcinoma” process 9 10 (Figure 5), creating new insights into the therapeutic and preventive methods for colitis- 11 12 associated cancer. 13 14 15 16 Acknowledgments 17 18 This work was For supported byPeer grants from the Review China National Key Scientific Technology 19 Downloaded from 20 Programs (2006CB910503), 111 Project (111-2-12), National Nature Scientific Foundation of 21 22 China (81172300, 81101509, 81071756), Ministry of Education (NCET-11-0520, SRF for 23
24 http://carcin.oxfordjournals.org/ ROCS), Hunan Province Nature Scientific Foundation (10JJ7003). Hunan Province Doctoral 25 26 Innovation Project (CX2010B092), and "211 Projects" Innovative Talents Training 27 28 29 Foundation (71131110016). The authors declare they have no conflict of interest. We are 30 31 grateful to the members of the lab, Songqing Fan (The Second Xiangya Hospital of Central 32
33 South University) and Jun Zhou (The Third Xiangya Hospital of Central South University). by guest on November 20, 2015 34 35 36 37 References 38 39 1. Coussens, L.M. et al. (2002) Inflammation and cancer. Nature, 420, 860-867. 40 41 2. Nathan, C. et al. (2010) Nonresolving Inflammation. Cell, 140, 871-882. 42 43 3. Zisman, T.L. et al. (2008) Colorectal cancer and dysplasia in inflammatory bowel 44 45 disease. World J. Gastroenterol., 14, 2662-2669. 46 47 4. Karin, M. (2006) Nuclear factor-kappa B in cancer development and progression. 48 49 Nature 441 50 , , 431-436. 51 52 5. Xiao, H. et al. (2007) The Toll-interleukin-1 receptor member SIGIRR regulates 53 54 colonic epithelial homeostasis, inflammation, and tumorigenesis. Immunity, 26, 461- 55 56 475. 57 58 59 60 Carcinogenesis Page 18 of 98
18 1
2 3 6. Popivanova, B.K. et al. (2008) Blocking TNF-alpha in mice reduces colorectal 4 5 carcinogenesis associated with chronic colitis. J. Clin. Invest., 118, 560-570. 6 7 8 7. Grivennikov, S. et al. (2009) IL-6 and Stat3 Are Required for Survival of Intestinal 9 10 Epithelial Cells and Development of Colitis-Associated Cancer. Cancer Cell, 15, 11 12 103-113. 13 14 8. Hanahan, D. et al. (2011) Hallmarks of cancer: the next generation. Cell, 144, 646- 15 16 674. 17 18 9. Subramanian,For A. et al. Peer (2005) Gene set Reviewenrichment analysis: A knowledge-based 19 Downloaded from 20 approach for interpreting genome-wide expression profiles. Proc. Natl Acad. Sci. 21 22 USA, 102, 15545-15550. 23
24 10. Merico, D. et al. (2010) Enrichment map: a network-based method for gene-set http://carcin.oxfordjournals.org/ 25 26 enrichment visualization and interpretation. PLoS One, 5, e13984. 27 28 11. Smoot, M.E. et al. (2011) Cytoscape 2.8: new features for data integration and 29 30 network visualization. Bioinformatics, 27, 431-432. 31 32 12. Boivin, G.P. et al. (2003) Pathology of mouse models of intestinal cancer: consensus
33 by guest on November 20, 2015 34 report and recommendations. Gastroenterology, 124, 762-777. 35 36 13. Ray, S. et al. (2007) Classification and prediction of clinical Alzheimer's diagnosis 37 38 based on plasma signaling proteins. Nat. Med., 13, 1359-1362. 39 40 14. Cooper, H.S. et al. (1993) Clinicopathologic study of dextran sulfate sodium 41 42 experimental murine colitis. Lab Invest., 69, 238-249. 43 44 15. Wood, L.D. et al. (1995) Constitutive and cytokine-induced expression of the 45 46 melanoma growth stimulatory activity/GRO alpha gene requires both NF-kappa B 47 48 and novel constitutive factors. J. Biol. Chem., 270, 30619-30626. 49 50 16. Hiscott, J. et al. (1993) Characterization of a functional NF-kappa B site in the human 51 52 interleukin 1 beta promoter: evidence for a positive autoregulatory loop. Mol. Cell 53 54 Biol., 13, 6231-6240. 55 56 57 58 59 60 Page 19 of 98 Carcinogenesis
19 1
2 3 17. Son, Y.H. et al. (2008) Roles of MAPK and NF-kappaB in interleukin-6 induction by 4 5 lipopolysaccharide in vascular smooth muscle cells. J. Cardiovasc. Pharmacol., 51, 6 7 8 71-77. 9 10 18. Nishizawa, M. et al. (1990) Regulatory elements responsible for inducible expression 11 12 of the granulocyte colony-stimulating factor gene in macrophages. Mol. Cell Biol., 10, 13 14 2002-2011. 15 16 19. Xia, Y.F. et al. (2001) NF-kappaB activation for constitutive expression of VCAM-1 17 18 and ICAM-1For on B lymphocytes Peer and plasma Review cells. Biochem. Biophys. Res. Commun., 19 Downloaded from 20 289, 851-856. 21 22 20. Thornburg, N.J. et al. (2007) Induction of epidermal growth factor receptor 23
24 expression by Epstein-Barr virus latent membrane protein 1 C-terminal-activating http://carcin.oxfordjournals.org/ 25 26 region 1 is mediated by NF-kappaB p50 homodimer/Bcl-3 complexes. J. Virol., 81, 27 28 12954-12961. 29 30 21. Nemeth, J. et al. (2009) S100A8 and S100A9 are novel nuclear factor kappa B target 31 32 genes during malignant progression of murine and human liver carcinogenesis.
33 by guest on November 20, 2015 34 Hepatology, 50, 1251-1262. 35 36 22. Tai, Y.T. et al. (2003) CD40 induces human multiple myeloma cell migration via 37 38 phosphatidylinositol 3-kinase/AKT/NF-kappa B signaling. Blood, 101, 2762-2769. 39 40 23. Cai, S. et al. (2010) CXCL1 regulates pulmonary host defense to Klebsiella Infection 41 42 via CXCL2, CXCL5, NF-kappaB, and MAPKs. J. Immunol., 185, 6214-6225. 43 44 24. Bachmeier, B.E. et al. (2008) Curcumin downregulates the inflammatory cytokines 45 46 CXCL1 and -2 in breast cancer cells via NFkappaB. Carcinogenesis, 29, 779-789. 47 48 25. Richmond, A. (2002) NF-kappa B, chemokine gene transcription and tumour growth. 49 50 Nat. Rev. Immunol., 2, 664-674. 51 52 26. Huber, M.A. et al. (2002) The IKK-2/I kappa B alpha/NF-kappa B pathway plays a 53 54 key role in the regulation of CCR3 and eotaxin-1 in fibroblasts - A critical link to 55 56 dermatitis in I kappa B alpha-deficient mice. J. Biol. Chem., 277, 1268-1275. 57 58 59 60 Carcinogenesis Page 20 of 98
20 1
2 3 27. Brown, A. et al. (2008) The GM-CSF Receptor Utilises Members of the Canonical 4 5 Wnt-Signaling Pathway during Macrophage Differentiation. Blood, 112, 1313. 6 7 8 28. Kuwabara, M. et al. (2007) Granulocyte colony-stimulating factor activates Wnt 9 10 signal to sustain gap junction function through recruitment of beta-catenin and 11 12 cadherin. FEBS Lett., 581, 4821-4830. 13 14 29. Tamura, M. et al. (2011) Regulation of CXCL12 expression by canonical Wnt 15 16 signaling in bone marrow stromal cells. Int. J. Biochem. Cell Biol., 43, 760-767. 17 18 30. Oyegunwa,For A.O. et al.Peer (2010) Tetra-O-methyl Review nordihydroguaiaretic acid 19 Downloaded from 20 (Terameprocol) inhibits the NF-kappaB-dependent transcription of TNF-alpha and 21 22 MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA. J. 23
24 Inflamm. (Lond.), 7, 59. http://carcin.oxfordjournals.org/ 25 26 31. Lutgens, M.W. et al. (2008) High frequency of early colorectal cancer in 27 28 inflammatory bowel disease. Gut, 57, 1246-1251. 29 30 32. Greten, F.R. et al. (2004) IKKbeta links inflammation and tumorigenesis in a mouse 31 32 model of colitis-associated cancer. Cell, 118, 285-296.
33 by guest on November 20, 2015 34 33. Kaur, S. et al. (2010) Propionibacterium acnes induces an inflammatory response in 35 36 keratinocytes via crosstalk of the p38 MAPK and NF-kappa B pathways. J. Invest. 37 38 Dermatol. y, 130, S123. 39 40 34. Cheng, W.L. et al. (2011) Overexpression of CXCL1 and its receptor CXCR2 41 42 promote tumor invasion in gastric cancer. Ann. Oncol., 22, 2267-2276. 43 44 35. Begley, L.A. et al. (2008) CXCL5 promotes prostate cancer progression. Neoplasia, 45 46 10, 244-254. 47 48 36. Lin, W.W. et al. (2007) A cytokine-mediated link between innate immunity, 49 50 inflammation, and cancer. J. Clin. Invest., 117, 1175-1183. 51 52 37. Karin, M. et al. (2005) NF-kappaB: linking inflammation and immunity to cancer 53 54 development and progression. Nat. Rev. Immunol., 5, 749-759. 55 56 57 58 59 60 Page 21 of 98 Carcinogenesis
21 1
2 3 38. Stephanou, A. et al. (2000) Opposing actions of STAT-1 and STAT-3 on the Bcl-2 4 5 and Bcl-x promoters. Cell Death Differ., 7, 329-330. 6 7 8 39. Wang, D. et al. (2010) The role of COX-2 in intestinal inflammation and colorectal 9 10 cancer. Oncogene, 29, 781-788. 11 12 40. Lo, H.W. et al. (2010) Cyclooxygenase-2 Is a Novel Transcriptional Target of the 13 14 Nuclear EGFR-STAT3 and EGFRvIII-STAT3 Signaling Axes. Mol. Cancer Res., 8, 15 16 232-245. 17 18 41. Jarnicki,For A. et al. (2010) Peer Stat3: linking inflammationReview to epithelial cancer - more than 19 Downloaded from 20 a "gut" feeling? Cell Div., 5, 14. 21 22 42. Yu, X. et al. (2010) Wnt/beta-catenin activation promotes prostate tumor progression 23
24 in a mouse model. Oncogene, 30, 1868-1879. http://carcin.oxfordjournals.org/ 25 26 43. Koskensalo, S. et al. (2011) MMP-7 as a prognostic marker in colorectal cancer. 27 28 Tumour Biol., 32, 259-264. 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47
48 49 50 51 52 53 Legends to Figure 1~5 54 55 56 Figure 1. Experimental procedure, pathological observation and Disease Activity Index (DAI) 57 58 curves of the CAC mouse model. (A) Experimental procedure of the AOM/DSS group and 59 60 Carcinogenesis Page 22 of 98
22 1
2 3 the control group. (B) General observation of the colorectums of the AOM/DSS group at the 4 5 end of the 2nd, 4th, 6th, 8th and 20th week. (C) Histopathological examination (H&E staining, 6 7 8 top panel: 40×original magnification, bar=500 m; bottom panel: 200×original magnification, 9 10 bar=100 m). (D) DAI of the AOM/DSS treated mice and littermate controls [DAI = (Weight 11 12 loss score + Stool characters score + Hematochezia score)/3. * P-value < 0.05 compared with 13 14 control group]. 15 16 17 18 Figure 2. Gene For Ontology EnrichmentPeer Map. EnrichmentReview Map representation of the GSEA 19 Downloaded from 20 results obtained for the mouse model of CAC (in the inflammatory phase, i.e. at the end of 21 22 the 2nd week after AOM treatment, and the neoplastic phase, i.e. at the end of the 6th week 23
24 after AOM treatment) versus littermate controls. The inner circle is colored according to the http://carcin.oxfordjournals.org/ 25 26 inflammatory phase, and the outer circle according to the neoplastic phase. Node color and 27 28 shading intensity represents the statistical significance of enrichment of a particular gene set. 29 30 Up- or down-regulated gene set is shown as red and blue, respectively, according to the color 31 32 bar at the bottom. (i), (ii): Zoom-in of the Enrichment Map gene set cluster representing 33 by guest on November 20, 2015 34 Response to stimulus (i) and Protein kinase cascade (ii) enriched in the two major phases of 35 36 CAC. 37 38 39 40 41 Figure 3. P-value heatmap of signaling pathways during CAC progression. (A) Hierarchical 42 43 clustering was performed to make a p-value heatmap of 31 significantly changed signaling 44 45 pathways. The p-value score was obtained by Molecule Annotation System 3.0 based on 46 47 KEGG database. P-value is indicated as yellow to red boxes, according to the color bar shown 48 49 on the top right. Gray boxes signify p-value >0.05. (B) Fold Change of expression levels of 50 51 differentially expressed genes relative to the important pathways “Cytokine-cytokine receptor 52 53 interaction” (a), and “Wnt signaling pathway” (b). Green boxes signify low expression, red 54 55 boxes signify high expression, according to the color bar shown on the bottom right. (C) Gene 56 57 expression levels of Cxcl1, Cxcl5 and Mmp7 at serial time points. The left panel shows the 58 59 60 Page 23 of 98 Carcinogenesis
23 1
2 3 gene array data, the right panel shows the gene expression levels detected by qPCR. * 4 5 Statistical significant compared with normal. 6 7 8 9 10 Figure 4. Serum inflammatory protein antibody array experiment. (A) ECL exposed antibody 11 12 array films from pooled serum sample collected from both AOM/DSS treated mice and 13 14 controls (each has 5 mice’s blood been pooled) with the indicated time points. Each array 15 16 detects 40 proteins and each protein is measured in duplicates. Colored boxes or circles 17 18 indicate the locationFor of the named Peer proteins. (B) Review Proteins dramatically up-regulated mainly in 19 Downloaded from 20 the inflammatory phase have an impact on NF-κB, STAT3 and/or p38 MAPK signaling 21 22 pathways. (C) Proteins up-regulated in neoplastic lesions were correlated with Wnt/β- 23
24 catenin and NF-κB signaling pathway. http://carcin.oxfordjournals.org/ 25 26
27 28 29 Figure 5. Schema of the key pathways alteration during the colitis-associated carcinogenesis 30 31 processes of the AOM/DSS mouse model. The molecules listed in the figure are significantly 32
33 upregulated in the present study by means of mRNA expression profiling, protein array, and by guest on November 20, 2015 34 35 immunohistochemistry analysis. For example, in the left panel (Inflammatory phase), 36 37 Chemokines (CCL2,4,6, CXCL1,2,3,5, etc.) and chemokine receptors (CCR1,2,5,6, etc.) were 38 39 up-regulated in the inflammatory phase in AOM/DSS mice, which can induce STAT3 40 41 signaling activation, and, then increase the transcription of STAT3 downstream target genes 42 43 (Il10, Il12, CD86, Tnfr, Bcl2 etc.). All of the target genes at the bottom of the left panel can 44 45 continue affect the inflammation environment and contribute to linking inflammation and 46 47 cancer. 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 24 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 Experimental procedure, pathological observation and Disease Activity Index (DAI) curves of the CAC mouse 39 model 40 150x140mm (300 x 300 DPI) 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 25 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Gene Ontology Enrichment Map 156x210mm (300 x 300 DPI) 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 26 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 P-value heatmap of signaling pathways during CAC progression 127x180mm (300 x 300 DPI) 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 27 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 Serum inflammatory protein antibody array experiment 44 86x92mm (300 x 300 DPI) 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 28 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 Schema of the key pathways alteration during the colitis-associated carcinogenesis processes of the 36 AOM/DSS mouse model 37 160x134mm (300 x 300 DPI) 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 29 of 98 Carcinogenesis
1 1 2 3 4 Legends to Supplementary Figure S1~S6 5 6 7 Supplementary Figure S1 The “inflammation dysplasia carcinoma” sequential pathological 8 9 processed in a single bowel (H&E stain). (A) Inflammatory mucosa to dysplastic mucosa in 10 11 one single colon (40× magnification). (a) Inflammatory mucosa (100× magnification); (b) 12 13 High grade dysplasia (100× magnification ). (B) Adenocarcinoma in the same colon (40× 14 15 magnification). (c) Adenocarcinoma (100× magnification). 16 17 18 For Peer Review 19 Downloaded from Supplementary Figure S2 Global gene expression and qPCR verification in CAC 20 21 progression. (A) Comparison of expression levels of all probe sets among diseased samples 22 23 and normal controls at each time point. Numbers of up and down regulated genes are
24 http://carcin.oxfordjournals.org/ 25 26 presented as red and green bars, respectively. (B) Fold change of the mRNA expression levels 27 28 of Il6, Il10, csf3, Il1b, S100a9, Saa3, Cxcl2, Mmp3, Mmp9, Spp1, S100a8 and Postn in 29 30 different time points of CAC mouse model in both gene array and qPCR. Error bars represent 31 32 standard deviation (n = 3 for gene array, n≥ 5 for qPCR verification). * Statistical significant
33 by guest on November 20, 2015 34 compared with normal control. 35 36 37 38 Supplementary Figure S3. Important gene levels at serial time points. Fold Change of 39 40 expression levels of differentially expressed genes annotated to the GO terms Positive 41 42 regulation of apoptosis process and Negative regulation of apoptosis process compared to the 43 44 normal controls at different time points. Green boxes signify low expression, red boxes 45 46 signify high expression, according to the color bar shown on the bottom right. 47 48 49 50 51 Supplementary Figure S4. Immunohistochemistry (400× magnification) of p65, p52, p 52 53 STAT3, p p38, β catenin, PCNA, Bcl xL, and COX 2 in normal (the first column), 54 55 inflammation (the second column), dysplasia (the third column) and adenocarcinoma tissues 56 57 58 59 60 Carcinogenesis Page 30 of 98
2 1 2 3 (the fourth column) of the mouse colorectum (n≥12). Omission of the primary antibody was 4 5 used as negative control (the fifth column). 6 7 8 9 10 Supplementary Figure S5 Gene Ontology Enrichment Map representation of the GSEA 11 12 results obtained for the ulcerative colitis mouse model (at the end of the 2nd week after AOM 13 14 treatment, 2%DSS at day 7) and GSE22307 dataset (3% DSS at day 6). The inner circle is 15 16 colored according to GSE22307 data, and the outer circle according to our data. Node color 17 18 and shading intensityFor represents Peer the statistical significanceReview of enrichment of a particular gene 19 Downloaded from 20 set. 21 22
23
24 http://carcin.oxfordjournals.org/ 25 Supplementary Figure S6 Gene Ontology Enrichment Map of CAC mouse model and 26 27 human SCC. (A) Gene Ontology Enrichment Map representation of the GSEA results 28 29 obtained for the ulcerative colitis mouse model (at the end of the 2nd week after AOM 30 31 treatment, 2%DSS at day 7) and GSE4183 dataset (human IBD). (B) Gene Ontology 32
33 Enrichment Map representation of the GSEA results obtained for the CAC mouse model (at by guest on November 20, 2015 34 35 the end of the 6th week after AOM treatment) and GSE4183 dataset (human SCC). The inner 36 37 circle is colored according to GSE4183 data, and the outer circle according to our data. Node 38 39 color and shading intensity represents the statistical significance of enrichment of a particular 40 41 gene set. 42 43 44 45
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 31 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 The “inflammation-dysplasia-carcinoma” sequential pathological processed in a single bowel 28 182x109mm (125 x 125 DPI) 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 32 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 Global gene expression and qPCR verification in CAC progression 182x145mm (300 x 300 DPI) 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 33 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Important gene levels at serial time points 61x140mm (300 x 300 DPI) 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 34 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Immunohistochemistry of p65, p52, p STAT3, p p38, β catenin, PCNA, Bcl xL, and COX 2 187x230mm (300 x 300 DPI) 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 35 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 Gene Ontology Enrichment Map representation of the GSEA results obtained for the ulcerative colitis mouse 43 model and GSE22307 dataset 724x758mm (72 x 72 DPI) 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 36 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 Gene Ontology Enrichment Map of CAC mouse model and human SCC 141x86mm (300 x 300 DPI) 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 1 1 Downloaded from TTCACCTGCTCCACTGCCTTGC TTCACCTGCTCCACTGCCTTGC TGGAGCTGGCTTAGGCACTGTGT TGCCTGCCTGAAGCTCTTGTTGAT AGCGCAGCTCATTGGCGATAGG GAGCACACAACCACACACAGCCA AAGCTTCTTCTCCTCTGAGCTGCCA AGGGCTTCATTTCTCTTCTCTTTC TGACTGGCTCTCCGTGGATCACTT GCATAACGCACTAGGTTTGCCGAGT GCATAACGCACTAGGTTTGCCGAGT http://carcin.oxfordjournals.org/ Reverse: Reverse: Reverse: Reverse: Reverse: Reverse: ACAGCGAGGCACATCAGGTACGA Reverse: Reverse: Reverse: Reverse: ACTGGGAACAACAGGAAGAGAA Reverse: Reverse: GCTCCGTTGCGGCTATGACTGA Reverse: Reverse: GCAAGGAACTCCTCGAAGTTAAT Reverse: Reverse: CCTGTTCCCACTGATGTGCGCT Reverse: Reverse: ATAGTTGGCTGTGGTGGCGCA
by guest on November 20, 2015 Carcinogenesis Legends to Supplementary Table S1~S7 S1~S7 Table Supplementary to Legends
For Peer Review GGCAGAGAAGCATGGCCCAGAA GGCAGAGAAGCATGGCCCAGAA TGGTGTTGCTGGGCCACTCTCT ACCCCAAAAGATGAAGGGCTGCTT AGCACTCCAGACTCCAGCCACA ACTGACCTGGAAAGGAGGAGCCTG ACCTAGAAGGAGGCAGCAGAGAACC ACGGCAACGGAGAAGGCAAACC AGGCTGCAGTTCTCCTGGCTGA ACCATGCCCTCTACAAGAATGAC CATCGACACCTTCCATCAATACTC GGGACATGGAGCAGAGGACT CCAGCGGTTCCATCTCGCCATT TGGCAGCTATGCAGCTCACCCT ACGGAAGGACCTGCAATGACGAAGA Reverse: GCTGGAGTCACAGAAGGAGTGGCTA GCTGGAGTCACAGAAGGAGTGGCTA Reverse:
Primers used for qPCR. for qPCR. used Primers
Forward: Forward: Forward: Forward: Forward: Forward: Forward: Forward: Forward: Forward: Forward: Forward: Forward: Forward:
Spp1 S100a9 Cxcl5 Mmp7 Csf3 Cxcl1 Cxcl2 S100a8 Saa3 Il10 Forward: Il6 Postn Il1b Mmp9 Mmp3 Supplementary Table S1 Table Supplementary Page 37 of 98 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 38 of 98 2 2 18 18 20w-Ca. 20w-Ca. Cd44, Cd44, Chi3l1, Cxcl2, Cxcl5, Abcb1, Abcb1, Abcg5, Apod, 17 8w-HD. 8w-HD. Cxcl1, Cxcl2, Cxcl5, Ighg1, Ighg1, Cxcl5, Cxcl2, Cxcl1, Spp1, Serpine2, Serpina3, Pglyrp1 Thbs1, Abcb1, Apod, Bcl2a1, Cd44, Cd44, Bcl2a1, Apod, Abcb1, Saa3, Mmp9, Pim1, Lcn2, Downloaded from 25 Ccl3, Cxcl1, Cxcl1, Ccl3, Cxcl5, Cxcl2, Gzmb, Cxcl9, Abcb1, Abcb1, Bcl2a1, Lcn2, Il1b, Mmp3, Mdk, http://carcin.oxfordjournals.org/ Reverse: Reverse: GGCAGAAGGGGCGGAGATGATG 19 4w-LD. 4w-LD. 6w-HD.
Cd44, Chi3l1, Chi3l1, Cd44, Ighg1, Cyp7b1, Selp, S100a4, Spp1, Serpina3, Apod, Bcl2a1, Bcl2a1, Apod, Ccr5, C3, Bcl3, Mmp3, Il1rn, by guest on November 20, 2015 Carcinogenesis 123 2w-Infla. 2w-Infla. For Peer Review GGGTGAGGCCGGTGCTGAGTATG GGGTGAGGCCGGTGCTGAGTATG
he differentially expressed NF κB target genes at different time points in the carcinogenesis of CAC. of CAC. carcinogenesis the in points time different at genes target NF κB expressed differentially he Differentially altering pathways analyzed by Molecule Annotation System 3.0 base on KEGG database. Each sheets presented the the presented sheets Each database. KEGG on base 3.0 System Annotation Molecule by analyzed pathways altering Differentially T Ccl11, Ccl2, Ccl22, Ccl3, Ccl4, Ccl7, Ccr5, Ccr7, Ccr7, Ccr5, Ccl7, Ccl4, Ccl3, Ccl22, Ccl2, Ccl11, Cfb, Cebpd, Cd86, Cd48, Cd44, Cd40, Cd274, Cxcl2, Cxcl10, Cxcl1, Ctsb, Csf3, Col1a2, Chi3l1, Ebi3, Dusp1, Dio2, Cyp7b1, Cxcl9, Cxcl5, Cxcl3, Abca1, Abcb1, Adam19 , Adora1, Alox5, Apod, Apod, Alox5, , Adora1, Adam19 Abcb1, Abca1, Bgn, Bdkrb1, Bcl2a1, Bcl3, Bace1, Ass1, Apoe, Calcb, C3, Btk, Bnip3, Bmp4, /Prdm1, Blimp1
Forward: Gene Gene Gene Gene symbol symbol
number Gapdh Up Up genes genes regulated regulated data shown at different time points (see the Excel file). file). Excel the (see points time different at shown data S3 Table Supplementary S2 Table Supplementary high grade dysplasia (the end of the 6th and 8th week), and adenocarcinoma (the end of the 20th week), respectively. respectively. week), 20th of the end (the adenocarcinoma and week), 8th 6th the and of(the end dysplasia grade high NF κB target genes differentially expressed in the inflamed mucosae (the end of the 2nd week), the low grade dysplasia (the end of the 4th week), and the the and week), 4th of the end (the dysplasia grade low the week), 2nd of the end (the mucosae in inflamed the expressed differentially genes target NF κB 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 3 3 4 Ccl28, Ccl28, Saa3, Saa3, Selp, Serpine2, Spp1, Thbs1 Egr1, Egr1, Lipg, Nfkbiz Dio2, Dio2, Ighg1, Lcn2, Mmp3, Mmp9, Mt3, 22 Slc16a1, St6gal1, Upp1 Upp1 St6gal1, Slc16a1, Nfkbiz, Penk, Ccl28, Cdx1, Cdx1, Ccl28, Penk, Nfkbiz, Hsd11b2, Fabp6, Dpyd, Prkcd, Pigr, Pde7a, Kcnk5, Cav1, Bmp2, Scnn1a, Pycard, Npy1r, Mylk, Lipg, Edn1, Downloaded from 5 5 Ccl28, Dpyd, Dpyd, Ccl28, Selp, Selp, Serpina3, Spp1, Tnfrsf1b, Ccl17, Ido1, Cxcl11, Egr1 , Penk, , Penk, Egr1 Igfbp2 Mmp9, Saa3, Saa3, Mmp9, Lef1, Il23a, Mt3, Pglyrp1 http://carcin.oxfordjournals.org/ 8 8
Ccl28 , Dpyd, Dpyd, , Ccl28 Tnc, Tnfrsf1b, Tnfrsf1b, Tnc, Pglyrp1 Vcam1, Hsd11b2, Pigr, Pigr, Hsd11b2, Bmp2, Pycard, St6gal1 Npy1r, by guest on November 20, 2015 Carcinogenesis 36 36 For Peer Review he differentially expressed STAT3 target genes at different time points in the carcinogenesis of CAC. of CAC. carcinogenesis the in points time different at genes target STAT3 expressed differentially he T Cd38, Cdx1, Cldn2, Dpyd, Elf3, Erbb2, F11r, F11r, Elf3, Erbb2, Dpyd, Cldn2, Cdx1, Cd38, Tff3 Sox9, Gzmb, Hgf, Hif1a, Hmox1, Hpse, Icam1, Icos, Icam1, Icos, Hpse, Hif1a, Hmox1, Hgf, Gzmb, Slfn2, Slc3a2, Serpine2, Pai-1, Serpine1, Serpina3, Tnc, Tlr2, Thbs1, Tgm2, Tgm1, Sod2, Spp1, Snai1, Traf1, Tnfrsf9, Tnfrsf4, Tnfrsf1b, Tnfaip3, Tnfaip2, Xdh Vim, Vcam1, Twist1, Trem1, Apobec2, Aqp4, Asph, Ccl20, Ccl28, Ccnd1, Ccnd2, Ccnd2, Ccnd1, Ccl28, Ccl20, Asph, Aqp4, Apobec2, Il15, Hsd11b2, Hoxa9, Hamp, Gjb1, Gcnt1, Fabp6, Pigr, Pigf, Pde7a, Pafah2, Myb, Muc2, Kcnk5, Scnn1a, Saa2, Saa1, S100a10, Pycard, Prkcd, Egfr, Egr1, Eng, Eno2, Fas, Fcgrt, Fn1, Gadd45b, Fn1, Gadd45b, Fcgrt, Fas, Eng, Eno2, Egr1, Egfr, Il2ra, Il1rn, Il1b, Il15ra, Il11, Il10, Iigp1, Ighg1, Mdk, Madcam1, Lyz, Ltf, Lcn2, Lbp, Il8rb, Il6, Nfkbie, Nfkbia, Nfkb2, Mmp9, Mmp8, Mmp3, Pim1, Penk, Pdgfb, Nrg1, Nr4a2, Nos1, Nfkbiz, Serpina1, Selp, Saa3, S100a4, Ptx3, Ptpn1, Ptgis,
Gene Gene Gene Gene symbol symbol number genes genes Down regulated regulated S4 Table Supplementary the and 4th oftheweek), end (the dysplasia grade low the week), 2nd of the end (the mucosae inflamed in the expressed differentially genes target STAT3 respectively. week), 20th of the end (the adenocarcinoma and week), 8th 6th the and of(the end dysplasia grade high Page 39 of 98 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 40 of 98 4 4 1 1 13 13 20w-Ca. 20w-Ca. cdkn1b cdkn1b ifitm1, mmp10, mmp10, ifitm1, saa3, cxcl2, selp, mmp3, mmp7, tnfrsf12a, serpine2, mmp13, mmp13, serpine2, gspt1 sp5, plagl1, 5 5 11 11 8w-HD. 8w-HD. cdkn1b, kit kit cdkn1b, bcl2a1a, ifitm1, ifitm1, bcl2a1a, cxcl2, mmp10, pim1, cyr61, saa3, socs3, socs3, saa3, sulf1, serpina3n, serpine2 Downloaded from 0 0 15 6w-HD. 6w-HD. http://carcin.oxfordjournals.org/ bcl2a1a, ifitm1, ifitm1, bcl2a1a, mmp13, mmp10, selp, mmp3, mmp7, tnfrsf12a, socs3, saa3, cxcl2, plagl1, sp5 tgtp, serpina3g, serpina3g, - - oasl2, oas1, efnb2, 0 0 13
4w-LD. 4w-LD. by guest on November 20, 2015 bcl2a1a, bcl3, bcl3, bcl2a1a, ifitm1, mmp10, mmp3, mmp13, mmp7 c3, tnfrsf12a, selp, serpina3g, serpina3g, selp, sulf1, serpina3n, Carcinogenesis
15 15 59 2w-Infla. 2w-Infla. For Peer Review he differentially expressed p38 MAPK target genes at different time points in the carcinogenesis of CAC. of CAC. carcinogenesis the in points time different at genes target MAPK p38 expressed differentially he T ccnd1, ect2, efna1, efnb2, gata6, ifi44, ifit1, ifit1, ifi44, gata6, efnb2, efna1, ect2, ccnd1, serpinb1, rab27a, ocln, oasl2, oas2, oas1, tspan7 trim14, abca1, adm, angpt1, bcl2a1a, bcl3, c1rc1s, c1rc1s, bcl3, bcl2a1a, angpt1, adm, abca1, ctsl, col5a1, cebpd, cebpb, cdo1, cd86, ccl2, epas1, egfr, dusp1, cyr61, cyp1b1, cxcl2, maff, il6r, il4ra, il1r1, il18rap, il10, ifitm1, pim1, plaur, mmp3, mmp2, mmp13, mmp10, selp, serpina3g, sdc1, saa3, rtn4, rgs16, vim tnfrsf12a, thbs1, tgtp, fgl2, flt4, fosl1, gadd45b, hif1a, icam1, icam1, hif1a, gadd45b, fosl1, flt4, fgl2, serpine1, serpinb9, serpina3n, serpina3m, stat3, sulf1, sod2, socs3, sipa1, serpine2,
Gene Gene Gene Gene Gene Gene Gene Gene symbol symbol symbol symbol number number Up Up genes genes genes genes Down regulated regulated regulated regulated S5 Table Supplementary the high grade dysplasia (the end of the 6th and 8th week), and adenocarcinoma (the end of the 20th week), respectively. respectively. 20th week), of the end (the adenocarcinoma and week), 8th 6th ofthe and end (the dysplasia grade high the
p38 MAPK target genes differentially expressed in the inflamed mucosae (the end of the 2nd week), the low grade dysplasia (the end of the 4th week), and and 4th week), ofthe end (the dysplasia grade low the week), 2nd of the (the end mucosae inflamed in the expressed differentially genes target MAPK p38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
5 5 - 5 5 0 0 19 20w-Ca. 20w-Ca. 20w-Ca. 20w-Ca. Nfe2l2, Spp1, Wisp1 Spp1, Nfe2l2, 2 2
8w-HD. 8w-HD. 9 9 8w-HD. 8w-HD. Mmp9, Spp1 Spp1 Mmp9, Mmp9, Mmp13, Downloaded from - Cav1 Car2, 0 0 http://carcin.oxfordjournals.org/ 6w-HD. 6w-HD. Ccl3, Il1b, Mmp13, Il1b, Mmp13, Ccl3, Mmp9, Spp1 Mmp9, Spp1 6w-HD. 6w-HD.
2 10 10 5 2 4w-LD. 4w-LD. by guest on November 20, 2015 Carcinogenesis C3, Ccr5, Cntn1, Cntn1, Ccr5, C3, Wisp1 Vcam1, Tnc, Il1rn, Mmp13, Mmp13, Il1rn, Spp1, Ppargc1a, 9 9 15 catenin target genes at different time points in the carcinogenesis of CAC. of CAC. carcinogenesis the in points time different at genes target β catenin 4w-LD. 4w-LD.
5 5 30
2w-Infla. 2w-Infla. For Peer Review
12 w-Infla. w-Infla. 2 he differentially expressed Wnt/ expressed differentially he T Car2, Ccl20, Ccnd1, Ephx2, Ezr Ezr Ephx2, Ccnd1, Ccl20, Car2, Ephx2 Car2, C3, Ccl2, Ccl3, Ccl7, Ccnd3, Ccr5, Ccr5, Ccnd3, Ccl7, Ccl3, Ccl2, C3, Fgl2, Eng, Col1a2, Cntn1, Cd40, Wisp1 Vcam1, Tnc, Hmox1, Icam1, Il10, Il1b, Il1rn, Il6, Il6, Il1rn, Il10, Il1b, Icam1, Hmox1, Nos1, Mmp9, Mmp2, Mmp13, Mitf, Tgfb1, Spp1, Ptgs2, Ppargc1a, Nos3,
Gene Gene Gene Gene Gene Gene Gene Gene Gene Gene symbol symbol symbol symbol number number number catenin target genes differentially expressed in the inflamed mucosae (the end of the 2nd week), the low grade dysplasia (the end of the 4th week), and and week), 4th ofthe end (the dysplasia grade low the 2nd week), the end of (the mucosae inflamed the in expressed differentially genes target β catenin Up Up Up Up genes genes genes genes Down regulated regulated regulated regulated regulated regulated the high grade dysplasia (the end of the 6th and 8th week), and adenocarcinoma (the end of the 20th week), respectively. 20th week), of the end (the adenocarcinoma and week), 8th 6th ofthe and end (the dysplasia grade high the Wnt/ S6 Table Supplementary
Page 41 of 98 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 42 of 98 6 6 3 3 Cdkn2a, Dkk2, Grem1, Grem1, Dkk2, Cdkn2a, Tcf4, T, Stra6, Sp5, Wisp1 Tnfrsf19, Tle1, Abcb1a, Neurod1, Postn Postn Neurod1, Abcb1a, Apcdd1, Axin2, Cd44, Cd44, Axin2, Apcdd1, Mmp10, Id2, Igf1, Saa3, Mmp9, Mmp7, 8 8 Downloaded from Grem1, Igf1, Mmp10, Igf1,Mmp10, Grem1, Abcb1a, Atho1, Cdx1, Cdx1, Atho1, Abcb1a, L1cam, Kit, Efnb1, Ppard Postn, Apcdd1, Cd44, Cyr61, Cyr61, Cd44, Apcdd1, Saa3 Runx2, Mmp9, http://carcin.oxfordjournals.org/ 4 Normalized Expression Levels Levels Expression Normalized
Saa3, Sp5, Stra6, T, Stra6, Sp5, Saa3, Tnfrsf19 Tcf7l2, Apcdd1, Axin2, Cubn, Cubn, Axin2, Apcdd1, Id2, Lef1, Dkk2, Mmp9, Mmp7, Mmp10, Postn Postn by guest on November 20, 2015 Carcinogenesis 2 2 Grem1, Igf1, Mmp10, Igf1,Mmp10, Grem1, Apcdd1, Axin2, Cd44, Cd44, Axin2, Apcdd1, Wisp1 Mmp7, Sfrp2, Atho1, Neurod1 Neurod1 Atho1, Ctgf, Neurod1, Abcb1a, For Peer Review 15 15 xpression levels of 40 inflammatory proteins. proteins. inflammatory of 40 levels xpression E Apccd1, Cd44, Cyr61, Cyr61, Cd44, Apccd1, Id2, Igf1, Grem1, Wisp1 T, Saa3, Ccnd1, Ccnd2, Cdh1, Cdh1, Ccnd2, Ccnd1, Efnb1, Efnb1, Cdx1, Mmp10, Mmp9, Runx2, Runx2, Mmp9, Mmp10, Abcb1a, Atho1, Axin2, Axin2, Atho1, Abcb1a, Neurod1, Met, L1cam, Sox9 Pttg1, Ppard,
Gene Gene Gene Gene Gene Gene symbol symbol symbol symbol number rotein Symbol Symbol rotein Aliase P genes genes genes genes Down regulated regulated Antibody Array 1. The normalized expression levels of each protein at different time points were shown in this table. table. in this shown were points time different protein at of each levels expression normalized The 1. Array Antibody respectively. proteins, down regulated and torefer up words green and red The S7 Table Supplementary Inflammation Mouse RayBio the by detected were controls and mice treated of AOM/DSS blood samples the in levels chemokines and cytokines 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 7 7 0.68 0.68 0.81 0.81 0.22 0.22 0.61 0.10 1.91 3.98 3.98 0.03 1.00 1.00 41.79 1.59 1.59 1.13 1.13 0.83 1.08 1.98 1.40 0.81 18.80 Downloaded from 1.56 1.56 1.00 1.59 0.97 1.49 1.58 1.02 http://carcin.oxfordjournals.org/ .14 .14 2.38 2.32 7.43 1.43 1.23 0.72 1.20 1.03 1.10 1.44 0.88 1.04 1.12 1.38 1.22 1.00 0.82 1.09 0.43 0.82 1.00 1.78 1.05 1.02 2.50 0.44 1.46 1.00 1.04 1.57 0.98 2.88 1.45 2.87 1.83 2.82 21.55 4 1.38 1.39 1.44 1.33 1.22 1.46 1.20 0.82 1.25 1.15 15.80 15.80 2.26 10.21
by guest on November 20, 2015 Carcinogenesis 6.38 6.38 2.30 2.30 0.59 5.64 0.63 1.64 6.48 1.62 6.51 6.51 3.87 3.87 0.31 0.31 0.49 0.49 1.34 1.34 1.31 1.11 0.78 1.19 20.19 15.34 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Norm. Norm. 2w-Infla. 4w-LD. 6w-HD. 8w-HD. 20w-Ca. For Peer Review CX3CL1 CX3CL1 1 CCL24 CCL24 CCL11 CCL11 CXCL13 CXCL13 1
CSF3 CSF3 CSF2 CSF2 CSF CSF M CSF M CSF otaxin 2 otaxin 2 as Ligand Ligand as ractalkine ractalkine L 3 L 3 IL 17 IL 17 CD30L CD30L BLC BLC IL 12p40p70 IL 12p40p70 IL 12p70 IL 13 IL 2 IL 1β IL 1β IL 10 IL 10 IL 1α IL 4 IFNγ IFNγ Eotaxin Eotaxin F F G I E G Page 43 of 98 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 44 of 98 8 8 0.82 0.82 1.01 1.01 0.87 1.22 1.22 0.73 0.73 0.60 0.60 0.35 0.35 0.88 10.00 1.60 1.60 9.05 9.05 1.67 1.67 0.72 1.42 0.78 0.78 0.84 Downloaded from 1.02 1.02 0.97 0.97 0.80 0.80 0.78 1.12 1.40 1.02 1.77 1.04 1.87 http://carcin.oxfordjournals.org/ .85 .85 1.74 3.33 .50 5.96 5.96 2.12 14.36 1.59 0.80 0.92 1.37 2.70 2.34 1.19 1.48 1.44 1.26 1.71 1.67 1.71 2.38 1.06 1.25 1.04 1.00 1.07 1.01 0.86 1.19 3 1 1.18 1.12 1.27 1.34 1.11 1.87 1.21 0.94 1.26 0.83 1.13 0.91 1.20 0.83 1.01 0.76 1.49 1.16 1.03 1.05 0.97 1.25 0.90 0.94 0.79 1
by guest on November 20, 2015 .16 .16 .36 .36 Carcinogenesis 1.17 1.17 0.63 0.63 2.43 2.43 2.17 2.83 2.11 2.11 4.04 4.04 2.04 2.04 1.03 1.03 1 0.87 0.87 1.35 1.35 0.89 0.89 1.23 1.41 1.45 1.45 1 0.92 0.92 1.05 1.05 18.63 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
For Peer Review CXCL5 CXCL5 1
CXCL1 CXCL1 1 CCL5 CCL5 CCL2 CCL2 CXCL12 CXCL12 1 CCL25 CCL25 CSF1 CSF1 CXCL9 CCL9 1 CCL3 CCL3 CXCL11 CXCL11 1 CCL1 CCL1
Ⅰ Ⅱ CP 1 CP 1 IP 1γ CA 3 CA 3 IX ECK eptin eptin IMP 1 IMP 2 TNF R TNF TNF R TNF TAC TAC SDF 1 SDF 1 IL 6 IL 6 MIP 1α MIP 1α IL 9 IL 9 s KC KC I s T Lymphotactin Lymphotactin XCL1 T L M L T T M M CSF M CSF MIG RANTES RANTES 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 9 9 0.51 0.51 Downloaded from http://carcin.oxfordjournals.org/ 1.27 1.01 1.41
by guest on November 20, 2015 Carcinogenesis 1.38 1.38 1 1
For Peer Review
TNFα TNFα
Page 45 of 98 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 46 of 98
1 2 2w-Inflammation vs Normal 3 Pathway Count p-Value q-Value Gene 4 Cytokine-cytokine receptor interaction 49 5.89E-49 1.22E-46 Cxcl5;Il6;Cxcl2;Cxcl1;Il11;Cxcl1;Ccl2;Il1r2;Ccl3;Csf3;Tnfsf11;Il1b;Inhbb;Hgf;Ppbp;Pf4;Ccr1;Cxcl1;Ccr1;Il10;Ccl9;Cxcl14;Il1r1;Osmr;Ccl7;Ccl8;Bmp7;Ccl11;Tnfrsf9;Csf2rb;Csf2rb;Ccl9;Cxcl12;Csf2rb2;Hgf;Tnfrsf9;Hgf;Tnfrsf11b;Ifnar2;Cxcl13;Il6st;Il8rb;Pdgfrb;Tnfrsf12a;Il4ra;Cxcl13;Ifnar2;Ccl12;Il2ra;Csf3r;Osm;Cxcl16;Il15ra;Lif;Flt1;Cxcl10;Ccl4;Il18;Ccl28 5 Cell Communication 24 6.93E-24 7.18E-22 Spp1;Thbs1;Tnc;Thbs1;Lama1;Thbs1;Col4a2;Prph;Lama4;Col4a1;Col5a3;Lamb1-1;Gja1;Col4a1;Gja1;Col5a2;Lama4;Col1a1;Lamb1-1;Gja1;Gja1;Lamc1;Krt7;Dsg2;Lamb3;Dsg2;Krt8;Krt18;Dsg2;Krt8;Thbs4;Krt19;Krt20;Dsg2;Krt8;Gjb3;Dsc2;Dsg2 6 Cell adhesion molecules (CAMs) 25 4.41E-23 3.05E-21 Selp;Selp;Selp;Itgam;Vcan;Itga4;Icam1;Vcan;Icos;Ctla4;Vcam1;Cd86;Itgb2;Icos;Madcam1;Sell;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;Cldn3;Cdh1;Cldn7;Cldn3;Cldn3;Cldn3;Cldn23;Ocln;Cldn8;H2-Q1;Cldn2 7 Complement and coagulation cascades 18 1.42E-20 7.37E-19 Serpine1;C3;F10;Bdkrb1;C5ar1;F13a1;Plat;Plaur;C1r;Cd59a;Cfh;C3ar1;Cfh;Serping1;F10;C1qb;C1qc;C1qb;C4b;F5;Cd59a;C3ar1;C4bp 8 9 Leukocyte transendothelial migration 20 1.38E-19 5.70E-18 Mmp9;Mmp9;Itgam;Itga4;Cxcl12;Mmp2;Icam1;Mmp2;Ncf4;Vcam1;Itgb2;Cybb;Cybb;Msn;Gnai2;Ncf1;Rac2;Cldn3;Cldn7;Cldn3;Cldn3;Cldn3;Cldn23;Ocln;Cldn8;Cldn2 10 Hematopoietic cell lineage 17 7.52E-18 2.60E-16 Il6;Il11;Il1r2;Csf3;Ighg;Igh;Il1b;Ighg;Itgam;Il1r1;Ighg;Itga4;Fcgr1;Cd59a;Cd44;Igh;Il4ra;Igh;Il2ra;Csf3r;Igh;Cd59a;H2-Eb1 11 ECM-receptor interaction 16 7.10E-17 2.10E-15 Spp1;Thbs1;Tnc;Thbs1;Lama1;Itga4;Thbs1;Col4a2;Lama4;Col4a1;Col5a3;Lamb1-1;Col4a1;Cd44;Col5a2;Lama4;Col1a1;Lamb1-1;Lamc1;Lamb3;Thbs4 12 Jak-STAT signaling pathway 19 9.63E-16 2.49E-14 Il6;Il11;Csf3;Socs3;Socs3;Socs3;Il10;Osmr;Csf2rb;Csf2rb;Csf2rb2;Ifnar2;Il6st;Il4ra;Ifnar2;Il13ra2;Il2ra;Pim1;Csf3r;Osm;Il15ra;Lif;Pim1;Cblc 13 Drug metabolism - cytochrome P450 15 1.84E-15 4.23E-14 Gstm6;Gsta1;Gsta2;Gsta4;Mgst3;Gsta3;Cyp2d26;Maoa;Cyp2d9;Maoa;Cyp2c40;Adh1;Gstm3;Cyp3a13;Cyp2d10;Cyp2c55 14 Focal adhesion 19 6.17E-14 1.28E-12 Spp1;Thbs1;Hgf;Tnc;Thbs1;Lama1;Itga4;Thbs1;Col4a2;Hgf;Hgf;Lama4;Col4a1;Col5a3;Lamb1-1;Col4a1;Pdgfrb;Col5a2;Lama4;Col1a1;Lamb1-1;Flt1;Rac2;Lamc1;Lamb3;Thbs4 15 Metabolism of xenobiotics by cytochrome P450 13 1.63E-13 3.07E-12 Cyp1b1;Gstm6;Gsta1;Gsta2;Gsta4;Mgst3;Gsta3;Cyp2s1;Cyp2c40;Adh1;Gstm3;Cyp3a13;Cyp2c55 16 PPAR signaling pathway 13 3.43E-13 5.92E-12 Lpl;Lpl;Acsl4;Angptl4;Fabp5;Acsl4;Fabp5;Acsl4;Fabp4;Fabp7;Fabp4;Scd2;Acsl3;Fads2;Hmgcs2;Acsl3;Fads2;Fabp6;Scd2;Acsl3;Pck1;Fabp2 17 Tight junction 15 4.84E-12 7.70E-11 Hcls1;Gnai2;Llgl2;Crb3;Igsf5;Cgn;Tjp3;Myh14;Cldn3;Inadl;Cldn7;Cldn3;Cldn3;Cldn3;Cldn23;Ocln;Cldn8;Cldn2 18 Autoimmune thyroid diseaseFor Peer Review12 1.94E-11 2.87E-10 Ighg;Igh;Ighg;Il10;Ighg;Gzmb;Ctla4;Cd86;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1 19 Downloaded from 20 Allograft rejection 11 3.56E-11 4.92E-10 Ighg;Igh;Ighg;Il10;Ighg;Gzmb;Cd86;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1 21 Glutathione metabolism 10 6.28E-11 8.13E-10 Ggt5;Gpx3;Gstm6;Gsta1;Gsta2;Ggt6;Gsta4;Mgst3;Gsta3;Gstm3 22 Urea cycle and metabolism of amino groups 8 8.66E-11 1.05E-09 Arg1;Arg2;Arg2;Aldh2;Aldh1b1;Maoa;Maoa;Cps1;Abp1;Otc 23 Glycolysis / Gluconeogenesis 10 1.13E-10 1.30E-09 Hk3;Fbp1;Eno2;Aldh2;Fbp2;Aldh1b1;Adh1;Acss2;Acss2;Eno3;Aldob
24 Natural killer cell mediated cytotoxicity 13 4.00E-10 4.35E-09 Ighg;Igh;Fcgr4;Ighg;Fcer1g;Ighg;Fcgr3;Tyrobp;Icam1;Gzmb;Ifnar2;Igh;Itgb2;Ifnar2;Igh;Cd244;Igh;Rac2;H2-D1;H2-D1http://carcin.oxfordjournals.org/ 25 Graft-versus-host disease 10 7.43E-10 7.69E-09 Il6;Il1b;Gzmb;Cd86;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1 26 Systemic lupus erythematosus 14 2.43E-09 2.40E-08 Ighg;Igh;Fcgr4;Ighg;C3;Il10;Ighg;Fcgr2b;Fcgr2b;Fcgr1;Fcgr2b;Fcgr3;C1r;Cd86;Fcgr2b;Igh;C1qb;Igh;C1qc;C1qb;C4b;Igh;H2-Eb1 27 Histidine metabolism 7 5.16E-09 4.85E-08 Hdc;Hdc;Hal;Aldh2;Aldh1b1;Maoa;Maoa;Ddc;Abp1 28 29 Glycan structures - biosynthesis 2 9 5.82E-09 5.24E-08 St3gal1;St6galnac5;B3galt5;St3gal6;St6galnac4;St6galnac6;Fut4;B3gnt5;St3gal6;B3galt5;St3gal6;Fut9;Fut9 30 MAPK signaling pathway 16 6.78E-09 5.78E-08 Il1r2;Il1b;Fgf7;Il1r1;Map3k8;Fgf7;Dusp1;Nr4a1;Map4k4;Pdgfrb;Map4k4;Fgf13;Hspa2;Arrb2;Rac2;Evi1;Mapkapk3;Pla2g10 31 Tryptophan metabolism 8 6.98E-09 5.78E-08 Cyp1b1;Hadh;Ccbl1;Aldh2;Ccbl1;Aldh1b1;Maoa;Maoa;Ddc;Abp1 32 Type I diabetes mellitus 9 2.67E-08 2.13E-07 Il1b;Gzmb;Cd86;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1
33 Nitrogen metabolism 6 3.49E-08 2.68E-07 Hal;Cth;Car2;Car4;Car4;Cps1;Car1 by guest on November 20, 2015 34 Selenoamino acid metabolism 6 4.76E-08 3.52E-07 Ggt5;Papss2;Ahcyl2;Ggt6;Cbs;Cth 35 Toll-like receptor signaling pathway 10 5.03E-08 3.59E-07 Il6;Ccl3;Il1b;Spp1;Map3k8;Lbp;Ifnar2;Cd86;Ifnar2;Cxcl10;Ccl4 36 Fructose and mannose metabolism 7 1.16E-07 8.03E-07 Pfkfb3;Hk3;Fbp1;Gmds;Fbp2;Gmds;Akr1c13;Akr1c13;Aldob 37 Small cell lung cancer 9 3.14E-07 2.06E-06 Ptgs2;Lama1;Col4a2;Lama4;Col4a1;Lamb1-1;Col4a1;Lama4;Lamb1-1;Lamc1;Lamb3;Cdkn2b 38 39 Neuroactive ligand-receptor interaction 14 3.18E-07 2.06E-06 Fpr2;Fpr1;Bdkrb1;Ednrb;Ednrb;C5ar1;Ednra;C3ar1;P2ry13;Adora1;Cnr1;C3ar1;Ptger2;F2rl1;Vipr1;Htr4 40 Arachidonic acid metabolism 8 4.05E-07 2.54E-06 Ptgs2;Ptges;Ptges;Ggt5;Gpx3;Ggt6;Cyp2c40;Pla2g10;Cyp2c55 41 Antigen processing and presentation 9 4.90E-07 2.98E-06 Lgmn;Ctsb;Hspa2;Ctsb;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1 42 Calcium signaling pathway 12 6.01E-07 3.56E-06 Ighg;Igh;Sphk1;Ighg;Bst1;Bst1;Ighg;Bdkrb1;Ednrb;Ednrb;Pde1a;Ednra;Pdgfrb;Igh;Igh;Igh;Gna14;Gna14;Erbb3;Htr4 43 Asthma 6 9.33E-07 5.36E-06 Ighg;Igh;Ighg;Il10;Fcer1g;Ighg;Ccl11;Igh;Igh;Igh;H2-Eb1 44 Butanoate metabolism 6 1.11E-06 6.21E-06 Hadh;Aldh2;Hmgcs2;Aldh1b1;Akr1c13;Akr1c13;Abat 45 Phenylalanine metabolism 5 1.38E-06 7.52E-06 Maoa;Maoa;Prdx6;Ddc;Hpd;Lpo 46 Sulfur metabolism 4 2.55E-06 1.35E-05 Chst11;Papss2;Sult2b1;Sult1a1 47 Fatty acid metabolism 6 3.28E-06 1.70E-05 Acsl4;Acsl4;Acsl4;Hadh;Acsl3;Aldh2;Acsl3;Aldh1b1;Acsl3;Adh1 48 49 TGF-beta signaling pathway 8 3.79E-06 1.91E-05 Inhbb;LOC100046802;Thbs1;Thbs1;Bmp7;Dcn;Thbs1;Fst;Fst;Thbs4;Cdkn2b 50 Glycine, serine and threonine metabolism 6 4.32E-06 2.13E-05 Shmt1;Cbs;Cth;Maoa;Maoa;Akr1c13;Akr1c13;Chdh 51 B cell receptor signaling pathway 7 4.44E-06 2.14E-05 Ighg;Igh;Ighg;Ifitm1;Ighg;Lilrb3;Fcgr2b;Lilrb3;Fcgr2b;Fcgr2b;Fcgr2b;Igh;Igh;Nfkbie;Igh;Rac2 52 O-Glycan biosynthesis 5 5.22E-06 2.46E-05 St3gal1;Gcnt1;Galnt4;Galnt7;Galnt7;Galnt7;Gcnt3 53 Prion disease 4 5.43E-06 2.50E-05 Il6;Lama1;Lamb1-1;Lamb1-1;Lamc1 54 Alzheimer's disease 5 6.31E-06 2.84E-05 Lpl;Lpl;Il1b;C1qb;C1qc;C1qb;Lrp1 55 Regulation of actin cytoskeleton 11 6.81E-06 3.00E-05 Itgam;Fgf7;Fgf7;Itga4;Bdkrb1;Pdgfrb;Itgb2;Fgf13;Msn;Rac2;Pip5k1b;Myh14 56 Glycosphingolipid biosynthesis - ganglioseries 4 1.35E-05 5.83E-05 St3gal1;St6galnac5;St6galnac4;St6galnac6 57 Glycan structures - biosynthesis 1 8 1.66E-05 7.03E-05 Csgalnact1;St3gal1;Chst11;Gcnt1;Galnt4;Galnt7;Galnt7;Galnt7;B3gnt7;Gcnt3 58 59 60 Page 47 of 98 Carcinogenesis
1 2 Arginine and proline metabolism 5 1.70E-05 7.06E-05 Arg1;Arg2;Arg2;Cps1;Ckmt1;Otc;Ckmt1 3 Glycosphingolipid biosynthesis - neo-lactoseries 4 2.24E-05 9.09E-05 St3gal6;Fut4;B3gnt5;St3gal6;St3gal6;Fut9;Fut9 4 Sphingolipid metabolism 5 2.61E-05 1.04E-04 Sphk1;Ppap2c;Gal3st1;Degs2;Sgpp2 5 Cyanoamino acid metabolism 3 2.92E-05 1.14E-04 Ggt5;Shmt1;Ggt6 6 Axon guidance 8 3.79E-05 1.45E-04 Slit3;Cxcl12;Rnd1;Sema7a;Gnai2;Rac2;Ngef;Sema4g 7 Linoleic acid metabolism 5 4.35E-05 1.64E-04 Akr1c13;Cyp2c40;Akr1c13;Pla2g10;Cyp3a13;Cyp2c55 8 9 Adipocytokine signaling pathway 6 4.43E-05 1.64E-04 Acsl4;Socs3;Socs3;Socs3;Acsl4;Acsl4;Nfkbie;Acsl3;Acsl3;Ppargc1a;Acsl3;Ppargc1a;Ppargc1a;Pck1 10 Methane metabolism 3 4.64E-05 1.69E-04 Shmt1;Prdx6;Lpo 11 Methionine metabolism 4 5.19E-05 1.81E-04 Dnmt3l;Ahcyl2;Cbs;Cth 12 beta-Alanine metabolism 4 5.19E-05 1.81E-04 Aldh2;Dpyd;Aldh1b1;Dpyd;Abat 13 Retinol metabolism 6 5.24E-05 1.81E-04 Aldh1a2;Cyp2c40;Rdh16;Adh1;Cyp3a13;Cyp2c55 14 3-Chloroacrylic acid degradation 3 6.91E-05 2.35E-04 Aldh2;Aldh1b1;Adh1 15 Maturity onset diabetes of the young 4 8.78E-05 2.93E-04 Nr5a2;Hnf4a;Foxa3;Hnf4a;Hnf4a;Foxa2 16 Pentose phosphate pathway 4 1.20E-04 3.94E-04 Fbp1;H6pd;Fbp2;Aldob 17 Purine metabolism 8 1.25E-04 4.03E-04 Pde4b;Pde4b;Pde1a;Pde4b;Pde10a;Ada;Pde7a;Pde7a;Entpd5;Papss2;Gucy2c 18 Bile acid biosynthesis For Peer Review4 1.83E-04 5.83E-04 Aldh2;Aldh1b1;Akr1c13;Akr1c13;Adh1 19 Downloaded from 20 Aminosugars metabolism 4 2.09E-04 6.50E-04 Npl;Hk3;Gfpt1;Nans 21 Propanoate metabolism 4 2.09E-04 6.50E-04 Aldh2;Aldh1b1;Abat;Acss2;Acss2 22 Glycosphingolipid biosynthesis - globoseries 3 2.29E-04 6.96E-04 St3gal1;B3galt5;B3galt5;Fut9;Fut9 23 Insulin signaling pathway 7 3.47E-04 0.0010414 Socs3;Socs3;Socs3;Pygl;Fbp1;Cblc;Fbp2;Ppargc1a;Ppargc1a;Ppargc1a;Pck1
24 Primary immunodeficiency 4 3.76E-04 0.001113 Ighg;Igh;Ighg;Ighg;Icos;Igh;Igh;Icos;Ada;Ighhttp://carcin.oxfordjournals.org/ 25 Melanogenesis 6 4.07E-04 0.0011852 Ednrb;Ednrb;Fzd1;Gnai2;Tcf7l2;Creb3l4;Fzd5 26 Androgen and estrogen metabolism 4 5.14E-04 0.001467 Hsd11b1;Sult2b1;Hsd17b2;Hsd11b2 27 Tyrosine metabolism 4 5.14E-04 0.001467 Maoa;Maoa;Ddc;Adh1;Hpd 28 29 Alkaloid biosynthesis II 3 5.29E-04 0.0014791 Pla1a;Aadac;Prdx6 30 T cell receptor signaling pathway 6 6.12E-04 0.0016674 Il10;Map3k8;Icos;Ctla4;Icos;Nfkbie;Cblc 31 Wnt signaling pathway 7 6.75E-04 0.0017579 Fosl1;Sfrp1;Prickle2;Fzd1;Sfrp1;Rac2;Tcf7l2;Fzd5 32 Melanoma 5 6.78E-04 0.0017579 Hgf;Fgf7;Fgf7;Hgf;Hgf;Pdgfrb;Fgf13;Cdh1
33 Glycerolipid metabolism 4 6.84E-04 0.0017579 Lpl;Lpl;Ppap2c;Aldh2;Aldh1b1 by guest on November 20, 2015 34 Pyruvate metabolism 4 6.84E-04 0.0017579 Aldh2;Aldh1b1;Acss2;Acss2;Pck1 35 VEGF signaling pathway 5 7.22E-04 0.0018222 Sphk1;Ptgs2;Rac2;Mapkapk3;Pla2g10 36 Bladder cancer 4 7.48E-04 0.0018658 Mmp9;Mmp9;Thbs1;Thbs1;Thbs1;Mmp2;Mmp2;Cdh1 37 Valine, leucine and isoleucine degradation 4 8.17E-04 0.0020128 Hadh;Aldh2;Hmgcs2;Aldh1b1 38 39 Fc epsilon RI signaling pathway 5 9.71E-04 0.0023382 Ighg;Igh;Ighg;Fcer1g;Ighg;Igh;Igh;Igh;Rac2;Pla2g10 40 Chondroitin sulfate biosynthesis 3 0.0010053 0.0023806 Csgalnact1;Chst11;Dse 41 Carbon fixation 3 0.0014978 0.0034836 Fbp1;Fbp2;Aldob 42 Drug metabolism - other enzymes 4 0.0017655 0.0040607 Cda;Dpyd;Ces5;Dpyd;Cyp3a13 43 Basal cell carcinoma 4 0.0018898 0.0042642 Fzd1;Tcf7l2;Fzd5;Hhip 44 Apoptosis 5 0.0020097 0.0044022 Il1b;Il1r1;Irak3;Csf2rb;Csf2rb;Csf2rb2 45 Colorectal cancer 5 0.0020097 0.0044022 Pdgfrb;Fzd1;Rac2;Tcf7l2;Fzd5 46 Gap junction 5 0.0022061 0.0047569 Tubb3;Gja1;Gja1;Pdgfrb;Gja1;Gnai2;Gja1;Gucy2c 47 Lysine degradation 3 0.0023568 0.0050294 Hadh;Aldh2;Aldh1b1 48 49 Ascorbate and aldarate metabolism 2 0.0024398 0.0051013 Aldh2;Aldh1b1 50 Glutamate metabolism 3 0.0031661 0.0065539 Gfpt1;Abat;Cps1 51 Ether lipid metabolism 3 0.0034692 0.0071101 Pla2g7;Ppap2c;Pla2g10 52 Taurine and hypotaurine metabolism 2 0.0038718 0.0078192 Ggt5;Ggt6 53 Glycosphingolipid biosynthesis - lactoseries 2 0.0038718 0.0078192 B3galt5;B3gnt5;B3galt5 54 p53 signaling pathway 4 0.0052742 0.0101089 Serpine1;Thbs1;Thbs1;Thbs1;Perp;Serpinb5;Serpinb5;Serpinb5;Serpinb5 55 Adherens junction 4 0.00608 0.0112372 Rac2;Tcf7l2;Lmo7;Cdh1 56 C21-Steroid hormone metabolism 2 0.0065855 0.0120637 Hsd11b1;Hsd11b2 57 ABC transporters - General 3 0.0069996 0.0127097 Abcc9;Abcc9;Abcc9;Abcb1a;Abcb1a;Cftr 58 59 60 Carcinogenesis Page 48 of 98
1 2 Keratan sulfate biosynthesis 2 0.0087543 0.0154081 St3gal1;B3gnt7 3 Pantothenate and CoA biosynthesis 2 0.0087543 0.0154081 Pank1;Dpyd;Pank1;Dpyd 4 alpha-Linolenic acid metabolism 2 0.0099423 0.0166644 Fads2;Fads2;Pla2g10 5 Limonene and pinene degradation 2 0.0099423 0.0166644 Aldh2;Aldh1b1 6 ErbB signaling pathway 4 0.0101114 0.0167446 Ereg;Nrg1;Cblc;Erbb3 7 gamma-Hexachlorocyclohexane degradation 2 0.0111974 0.0182509 Alpl;Cyp3a13 8 9 Pyrimidine metabolism 4 0.0135791 0.0216221 Ctps;Entpd5;Cda;Dpyd;Dpyd 10 Glycerophospholipid metabolism 3 0.0171841 0.0271535 Ppap2c;Cds1;Pla2g10 11 Galactose metabolism 2 0.0217505 0.0338523 Hk3;Gale 12 Nicotinate and nicotinamide metabolism 2 0.0234949 0.0362944 Bst1;Bst1;Nnmt 13 Thyroid cancer 2 0.0290558 0.0439019 Tcf7l2;Cdh1 14 Folate biosynthesis 2 0.0330244 0.0493578 Alpl;Ggh 15 Biosynthesis of unsaturated fatty acids 2 0.0330244 0.0493578 Scd2;Fads2;Fads2;Scd2 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 49 of 98 Carcinogenesis
1 2 3 4 Cxcl5;Il6;Cxcl2;Cxcl1;Il11;Cxcl1;Ccl2;Il1r2;Ccl3;Csf3;Tnfsf11;Il1b;Inhbb;Hgf;Ppbp;Pf4;Ccr1;Cxcl1;Ccr1;Il10;Ccl9;Cxcl14;Il1r1;Osmr;Ccl7;Ccl8;Bmp7;Ccl11;Tnfrsf9;Csf2rb;Csf2rb;Ccl9;Cxcl12;Csf2rb2;Hgf;Tnfrsf9;Hgf;Tnfrsf11b;Ifnar2;Cxcl13;Il6st;Il8rb;Pdgfrb;Tnfrsf12a;Il4ra;Cxcl13;Ifnar2;Ccl12;Il2ra;Csf3r;Osm;Cxcl16;Il15ra;Lif;Flt1;Cxcl10;Ccl4;Il18;Ccl28 5 Spp1;Thbs1;Tnc;Thbs1;Lama1;Thbs1;Col4a2;Prph;Lama4;Col4a1;Col5a3;Lamb1-1;Gja1;Col4a1;Gja1;Col5a2;Lama4;Col1a1;Lamb1-1;Gja1;Gja1;Lamc1;Krt7;Dsg2;Lamb3;Dsg2;Krt8;Krt18;Dsg2;Krt8;Thbs4;Krt19;Krt20;Dsg2;Krt8;Gjb3;Dsc2;Dsg2 6 Selp;Selp;Selp;Itgam;Vcan;Itga4;Icam1;Vcan;Icos;Ctla4;Vcam1;Cd86;Itgb2;Icos;Madcam1;Sell;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;Cldn3;Cdh1;Cldn7;Cldn3;Cldn3;Cldn3;Cldn23;Ocln;Cldn8;H2-Q1;Cldn2 7 Serpine1;C3;F10;Bdkrb1;C5ar1;F13a1;Plat;Plaur;C1r;Cd59a;Cfh;C3ar1;Cfh;Serping1;F10;C1qb;C1qc;C1qb;C4b;F5;Cd59a;C3ar1;C4bp 8 9 Mmp9;Mmp9;Itgam;Itga4;Cxcl12;Mmp2;Icam1;Mmp2;Ncf4;Vcam1;Itgb2;Cybb;Cybb;Msn;Gnai2;Ncf1;Rac2;Cldn3;Cldn7;Cldn3;Cldn3;Cldn3;Cldn23;Ocln;Cldn8;Cldn2 10 Il6;Il11;Il1r2;Csf3;Ighg;Igh;Il1b;Ighg;Itgam;Il1r1;Ighg;Itga4;Fcgr1;Cd59a;Cd44;Igh;Il4ra;Igh;Il2ra;Csf3r;Igh;Cd59a;H2-Eb1 11 Spp1;Thbs1;Tnc;Thbs1;Lama1;Itga4;Thbs1;Col4a2;Lama4;Col4a1;Col5a3;Lamb1-1;Col4a1;Cd44;Col5a2;Lama4;Col1a1;Lamb1-1;Lamc1;Lamb3;Thbs4 12 Il6;Il11;Csf3;Socs3;Socs3;Socs3;Il10;Osmr;Csf2rb;Csf2rb;Csf2rb2;Ifnar2;Il6st;Il4ra;Ifnar2;Il13ra2;Il2ra;Pim1;Csf3r;Osm;Il15ra;Lif;Pim1;Cblc 13 Gstm6;Gsta1;Gsta2;Gsta4;Mgst3;Gsta3;Cyp2d26;Maoa;Cyp2d9;Maoa;Cyp2c40;Adh1;Gstm3;Cyp3a13;Cyp2d10;Cyp2c55 14 Spp1;Thbs1;Hgf;Tnc;Thbs1;Lama1;Itga4;Thbs1;Col4a2;Hgf;Hgf;Lama4;Col4a1;Col5a3;Lamb1-1;Col4a1;Pdgfrb;Col5a2;Lama4;Col1a1;Lamb1-1;Flt1;Rac2;Lamc1;Lamb3;Thbs4 15 Cyp1b1;Gstm6;Gsta1;Gsta2;Gsta4;Mgst3;Gsta3;Cyp2s1;Cyp2c40;Adh1;Gstm3;Cyp3a13;Cyp2c55 16 Lpl;Lpl;Acsl4;Angptl4;Fabp5;Acsl4;Fabp5;Acsl4;Fabp4;Fabp7;Fabp4;Scd2;Acsl3;Fads2;Hmgcs2;Acsl3;Fads2;Fabp6;Scd2;Acsl3;Pck1;Fabp2 17 Hcls1;Gnai2;Llgl2;Crb3;Igsf5;Cgn;Tjp3;Myh14;Cldn3;Inadl;Cldn7;Cldn3;Cldn3;Cldn3;Cldn23;Ocln;Cldn8;Cldn2 18 Ighg;Igh;Ighg;Il10;Ighg;Gzmb;Ctla4;Cd86;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1For Peer Review 19 Downloaded from 20 Ighg;Igh;Ighg;Il10;Ighg;Gzmb;Cd86;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1 21 Ggt5;Gpx3;Gstm6;Gsta1;Gsta2;Ggt6;Gsta4;Mgst3;Gsta3;Gstm3 22 Arg1;Arg2;Arg2;Aldh2;Aldh1b1;Maoa;Maoa;Cps1;Abp1;Otc 23 Hk3;Fbp1;Eno2;Aldh2;Fbp2;Aldh1b1;Adh1;Acss2;Acss2;Eno3;Aldob
24 Ighg;Igh;Fcgr4;Ighg;Fcer1g;Ighg;Fcgr3;Tyrobp;Icam1;Gzmb;Ifnar2;Igh;Itgb2;Ifnar2;Igh;Cd244;Igh;Rac2;H2-D1;H2-D1 http://carcin.oxfordjournals.org/ 25 Il6;Il1b;Gzmb;Cd86;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1 26 Ighg;Igh;Fcgr4;Ighg;C3;Il10;Ighg;Fcgr2b;Fcgr2b;Fcgr1;Fcgr2b;Fcgr3;C1r;Cd86;Fcgr2b;Igh;C1qb;Igh;C1qc;C1qb;C4b;Igh;H2-Eb1 27 Hdc;Hdc;Hal;Aldh2;Aldh1b1;Maoa;Maoa;Ddc;Abp1 28 29 St3gal1;St6galnac5;B3galt5;St3gal6;St6galnac4;St6galnac6;Fut4;B3gnt5;St3gal6;B3galt5;St3gal6;Fut9;Fut9 30 Il1r2;Il1b;Fgf7;Il1r1;Map3k8;Fgf7;Dusp1;Nr4a1;Map4k4;Pdgfrb;Map4k4;Fgf13;Hspa2;Arrb2;Rac2;Evi1;Mapkapk3;Pla2g10 31 Cyp1b1;Hadh;Ccbl1;Aldh2;Ccbl1;Aldh1b1;Maoa;Maoa;Ddc;Abp1 32 Il1b;Gzmb;Cd86;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1
33 Hal;Cth;Car2;Car4;Car4;Cps1;Car1 by guest on November 20, 2015 34 Ggt5;Papss2;Ahcyl2;Ggt6;Cbs;Cth 35 Il6;Ccl3;Il1b;Spp1;Map3k8;Lbp;Ifnar2;Cd86;Ifnar2;Cxcl10;Ccl4 36 Pfkfb3;Hk3;Fbp1;Gmds;Fbp2;Gmds;Akr1c13;Akr1c13;Aldob 37 Ptgs2;Lama1;Col4a2;Lama4;Col4a1;Lamb1-1;Col4a1;Lama4;Lamb1-1;Lamc1;Lamb3;Cdkn2b 38 39 Fpr2;Fpr1;Bdkrb1;Ednrb;Ednrb;C5ar1;Ednra;C3ar1;P2ry13;Adora1;Cnr1;C3ar1;Ptger2;F2rl1;Vipr1;Htr4 40 Ptgs2;Ptges;Ptges;Ggt5;Gpx3;Ggt6;Cyp2c40;Pla2g10;Cyp2c55 41 Lgmn;Ctsb;Hspa2;Ctsb;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;H2-Q1 42 Ighg;Igh;Sphk1;Ighg;Bst1;Bst1;Ighg;Bdkrb1;Ednrb;Ednrb;Pde1a;Ednra;Pdgfrb;Igh;Igh;Igh;Gna14;Gna14;Erbb3;Htr4 43 Ighg;Igh;Ighg;Il10;Fcer1g;Ighg;Ccl11;Igh;Igh;Igh;H2-Eb1 44 Hadh;Aldh2;Hmgcs2;Aldh1b1;Akr1c13;Akr1c13;Abat 45 Maoa;Maoa;Prdx6;Ddc;Hpd;Lpo 46 Chst11;Papss2;Sult2b1;Sult1a1 47 Acsl4;Acsl4;Acsl4;Hadh;Acsl3;Aldh2;Acsl3;Aldh1b1;Acsl3;Adh1 48 49 Inhbb;LOC100046802;Thbs1;Thbs1;Bmp7;Dcn;Thbs1;Fst;Fst;Thbs4;Cdkn2b 50 Shmt1;Cbs;Cth;Maoa;Maoa;Akr1c13;Akr1c13;Chdh 51 Ighg;Igh;Ighg;Ifitm1;Ighg;Lilrb3;Fcgr2b;Lilrb3;Fcgr2b;Fcgr2b;Fcgr2b;Igh;Igh;Nfkbie;Igh;Rac2 52 St3gal1;Gcnt1;Galnt4;Galnt7;Galnt7;Galnt7;Gcnt3 53 Il6;Lama1;Lamb1-1;Lamb1-1;Lamc1 54 Lpl;Lpl;Il1b;C1qb;C1qc;C1qb;Lrp1 55 Itgam;Fgf7;Fgf7;Itga4;Bdkrb1;Pdgfrb;Itgb2;Fgf13;Msn;Rac2;Pip5k1b;Myh14 56 St3gal1;St6galnac5;St6galnac4;St6galnac6 57 Csgalnact1;St3gal1;Chst11;Gcnt1;Galnt4;Galnt7;Galnt7;Galnt7;B3gnt7;Gcnt3 58 59 60 Carcinogenesis Page 50 of 98
1 2 Arg1;Arg2;Arg2;Cps1;Ckmt1;Otc;Ckmt1 3 St3gal6;Fut4;B3gnt5;St3gal6;St3gal6;Fut9;Fut9 4 Sphk1;Ppap2c;Gal3st1;Degs2;Sgpp2 5 Ggt5;Shmt1;Ggt6 6 Slit3;Cxcl12;Rnd1;Sema7a;Gnai2;Rac2;Ngef;Sema4g 7 Akr1c13;Cyp2c40;Akr1c13;Pla2g10;Cyp3a13;Cyp2c55 8 9 Acsl4;Socs3;Socs3;Socs3;Acsl4;Acsl4;Nfkbie;Acsl3;Acsl3;Ppargc1a;Acsl3;Ppargc1a;Ppargc1a;Pck1 10 Shmt1;Prdx6;Lpo 11 Dnmt3l;Ahcyl2;Cbs;Cth 12 Aldh2;Dpyd;Aldh1b1;Dpyd;Abat 13 Aldh1a2;Cyp2c40;Rdh16;Adh1;Cyp3a13;Cyp2c55 14 Aldh2;Aldh1b1;Adh1 15 Nr5a2;Hnf4a;Foxa3;Hnf4a;Hnf4a;Foxa2 16 Fbp1;H6pd;Fbp2;Aldob 17 Pde4b;Pde4b;Pde1a;Pde4b;Pde10a;Ada;Pde7a;Pde7a;Entpd5;Papss2;Gucy2c 18 Aldh2;Aldh1b1;Akr1c13;Akr1c13;Adh1For Peer Review 19 Downloaded from 20 Npl;Hk3;Gfpt1;Nans 21 Aldh2;Aldh1b1;Abat;Acss2;Acss2 22 St3gal1;B3galt5;B3galt5;Fut9;Fut9 23 Socs3;Socs3;Socs3;Pygl;Fbp1;Cblc;Fbp2;Ppargc1a;Ppargc1a;Ppargc1a;Pck1
24 Ighg;Igh;Ighg;Ighg;Icos;Igh;Igh;Icos;Ada;Igh http://carcin.oxfordjournals.org/ 25 Ednrb;Ednrb;Fzd1;Gnai2;Tcf7l2;Creb3l4;Fzd5 26 Hsd11b1;Sult2b1;Hsd17b2;Hsd11b2 27 Maoa;Maoa;Ddc;Adh1;Hpd 28 29 Pla1a;Aadac;Prdx6 30 Il10;Map3k8;Icos;Ctla4;Icos;Nfkbie;Cblc 31 Fosl1;Sfrp1;Prickle2;Fzd1;Sfrp1;Rac2;Tcf7l2;Fzd5 32 Hgf;Fgf7;Fgf7;Hgf;Hgf;Pdgfrb;Fgf13;Cdh1
33 Lpl;Lpl;Ppap2c;Aldh2;Aldh1b1 by guest on November 20, 2015 34 Aldh2;Aldh1b1;Acss2;Acss2;Pck1 35 Sphk1;Ptgs2;Rac2;Mapkapk3;Pla2g10 36 Mmp9;Mmp9;Thbs1;Thbs1;Thbs1;Mmp2;Mmp2;Cdh1 37 Hadh;Aldh2;Hmgcs2;Aldh1b1 38 39 Ighg;Igh;Ighg;Fcer1g;Ighg;Igh;Igh;Igh;Rac2;Pla2g10 40 Csgalnact1;Chst11;Dse 41 Fbp1;Fbp2;Aldob 42 Cda;Dpyd;Ces5;Dpyd;Cyp3a13 43 Fzd1;Tcf7l2;Fzd5;Hhip 44 Il1b;Il1r1;Irak3;Csf2rb;Csf2rb;Csf2rb2 45 Pdgfrb;Fzd1;Rac2;Tcf7l2;Fzd5 46 Tubb3;Gja1;Gja1;Pdgfrb;Gja1;Gnai2;Gja1;Gucy2c 47 Hadh;Aldh2;Aldh1b1 48 49 Aldh2;Aldh1b1 50 Gfpt1;Abat;Cps1 51 Pla2g7;Ppap2c;Pla2g10 52 53 B3galt5;B3gnt5;B3galt5 54 Serpine1;Thbs1;Thbs1;Thbs1;Perp;Serpinb5;Serpinb5;Serpinb5;Serpinb5 55 Rac2;Tcf7l2;Lmo7;Cdh1 56 Hsd11b1;Hsd11b2 57 Abcc9;Abcc9;Abcc9;Abcb1a;Abcb1a;Cftr 58 59 60 Page 51 of 98 Carcinogenesis
1 2 St3gal1;B3gnt7 3 Pank1;Dpyd;Pank1;Dpyd 4 Fads2;Fads2;Pla2g10 5 Aldh2;Aldh1b1 6 Ereg;Nrg1;Cblc;Erbb3 7 Alpl;Cyp3a13 8 9 Ctps;Entpd5;Cda;Dpyd;Dpyd 10 Ppap2c;Cds1;Pla2g10 11 12 Bst1;Bst1;Nnmt 13 Tcf7l2;Cdh1 14 15 Scd2;Fads2;Fads2;Scd2 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 52 of 98
1 2 3 Cxcl5;Il6;Cxcl2;Cxcl1;Il11;Cxcl1;Ccl2;Il1r2;Ccl3;Csf3;Tnfsf11;Il1b;Inhbb;Hgf;Ppbp;Pf4;Ccr1;Cxcl1;Ccr1;Il10;Ccl9;Cxcl14;Il1r1;Osmr;Ccl7;Ccl8;Bmp7;Ccl11;Tnfrsf9;Csf2rb;Csf2rb;Ccl9;Cxcl12;Csf2rb2;Hgf;Tnf4 rsf9;Hgf;Tnfrsf11b;Ifnar2;Cxcl13;Il6st;Il8rb;Pdgfrb;Tnfrsf12a;Il4ra;Cxcl13;Ifnar2;Ccl12;Il2ra;Csf3r;Osm;Cxcl16;Il15ra;Lif;Flt1;Cxcl10;Ccl4;Il18;Ccl28 Spp1;Thbs1;Tnc;Thbs1;Lama1;Thbs1;Col4a2;Prph;Lama4;Col4a1;Col5a3;Lamb1-1;Gja1;Col4a1;Gja1;Col5a2;Lama4;Col1a1;Lamb1-1;Gja1;Gja1;Lamc1;Krt7;Dsg2;Lamb3;Dsg2;Krt8;Krt18;Dsg2;Krt8;Thbs4;Krt19;Krt20;Dsg2;K5 rt8;Gjb3;Dsc2;Dsg2 Selp;Selp;Selp;Itgam;Vcan;Itga4;Icam1;Vcan;Icos;Ctla4;Vcam1;Cd86;Itgb2;Icos;Madcam1;Sell;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;Cldn3;Cdh1;Cldn7;Cldn3;Cldn3;Cldn3;Cldn23;Ocln;Cldn8;H2-Q1;Cldn26 7 Serpine1;C3;F10;Bdkrb1;C5ar1;F13a1;Plat;Plaur;C1r;Cd59a;Cfh;C3ar1;Cfh;Serping1;F10;C1qb;C1qc;C1qb;C4b;F5;Cd59a;C3ar1;C4bp 8 Mmp9;Mmp9;Itgam;Itga4;Cxcl12;Mmp2;Icam1;Mmp2;Ncf4;Vcam1;Itgb2;Cybb;Cybb;Msn;Gnai2;Ncf1;Rac2;Cldn3;Cldn7;Cldn3;Cldn3;Cldn3;Cldn23;Ocln;Cldn8;Cldn29 Il6;Il11;Il1r2;Csf3;Ighg;Igh;Il1b;Ighg;Itgam;Il1r1;Ighg;Itga4;Fcgr1;Cd59a;Cd44;Igh;Il4ra;Igh;Il2ra;Csf3r;Igh;Cd59a;H2-Eb110 Spp1;Thbs1;Tnc;Thbs1;Lama1;Itga4;Thbs1;Col4a2;Lama4;Col4a1;Col5a3;Lamb1-1;Col4a1;Cd44;Col5a2;Lama4;Col1a1;Lamb1-1;Lamc1;Lamb3;Thbs411 Il6;Il11;Csf3;Socs3;Socs3;Socs3;Il10;Osmr;Csf2rb;Csf2rb;Csf2rb2;Ifnar2;Il6st;Il4ra;Ifnar2;Il13ra2;Il2ra;Pim1;Csf3r;Osm;Il15ra;Lif;Pim1;Cblc12 Gstm6;Gsta1;Gsta2;Gsta4;Mgst3;Gsta3;Cyp2d26;Maoa;Cyp2d9;Maoa;Cyp2c40;Adh1;Gstm3;Cyp3a13;Cyp2d10;Cyp2c5513 Spp1;Thbs1;Hgf;Tnc;Thbs1;Lama1;Itga4;Thbs1;Col4a2;Hgf;Hgf;Lama4;Col4a1;Col5a3;Lamb1-1;Col4a1;Pdgfrb;Col5a2;Lama4;Col1a1;Lamb1-1;Flt1;Rac2;Lamc1;Lamb3;Thbs414 15 Lpl;Lpl;Acsl4;Angptl4;Fabp5;Acsl4;Fabp5;Acsl4;Fabp4;Fabp7;Fabp4;Scd2;Acsl3;Fads2;Hmgcs2;Acsl3;Fads2;Fabp6;Scd2;Acsl3;Pck1;Fabp216 17 18 For Peer Review 19 Downloaded from 20 21 22 23
Ighg;Igh;Fcgr4;Ighg;Fcer1g;Ighg;Fcgr3;Tyrobp;Icam1;Gzmb;Ifnar2;Igh;Itgb2;Ifnar2;Igh;Cd244;Igh;Rac2;H2-D1;H2-D124 http://carcin.oxfordjournals.org/ 25 Ighg;Igh;Fcgr4;Ighg;C3;Il10;Ighg;Fcgr2b;Fcgr2b;Fcgr1;Fcgr2b;Fcgr3;C1r;Cd86;Fcgr2b;Igh;C1qb;Igh;C1qc;C1qb;C4b;Igh;H2-Eb126 27 28 29 Il1r2;Il1b;Fgf7;Il1r1;Map3k8;Fgf7;Dusp1;Nr4a1;Map4k4;Pdgfrb;Map4k4;Fgf13;Hspa2;Arrb2;Rac2;Evi1;Mapkapk3;Pla2g1030 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 Ighg;Igh;Sphk1;Ighg;Bst1;Bst1;Ighg;Bdkrb1;Ednrb;Ednrb;Pde1a;Ednra;Pdgfrb;Igh;Igh;Igh;Gna14;Gna14;Erbb3;Htr442 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 53 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 54 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 55 of 98 Carcinogenesis
1 2 3 Cxcl5;Il6;Cxcl2;Cxcl1;Il11;Cxcl1;Ccl2;Il1r2;Ccl3;Csf3;Tnfsf11;Il1b;Inhbb;Hgf;Ppbp;Pf4;Ccr1;Cxcl1;Ccr1;Il10;Ccl9;Cxcl14;Il1r1;Osmr;Ccl7;Ccl8;Bmp7;Ccl11;Tnfrsf9;Csf2rb;Csf2rb;Ccl9;Cxcl12;Csf2rb2;Hgf;Tnf4 rsf9;Hgf;Tnfrsf11b;Ifnar2;Cxcl13;Il6st;Il8rb;Pdgfrb;Tnfrsf12a;Il4ra;Cxcl13;Ifnar2;Ccl12;Il2ra;Csf3r;Osm;Cxcl16;Il15ra;Lif;Flt1;Cxcl10;Ccl4;Il18;Ccl28 Spp1;Thbs1;Tnc;Thbs1;Lama1;Thbs1;Col4a2;Prph;Lama4;Col4a1;Col5a3;Lamb1-1;Gja1;Col4a1;Gja1;Col5a2;Lama4;Col1a1;Lamb1-1;Gja1;Gja1;Lamc1;Krt7;Dsg2;Lamb3;Dsg2;Krt8;Krt18;Dsg2;Krt8;Thbs4;Krt19;Krt20;Dsg2;K5 rt8;Gjb3;Dsc2;Dsg2 Selp;Selp;Selp;Itgam;Vcan;Itga4;Icam1;Vcan;Icos;Ctla4;Vcam1;Cd86;Itgb2;Icos;Madcam1;Sell;H2-T3-like;H2-T3;H2-D1;H2-Q2;H2-D1;H2-Eb1;Cldn3;Cdh1;Cldn7;Cldn3;Cldn3;Cldn3;Cldn23;Ocln;Cldn8;H2-Q1;Cldn26 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 56 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 57 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 58 of 98
1 2 3 Cxcl5;Il6;Cxcl2;Cxcl1;Il11;Cxcl1;Ccl2;Il1r2;Ccl3;Csf3;Tnfsf11;Il1b;Inhbb;Hgf;Ppbp;Pf4;Ccr1;Cxcl1;Ccr1;Il10;Ccl9;Cxcl14;Il1r1;Osmr;Ccl7;Ccl8;Bmp7;Ccl11;Tnfrsf9;Csf2rb;Csf2rb;Ccl9;Cxcl12;Csf2rb2;Hgf;Tnfrsf9;Hgf;Tnfrsf11b;Ifnar2;Cxcl13;Il6st;Il8rb;Pdgfrb;Tnfrsf12a;Il4ra;Cxcl13;Ifnar2;Ccl12;Il2ra;Csf3r;Osm;Cxcl16;Il15ra;Lif;Flt1;Cxcl10;Ccl4;Il18;Ccl284 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 59 of 98 Carcinogenesis
1 2 4w-Dysplasia vs Normal 3 Pathway Count p-Value q-Value Gene 4 Systemic lupus erythematosus 26 1.50E-29 2.26E-27 C4b;Igh;Fcgr2b;C3;Ighg;Ighg;Igh;Fcgr4;Fcgr2b;Igh;LOC100041230;Hist1h4a;Hist1h4m;Hist1h4i;Hist1h4c;Hist4h4;Hist1h4h;Hist1h4d;Hist1h4b;Hist1h4k;Hist2h4;Hist1h4f;Hist1h4j;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1;Hist2h2bb 5 6 Drug metabolism - cytochrome P450 20 5.52E-28 4.17E-26 Aldh1a3;Cyp2c40;Gstm1;Fmo2;Fmo2;Maob;Fmo2;Gstm3;Gstm1;Maoa;Gstm1;Fmo2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Gstm3;Cyp2d26;Gstm6;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1;Maoa;Cyp2d10 7 Metabolism of xenobiotics by cytochrome P450 15 3.50E-20 1.76E-18 Aldh1a3;Cyp2c40;Gstm1;Gstm3;Gstm1;Gstm1;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Gstm3;Gstm6;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1 8 Drug metabolism - other enzymes 12 1.08E-16 4.06E-15 Ces3;Ces3;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Dpyd;Dpyd;Ces5;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b 9 Retinol metabolism 12 2.58E-15 7.78E-14 Aldh1a1;Cyp2c40;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1 10 11 Androgen and estrogen metabolism 10 8.12E-15 2.04E-13 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Hsd17b2;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Hsd11b2 12 Pentose and glucuronate interconversions 8 1.66E-13 3.58E-12 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b 13 Porphyrin and chlorophyll metabolism 9 2.37E-13 4.47E-12 Cp;Cp;Cp;Cp;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b 14 Starch and sucrose metabolism 9 3.11E-13 5.22E-12 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Enpp3;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b 15 Cytokine-cytokine receptor interaction 14 9.04E-11 1.37E-09 Tnfrsf1b;Cxcl16;Osmr;Pdgfrb;Cxcl14;Cxcl14;Csf2rb2;Ccr5;Csf2rb;Tnfrsf12a;Tnfrsf12a;Ccr1;Inhbb;Ccl28;Il18;Ccl28;Bmp2 16 17 Propanoate metabolism 6 1.36E-08 1.87E-07 Acat2;Aldh6a1;Aldh1b1;Acss2;Abat;Ehhadh;Acss2 18 Phenylalanine metabolismFor Peer Review5 7.54E-08 9.49E-07 Aldh1a3;Maob;Maoa;Prdx6;Hpd;Prdx6;Maoa 19 Fatty acid metabolism 6 1.07E-07 1.19E-06 Acat2;Acsl4;Aldh1b1;Acaa2;Ehhadh;Adh1Downloaded from 20 Tryptophan metabolism 6 1.07E-07 1.19E-06 Acat2;Maob;Maoa;Aldh1b1;Ccbl1;Ehhadh;Ccbl1;Maoa 21 22 Valine, leucine and isoleucine degradation 6 1.23E-07 1.24E-06 Acat2;Aldh6a1;Ivd;Aldh1b1;Acaa2;Ehhadh 23 Glycine, serine and threonine metabolism 6 1.41E-07 1.33E-06 Psat1;Psat1;Phgdh;Phgdh;Akr1c13;Maob;Maoa;Akr1c13;Cth;Maoa
24 ECM-receptor interaction 7 2.66E-07 2.37E-06 Spp1;Gp1bb;Cd44;Cd44;Col4a1;Col4a1;Col4a2;Cd44;Tnc;Lama3http://carcin.oxfordjournals.org/ 25 Focal adhesion 9 1.08E-06 9.03E-06 Myl7;Pdgfrb;Spp1;Col4a1;Col4a1;Col4a2;Igf1;Tnc;Lama3;Igf1;Igf1;Igf1;Farp2 26 Butanoate metabolism 5 1.31E-06 1.04E-05 Acat2;Akr1c13;Aldh1b1;Abat;Akr1c13;Ehhadh 27 28 Tyrosine metabolism 5 1.97E-06 1.49E-05 Aldh1a3;Maob;Maoa;Hpd;Adh1;Maoa 29 Cell adhesion molecules (CAMs) 8 2.24E-06 1.61E-05 Cd276;Vcam1;Cntn1;Selp;Cldn4;Vcan;Cldn8;H2-Bl 30 Pyruvate metabolism 5 2.88E-06 1.98E-05 Acat2;Glo1;Pck1;Aldh1b1;Acss2;Acss2 31 PPAR signaling pathway 6 3.06E-06 2.01E-05 Ubc;Acsl4;Fabp5;Lpl;Pck1;Ehhadh 32
33 beta-Alanine metabolism 4 5.17E-06 3.25E-05 Aldh1b1;Abat;Dpyd;Dpyd;Ehhadh by guest on November 20, 2015 34 Cell Communication 7 6.49E-06 3.92E-05 Krt7;Spp1;Col4a1;Col4a1;Col4a2;Tnc;Lama3;Krt14 35 Urea cycle and metabolism of amino groups 4 1.04E-05 6.03E-05 Maob;Maoa;Aldh1b1;Otc;Maoa 36 Histidine metabolism 4 1.21E-05 6.79E-05 Aldh1a3;Maob;Maoa;Aldh1b1;Maoa 37 Glycan structures - biosynthesis 2 5 1.71E-05 9.22E-05 B4galt6;St3gal1;Fut9;St8sia5;Fut9;St3gal6 38 39 Bile acid biosynthesis 4 1.87E-05 9.75E-05 Akr1c13;Aldh1b1;Acaa2;Akr1c13;Adh1 40 Adipocytokine signaling pathway 5 2.93E-05 1.48E-04 Tnfrsf1b;Acsl4;Pck1;Ppargc1a;Prkaa2 41 B cell receptor signaling pathway 5 3.38E-05 1.65E-04 Igh;Fcgr2b;Ighg;Ifitm1;Ighg;Igh;Lilrb3;Fcgr2b;Igh 42 Glycosphingolipid biosynthesis - globoseries 3 4.01E-05 1.89E-04 St3gal1;Fut9;Fut9;Hexb 43 44 Complement and coagulation cascades 5 4.75E-05 2.17E-04 C4b;Plat;C3;C3ar1;C3ar1;Cd55 45 Linoleic acid metabolism 4 6.61E-05 2.94E-04 Cyp2c40;Akr1c13;Cyp3a13;Akr1c13;Pla2g10 46 Natural killer cell mediated cytotoxicity 6 6.81E-05 2.94E-04 Igh;Cd244;Ighg;Ighg;Igh;Fcgr4;Tyrobp;Fcer1g;Igh 47 Axon guidance 6 7.11E-05 2.98E-04 Limk1;Sema7a;Ephb2;Plxnb1;Sema5a;Sema5a;Sema4g 48 Glycosphingolipid biosynthesis - ganglioseries 3 7.75E-05 3.16E-04 St3gal1;St8sia5;Hexb 49 50 Tight junction 6 9.12E-05 3.63E-04 Myl7;Cldn4;Epb4.1l3;Prkcz;Epb4.1l3;Cldn8;Magi3 51 gamma-Hexachlorocyclohexane degradation 3 9.38E-05 3.63E-04 Alpl;Acpp;Cyp3a13 52 Hematopoietic cell lineage 5 9.75E-05 3.68E-04 Igh;Gp1bb;Cd44;Cd44;Ighg;Cd55;Ighg;Igh;Cd44;Igh 53 Pyrimidine metabolism 5 1.64E-04 6.04E-04 Ctps;Nt5c2;Rrm2;Rrm2;Dpyd;Dpyd;Entpd5;Entpd5 54 55 Glutathione metabolism 4 1.69E-04 6.07E-04 Rrm2;Rrm2;Gstm1;Gstm3;Gstm1;Gstm1;Gstm3;Gstm6 56 Nitrogen metabolism 3 1.81E-04 6.34E-04 Asns;Asns;Car2;Cth 57 Glycolysis / Gluconeogenesis 4 2.10E-04 7.21E-04 Aldh1a3;Aldh1b1;Acss2;Acss2;Adh1 58 Tetrachloroethene degradation 2 2.75E-04 9.22E-04 Akr1c13;Ephx2;Akr1c13 59 60 Carcinogenesis Page 60 of 98
1 2 Maturity onset diabetes of the young 3 3.07E-04 0.0010089 Foxa2;Nr5a2;Neurod1 3 Lysine degradation 3 4.33E-04 0.0013611 Acat2;Aldh1b1;Ehhadh 4 Folate biosynthesis 3 5.32E-04 0.0016295 Gch1;Alpl;Ggh 5 6 MAPK signaling pathway 7 5.40E-04 0.0016295 Pdgfrb;Map4k4;Map4k4;Dusp4;Fgf1;Fgf1;Fgfr3;Cacna2d2;Pla2g10 7 Arachidonic acid metabolism 4 5.60E-04 0.0016588 Alox15;Cyp2c40;Ephx2;Pla2g10 8 Calcium signaling pathway 6 7.22E-04 0.0020584 Ednra;Pdgfrb;Sphk1;Igh;Ighg;Ighg;Igh;Igh;Htr4 9 Arginine and proline metabolism 3 7.72E-04 0.0021588 Pycr1;Otc;Ckmt1 10 11 Fc epsilon RI signaling pathway 4 8.38E-04 0.002268 Igh;Ighg;Ighg;Igh;Fcer1g;Igh;Pla2g10 12 Asthma 3 8.41E-04 0.002268 Igh;Ighg;Ighg;Igh;Fcer1g;Igh 13 Regulation of actin cytoskeleton 6 9.53E-04 0.0024816 Myl7;Limk1;Pdgfrb;Fgf1;Fgf1;Fgfr3;Gsn 14 3-Chloroacrylic acid degradation 2 9.75E-04 0.0024965 Aldh1b1;Adh1 15 Fatty acid elongation in mitochondria 2 0.001215 0.0030579 Mecr;Acaa2 16 17 Wnt signaling pathway 5 0.0013348 0.0032508 Wif1;Sfrp1;Mmp7;Sfrp1;Sfrp2;Axin2 18 Purine metabolism For Peer Review5 0.001414 0.0033871 Nt5c2;Rrm2;Rrm2;Pde8b;Pde8b;Entpd5;Enpp3;Entpd5 19 Glycerolipid metabolism 3 0.0014356 0.0033871 Lpl;Pnliprp2;Aldh1b1 Downloaded from 20 Sulfur metabolism 2 0.0014799 0.0034379 Chst11;Sult1a1 21 22 Small cell lung cancer 4 0.0015992 0.0036587 Col4a1;Col4a1;Col4a2;Lama3;Cdkn2b 23 TGF-beta signaling pathway 4 0.0016626 0.0037471 Inhbb;LOC100046802;Cdkn2b;Bmp2
24 Circadian rhythm 2 0.002423 0.0053026 Per3;Per2 http://carcin.oxfordjournals.org/ 25 Pantothenate and CoA biosynthesis 2 0.0027861 0.0059253 Dpyd;Dpyd;Enpp3 26 Basal cell carcinoma 3 0.0031192 0.0063884 Axin2;Bmp2;Hhip;Hhip 27 28 Benzoate degradation via CoA ligation 2 0.003173 0.0063884 Acat2;Ehhadh 29 Riboflavin metabolism 2 0.003173 0.0063884 Acpp;Enpp3 30 Limonene and pinene degradation 2 0.003173 0.0063884 Aldh1b1;Ehhadh 31 Leukocyte transendothelial migration 4 0.0033257 0.0065218 Myl7;Vcam1;Cldn4;Cldn8 32
33 Glycan structures - biosynthesis 1 4 0.0034304 0.0065641 St3gal1;Csgalnact1;Chst11;St6gal1 by guest on November 20, 2015 34 Alkaloid biosynthesis II 2 0.0035836 0.006764 Ces3;Ces3;Prdx6;Prdx6 35 Glycosphingolipid biosynthesis - neo-lactoseries 2 0.0040175 0.0074895 Fut9;Fut9;St3gal6 36 Allograft rejection 3 0.0052137 0.0094852 Igh;Ighg;Ighg;Igh;Igh;H2-Bl 37 Chondroitin sulfate biosynthesis 2 0.005457 0.0098097 Csgalnact1;Chst11 38 39 Methionine metabolism 2 0.0059819 0.0105672 Mtap;Cth 40 Insulin signaling pathway 4 0.0060184 0.0105672 Prkcz;Pck1;Ppargc1a;Prkaa2 41 Biosynthesis of steroids 2 0.0065289 0.0113318 Cyp51;Hmgcr 42 Melanoma 3 0.0068973 0.0117683 Pdgfrb;Igf1;Igf1;Igf1;Igf1;Fgf1;Fgf1 43 44 p53 signaling pathway 3 0.0068973 0.0117683 Rrm2;Rrm2;Igf1;Igf1;Igf1;Igf1;Rprm 45 Nicotinate and nicotinamide metabolism 2 0.0076882 0.0128991 Nt5c2;Enpp3 46 Autoimmune thyroid disease 3 0.0091743 0.0150578 Igh;Ighg;Ighg;Igh;Igh;H2-Bl 47 Long-term depression 3 0.009804 0.0159183 Prkg2;Igf1;Igf1;Igf1;Igf1;Pla2g10 48 Inositol metabolism 1 0.010527 0.0169104 Aldh6a1 49 50 Aminosugars metabolism 2 0.0116716 0.0185517 Uap1;Uap1;Uap1;Hexb 51 Apoptosis 3 0.0133244 0.0207421 Csf2rb2;Csf2rb;Cflar 52 Neuroactive ligand-receptor interaction 5 0.0135095 0.0208157 Ednra;P2ry13;C3ar1;C3ar1;Npy1r;Htr4 53 Alanine and aspartate metabolism 2 0.0139359 0.0212558 Asns;Asns;Abat 54 55 Primary immunodeficiency 2 0.0155422 0.0230085 Igh;Ighg;Ighg;Igh;Igh 56 Sphingolipid metabolism 2 0.0163737 0.0240042 B4galt6;Sphk1 57 ABC transporters - General 2 0.0198837 0.0276722 Abca8a;Abcc3 58 Fructose and mannose metabolism 2 0.0198837 0.0276722 Akr1c13;Sord;Akr1c13 59 60 Page 61 of 98 Carcinogenesis
1 2 Peptidoglycan biosynthesis 1 0.0209435 0.0287497 Pglyrp1 3 Vitamin B6 metabolism 1 0.0261107 0.0352028 Psat1;Psat1 4 mTOR signaling pathway 2 0.0309607 0.0413722 Igf1;Igf1;Igf1;Igf1;Prkaa2 5 6 Caprolactam degradation 1 0.0312507 0.0413934 Ehhadh 7 Hedgehog signaling pathway 2 0.0320648 0.0421024 Bmp2;Hhip;Hhip 8 Bisphenol A degradation 1 0.0363636 0.0461421 Akr1c13;Akr1c13 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 62 of 98
1 2 3 C4b;Igh;Fcgr2b;C3;Ighg;Ighg;Igh;Fcgr4;Fcgr2b;Igh;LOC100041230;Hist1h4a;Hist1h4m;Hist1h4i;Hist1h4c;Hist4h4;Hist1h4h;Hist1h4d;Hist1h4b;Hist1h4k;Hist2h4;Hist1h4f;Hist1h4j;Hist1h3e;Hist2h3c2;Hist1h3d;Hist4 1h3c;Hist1h3f;Hist2h3c1;Hist2h2bb 5 Aldh1a3;Cyp2c40;Gstm1;Fmo2;Fmo2;Maob;Fmo2;Gstm3;Gstm1;Maoa;Gstm1;Fmo2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Gs6 tm3;Cyp2d26;Gstm6;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1;Maoa;Cyp2d10 Aldh1a3;Cyp2c40;Gstm1;Gstm3;Gstm1;Gstm1;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Gstm3;Gstm6;Ugt1a6a;Ugt1a2;Ugt1a7 9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1 Ces3;Ces3;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Dpyd;Dpyd;Ces5;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ug8 t1a5;Ugt1a6b Aldh1a1;Cyp2c40;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt19 a6b;Adh1 10 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Hsd17b2;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Hsd11b211 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b12 Cp;Cp;Cp;Cp;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b13 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Enpp3;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b14 Tnfrsf1b;Cxcl16;Osmr;Pdgfrb;Cxcl14;Cxcl14;Csf2rb2;Ccr5;Csf2rb;Tnfrsf12a;Tnfrsf12a;Ccr1;Inhbb;Ccl28;Il18;Ccl28;Bmp215 16 Acat2;Aldh6a1;Aldh1b1;Acss2;Abat;Ehhadh;Acss217 Aldh1a3;Maob;Maoa;Prdx6;Hpd;Prdx6;Maoa18 For Peer Review Acat2;Acsl4;Aldh1b1;Acaa2;Ehhadh;Adh119 Downloaded from Acat2;Maob;Maoa;Aldh1b1;Ccbl1;Ehhadh;Ccbl1;Maoa20 21 Acat2;Aldh6a1;Ivd;Aldh1b1;Acaa2;Ehhadh22 Psat1;Psat1;Phgdh;Phgdh;Akr1c13;Maob;Maoa;Akr1c13;Cth;Maoa23
Spp1;Gp1bb;Cd44;Cd44;Col4a1;Col4a1;Col4a2;Cd44;Tnc;Lama324 http://carcin.oxfordjournals.org/ Myl7;Pdgfrb;Spp1;Col4a1;Col4a1;Col4a2;Igf1;Tnc;Lama3;Igf1;Igf1;Igf1;Farp225 Acat2;Akr1c13;Aldh1b1;Abat;Akr1c13;Ehhadh26 27 Aldh1a3;Maob;Maoa;Hpd;Adh1;Maoa28 Cd276;Vcam1;Cntn1;Selp;Cldn4;Vcan;Cldn8;H2-Bl29 Acat2;Glo1;Pck1;Aldh1b1;Acss2;Acss230 Ubc;Acsl4;Fabp5;Lpl;Pck1;Ehhadh31 32
Aldh1b1;Abat;Dpyd;Dpyd;Ehhadh33 by guest on November 20, 2015 Krt7;Spp1;Col4a1;Col4a1;Col4a2;Tnc;Lama3;Krt1434 Maob;Maoa;Aldh1b1;Otc;Maoa35 Aldh1a3;Maob;Maoa;Aldh1b1;Maoa36 37 B4galt6;St3gal1;Fut9;St8sia5;Fut9;St3gal6 38 Akr1c13;Aldh1b1;Acaa2;Akr1c13;Adh139 Tnfrsf1b;Acsl4;Pck1;Ppargc1a;Prkaa240 Igh;Fcgr2b;Ighg;Ifitm1;Ighg;Igh;Lilrb3;Fcgr2b;Igh41 St3gal1;Fut9;Fut9;Hexb42 43 C4b;Plat;C3;C3ar1;C3ar1;Cd5544 Cyp2c40;Akr1c13;Cyp3a13;Akr1c13;Pla2g1045 Igh;Cd244;Ighg;Ighg;Igh;Fcgr4;Tyrobp;Fcer1g;Igh46 Limk1;Sema7a;Ephb2;Plxnb1;Sema5a;Sema5a;Sema4g47 48 St3gal1;St8sia5;Hexb 49 Myl7;Cldn4;Epb4.1l3;Prkcz;Epb4.1l3;Cldn8;Magi350 Alpl;Acpp;Cyp3a1351 Igh;Gp1bb;Cd44;Cd44;Ighg;Cd55;Ighg;Igh;Cd44;Igh52 Ctps;Nt5c2;Rrm2;Rrm2;Dpyd;Dpyd;Entpd5;Entpd553 54 Rrm2;Rrm2;Gstm1;Gstm3;Gstm1;Gstm1;Gstm3;Gstm655 Asns;Asns;Car2;Cth56 Aldh1a3;Aldh1b1;Acss2;Acss2;Adh157 Akr1c13;Ephx2;Akr1c1358 59 60 Page 63 of 98 Carcinogenesis
1 Foxa2;Nr5a2;Neurod12 Acat2;Aldh1b1;Ehhadh3 Gch1;Alpl;Ggh4 5 Pdgfrb;Map4k4;Map4k4;Dusp4;Fgf1;Fgf1;Fgfr3;Cacna2d2;Pla2g106 Alox15;Cyp2c40;Ephx2;Pla2g107 Ednra;Pdgfrb;Sphk1;Igh;Ighg;Ighg;Igh;Igh;Htr48 Pycr1;Otc;Ckmt19 10 Igh;Ighg;Ighg;Igh;Fcer1g;Igh;Pla2g1011 Igh;Ighg;Ighg;Igh;Fcer1g;Igh12 Myl7;Limk1;Pdgfrb;Fgf1;Fgf1;Fgfr3;Gsn13 Aldh1b1;Adh114 Mecr;Acaa215 16 Wif1;Sfrp1;Mmp7;Sfrp1;Sfrp2;Axin217 Nt5c2;Rrm2;Rrm2;Pde8b;Pde8b;Entpd5;Enpp3;Entpd518 For Peer Review Lpl;Pnliprp2;Aldh1b119 Downloaded from Chst11;Sult1a120 21 Col4a1;Col4a1;Col4a2;Lama3;Cdkn2b22 Inhbb;LOC100046802;Cdkn2b;Bmp223
24 http://carcin.oxfordjournals.org/ Dpyd;Dpyd;Enpp325 Axin2;Bmp2;Hhip;Hhip26 27 Acat2;Ehhadh28 Acpp;Enpp329 Aldh1b1;Ehhadh30 Myl7;Vcam1;Cldn4;Cldn831 32
St3gal1;Csgalnact1;Chst11;St6gal133 by guest on November 20, 2015 Ces3;Ces3;Prdx6;Prdx634 Fut9;Fut9;St3gal635 Igh;Ighg;Ighg;Igh;Igh;H2-Bl36 37 Csgalnact1;Chst11 38 39 Prkcz;Pck1;Ppargc1a;Prkaa240 Cyp51;Hmgcr41 Pdgfrb;Igf1;Igf1;Igf1;Igf1;Fgf1;Fgf142 43 Rrm2;Rrm2;Igf1;Igf1;Igf1;Igf1;Rprm44 Nt5c2;Enpp345 Igh;Ighg;Ighg;Igh;Igh;H2-Bl46 Prkg2;Igf1;Igf1;Igf1;Igf1;Pla2g1047 48 49 Uap1;Uap1;Uap1;Hexb50 Csf2rb2;Csf2rb;Cflar51 Ednra;P2ry13;C3ar1;C3ar1;Npy1r;Htr452 Asns;Asns;Abat53 54 Igh;Ighg;Ighg;Igh;Igh55 B4galt6;Sphk156 Abca8a;Abcc357 Akr1c13;Sord;Akr1c1358 59 60 Carcinogenesis Page 64 of 98
1 2 Psat1;Psat13 Igf1;Igf1;Igf1;Igf1;Prkaa24 5 6 Bmp2;Hhip;Hhip7 Akr1c13;Akr1c138 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 65 of 98 Carcinogenesis
1 2 3 C4b;Igh;Fcgr2b;C3;Ighg;Ighg;Igh;Fcgr4;Fcgr2b;Igh;LOC100041230;Hist1h4a;Hist1h4m;Hist1h4i;Hist1h4c;Hist4h4;Hist1h4h;Hist1h4d;Hist1h4b;Hist1h4k;Hist2h4;Hist1h4f;Hist1h4j;Hist1h3e;Hist2h3c2;Hist1h3d;Hist4 1h3c;Hist1h3f;Hist2h3c1;Hist2h2bb 5 Aldh1a3;Cyp2c40;Gstm1;Fmo2;Fmo2;Maob;Fmo2;Gstm3;Gstm1;Maoa;Gstm1;Fmo2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Gs6 tm3;Cyp2d26;Gstm6;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1;Maoa;Cyp2d10 Aldh1a3;Cyp2c40;Gstm1;Gstm3;Gstm1;Gstm1;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Gstm3;Gstm6;Ugt1a6a;Ugt1a2;Ugt1a7 9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1 Ces3;Ces3;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Dpyd;Dpyd;Ces5;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ug8 t1a5;Ugt1a6b Aldh1a1;Cyp2c40;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt19 a6b;Adh1 10 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Hsd17b2;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Hsd11b211 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b12 Cp;Cp;Cp;Cp;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b13 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Enpp3;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b14 Tnfrsf1b;Cxcl16;Osmr;Pdgfrb;Cxcl14;Cxcl14;Csf2rb2;Ccr5;Csf2rb;Tnfrsf12a;Tnfrsf12a;Ccr1;Inhbb;Ccl28;Il18;Ccl28;Bmp215 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 66 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 67 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 68 of 98
1 2 3 C4b;Igh;Fcgr2b;C3;Ighg;Ighg;Igh;Fcgr4;Fcgr2b;Igh;LOC100041230;Hist1h4a;Hist1h4m;Hist1h4i;Hist1h4c;Hist4h4;Hist1h4h;Hist1h4d;Hist1h4b;Hist1h4k;Hist2h4;Hist1h4f;Hist1h4j;Hist1h3e;Hist2h3c2;Hist1h3d;Hist4 1h3c;Hist1h3f;Hist2h3c1;Hist2h2bb 5 Aldh1a3;Cyp2c40;Gstm1;Fmo2;Fmo2;Maob;Fmo2;Gstm3;Gstm1;Maoa;Gstm1;Fmo2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Gs6 tm3;Cyp2d26;Gstm6;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1;Maoa;Cyp2d10 Aldh1a3;Cyp2c40;Gstm1;Gstm3;Gstm1;Gstm1;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Gstm3;Gstm6;Ugt1a6a;Ugt1a2;Ugt1a7 9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1 Ces3;Ces3;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Dpyd;Dpyd;Ces5;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ug8 t1a5;Ugt1a6b Aldh1a1;Cyp2c40;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt19 a6b;Adh1 10 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Hsd17b2;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Hsd11b211 12 Cp;Cp;Cp;Cp;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b13 Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Enpp3;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 69 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 70 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 71 of 98 Carcinogenesis
1 2 3 4 5 Aldh1a3;Cyp2c40;Gstm1;Fmo2;Fmo2;Maob;Fmo2;Gstm3;Gstm1;Maoa;Gstm1;Fmo2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Gstm3;Cyp2d26;Gstm6;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Adh1;Maoa;Cyp2d106 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 72 of 98
1 2 6w-Carcinoma vs Normal 3 Pathway Count p-Value q-Value Gene 4 Cytokine-cytokine receptor interaction 21 9.72E-20 1.65E-17 Tnfrsf11b;Cxcl5;Tnfrsf19;Cxcl2;Ccl3;Tnfrsf1b;Cxcl14;Il23a;Tnfsf9;Inhbb;Cxcl14;Cxcl11;Cxcr6;Ccl17;Cxcl1;Cxcl1;Cxcl16;Bmp7;Ccr1;Cxcl9;Tnfrsf12a;Tnfrsf12a;Il1b;Ccl28;Ccl28 5 6 Cell adhesion molecules (CAMs) 15 3.10E-15 2.64E-13 Cd276;Itga4;Cldn4;Cadm1;H2-Q7;H2-Q6;Selp;Cldn8;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;Neo1;Itga8;H2-Q2;H2-D1 7 Allograft rejection 10 1.13E-12 6.41E-11 H2-Q7;H2-Q6;Gzmb;Ighg;Igh;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;H2-Q2;H2-D1 8 Type I diabetes mellitus 10 2.42E-12 1.03E-10 H2-Q7;H2-Q6;Gzmb;Il1b;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;Cpe;H2-Bl;H2-Q2;H2-D1 9 Drug metabolism - cytochrome P450 10 9.45E-12 2.92E-10 Cyp2b10;Cyp2b13;Gstm7;Aldh1a3;Gstm3;Maob;Cyp3a13;Cyp2d22;Fmo2;Fmo2;Fmo2;Fmo2;Cyp2c55 10 11 Autoimmune thyroid disease 10 9.45E-12 2.92E-10 H2-Q7;H2-Q6;Gzmb;Ighg;Igh;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;H2-Q2;H2-D1 12 Graft-versus-host disease 9 4.17E-11 1.01E-09 H2-Q7;H2-Q6;Gzmb;Il1b;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;H2-Q2;H2-D1 13 Wnt signaling pathway 11 3.04E-10 6.46E-09 Wif1;Nkd1;Axin2;Nkd1;Dkk2;Nlk;Mmp7;Rac3;Sox17;Wnt6;Wnt10a;Lef1 14 Phenylalanine metabolism 5 5.20E-08 8.91E-07 Aldh1a3;Maob;Lpo;Prdx6;Ddc 15 Retinol metabolism 7 5.24E-08 8.91E-07 Cyp2b10;Cyp2b13;Rdh10;Cyp3a13;Aldh1a1;Rdh16;Cyp2c55 16 17 Metabolism of xenobiotics by cytochrome P450 7 6.41E-08 9.90E-07 Cyp2b10;Cyp2b13;Gstm7;Aldh1a3;Gstm3;Cyp3a13;Cyp2c55 18 ECM-receptor interaction For Peer Review7 1.61E-07 2.28E-06 Spp1;Gp1bb;Itga4;Npnt;Lama3;Thbs4;Itga8 19 Histidine metabolism 5 2.01E-07 2.63E-06 Aspa;Aldh1a3;Maob;Aldh1b1;DdcDownloaded from 20 Cell Communication 8 2.92E-07 3.42E-06 Spp1;Krt23;Krt14;Col17a1;Krt7;Lama3;Thbs4;Des 21 22 Axon guidance 8 2.92E-07 3.42E-06 Plxnb1;Sema7a;Robo1;Rac3;Slit2;Sema3e;Sema3e;Sema5a;Sema5a;Ntn1 23 Antigen processing and presentation 7 6.38E-07 6.78E-06 H2-Q7;H2-Q6;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;H2-Q2;H2-D1
24 Arachidonic acid metabolism 6 1.44E-06 1.44E-05 Alox12;Alox15;Cyp2b10;Cyp2b13;Pla2g2a;Cyp2c55http://carcin.oxfordjournals.org/ 25 Fc epsilon RI signaling pathway 6 2.70E-06 2.55E-05 Ms4a2;Rac3;Fcer1a;Pla2g2a;Ighg;Igh 26 Natural killer cell mediated cytotoxicity 7 3.78E-06 3.38E-05 Fcgr4;Rac3;Cd244;Gzmb;Ighg;Igh;H2-D1;H2-D1;H2-D1 27 28 Calcium signaling pathway 8 7.37E-06 5.99E-05 Adcy8;Gnal;Adcy1;Ighg;Igh;Htr4;Plce1;Pln;Pln 29 Urea cycle and metabolism of amino groups 4 7.74E-06 5.99E-05 Arg1;Maob;Otc;Aldh1b1 30 Basal cell carcinoma 5 7.75E-06 5.99E-05 Axin2;Shh;Wnt6;Wnt10a;Lef1 31 Purine metabolism 7 1.21E-05 8.94E-05 Adcy8;Ada;Nme4;Nt5c2;Adcy1;Prim2;Enpp3 32
33 Arginine and proline metabolism 4 2.33E-05 1.60E-04 Arg1;Pycr1;Otc;Ckmt1 by guest on November 20, 2015 34 Leukocyte transendothelial migration 6 2.36E-05 1.60E-04 Myl7;Itga4;Cyba;Cldn4;Mmp9;Cldn8 35 Asthma 4 2.62E-05 1.71E-04 Ms4a2;Fcer1a;Ighg;Igh 36 Systemic lupus erythematosus 7 3.19E-05 2.01E-04 Fcgr4;C1qb;Hist3h2bb;Hist3h2ba;Ighg;Igh;Hist2h2bb 37 Focal adhesion 7 5.31E-05 3.19E-04 Myl7;Spp1;Itga4;Rac3;Lama3;Thbs4;Itga8 38 39 Pyruvate metabolism 4 5.45E-05 3.19E-04 Glo1;Glo1;Aldh1b1;Pck1;Acss2 40 Tryptophan metabolism 4 5.98E-05 3.39E-04 Ido1;Maob;Aldh1b1;Ddc 41 Hematopoietic cell lineage 5 6.86E-05 3.76E-04 Gp1bb;Itga4;Ighg;Igh;Il1b 42 Alkaloid biosynthesis II 3 7.51E-05 3.99E-04 Ces3;Ces3;Prdx6;Aadac 43 44 Renin-angiotensin system 3 1.06E-04 5.42E-04 Cpa3;Cma1;Ace2;Ace2 45 Gap junction 5 1.10E-04 5.42E-04 Prkg2;Prkg2;Adcy8;Tubb2b;Tubb2a;Prkg2;Adcy1 46 TGF-beta signaling pathway 5 1.10E-04 5.42E-04 Inhbb;LOC100046802;Id2;Bmp7;Thbs4 47 Hedgehog signaling pathway 4 1.37E-04 6.44E-04 Shh;Wnt6;Bmp7;Wnt10a 48 Melanogenesis 5 1.40E-04 6.44E-04 Adcy8;Wnt6;Adcy1;Wnt10a;Lef1 49 50 Toll-like receptor signaling pathway 5 1.47E-04 6.57E-04 Spp1;Ccl3;Cxcl11;Cxcl9;Il1b 51 Glycolysis / Gluconeogenesis 4 1.58E-04 6.88E-04 Aldh1a3;Aldob;Aldh1b1;Acss2 52 beta-Alanine metabolism 3 1.67E-04 7.10E-04 Dpyd;Dpyd;Aldh1b1;Abat 53 Biosynthesis of steroids 3 1.91E-04 7.94E-04 Cyp51;Fdps;Idi1 54 55 Terpenoid biosynthesis 2 2.37E-04 9.58E-04 Fdps;Idi1 56 Maturity onset diabetes of the young 3 2.47E-04 9.76E-04 Pdx1;Nr5a2;Neurod1 57 MAPK signaling pathway 7 3.45E-04 0.0013346 Nlk;Dusp4;Map4k4;Rac3;Pla2g2a;Il1b;Fgf1;Fgf1 58 B cell receptor signaling pathway 4 3.79E-04 0.0014324 Ifitm1;Rac3;Ighg;Igh 59 60 Page 73 of 98 Carcinogenesis
1 2 Aminosugars metabolism 3 4.72E-04 0.0017252 2310007H09Rik;Npl;Uap1 3 Propanoate metabolism 3 4.72E-04 0.0017252 Aldh1b1;Abat;Acss2 4 Complement and coagulation cascades 4 4.95E-04 0.0017534 Plat;Cfi;C1qb;F13a1 5 6 Regulation of actin cytoskeleton 6 6.47E-04 0.0022307 Myl7;Itga4;Rac3;Fgf1;Fgf1;Gsn;Itga8 7 Methane metabolism 2 6.56E-04 0.0022307 Lpo;Prdx6 8 Primary immunodeficiency 3 7.36E-04 0.0024538 Ada;Ighg;Igh 9 Tyrosine metabolism 3 9.32E-04 0.0030471 Aldh1a3;Maob;Ddc 10 11 ABC transporters - General 3 0.0010794 0.0034298 Abcc2;Abcb1a;Abcb1a;Abca8a 12 Linoleic acid metabolism 3 0.0010794 0.0034298 Pla2g2a;Cyp3a13;Cyp2c55 13 Sulfur metabolism 2 0.0012763 0.0038744 Chst11;Sult1a1 14 GnRH signaling pathway 4 0.0013139 0.0038847 Adcy8;Mmp14;Adcy1;Pla2g2a 15 Pyrimidine metabolism 4 0.0013139 0.0038847 Nme4;Nt5c2;Prim2;Dpyd;Dpyd 16 17 Drug metabolism - other enzymes 3 0.0023965 0.0065949 Dpyd;Ces3;Dpyd;Ces3;Cyp3a13 18 Pantothenate and CoA biosynthesisFor Peer Review2 0.0024052 0.0065949 Dpyd;Dpyd;Enpp3 19 Riboflavin metabolism 2 0.0027399 0.0073935 2310007H09Rik;Enpp3 Downloaded from 20 Acute myeloid leukemia 3 0.0029386 0.0078058 Lef1;Runx1t1;Runx1t1;Zbtb16;Zbtb16 21 22 Adipocytokine signaling pathway 3 0.0044172 0.0112079 Tnfrsf1b;Socs3;Socs3;Socs3;Pck1 23 Tight junction 4 0.0046311 0.0115778 Myl7;Cldn4;Cldn8;Mpdz
24 Nitrogen metabolism 2 0.0047181 0.0116244 Car4;Car4;Car1 http://carcin.oxfordjournals.org/ 25 Amyotrophic lateral sclerosis (ALS) 2 0.0056477 0.0133348 Nefm;Nefl 26 PPAR signaling pathway 3 0.0060503 0.0140898 Fabp5;Fabp5;Ubc;Pck1 27 28 Adherens junction 3 0.0062765 0.0144189 Nlk;Rac3;Lef1 29 Nicotinate and nicotinamide metabolism 2 0.0066539 0.0148837 Nt5c2;Enpp3 30 Alzheimer's disease 2 0.0083034 0.0180971 C1qb;Il1b 31 Colorectal cancer 3 0.010903 0.0230341 Axin2;Rac3;Lef1 32
33 Alanine and aspartate metabolism 2 0.0120881 0.0247588 Aspa;Abat by guest on November 20, 2015 34 SNARE interactions in vesicular transport 2 0.0134881 0.0271358 Stx1a;Snap25 35 Butanoate metabolism 2 0.0134881 0.0271358 Aldh1b1;Abat 36 Fructose and mannose metabolism 2 0.0172772 0.0326347 2310007H09Rik;Aldob 37 Glycerolipid metabolism 2 0.0180831 0.0337817 Pnliprp2;Pnliprp2;Aldh1b1 38 39 Peptidoglycan biosynthesis 1 0.0194406 0.0357287 Pglyrp1 40 Type II diabetes mellitus 2 0.0205941 0.0368526 Socs3;Pdx1;Socs3;Socs3 41 Glycine, serine and threonine metabolism 2 0.0205941 0.0368526 Psat1;Psat1;Maob 42 Vitamin B6 metabolism 1 0.0242417 0.0422675 Psat1;Psat1 43 44 Alkaloid biosynthesis I 1 0.0242417 0.0422675 Ddc 45 Endometrial cancer 2 0.0269749 0.0451796 Axin2;Lef1 46 Glutathione metabolism 2 0.0269749 0.0451796 Gstm7;Gstm3 47 Insulin signaling pathway 3 0.0295812 0.0488233 Socs3;Socs3;Socs3;Pck1;Prkar2b;Prkar2b 48 Ubiquitin mediated proteolysis 3 0.030137 0.0492624 Ube2e2;Socs3;Socs3;Socs3;Nedd4l;Nedd4l 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 74 of 98
1 2 3 Tnfrsf11b;Cxcl5;Tnfrsf19;Cxcl2;Ccl3;Tnfrsf1b;Cxcl14;Il23a;Tnfsf9;Inhbb;Cxcl14;Cxcl11;Cxcr6;Ccl17;Cxcl1;Cxcl1;Cxcl16;Bmp7;Ccr1;Cxcl9;Tnfrsf12a;Tnfrsf12a;Il1b;Ccl28;Ccl284 5 Cd276;Itga4;Cldn4;Cadm1;H2-Q7;H2-Q6;Selp;Cldn8;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;Neo1;Itga8;H2-Q2;H2-D16 H2-Q7;H2-Q6;Gzmb;Ighg;Igh;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;H2-Q2;H2-D17 H2-Q7;H2-Q6;Gzmb;Il1b;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;Cpe;H2-Bl;H2-Q2;H2-D18 Cyp2b10;Cyp2b13;Gstm7;Aldh1a3;Gstm3;Maob;Cyp3a13;Cyp2d22;Fmo2;Fmo2;Fmo2;Fmo2;Cyp2c559 10 H2-Q7;H2-Q6;Gzmb;Ighg;Igh;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;H2-Q2;H2-D111 H2-Q7;H2-Q6;Gzmb;Il1b;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;H2-Q2;H2-D112 Wif1;Nkd1;Axin2;Nkd1;Dkk2;Nlk;Mmp7;Rac3;Sox17;Wnt6;Wnt10a;Lef113 Aldh1a3;Maob;Lpo;Prdx6;Ddc14 Cyp2b10;Cyp2b13;Rdh10;Cyp3a13;Aldh1a1;Rdh16;Cyp2c5515 16 Cyp2b10;Cyp2b13;Gstm7;Aldh1a3;Gstm3;Cyp3a13;Cyp2c5517 Spp1;Gp1bb;Itga4;Npnt;Lama3;Thbs4;Itga818 For Peer Review Aspa;Aldh1a3;Maob;Aldh1b1;Ddc19 Downloaded from Spp1;Krt23;Krt14;Col17a1;Krt7;Lama3;Thbs4;Des20 21 Plxnb1;Sema7a;Robo1;Rac3;Slit2;Sema3e;Sema3e;Sema5a;Sema5a;Ntn122 H2-Q7;H2-Q6;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;H2-Q2;H2-D123
Alox12;Alox15;Cyp2b10;Cyp2b13;Pla2g2a;Cyp2c5524 http://carcin.oxfordjournals.org/ Ms4a2;Rac3;Fcer1a;Pla2g2a;Ighg;Igh25 Fcgr4;Rac3;Cd244;Gzmb;Ighg;Igh;H2-D1;H2-D1;H2-D126 27 Adcy8;Gnal;Adcy1;Ighg;Igh;Htr4;Plce1;Pln;Pln28 Arg1;Maob;Otc;Aldh1b129 Axin2;Shh;Wnt6;Wnt10a;Lef130 Adcy8;Ada;Nme4;Nt5c2;Adcy1;Prim2;Enpp331 32
Arg1;Pycr1;Otc;Ckmt133 by guest on November 20, 2015 Myl7;Itga4;Cyba;Cldn4;Mmp9;Cldn834 Ms4a2;Fcer1a;Ighg;Igh35 Fcgr4;C1qb;Hist3h2bb;Hist3h2ba;Ighg;Igh;Hist2h2bb36 37 Myl7;Spp1;Itga4;Rac3;Lama3;Thbs4;Itga8 38 Glo1;Glo1;Aldh1b1;Pck1;Acss239 Ido1;Maob;Aldh1b1;Ddc40 Gp1bb;Itga4;Ighg;Igh;Il1b41 Ces3;Ces3;Prdx6;Aadac42 43 Cpa3;Cma1;Ace2;Ace244 Prkg2;Prkg2;Adcy8;Tubb2b;Tubb2a;Prkg2;Adcy145 Inhbb;LOC100046802;Id2;Bmp7;Thbs446 Shh;Wnt6;Bmp7;Wnt10a47 48 Adcy8;Wnt6;Adcy1;Wnt10a;Lef1 49 Spp1;Ccl3;Cxcl11;Cxcl9;Il1b50 Aldh1a3;Aldob;Aldh1b1;Acss251 Dpyd;Dpyd;Aldh1b1;Abat52 Cyp51;Fdps;Idi153 54 55 Pdx1;Nr5a2;Neurod156 Nlk;Dusp4;Map4k4;Rac3;Pla2g2a;Il1b;Fgf1;Fgf157 Ifitm1;Rac3;Ighg;Igh58 59 60 Page 75 of 98 Carcinogenesis
1 2310007H09Rik;Npl;Uap12 Aldh1b1;Abat;Acss23 Plat;Cfi;C1qb;F13a14 5 Myl7;Itga4;Rac3;Fgf1;Fgf1;Gsn;Itga86 7 Ada;Ighg;Igh8 Aldh1a3;Maob;Ddc9 10 Abcc2;Abcb1a;Abcb1a;Abca8a11 Pla2g2a;Cyp3a13;Cyp2c5512 Chst11;Sult1a113 Adcy8;Mmp14;Adcy1;Pla2g2a14 Nme4;Nt5c2;Prim2;Dpyd;Dpyd15 16 Dpyd;Ces3;Dpyd;Ces3;Cyp3a1317 Dpyd;Dpyd;Enpp318 For Peer Review 2310007H09Rik;Enpp319 Downloaded from Lef1;Runx1t1;Runx1t1;Zbtb16;Zbtb1620 21 Tnfrsf1b;Socs3;Socs3;Socs3;Pck122 Myl7;Cldn4;Cldn8;Mpdz23
Car4;Car4;Car124 http://carcin.oxfordjournals.org/ 25 Fabp5;Fabp5;Ubc;Pck126 27 Nlk;Rac3;Lef128 Nt5c2;Enpp329 30 Axin2;Rac3;Lef131 32
33 by guest on November 20, 2015 Stx1a;Snap2534 Aldh1b1;Abat35 2310007H09Rik;Aldob36 37 Pnliprp2;Pnliprp2;Aldh1b1 38 39 Socs3;Pdx1;Socs3;Socs340 Psat1;Psat1;Maob41 Psat1;Psat142 43 44 45 Gstm7;Gstm346 Socs3;Socs3;Socs3;Pck1;Prkar2b;Prkar2b47 48 Ube2e2;Socs3;Socs3;Socs3;Nedd4l;Nedd4l 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 76 of 98
1 2 3 Tnfrsf11b;Cxcl5;Tnfrsf19;Cxcl2;Ccl3;Tnfrsf1b;Cxcl14;Il23a;Tnfsf9;Inhbb;Cxcl14;Cxcl11;Cxcr6;Ccl17;Cxcl1;Cxcl1;Cxcl16;Bmp7;Ccr1;Cxcl9;Tnfrsf12a;Tnfrsf12a;Il1b;Ccl28;Ccl284 5 Cd276;Itga4;Cldn4;Cadm1;H2-Q7;H2-Q6;Selp;Cldn8;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl;Neo1;Itga8;H2-Q2;H2-D16 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 77 of 98 Carcinogenesis
1 2 8w-Carcinoma vs Normal 3 Pathway Count p-Value q-Value Gene 4 Drug metabolism - cytochrome P450 25 8.69E-33 1.39E-30 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Maoa;Fmo2;Maob;Fmo2;Fmo2;Fmo2;Maoa;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Cyp2d22;Adh1;Gstt1;Cyp2d10;Cyp2d26;Gsta3;Cyp2d9 5 6 Metabolism of xenobiotics by cytochrome P450 19 6.97E-24 5.58E-22 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Cyp2s1;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Adh1;Gstt1;Gsta3 7 Retinol metabolism 16 3.23E-19 1.72E-17 Rdh10;Aldh1a1;Cyp2c40;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Rdh16;Retsat;Adh1 8 Drug metabolism - other enzymes 13 4.26E-16 1.70E-14 Gusb;Gusb;Dpyd;Dpyd;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ces3;Ces3;Upp1 9 Pentose and glucuronate interconversions 10 6.27E-16 2.01E-14 Gusb;Gusb;Ugdh;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b 10 11 Starch and sucrose metabolism 11 5.92E-15 1.58E-13 Gusb;Gusb;Enpp3;Ugdh;Enpp3;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b 12 Androgen and estrogen metabolism 11 1.14E-14 2.61E-13 Hsd11b2;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Sult2b1;Hsd17b2 13 Porphyrin and chlorophyll metabolism 10 2.23E-13 4.46E-12 Cp;Cp;Cp;Cp;Cp;Gusb;Cp;Gusb;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b 14 Urea cycle and metabolism of amino groups 8 2.32E-11 4.12E-10 Arg1;Otc;Cps1;Aldh1b1;Aldh2;Maoa;Aldh2;Aldh2;Maob;Aldh2;Maoa;Abp1 15 Histidine metabolism 8 3.27E-11 5.23E-10 Aspa;Aldh1a3;Aldh1b1;Aldh2;Maoa;Aldh2;Aldh2;Maob;Aldh2;Maoa;Abp1;Ddc 16 17 Tight junction 13 1.02E-10 1.49E-09 Gnai2;Myl7;Cdk4;LOC640611;Cldn4;Prkcz;Prkcd;Myh11;Prkca;Myh11;Epb4.1l3;Cldn8;Prkce;Prkce;Epb4.1l3;Igsf5 18 Phenylalanine metabolismFor Peer Review7 2.23E-10 2.98E-09 Aldh1a3;Hpd;Prdx6;Maoa;Maob;Maoa;Prdx6;Lpo;Ddc 19 PPAR signaling pathway 10 5.49E-10 6.76E-09 Acsl4;Lpl;Lpl;Pck1;Fads2;Ehhadh;Fabp2;Ppard;Sorbs1;Fabp6;Hmgcs2Downloaded from 20 Tryptophan metabolism 8 1.91E-09 2.18E-08 Aldh1b1;Aldh2;Maoa;Aldh2;Aldh2;Maob;Ehhadh;Aldh2;Maoa;Abp1;Ccbl1;Ddc;Ccbl1 21 22 Cell adhesion molecules (CAMs) 12 7.50E-09 8.00E-08 Itga4;Cldn4;L1cam;Itga8;H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;Neo1;Cldn8;Neo1;H2-Bl;H2-Q2;H2-D1;H2-Eb1 23 Nitrogen metabolism 6 1.30E-08 1.30E-07 Asns;Asns;Cps1;Cth;Car2;Car1;Car4;Car4
24 Glycolysis / Gluconeogenesis 8 1.47E-08 1.38E-07 Aldh1a3;Aldob;Aldh1b1;Aldh2;Aldh2;Aldh2;Acss1;Acss2;Aldh2;Eno3;Acss2;Adh1http://carcin.oxfordjournals.org/ 25 Tyrosine metabolism 7 2.61E-08 2.32E-07 Comt1;Aldh1a3;Hpd;Maoa;Maob;Maoa;Ddc;Adh1 26 Pyruvate metabolism 7 4.48E-08 3.77E-07 Glo1;Glo1;Pck1;Aldh1b1;Aldh2;Aldh2;Aldh2;Acss1;Acss2;Aldh2;Pcx;Acss2 27 28 Allograft rejection 8 6.42E-08 5.14E-07 Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb1 29 Focal adhesion 12 7.36E-08 5.37E-07 Myl7;Igf1;Igf1;Igf1;Igf1;Lama1;Thbs1;Itga4;Spp1;Tnxb;Cav1;Itga8;Mylk;Prkca;Thbs4 30 Glycine, serine and threonine metabolism 7 7.38E-08 5.37E-07 Phgdh;Psat1;Psat1;Phgdh;Cth;Maoa;Maob;Maoa;Chdh;Akr1c13 31 Propanoate metabolism 6 1.65E-07 1.15E-06 Aldh1b1;Aldh2;Aldh2;Aldh2;Abat;Ehhadh;Acss1;Acss2;Aldh2;Acss2 32
33 Systemic lupus erythematosus 11 2.75E-07 1.83E-06 Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Fcgr4;Igh;Hist2h2bb;H2-Eb1;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1 by guest on November 20, 2015 34 ECM-receptor interaction 8 3.24E-07 2.03E-06 Lama1;Cd44;Cd44;Thbs1;Itga4;Spp1;Tnxb;Itga8;Thbs4 35 Autoimmune thyroid disease 8 3.24E-07 2.03E-06 Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb1 36 Butanoate metabolism 6 4.22E-07 2.50E-06 Aldh1b1;Aldh2;Aldh2;Aldh2;Abat;Ehhadh;Aldh2;Akr1c13;Hmgcs2 37 beta-Alanine metabolism 5 7.84E-07 4.48E-06 Dpyd;Dpyd;Aldh1b1;Aldh2;Aldh2;Aldh2;Abat;Ehhadh;Aldh2 38 39 Cytokine-cytokine receptor interaction 12 1.07E-06 5.89E-06 Cxcl5;Cxcl2;Inhbb;Tnfrsf11b;Tnfsf9;Cxcl14;Cxcl16;Ccr1;Cxcl14;Cxcl1;Ccl28;Ccl28;Bmp2;Kit 40 Axon guidance 9 1.24E-06 6.63E-06 Gnai2;Sema7a;Robo1;Sema5a;Sema5a;L1cam;Efnb2;Sema4g;Sema4a;Efnb2;Ngef 41 Melanogenesis 8 1.64E-06 8.46E-06 Gnai2;Creb3l1;Fzd5;Prkca;Adcy6;Kit;Edn1;Tcf7l2 42 Fc epsilon RI signaling pathway 7 3.72E-06 1.86E-05 Igh;Ighg;Ighg;Igh;Igh;Igh;Fcer1g;Igh;Igh;Pla2g10;Prkcd;Prkca;Prkce;Prkce 43 44 Glutathione metabolism 6 3.96E-06 1.92E-05 Gstm3;Gstm1;Gstm3;Gstm1;Gstm1;Ggt6;Gstm2;Gstt1;Gsta3 45 Leukocyte transendothelial migration 8 4.69E-06 2.21E-05 Gnai2;Myl7;Mmp9;Cyba;Itga4;Cldn4;Prkca;Cldn8 46 Glycan structures - biosynthesis 1 8 5.00E-06 2.29E-05 Csgalnact1;Chst11;Galnt7;B4galt4;Galnt7;Mgat3;Gcnt3;Galnt7;B3gnt7;St6gal1 47 Acute myeloid leukemia 6 7.55E-06 3.31E-05 Pim1;Kit;Zbtb16;Zbtb16;Ppard;Tcf7l2;Runx1t1 48 Arginine and proline metabolism 5 7.65E-06 3.31E-05 Arg1;Pycr1;Otc;Cps1;Ckmt1;Ckmt1 49 50 Natural killer cell mediated cytotoxicity 8 1.09E-05 4.61E-05 Cd244;Igh;Ighg;Tyrobp;Ighg;Igh;Igh;Igh;Fcer1g;Igh;Fcgr4;Igh;H2-D1;H2-D1;Prkca;H2-D1 51 Glycosphingolipid biosynthesis - neo-lactoseries 4 1.17E-05 4.78E-05 Fut9;Fut9;St3gal6;B4galt4;Fut4;St3gal6 52 Graft-versus-host disease 6 1.61E-05 6.42E-05 H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb1 53 Antigen processing and presentation 7 1.66E-05 6.50E-05 H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;Hspa1a;H2-Q2;H2-D1;H2-Eb1 54 55 Linoleic acid metabolism 5 1.97E-05 7.49E-05 Pla2g10;Cyp2c40;Cyp3a13;Akr1c13;Cyp2c55 56 Glycerolipid metabolism 5 2.22E-05 8.25E-05 Lpl;Lpl;Aldh1b1;Aldh2;Aldh2;Aldh2;Aldh2;Agpat4;Lipg;Agpat4 57 Type I diabetes mellitus 6 2.45E-05 8.76E-05 H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb1 58 Bladder cancer 5 2.49E-05 8.76E-05 Mmp9;Thbs1;Cdk4;LOC640611;Fgfr3 59 60 Carcinogenesis Page 78 of 98
1 2 Fatty acid metabolism 5 2.49E-05 8.76E-05 Acsl4;Aldh1b1;Aldh2;Aldh2;Aldh2;Ehhadh;Aldh2;Adh1 3 Ascorbate and aldarate metabolism 3 2.83E-05 9.43E-05 Ugdh;Aldh1b1;Aldh2;Aldh2;Aldh2;Aldh2 4 Purine metabolism 8 3.93E-05 1.28E-04 Ada;Enpp3;Nt5c3;Entpd5;Enpp3;Pde7a;Entpd5;Pde7a;Pde8b;Pde8b;Entpd5;Adcy6;Pde2a;Pde7a;Pde2a 5 6 Calcium signaling pathway 9 4.04E-05 1.29E-04 Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Igh;Htr4;Plce1;Pln;Mylk;Prkca;Atp2a3;Ptger3;Pln 7 3-Chloroacrylic acid degradation 3 4.22E-05 1.32E-04 Aldh1b1;Aldh2;Aldh2;Aldh2;Aldh2;Adh1 8 Hematopoietic cell lineage 6 7.25E-05 2.23E-04 Cd44;Igh;Ighg;Cd44;Ighg;Igh;Igh;Itga4;Igh;Igh;Igh;Kit;H2-Eb1 9 Sulfur metabolism 3 8.18E-05 2.47E-04 Chst11;Sult1a1;Sult2b1 10 11 Cell Communication 7 9.54E-05 2.79E-04 Lama1;Thbs1;Spp1;Tnxb;Des;Gjb3;Thbs4 12 Folate biosynthesis 4 9.67E-05 2.79E-04 Gch1;Alpl;Ifih1;Ggh 13 Bile acid biosynthesis 4 9.67E-05 2.79E-04 Aldh1b1;Aldh2;Aldh2;Aldh2;Aldh2;Akr1c13;Adh1 14 Aminosugars metabolism 4 1.10E-04 3.10E-04 Npl;Hexb;Hexb;Uap1;Uap1;Uap1;Uap1;Gfpt1;Gfpt1 15 Gap junction 6 1.26E-04 3.37E-04 Gnai2;Tubb2b;Tubb2a;Tubb2b;Tubb2a;Prkca;Adcy6;Prkg1 16 17 TGF-beta signaling pathway 6 1.26E-04 3.37E-04 Inhbb;LOC100046802;Thbs1;Bmp2;Thbs4;Cdkn2b 18 Glycan structures - biosynthesisFor 2 Peer Review5 1.26E-04 3.37E-04 Fut9;Fut9;St3gal6;B4galt4;Fut4;St3gal6;St8sia5 19 Alanine and aspartate metabolism 4 1.60E-04 4.19E-04 Asns;Asns;Aspa;Abat;PcxDownloaded from 20 Circadian rhythm 3 1.77E-04 4.48E-04 Per2;Per3;Per2;Arntl 21 22 Asthma 4 1.79E-04 4.48E-04 Igh;Ighg;Ighg;Igh;Igh;Igh;Fcer1g;Igh;Igh;H2-Eb1 23 Limonene and pinene degradation 3 2.69E-04 6.63E-04 Aldh1b1;Aldh2;Aldh2;Aldh2;Ehhadh;Aldh2
24 MAPK signaling pathway 9 3.19E-04 7.62E-04 Map4k4;Map4k4;Fgf1;Pla2g10;Cacna2d2;Fgfr3;Map3k5;Fgf1;Prkca;Ptprr;Hspa1ahttp://carcin.oxfordjournals.org/ 25 p53 signaling pathway 5 3.19E-04 7.62E-04 Igf1;Igf1;Igf1;Igf1;Thbs1;Cdk4;LOC640611;Rprm 26 Alkaloid biosynthesis II 3 3.25E-04 7.65E-04 Prdx6;Ces3;Ces3;Prdx6;Aadac 27 28 ABC transporters - General 4 3.33E-04 7.73E-04 Cftr;Abca8a;Abcb1a;Abcb1a;Abcc3 29 Valine, leucine and isoleucine degradation 4 4.38E-04 0.00100206 Aldh1b1;Aldh2;Aldh2;Aldh2;Ehhadh;Aldh2;Hmgcs2 30 Type II diabetes mellitus 4 4.78E-04 0.00107747 Socs3;Socs3;Socs3;Prkcz;Prkcd;Prkce;Prkce 31 Long-term depression 5 5.77E-04 0.00128293 Gnai2;Igf1;Igf1;Igf1;Igf1;Pla2g10;Prkca;Prkg1 32
33 Methionine metabolism 3 7.15E-04 0.00147603 Mtap;Mtap;Cth;Ahcyl2;Ahcyl2 by guest on November 20, 2015 34 Selenoamino acid metabolism 3 7.15E-04 0.00147603 Ggt6;Cth;Ahcyl2;Ahcyl2 35 Insulin signaling pathway 6 8.65E-04 0.00175176 Socs3;Socs3;Socs3;Pck1;Prkcz;Ppp1r3b;Sorbs1;Prkaa2 36 Small cell lung cancer 5 0.00101538 0.00202906 Lama1;Cdk4;LOC640611;Cdkn1b;Cdkn2b 37 Basal cell carcinoma 4 0.00102721 0.00202906 Fzd5;Hhip;Bmp2;Tcf7l2;Hhip 38 39 Maturity onset diabetes of the young 3 0.0010488 0.00204644 Hnf4a;Nr5a2;Neurod1;Hnf4a;Neurod1 40 GnRH signaling pathway 5 0.00111595 0.00213834 Mmp14;Pla2g10;Prkcd;Prkca;Adcy6 41 Pyrimidine metabolism 5 0.00111595 0.00213834 Ctps;Dpyd;Dpyd;Nt5c3;Entpd5;Entpd5;Entpd5;Upp1 42 Glycan structures - degradation 3 0.00131796 0.00248087 Gusb;Gusb;Hexb;Hexb;Neu1 43 44 Lysine degradation 3 0.00146733 0.00272992 Aldh1b1;Aldh2;Aldh2;Aldh2;Ehhadh;Aldh2 45 Regulation of actin cytoskeleton 7 0.00173129 0.00314781 Myl7;Itga4;Fgf1;Gsn;Fgfr3;Itga8;Fgf1;Mylk;Gsn;Gsn 46 Methane metabolism 2 0.00175762 0.00315976 Prdx6;Prdx6;Lpo 47 Glutamate metabolism 3 0.00197762 0.00351578 Cps1;Abat;Gfpt1;Gfpt1 48 Adipocytokine signaling pathway 4 0.00213992 0.00376249 Acsl4;Socs3;Socs3;Socs3;Pck1;Prkaa2 49 50 Ether lipid metabolism 3 0.00216924 0.00377259 Pla2g7;Pla2g10;Agpat4;Agpat4 51 Glioma 4 0.00225936 0.00388707 Igf1;Igf1;Igf1;Igf1;Cdk4;LOC640611;Prkca 52 B cell receptor signaling pathway 4 0.00238332 0.00401401 Ifitm1;Igh;Ighg;Card11;Ighg;Igh;Igh;Igh;Igh;Igh 53 Arachidonic acid metabolism 4 0.00264511 0.00440852 Pla2g10;Cyp2c40;Ggt6;Cyp2c55 54 55 Reductive carboxylate cycle (CO2 fixation) 2 0.00279472 0.00460985 Acss1;Acss2;Acss2 56 Melanoma 4 0.00292596 0.00477708 Igf1;Igf1;Igf1;Igf1;Cdk4;LOC640611;Fgf1;Fgf1 57 Primary immunodeficiency 3 0.00304917 0.00492795 Igh;Ighg;Ada;Ighg;Igh;Igh;Igh;Igh;Igh 58 Fructose and mannose metabolism 3 0.00441913 0.0070006 Aldob;Pmm2;Akr1c13 59 60 Page 79 of 98 Carcinogenesis
1 2 Glycosphingolipid biosynthesis - globoseries 2 0.00476728 0.00726443 Fut9;Hexb;Fut9;Hexb 3 Glycosaminoglycan degradation 2 0.00634951 0.00927782 Gusb;Gusb;Hexb;Hexb 4 Pantothenate and CoA biosynthesis 2 0.00634951 0.00927782 Dpyd;Enpp3;Dpyd;Enpp3 5 6 N-Glycan degradation 2 0.00634951 0.00927782 Hexb;Hexb;Neu1 7 Keratan sulfate biosynthesis 2 0.00634951 0.00927782 B4galt4;B3gnt7 8 Prostate cancer 4 0.0066663 0.009439 Igf1;Igf1;Igf1;Igf1;Creb3l1;Cdkn1b;Tcf7l2 9 Riboflavin metabolism 2 0.00721808 0.00982888 Enpp3;Enpp3;Rfk 10 11 alpha-Linolenic acid metabolism 2 0.00721808 0.00982888 Pla2g10;Fads2 12 Glycosphingolipid biosynthesis - ganglioseries 2 0.00721808 0.00982888 Hexb;Hexb;St8sia5 13 Dentatorubropallidoluysian atrophy (DRPLA) 2 0.00721808 0.00982888 Itch;Casp1 14 Wnt signaling pathway 5 0.00801836 0.01069115 Frat2;Fzd5;Prkca;Ppard;Tcf7l2 15 gamma-Hexachlorocyclohexane degradation 2 0.00813712 0.01075983 Alpl;Cyp3a13 16 17 Non-small cell lung cancer 3 0.01001093 0.01251367 Cdk4;LOC640611;Prkca 18 Chondroitin sulfate biosynthesisFor Peer Review2 0.01230076 0.01480751 Csgalnact1;Chst11 19 Amyotrophic lateral sclerosis (ALS) 2 0.01466335 0.01717539 Nefl;Nefm Downloaded from 20 Nicotinate and nicotinamide metabolism 2 0.01720443 0.01952275 Enpp3;Nt5c3;Enpp3 21 22 Cell cycle 4 0.01785318 0.02011626 Cdk4;LOC640611;Cdkn1b;Cdkn2b 23 Citrate cycle (TCA cycle) 2 0.01991767 0.02190259 Pck1;Pcx
24 O-Glycan biosynthesis 2 0.01991767 0.02190259 Galnt7;Galnt7;Gcnt3;Galnt7http://carcin.oxfordjournals.org/ 25 Alzheimer's disease 2 0.02133693 0.02306695 Snca;Lpl;Lpl 26 Complement and coagulation cascades 3 0.02212263 0.02375584 Plat;Cfh;Cfh;Cfi 27 28 Chronic myeloid leukemia 3 0.0288431 0.03056222 Cdk4;LOC640611;Cdkn1b 29 Peptidoglycan biosynthesis 1 0.03184967 0.03277137 Pglyrp1 30 SNARE interactions in vesicular transport 2 0.03409629 0.03474781 Stx11;Snap25 31 Sphingolipid metabolism 2 0.03585616 0.03608167 Gal3st1;Neu1 32
33 Neurodegenerative Disorders 2 0.03947831 0.03868548 Snca;Casp1 by guest on November 20, 2015 34 Vitamin B6 metabolism 1 0.03965262 0.03868548 Psat1;Psat1 35 Tetrachloroethene degradation 1 0.03965262 0.03868548 Akr1c13 36 Alkaloid biosynthesis I 1 0.03965262 0.03868548 Ddc 37 Nucleotide sugars metabolism 1 0.0473928 0.04491416 Ugdh 38 39 Caprolactam degradation 1 0.0473928 0.04491416 Ehhadh 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 80 of 98
1 2 3 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Maoa;Fmo2;Maob;Fmo2;Fmo2;Fmo2;Maoa;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;4 Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Cyp2d22;Adh1;Gstt1;Cyp2d10;Cyp2d26;Gsta3;Cyp2d9 5 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Cyp2s1;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a6 2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Adh1;Gstt1;Gsta3 Rdh10;Aldh1a1;Cyp2c40;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a7 5;Ugt1a6b;Cyp2c55;Rdh16;Retsat;Adh1 Gusb;Gusb;Dpyd;Dpyd;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;8 Ugt1a6b;Ces3;Ces3;Upp1 Gusb;Gusb;Ugdh;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b9 10 Gusb;Gusb;Enpp3;Ugdh;Enpp3;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;U11 gt1a6b Hsd11b2;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Sult2b1;Hsd112 7b2 Cp;Cp;Cp;Cp;Cp;Gusb;Cp;Gusb;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;13 Ugt1a6b Arg1;Otc;Cps1;Aldh1b1;Aldh2;Maoa;Aldh2;Aldh2;Maob;Aldh2;Maoa;Abp114 Aspa;Aldh1a3;Aldh1b1;Aldh2;Maoa;Aldh2;Aldh2;Maob;Aldh2;Maoa;Abp1;Ddc15 16 Gnai2;Myl7;Cdk4;LOC640611;Cldn4;Prkcz;Prkcd;Myh11;Prkca;Myh11;Epb4.1l3;Cldn8;Prkce;Prkce;Epb4.1l3;Igsf517 Aldh1a3;Hpd;Prdx6;Maoa;Maob;Maoa;Prdx6;Lpo;Ddc18 For Peer Review Acsl4;Lpl;Lpl;Pck1;Fads2;Ehhadh;Fabp2;Ppard;Sorbs1;Fabp6;Hmgcs219 Downloaded from Aldh1b1;Aldh2;Maoa;Aldh2;Aldh2;Maob;Ehhadh;Aldh2;Maoa;Abp1;Ccbl1;Ddc;Ccbl120 21 Itga4;Cldn4;L1cam;Itga8;H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;Neo1;Cldn8;Neo1;H2-Bl;H2-Q2;H2-D1;H2-Eb122 Asns;Asns;Cps1;Cth;Car2;Car1;Car4;Car423
Aldh1a3;Aldob;Aldh1b1;Aldh2;Aldh2;Aldh2;Acss1;Acss2;Aldh2;Eno3;Acss2;Adh124 http://carcin.oxfordjournals.org/ Comt1;Aldh1a3;Hpd;Maoa;Maob;Maoa;Ddc;Adh125 Glo1;Glo1;Pck1;Aldh1b1;Aldh2;Aldh2;Aldh2;Acss1;Acss2;Aldh2;Pcx;Acss226 27 Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb128 Myl7;Igf1;Igf1;Igf1;Igf1;Lama1;Thbs1;Itga4;Spp1;Tnxb;Cav1;Itga8;Mylk;Prkca;Thbs429 Phgdh;Psat1;Psat1;Phgdh;Cth;Maoa;Maob;Maoa;Chdh;Akr1c1330 Aldh1b1;Aldh2;Aldh2;Aldh2;Abat;Ehhadh;Acss1;Acss2;Aldh2;Acss231 32
Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Fcgr4;Igh;Hist2h2bb;H2-Eb1;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c133 by guest on November 20, 2015 Lama1;Cd44;Cd44;Thbs1;Itga4;Spp1;Tnxb;Itga8;Thbs434 Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb135 Aldh1b1;Aldh2;Aldh2;Aldh2;Abat;Ehhadh;Aldh2;Akr1c13;Hmgcs236 37 Dpyd;Dpyd;Aldh1b1;Aldh2;Aldh2;Aldh2;Abat;Ehhadh;Aldh2 38 Cxcl5;Cxcl2;Inhbb;Tnfrsf11b;Tnfsf9;Cxcl14;Cxcl16;Ccr1;Cxcl14;Cxcl1;Ccl28;Ccl28;Bmp2;Kit39 Gnai2;Sema7a;Robo1;Sema5a;Sema5a;L1cam;Efnb2;Sema4g;Sema4a;Efnb2;Ngef40 Gnai2;Creb3l1;Fzd5;Prkca;Adcy6;Kit;Edn1;Tcf7l241 Igh;Ighg;Ighg;Igh;Igh;Igh;Fcer1g;Igh;Igh;Pla2g10;Prkcd;Prkca;Prkce;Prkce42 43 Gstm3;Gstm1;Gstm3;Gstm1;Gstm1;Ggt6;Gstm2;Gstt1;Gsta344 Gnai2;Myl7;Mmp9;Cyba;Itga4;Cldn4;Prkca;Cldn845 Csgalnact1;Chst11;Galnt7;B4galt4;Galnt7;Mgat3;Gcnt3;Galnt7;B3gnt7;St6gal146 Pim1;Kit;Zbtb16;Zbtb16;Ppard;Tcf7l2;Runx1t147 48 Arg1;Pycr1;Otc;Cps1;Ckmt1;Ckmt1 49 Cd244;Igh;Ighg;Tyrobp;Ighg;Igh;Igh;Igh;Fcer1g;Igh;Fcgr4;Igh;H2-D1;H2-D1;Prkca;H2-D150 Fut9;Fut9;St3gal6;B4galt4;Fut4;St3gal651 H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb152 H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;Hspa1a;H2-Q2;H2-D1;H2-Eb153 54 Pla2g10;Cyp2c40;Cyp3a13;Akr1c13;Cyp2c5555 Lpl;Lpl;Aldh1b1;Aldh2;Aldh2;Aldh2;Aldh2;Agpat4;Lipg;Agpat456 H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb157 Mmp9;Thbs1;Cdk4;LOC640611;Fgfr358 59 60 Page 81 of 98 Carcinogenesis
1 Acsl4;Aldh1b1;Aldh2;Aldh2;Aldh2;Ehhadh;Aldh2;Adh12 Ugdh;Aldh1b1;Aldh2;Aldh2;Aldh2;Aldh23 Ada;Enpp3;Nt5c3;Entpd5;Enpp3;Pde7a;Entpd5;Pde7a;Pde8b;Pde8b;Entpd5;Adcy6;Pde2a;Pde7a;Pde2a4 5 Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Igh;Htr4;Plce1;Pln;Mylk;Prkca;Atp2a3;Ptger3;Pln6 Aldh1b1;Aldh2;Aldh2;Aldh2;Aldh2;Adh17 Cd44;Igh;Ighg;Cd44;Ighg;Igh;Igh;Itga4;Igh;Igh;Igh;Kit;H2-Eb18 Chst11;Sult1a1;Sult2b19 10 Lama1;Thbs1;Spp1;Tnxb;Des;Gjb3;Thbs411 Gch1;Alpl;Ifih1;Ggh12 Aldh1b1;Aldh2;Aldh2;Aldh2;Aldh2;Akr1c13;Adh113 Npl;Hexb;Hexb;Uap1;Uap1;Uap1;Uap1;Gfpt1;Gfpt114 Gnai2;Tubb2b;Tubb2a;Tubb2b;Tubb2a;Prkca;Adcy6;Prkg115 16 Inhbb;LOC100046802;Thbs1;Bmp2;Thbs4;Cdkn2b17 Fut9;Fut9;St3gal6;B4galt4;Fut4;St3gal6;St8sia518 For Peer Review Asns;Asns;Aspa;Abat;Pcx19 Downloaded from Per2;Per3;Per2;Arntl20 21 Igh;Ighg;Ighg;Igh;Igh;Igh;Fcer1g;Igh;Igh;H2-Eb122 Aldh1b1;Aldh2;Aldh2;Aldh2;Ehhadh;Aldh223
Map4k4;Map4k4;Fgf1;Pla2g10;Cacna2d2;Fgfr3;Map3k5;Fgf1;Prkca;Ptprr;Hspa1a24 http://carcin.oxfordjournals.org/ Igf1;Igf1;Igf1;Igf1;Thbs1;Cdk4;LOC640611;Rprm25 Prdx6;Ces3;Ces3;Prdx6;Aadac26 27 Cftr;Abca8a;Abcb1a;Abcb1a;Abcc328 Aldh1b1;Aldh2;Aldh2;Aldh2;Ehhadh;Aldh2;Hmgcs229 Socs3;Socs3;Socs3;Prkcz;Prkcd;Prkce;Prkce30 Gnai2;Igf1;Igf1;Igf1;Igf1;Pla2g10;Prkca;Prkg131 32
Mtap;Mtap;Cth;Ahcyl2;Ahcyl233 by guest on November 20, 2015 Ggt6;Cth;Ahcyl2;Ahcyl234 Socs3;Socs3;Socs3;Pck1;Prkcz;Ppp1r3b;Sorbs1;Prkaa235 Lama1;Cdk4;LOC640611;Cdkn1b;Cdkn2b36 37 Fzd5;Hhip;Bmp2;Tcf7l2;Hhip 38 Hnf4a;Nr5a2;Neurod1;Hnf4a;Neurod139 Mmp14;Pla2g10;Prkcd;Prkca;Adcy640 Ctps;Dpyd;Dpyd;Nt5c3;Entpd5;Entpd5;Entpd5;Upp141 Gusb;Gusb;Hexb;Hexb;Neu142 43 Aldh1b1;Aldh2;Aldh2;Aldh2;Ehhadh;Aldh244 Myl7;Itga4;Fgf1;Gsn;Fgfr3;Itga8;Fgf1;Mylk;Gsn;Gsn45 Prdx6;Prdx6;Lpo46 Cps1;Abat;Gfpt1;Gfpt147 48 Acsl4;Socs3;Socs3;Socs3;Pck1;Prkaa2 49 Pla2g7;Pla2g10;Agpat4;Agpat450 Igf1;Igf1;Igf1;Igf1;Cdk4;LOC640611;Prkca51 Ifitm1;Igh;Ighg;Card11;Ighg;Igh;Igh;Igh;Igh;Igh52 Pla2g10;Cyp2c40;Ggt6;Cyp2c5553 54 Acss1;Acss2;Acss255 Igf1;Igf1;Igf1;Igf1;Cdk4;LOC640611;Fgf1;Fgf156 Igh;Ighg;Ada;Ighg;Igh;Igh;Igh;Igh;Igh57 Aldob;Pmm2;Akr1c1358 59 60 Carcinogenesis Page 82 of 98
1 Fut9;Hexb;Fut9;Hexb2 Gusb;Gusb;Hexb;Hexb3 Dpyd;Enpp3;Dpyd;Enpp34 5 Hexb;Hexb;Neu16 B4galt4;B3gnt77 Igf1;Igf1;Igf1;Igf1;Creb3l1;Cdkn1b;Tcf7l28 Enpp3;Enpp3;Rfk9 10 Pla2g10;Fads211 Hexb;Hexb;St8sia512 13 Frat2;Fzd5;Prkca;Ppard;Tcf7l214 Alpl;Cyp3a1315 16 Cdk4;LOC640611;Prkca17 Csgalnact1;Chst1118 For Peer Review 19 Downloaded from Enpp3;Nt5c3;Enpp320 21 Cdk4;LOC640611;Cdkn1b;Cdkn2b22 23
Galnt7;Galnt7;Gcnt3;Galnt724 http://carcin.oxfordjournals.org/ Snca;Lpl;Lpl25 Plat;Cfh;Cfh;Cfi26 27 Cdk4;LOC640611;Cdkn1b28 29 Stx11;Snap2530 Gal3st1;Neu131 32
Snca;Casp133 by guest on November 20, 2015 Psat1;Psat134 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 83 of 98 Carcinogenesis
1 2 3 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Maoa;Fmo2;Maob;Fmo2;Fmo2;Fmo2;Maoa;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;4 Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Cyp2d22;Adh1;Gstt1;Cyp2d10;Cyp2d26;Gsta3;Cyp2d9 5 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Cyp2s1;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a6 2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Adh1;Gstt1;Gsta3 Rdh10;Aldh1a1;Cyp2c40;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a7 5;Ugt1a6b;Cyp2c55;Rdh16;Retsat;Adh1 Gusb;Gusb;Dpyd;Dpyd;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;8 Ugt1a6b;Ces3;Ces3;Upp1 Gusb;Gusb;Ugdh;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b9 10 Gusb;Gusb;Enpp3;Ugdh;Enpp3;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;U11 gt1a6b Hsd11b2;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Sult2b1;Hsd112 7b2 Cp;Cp;Cp;Cp;Cp;Gusb;Cp;Gusb;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;13 Ugt1a6b 14 15 16 Gnai2;Myl7;Cdk4;LOC640611;Cldn4;Prkcz;Prkcd;Myh11;Prkca;Myh11;Epb4.1l3;Cldn8;Prkce;Prkce;Epb4.1l3;Igsf517 18 For Peer Review 19 Downloaded from 20 21 Itga4;Cldn4;L1cam;Itga8;H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;Neo1;Cldn8;Neo1;H2-Bl;H2-Q2;H2-D1;H2-Eb122 23
24 http://carcin.oxfordjournals.org/ 25 26 27 Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb128 29 30 31 32
Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Fcgr4;Igh;Hist2h2bb;H2-Eb1;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c133 by guest on November 20, 2015 34 Igh;Ighg;Ighg;Igh;Igh;Igh;Igh;Igh;H2-T3-like;H2-T3;H2-D1;H2-T3;H2-T3-like;H2-D1;H2-Bl;H2-Q2;H2-D1;H2-Eb135 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 84 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 85 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 86 of 98
1 2 3 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Maoa;Fmo2;Maob;Fmo2;Fmo2;Fmo2;Maoa;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;4 Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Cyp2d22;Adh1;Gstt1;Cyp2d10;Cyp2d26;Gsta3;Cyp2d9 5 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Cyp2s1;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a6 2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Adh1;Gstt1;Gsta3 Rdh10;Aldh1a1;Cyp2c40;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a7 5;Ugt1a6b;Cyp2c55;Rdh16;Retsat;Adh1 Gusb;Gusb;Dpyd;Dpyd;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;8 Ugt1a6b;Ces3;Ces3;Upp1 Gusb;Gusb;Ugdh;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b9 10 Gusb;Gusb;Enpp3;Ugdh;Enpp3;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;U11 gt1a6b Hsd11b2;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Sult2b1;Hsd112 7b2 Cp;Cp;Cp;Cp;Cp;Gusb;Cp;Gusb;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;13 Ugt1a6b 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 87 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 88 of 98
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 89 of 98 Carcinogenesis
1 2 3 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Maoa;Fmo2;Maob;Fmo2;Fmo2;Fmo2;Maoa;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Cyp2d22;Adh1;Gstt1;Cyp2d10;Cyp2d26;Gsta3;Cyp2d94 5 Aldh1a3;Gstm3;Gstm1;Gstm3;Gstm1;Cyp2c40;Gstm1;Cyp2s1;Gstm2;Cyp3a13;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Ugt1a6a;Ugt1a2;Ugt1a9;Ugt1a1;Ugt1a7c;Ugt1a10;Ugt1a5;Ugt1a6b;Cyp2c55;Adh1;Gstt1;Gsta36 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 90 of 98
1 2 20w-Carcinoma vs Normal 3 Pathway Count p-Value q-Value Gene 4 Systemic lupus erythematosus 26 4.70E-32 5.41E-30 Igh;Igh;Igh;Igh;Ighg;Igh;Hist2h2bb;LOC100041230;Hist1h4a;Hist1h4m;Hist1h4i;Hist1h4c;Hist4h4;Hist1h4h;Hist1h4d;Hist1h4b;Hist1h4k;Hist2h4;Hist1h4f;Hist1h4j;Hist1h3g;Hist1h3h;Hist1h3i;Hist1h3a;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1 5 6 Drug metabolism - cytochrome P450 9 7.80E-11 4.48E-09 Cyp2b10;Cyp2b13;Gstm7;Cyp2d22;Fmo2;Fmo2;Fmo2;Fmo2;Maob;Gstm3;Gstt1;Cyp2c40 7 Cell adhesion molecules (CAMs) 10 1.84E-09 7.07E-08 Itga4;Cldn4;Cadm1;Selp;Cldn8;H2-T3;H2-T3-like;H2-D1;Neo1;H2-T3-like;H2-T3;H2-D1;Neo1;H2-Bl 8 ECM-receptor interaction 7 6.10E-08 1.75E-06 Spp1;Itga4;Npnt;Gp1bb;Cd44;Cd44;Thbs1;Thbs4 9 Wnt signaling pathway 8 3.28E-07 7.54E-06 Dkk2;Wif1;Nkd1;Mmp7;Sox17;Nkd1;Axin2;Wnt10a;Sox17;Wnt6 10 11 Allograft rejection 6 4.05E-07 7.77E-06 Igh;Igh;Igh;Igh;Ighg;Igh;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl 12 Retinol metabolism 6 5.29E-07 8.70E-06 Cyp2b10;Cyp2b13;Rdh10;Rdh16;Aldh1a1;Cyp2c40 13 Metabolism of xenobiotics by cytochrome P450 6 6.28E-07 9.03E-06 Cyp2b10;Cyp2b13;Gstm7;Gstm3;Gstt1;Cyp2c40 14 Autoimmune thyroid disease 6 1.37E-06 1.62E-05 Igh;Igh;Igh;Igh;Ighg;Igh;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl 15 Cytokine-cytokine receptor interaction 9 1.41E-06 1.62E-05 Tnfrsf11b;Cxcl5;Cxcl14;Inhbb;Cxcl14;Tnfrsf19;Cxcl2;Bmp7;Tnfrsf12a;Tnfrsf12a;Ccl28;Ccl28 16 17 Hematopoietic cell lineage 6 1.95E-06 2.04E-05 Itga4;Gp1bb;Igh;Cd44;Igh;Igh;Igh;Cd44;Cd24a;Cd24a;Ighg;Igh 18 TGF-beta signaling pathwayFor Peer Review6 3.50E-06 3.35E-05 Inhbb;LOC100046802;Id2;Thbs1;Bmp7;Thbs4 19 Urea cycle and metabolism of amino groups 4 4.41E-06 3.90E-05 Arg1;Maob;Aldh1b1;OtcDownloaded from 20 Arginine and proline metabolism 4 1.33E-05 1.05E-04 Pycr1;Arg1;Ckmt1;Otc 21 22 Arachidonic acid metabolism 5 1.37E-05 1.05E-04 Alox12;Cyp2b10;Cyp2b13;Alox15;Cyp2c40 23 Calcium signaling pathway 7 2.61E-05 1.88E-04 Adcy8;Igh;Igh;Igh;Igh;Adcy1;Ighg;Igh;Gnal;Pln;Htr4
24 ABC transporters - General 4 2.84E-05 1.92E-04 Abcc2;Abcg5;Abca8a;Abcb1a;Abcb1ahttp://carcin.oxfordjournals.org/ 25 Glycerolipid metabolism 4 3.13E-05 1.94E-04 Pnliprp2;Pnliprp2;Lpl;Lpl;Lipg;Lipg;Aldh1b1 26 Pyruvate metabolism 4 3.13E-05 1.94E-04 Glo1;Pcx;Acss2;Aldh1b1 27 28 Gap junction 5 5.63E-05 3.24E-04 Tubb2b;Tubb2a;Prkg2;Adcy8;Prkg2;Adcy1 29 Glycolysis / Gluconeogenesis 4 9.13E-05 4.97E-04 Aldob;Eno3;Acss2;Aldh1b1 30 Phenylalanine metabolism 3 9.50E-05 4.97E-04 Prdx6;Maob;Lpo 31 Biosynthesis of steroids 3 1.26E-04 6.29E-04 Hmgcr;Cyp51;Idi1;Cyp51 32
33 Leukocyte transendothelial migration 5 1.39E-04 6.67E-04 Myl7;Itga4;Mmp9;Cldn4;Cldn8 by guest on November 20, 2015 34 Graft-versus-host disease 4 1.86E-04 8.55E-04 H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl 35 Focal adhesion 6 1.94E-04 8.60E-04 Myl7;Igf1;Igf1;Spp1;Igf1;Itga4;Igf1;Thbs1;Thbs4 36 Histidine metabolism 3 2.05E-04 8.73E-04 Aspa;Maob;Aldh1b1 37 Type I diabetes mellitus 4 2.47E-04 1.01E-03 H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl 38 39 p53 signaling pathway 4 2.74E-04 1.09E-03 Igf1;Igf1;Cdkn2a;Igf1;Igf1;Thbs1;Rprm 40 PPAR signaling pathway 4 3.04E-04 1.15E-03 Acsl4;Lpl;Lpl;Scd2;Hmgcs2 41 Propanoate metabolism 3 3.11E-04 1.15E-03 Abat;Acss2;Aldh1b1 42 Alanine and aspartate metabolism 3 4.10E-04 1.47E-03 Aspa;Pcx;Abat 43 44 Butanoate metabolism 3 4.87E-04 1.67E-03 Abat;Aldh1b1;Hmgcs2 45 Methane metabolism 2 4.94E-04 1.67E-03 Prdx6;Lpo 46 Purine metabolism 5 5.36E-04 1.76E-03 Adcy8;Adcy1;Entpd5;Enpp3;Enpp1 47 Bladder cancer 3 8.23E-04 2.59E-03 Cdkn2a;Mmp9;Thbs1 48 Tryptophan metabolism 3 8.23E-04 2.59E-03 Maob;Aldh1b1;Ccbl1;Ccbl1 49 50 Antigen processing and presentation 4 8.70E-04 2.63E-03 H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl 51 Melanogenesis 4 9.04E-04 2.66E-03 Adcy8;Wnt10a;Adcy1;Wnt6 52 Glutathione metabolism 3 1.43E-03 3.83E-03 Gstm7;Gstm3;Gstt1 53 Hedgehog signaling pathway 3 1.51E-03 3.96E-03 Wnt10a;Wnt6;Bmp7 54 55 Basal cell carcinoma 3 1.68E-03 4.31E-03 Axin2;Wnt10a;Wnt6 56 Pantothenate and CoA biosynthesis 2 1.82E-03 4.54E-03 Enpp3;Enpp1 57 Riboflavin metabolism 2 2.07E-03 5.07E-03 Enpp3;Enpp1 58 Glycan structures - biosynthesis 2 3 2.16E-03 5.18E-03 B4galt6;St8sia5;Fut9;Fut9 59 60 Page 91 of 98 Carcinogenesis
1 2 Natural killer cell mediated cytotoxicity 4 2.31E-03 5.19E-03 Igh;Igh;Igh;Igh;Cd244;Ighg;Igh;H2-D1;H2-D1 3 Alkaloid biosynthesis II 2 2.34E-03 5.19E-03 Ces3;Prdx6;Ces3 4 Cell Communication 4 2.37E-03 5.19E-03 Spp1;Krt23;Thbs1;Thbs4 5 6 Axon guidance 4 2.37E-03 5.19E-03 Slit2;Plxnb1;Robo1;Sema7a 7 B cell receptor signaling pathway 3 3.22E-03 6.74E-03 Igh;Igh;Igh;Igh;Ifitm1;Ighg;Igh 8 Nitrogen metabolism 2 3.57E-03 7.32E-03 Car4;Car4;Car1 9 Melanoma 3 3.78E-03 7.49E-03 Igf1;Igf1;Cdkn2a;Igf1;Igf1;Fgf1 10 11 beta-Alanine metabolism 2 3.92E-03 7.52E-03 Abat;Aldh1b1 12 Complement and coagulation cascades 3 3.92E-03 7.52E-03 Cfh;Cfh;Plat;Cfi 13 Nicotinate and nicotinamide metabolism 2 5.05E-03 9.52E-03 Enpp3;Enpp1 14 GnRH signaling pathway 3 8.08E-03 1.41E-02 Mmp14;Adcy8;Adcy1 15 Asthma 2 9.74E-03 1.62E-02 Igh;Igh;Igh;Igh;Ighg;Igh 16 17 Primary immunodeficiency 2 1.03E-02 1.69E-02 Igh;Igh;Igh;Igh;Ighg;Igh 18 Starch and sucrose metabolismFor Peer Review2 1.08E-02 1.76E-02 Enpp3;Enpp1 19 Fatty acid metabolism 2 1.45E-02 2.25E-02 Acsl4;Aldh1b1 Downloaded from 20 Valine, leucine and isoleucine degradation 2 1.51E-02 2.32E-02 Aldh1b1;Hmgcs2 21 22 Cell cycle 3 1.57E-02 2.35E-02 Cdkn2a;Cdkn1c;Cdkn1b 23 Tight junction 3 2.05E-02 2.91E-02 Myl7;Cldn4;Cldn8
24 Terpenoid biosynthesis 1 2.10E-02 2.95E-02 Idi1 http://carcin.oxfordjournals.org/ 25 Non-small cell lung cancer 2 2.30E-02 3.19E-02 Cdkn2a;Rarb 26 Adipocytokine signaling pathway 2 3.31E-02 4.35E-02 Acsl4;Npy 27 28 Ascorbate and aldarate metabolism 1 3.35E-02 4.35E-02 Aldh1b1 29 Glioma 2 3.40E-02 0.04347745 Igf1;Igf1;Cdkn2a;Igf1;Igf1 30 3-Chloroacrylic acid degradation 1 3.76E-02 0.04669388 Aldh1b1 31 Long-term potentiation 2 3.87E-02 0.04716767 Adcy8;Adcy1 32
33 Reductive carboxylate cycle (CO2 fixation) 1 4.16E-02 0.04962641 Acss2 by guest on November 20, 2015 34 Synthesis and degradation of ketone bodies 1 4.16E-02 0.04962641 Hmgcs2 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 92 of 98
1 2 3 Igh;Igh;Igh;Igh;Ighg;Igh;Hist2h2bb;LOC100041230;Hist1h4a;Hist1h4m;Hist1h4i;Hist1h4c;Hist4h4;Hist1h4h;Hist1h4d;Hist1h4b;Hist1h4k;Hist2h4;Hist1h4f;Hist1h4j;Hist1h3g;Hist1h3h;Hist1h3i;Hist1h3a;Hist1h3e;H4 ist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1 5 Cyp2b10;Cyp2b13;Gstm7;Cyp2d22;Fmo2;Fmo2;Fmo2;Fmo2;Maob;Gstm3;Gstt1;Cyp2c406 Itga4;Cldn4;Cadm1;Selp;Cldn8;H2-T3;H2-T3-like;H2-D1;Neo1;H2-T3-like;H2-T3;H2-D1;Neo1;H2-Bl7 Spp1;Itga4;Npnt;Gp1bb;Cd44;Cd44;Thbs1;Thbs48 Dkk2;Wif1;Nkd1;Mmp7;Sox17;Nkd1;Axin2;Wnt10a;Sox17;Wnt69 10 Igh;Igh;Igh;Igh;Ighg;Igh;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl11 Cyp2b10;Cyp2b13;Rdh10;Rdh16;Aldh1a1;Cyp2c4012 Cyp2b10;Cyp2b13;Gstm7;Gstm3;Gstt1;Cyp2c4013 Igh;Igh;Igh;Igh;Ighg;Igh;H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl14 Tnfrsf11b;Cxcl5;Cxcl14;Inhbb;Cxcl14;Tnfrsf19;Cxcl2;Bmp7;Tnfrsf12a;Tnfrsf12a;Ccl28;Ccl2815 16 Itga4;Gp1bb;Igh;Cd44;Igh;Igh;Igh;Cd44;Cd24a;Cd24a;Ighg;Igh17 Inhbb;LOC100046802;Id2;Thbs1;Bmp7;Thbs418 For Peer Review Arg1;Maob;Aldh1b1;Otc19 Downloaded from Pycr1;Arg1;Ckmt1;Otc20 21 Alox12;Cyp2b10;Cyp2b13;Alox15;Cyp2c4022 Adcy8;Igh;Igh;Igh;Igh;Adcy1;Ighg;Igh;Gnal;Pln;Htr423
Abcc2;Abcg5;Abca8a;Abcb1a;Abcb1a24 http://carcin.oxfordjournals.org/ Pnliprp2;Pnliprp2;Lpl;Lpl;Lipg;Lipg;Aldh1b125 Glo1;Pcx;Acss2;Aldh1b126 27 Tubb2b;Tubb2a;Prkg2;Adcy8;Prkg2;Adcy128 Aldob;Eno3;Acss2;Aldh1b129 Prdx6;Maob;Lpo30 Hmgcr;Cyp51;Idi1;Cyp5131 32
Myl7;Itga4;Mmp9;Cldn4;Cldn833 by guest on November 20, 2015 H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl34 Myl7;Igf1;Igf1;Spp1;Igf1;Itga4;Igf1;Thbs1;Thbs435 Aspa;Maob;Aldh1b136 37 H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl 38 Igf1;Igf1;Cdkn2a;Igf1;Igf1;Thbs1;Rprm39 Acsl4;Lpl;Lpl;Scd2;Hmgcs240 Abat;Acss2;Aldh1b141 Aspa;Pcx;Abat42 43 Abat;Aldh1b1;Hmgcs244 45 Adcy8;Adcy1;Entpd5;Enpp3;Enpp146 Cdkn2a;Mmp9;Thbs147 48 Maob;Aldh1b1;Ccbl1;Ccbl1 49 H2-T3;H2-T3-like;H2-D1;H2-T3-like;H2-T3;H2-D1;H2-Bl50 Adcy8;Wnt10a;Adcy1;Wnt651 Gstm7;Gstm3;Gstt152 Wnt10a;Wnt6;Bmp753 54 Axin2;Wnt10a;Wnt655 Enpp3;Enpp156 Enpp3;Enpp157 B4galt6;St8sia5;Fut9;Fut958 59 60 Page 93 of 98 Carcinogenesis
1 Igh;Igh;Igh;Igh;Cd244;Ighg;Igh;H2-D1;H2-D12 Ces3;Prdx6;Ces33 Spp1;Krt23;Thbs1;Thbs44 5 Slit2;Plxnb1;Robo1;Sema7a6 Igh;Igh;Igh;Igh;Ifitm1;Ighg;Igh7 Car4;Car4;Car18 Igf1;Igf1;Cdkn2a;Igf1;Igf1;Fgf19 10 Abat;Aldh1b111 Cfh;Cfh;Plat;Cfi12 Enpp3;Enpp113 Mmp14;Adcy8;Adcy114 Igh;Igh;Igh;Igh;Ighg;Igh15 16 Igh;Igh;Igh;Igh;Ighg;Igh17 Enpp3;Enpp118 For Peer Review Acsl4;Aldh1b119 Downloaded from Aldh1b1;Hmgcs220 21 Cdkn2a;Cdkn1c;Cdkn1b22 Myl7;Cldn4;Cldn823
24 http://carcin.oxfordjournals.org/ Cdkn2a;Rarb25 26 27 28 Igf1;Igf1;Cdkn2a;Igf1;Igf129 30 Adcy8;Adcy131 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 94 of 98
1 2 3 Igh;Igh;Igh;Igh;Ighg;Igh;Hist2h2bb;LOC100041230;Hist1h4a;Hist1h4m;Hist1h4i;Hist1h4c;Hist4h4;Hist1h4h;Hist1h4d;Hist1h4b;Hist1h4k;Hist2h4;Hist1h4f;Hist1h4j;Hist1h3g;Hist1h3h;Hist1h3i;Hist1h3a;Hist1h3e;H4 ist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 95 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 96 of 98
1 2 3 Igh;Igh;Igh;Igh;Ighg;Igh;Hist2h2bb;LOC100041230;Hist1h4a;Hist1h4m;Hist1h4i;Hist1h4c;Hist4h4;Hist1h4h;Hist1h4d;Hist1h4b;Hist1h4k;Hist2h4;Hist1h4f;Hist1h4j;Hist1h3g;Hist1h3h;Hist1h3i;Hist1h3a;Hist1h3e;H4 ist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 97 of 98 Carcinogenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Carcinogenesis Page 98 of 98
1 2 3 Igh;Igh;Igh;Igh;Ighg;Igh;Hist2h2bb;LOC100041230;Hist1h4a;Hist1h4m;Hist1h4i;Hist1h4c;Hist4h4;Hist1h4h;Hist1h4d;Hist1h4b;Hist1h4k;Hist2h4;Hist1h4f;Hist1h4j;Hist1h3g;Hist1h3h;Hist1h3i;Hist1h3a;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c1;Hist1h3e;Hist2h3c2;Hist1h3d;Hist1h3c;Hist1h3f;Hist2h3c14 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 Downloaded from 20 21 22 23
24 http://carcin.oxfordjournals.org/ 25 26 27 28 29 30 31 32
33 by guest on November 20, 2015 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60