Association of Fungi and Archaea of the Gut Microbiota with Crohn's

Article Association of Fungi and Archaea of the Gut Microbiota with Crohn’s Disease in Pediatric Patients—Pilot Study

Agnieszka Krawczyk 1, Dominika Salamon 1,* , Kinga Kowalska-Duplaga 2 , Tomasz Bogiel 3,4 and Tomasz Gosiewski 1,*

1 Department of Molecular Medical Microbiology, Faculty of Medicine, Jagiellonian University Medical College, 31-121 Krakow, Poland; [email protected] 2 Department of Pediatrics, Gastroenterology and Nutrition, Faculty of Medicine, Jagiellonian University Medical College, 30-663 Krakow, Poland; [email protected] 3 Microbiology Department, Ludwik Rydygier Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Torun, 85-094 Bydgoszcz, Poland; [email protected] 4 Clinical Microbiology Laboratory, University Hospital No. 1 in Bydgoszcz, 85-094 Bydgoszcz, Poland * Correspondence: [email protected] (D.S.); [email protected] (T.G.); Tel.: +48-(12)-633-25-67 (D.S.); +48-(12)-633-25-67 (T.G.)

Abstract: The composition of bacteria is often altered in Crohn’s disease (CD), but its connection to the disease is not fully understood. Gut archaea and fungi have recently been suggested to play a role as well. In our study, the presence and number of selected species of fungi and archaea in pediatric patients with CD and healthy controls were evaluated. Stool samples were collected from children with active CD (n = 54), non-active CD (n = 37) and control subjects (n = 33). The prevalence and the number of selected microorganisms were assessed by real-time PCR. The prevalence of Candida Citation: Krawczyk, A.; Salamon, D.; tropicalis was significantly increased in active CD compared to non-active CD and the control group Kowalska-Duplaga, K.; Bogiel, T.; (p = 0.011 and p = 0.036, respectively). The number of Malassezia spp. cells was significantly lower in Gosiewski, T. Association of Fungi patients with active CD compared to the control group, but in non-active CD, a significant increase and Archaea of the Gut Microbiota was observed (p = 0.005 and p = 0.020, respectively). There were no statistically significant differences with Crohn’s Disease in Pediatric in the colonization by archaea. The obtained results indicate possible correlations with the course Patients—Pilot Study. Pathogens 2021, of the CD; however, further studies of the entire archeobiome and the mycobiome are necessary in 10, 1119. https://doi.org/10.3390/ order to receive a complete picture. pathogens10091119

Academic Editor: Ana Elena Pérez Keywords: fungi; archaea; gut microbiota; Crohn’s disease; gut dysbiosis Cobas

Received: 4 August 2021 Accepted: 29 August 2021 1. Introduction Published: 1 September 2021 Crohn’s disease (CD) is included in the group of diseases known as inﬂammatory bowel diseases (IBD). It is believed that the incidence and severity of the course of the Publisher’s Note: MDPI stays neutral disease are conditioned by a combination of genetic, immunological, environmental and with regard to jurisdictional claims in microbiological factors (Figure1)[ 1–3]. The latter remain a constant interest of many published maps and institutional afﬁl- research teams, due to the still unclear role of microorganisms in the pathogenesis of the iations. disease. The fact that microorganisms participate in causing CD is suggested by numerous studies and clinical observations, among others: exacerbation of the disease as a result of infection and food poisoning [4]; failure to induce enteritis in germ-free animals; alleviation Copyright: © 2021 by the authors. or amelioration of symptoms following the application of antibiotics, probiotics or colon Licensee MDPI, Basel, Switzerland. cleansing treatments [5,6], as well as achieving remission in patients who underwent a This article is an open access article transplant of gut microbiota from healthy people [7]. The majority of the studies to date distributed under the terms and have concerned the analysis of the bacteriobiome in IBD [8–14]. However, owing to the conditions of the Creative Commons recent development of molecular methods, more and more attention is also paid to other Attribution (CC BY) license (https:// microorganisms comprising the normal gut microbiota, i.e. fungi, viruses or archaea. creativecommons.org/licenses/by/ 4.0/).

Pathogens 2021, 10, 1119. https://doi.org/10.3390/pathogens10091119 https://www.mdpi.com/journal/pathogens Pathogens 2021, 10, x FOR PEER REVIEW 2 of 11

Pathogens 2021, 10, 1119 2 of 11 other microorganisms comprising the normal gut microbiota, i.e. fungi, viruses or archaea.

Figure 1.FigureRisk factors 1. Risk for factors CD —Crohn’s for CD — Disease;Crohn’s NOD2—nucleotide-binding Disease; NOD2—nucleotide oligomerization-binding oligomerization domain containing do- 2; CARD15—caspasemain containing recruitment 2; CARD15 domain family,—caspase member recruitment 15; TLR—toll-like domain receptors;family, member OCTN—organic 15; TLR cation—toll transporter;-like re- ATG16L1—autophagy-relatedceptors; OCTN—organic protein 16 cation like 1; transporter; LRRK2—leucine-rich ATG16L1 repeat—autophagy kinase 2; IRGM—immunity-related protein related 16 like GTPase 1; M; STAT3—signalLRRK2— transducerleucine-rich and repeat activator kinase of transcription 2; IRGM— 3;immunity CLEC7A—C-Type related GTPase Lectin Domain M; STAT3 Containing—signal 7A, trans- IFN-γ— interferonducer gamma, and TNF- activatorα—tumor of necrosistranscription factor alpha;3; CLEC7A Th1—Type—C- 1Type helper Lectin T-cells; Domain Th17—T-helper Containing 17 cell, 7A, Il- IFN interleukin.-γ— interferon gamma, TNF-α—tumor necrosis factor alpha; Th1—Type 1 helper T-cells; Th17—T- helper 17 cell, Il- interleukin.Fungi are organisms that belong to the domain Eukaryota. Despite the fact that they are a smaller population in the human microbiota than bacteria, their interactions with Fungi are immuneorganisms cells that or the belong production to the of domain metabolites Eukaryota are relevant. Despite to human the healthfact that and they disease [15]. are a smaller populationThe studies in to datethe human indicate microbiota that the course than of bacteria, CD may betheir associated interactions with thewith impact of mycobiome on GALT (gut-associated lymphoid tissue). The presence of antibodies against immune cells or the production of metabolites are relevant to human health and disease Saccharomyces cerevisiae (ASCA—anti-Saccharomyces cerevisiae antibodies) recognizing cell [15]. The studieswall to mannansdate indicate of yeast that is the a clinical course biomarker of CD may of patients be associated with CD with [16,17 the]. impact of mycobiome on GALTWith regard (gut- toassociated their general lymphoid structure, tissue). archaea The resemble presence bacteria, of antibodies while genetically, against Saccharomycesthey are cerevisiae more closely (ASCA related—anti to eukaryotes.-Saccharomyces They cerevisiaebelong to theantibodies) domain Archaea recog-, among nizing cell wallwhich mannans three of basic yeast groups is a clinical can be distinguished,biomarker of whichpatients are with halophilic, CD [16,17]. methanogenic and With regardthermophilic to their general archaea. structure, Methanogens archaea are the resemble group that bacteria, most frequently while colonizesgenetically, the human they are more closelygastrointestinal related tract. to eukaryotes. The importance They of belong the archaea to the presence domain in the Archaea human, gastrointestinalamong which three basictract groups is not fully can understood.be distinguished, Until now, which strong are emphasis halophilic, has beenmethanogenic placed on studyingand the role of bacteria in the course of CD, while the role of those microorganisms is so far less thermophilic archaea. Methanogens are the group that most frequently colonizes the hu- taken into account by researchers. man gastrointestinalTherefore, tract. The the importance objective of thisof the study archaea was an presence assessment in ofthe the hum prevalencean gastro- of the most intestinal tract commonis not fully representatives understood. of ArchaeaUntil now,and yeaststrong fungi emphasis in children has and been teenagers placed withon CD at studying the roledifferent of bacteria stages ofin thethe disease. course Moreover,of CD, while the number the role of of these those microorganisms microorganisms in individual is so far less takengroups into was account determined. by researchers. Therefore, the objective of this study was an assessment of the prevalence of the most 2. Results common representatives of Archaea and yeast fungi in children and teenagers with CD at 2.1. Characteristics of the Subjects different stages of the disease. Moreover, the number of these microorganisms in individual groups was determined.There were 124 children included in the study: 54 patients with active CD, 37 patients in remission and 33 healthy individuals for the control group. The age of each group of patients was similar: average 13.15 (±2.86) years for patients with active CD vs. 2. Results 12.86 (±3.95) years for patients with non-active CD vs. 11.39 (±3.99) for healthy children 2.1. Characteristics of the Subjects There were 124 children included in the study: 54 patients with active CD, 37 patients in remission and 33 healthy individuals for the control group. The age of each group of

Pathogens 2021, 10, x FOR PEER REVIEW 3 of 11

patients was similar: average 13.15 (±2.86) years for patients with active CD vs. 12.86 (±3.95) years for patients with non-active CD vs. 11.39 (±3.99) for healthy children from Pathogens 2021, 10, 1119 the control group. The group of patients with active CD consisted of 21 girls (39%). In3 ofthe 11 group of patients with non-active CD, there were 17 girls (46%). The control group included 19 girls (58%). The average Pediatric Crohn’s Disease Activity Index (PCDAI) value in the group of patients with active CD amounted to 33.23 pts (±13.30) while in the from the control group. The group of patients with active CD consisted of 21 girls (39%). group of patients in remission, 3.7 pts (±3.65). In the group of patients with non-active CD, there were 17 girls (46%). The control group included 19 girls (58%). The average Pediatric Crohn’s Disease Activity Index (PCDAI) 2.2. Prevalence of Fungi and Archaea in Stool Samples of Controls and Patients with CD value in the group of patients with active CD amounted to 33.23 pts (±13.30) while in the groupThe of presence patients inof remission,fungi and archaea 3.7 pts ( ±were3.65). detected in the stool samples using the Real- Time PCR method. Candida tropicalis-positive samples were more frequent in the group of patients2.2. Prevalence with active of Fungi CD and compared Archaea in to Stool non Samples-active CD of Controls (p = 0.036) and Patientsand control with CDgroup (p = 0.011)The (respectively presence of 60% fungi vs. and 35% archaea vs. 27%). were Similar detected relationships in the stool were samples observed using in thethe Real-case ofTime Methanobrevibacter PCR method. Candida smithii tropicalis-positive(respectively 44% samplesvs. 27% werevs. 36%), more however, frequent inthese the groupchanges of werepatients not with statistically active CD significant compared (p to > non-active0.05). The CDprevalence (p = 0.036) of andMalassezia control spp. group and (p =Crypto- 0.011) coccus(respectively neoformans 60% oscillated vs. 35% vs.at a 27%).similar Similar level in relationships the group of werepatients observed with CD in ( theirrespective case of ofMethanobrevibacter disease activity) and smithii were(respectively slightly higher 44% compared vs. 27% vs. to 36%), the healthy however, control these group changes (Figure were 2),not p statistically > 0.05. The signiﬁcantnumbers of (p Methanospharea> 0.05). The prevalence stadtmanae of-positiveMalassezia samplesspp. and wereCryptococcus similar in theneoformans group ofoscillated children at with a similar active level CD and in the in groupthe control of patients group, with while CD in (irrespective patients with of disease non- activeactivity CD,) and a weresomewhat slightly lower higher prevalence compared of to this the methanogen healthy control was group observed (Figure (Figure2), p >2), 0.05. p > 0.05.The numbers of Methanospharea stadtmanae-positive samples were similar in the group of childrenNegative with activeresults CD were and obtained in the control for all group,negative while controls in patients in the withassay non-active and positive CD, re- a sultssomewhat were found lower prevalencein all positive of thiscontrols. methanogen was observed (Figure2), p > 0.05.

Figure 2. The percentage of p positiveositive samples for the respective archaea and fungi in the examined groups.

2.3. TheNegative Number results of Fungi were Cells obtained in Stool Samples for all negative controls in the assay and positive resultsIn werepositive found samples, in all positivequantitative controls. analysis was carried out in relation to the examined microorganisms.2.3. The Number of The Fungi mean Cells number in Stool [fungal Samples cells/g of stool] of fungi of the genus Malas- sezia was significantly lower in the group of children with active CD compared to the con- In positive samples, quantitative analysis was carried out in relation to the examined trol group (p = 0.005). Whereas, among patients in remission, the number of Malassezia microorganisms. The mean number [fungal cells/g of stool] of fungi of the genus Malassezia spp. cells increased and was significantly higher compared to the number of these fungi was significantly lower in the group of children with active CD compared to the control in the control group (p = 0.020). In regard to the mean numbers of C. tropicalis and C. group (p = 0.005). Whereas, among patients in remission, the number of Malassezia spp. cells neoformans, there were no significant differences between the groups (Figure 3). It was increased and was significantly higher compared to the number of these fungi in the control group (p = 0.020). In regard to the mean numbers of C. tropicalis and C. neoformans, there were no significant differences between the groups (Figure3). It was demonstrated that there is a low positive correlation between C. tropicalis and PCDAI (rho = 0.23; p = 0.031).

Pathogens 2021, 10, x FOR PEER REVIEW 4 of 11

demonstrated that there is a low positive correlation between C. tropicalis and PCDAI (rho Pathogens 2021, 10, 1119 = 0.23; p = 0.031). 4 of 11 demonstrated that there is a low positive correlation between C. tropicalis and PCDAI (rho = 0.23; p = 0.031).

Figure 3. Number (fungal cells/g of stool) of fungi in the examined groups. Figure 3. 3. NumberNumber (fungal (fungal cells/g cells/g of ofstool) stool) of offungi fungi in inthe the examined examined groups groups.. 2.4. Methanogen DNA Concentration in Stool Samples 2.4. Methanogen DNA Concentration in Stool Samples 2.4. MethanogenM. smithii DNADNA Concentration concentration in [pg/µ Stool LSamples DNA in 1g of stool] was higher in the group of M. smithii DNA concentration [pg/µL DNA in 1 g of stool] was higher in the group of childrenM. smithii with DNA active concentration CD compared [pg/µ toL DNA patients in 1g in of remissionstool] was higher or healthy in the individuals;group of children with active CD compared to patients in remission or healthy individuals; however, childrenhowever, with these active changes CD were compared not statistically to patients significant in remission (Figure or healthy4). There individuals; were also no these changes were not statistically signiﬁcant (Figure4). There were also no statistical however,statistical these differences changes concerningwere not statistically the numbers significant of M. (Figure stadtmanae 4). Therebetween were the also groups, no differences concerning the numbers of M. stadtmanae between the groups, although the statisticalalthough differences the amount concerning of methanogens the numbers tended of to M. decrease stadtmanae along between with the the diminishing groups, amount of methanogens tended to decrease along with the diminishing degree of disease althoughdegree of the disease amount activity of methanogens (Figure 4). The tended correlation to decrease between along the number with the of diminishing M. smithii and activity (Figure4). The correlation between the number of M. smithii and PCDAI was degreePCDAI of was disease positive, activity but (Figure only 4).weak The an correlationd close to between statistical the significancenumber of M. (rho smithii = 0.22, and p = positive, but only weak and close to statistical signiﬁcance (rho = 0.22, p = 0.051). PCDAI0.051). was positive, but only weak and close to statistical significance (rho = 0.22, p = 0.051).

FigureFigure 4 4. .4 The.The The number number number (pg/µ (pg/ (pg/µLµ LLin inin 1 g 11 gofg of ofstool) stool)stool) of ofofrespective respectiverespective methanogens methanogensmethanogens in the inin the theexamined examinedexamined groups. groups.groups.

3. Discussion Our study, using real-time PCR, determined the frequency of occurrence and abun- dance of three species of fungi (C. tropicalis, C. neoformans and Malassezia spp.) and two species of methanogenic archaea (M. smithii, M. stadtmanae) in children and adolescents Pathogens 2021, 10, 1119 5 of 11

with CD at different stages of the disease. The results of this study showed that patients in the active phase of the disease were found to demonstrate the presence of C. tropicalis almost 2.5 times more frequently than was the case in the control group. Interestingly, children in remission demonstrated the prevalence of C. tropicalis that was significantly decreased and comparable to the control group (Figure2). The observed changes in the prevalence of C. tropicalis are similar to those in previously published reports. Hoarau et al. [18] also showed a significantly higher incidence of this yeast in the stool of patients with CD. Moreover, the researchers found a positive correlation between its presence and the concentration of ASCA antibodies. Apart from that, they established a link between the presence of C. tropicalis and increased colonization by the bacteria E. coli and Serratia marcescens. More extensive research into the matter revealed that these microorganisms form a thick layer of biofilm strongly adhering to the intestinal epithelium, which may promote an excessive immune response or cause intestinal mucosal barrier dysfunction, contributing to the formation of inflammatory lesions. Additionally, tests in animal models of IBD confirm the observations concerning the participation of C. tropicalis in the induction of the disease. CLEC7A knockout (resulting in a deficiency of the Dectin-1 receptor, which recognizes fungi) mice were characterized by an increased immune reaction in response to supplementation with C. tropicalis fungi. As a result, overproduction of pro-inflammatory cytokines, TNF-α, IFN-γ and IL-17, took place and intensification of inflammatory changes in the intestines followed [19]. Similar relationships were observed in the rat model of the disease. The rodents with colitis induced by the administration of trinitrobenzenesulfonic (TNBS) acid exhibited intensification of the inflammatory changes and increased synthesis of IL-1β and TNF-α, following having been infected with fungi of the genus Candida [20]. Moreover, our previous studies revealed that children with CD in the period of exacerbation of the disease exhibited significantly higher numbers of Candida spp. compared to the healthy control group. Interestingly, after the application of therapy and when the patients entered remission, the numbers of these yeasts decreased significantly [21]. We observed an increased prevalence of C. neoformans and Malassezia spp. in patients with both CD groups (Figure2) compared to the control group; however, these changes were not statistically significant and need further study. There is little data on the participation of fungi of the genus Malassezia and C. neoformans in the course of IBD, but the reports published to date indicate an increased frequency of these species among patients, which is in line with our observations. Limon et al. [22] showed that the species Malassezia restricta was significantly more common in patients with CD than in healthy subjects, and its presence was associated with exacerbation of colitis in mice. While Liguori et al. [23] found that mucosal sections taken from the colon of people suffering from Crohn’s disease exhibited a more frequent occurrence of Malassezia globosa than the biopsies collected from healthy individuals. Furthermore, Li et al. [24] demonstrated differences between biopsies from the same patient, which were collected from inflamed sites vs. sites without evidence of inflammation; C. neoformans and M. restricta were overrepresented in the inflamed mucosa. In the aforementioned studies, only the presence of these species was analyzed, but no quantitative research was performed. In our study, quantitative evaluation showed that the number of fungi of the genus Malassezia was the lowest in the group of patients with newly diagnosed CD, being in the period of active disease. It is different, in patients in remission, who were diagnosed with CD several years prior to recruitment into the study, the number of these yeasts increased significantly (Figure3). Such a trend, reversed in relation to the examination of prevalence, can be explained by the fact that the qualitative analysis did not include the samples that were negative in terms of the presence of the tested microorganisms, which could have influenced the results. On the other hand, this may suggest that quantitative changes within this genus are a secondary effect of the treatment that was administered, chronic inflammation, or the antibiotic therapy applied. As shown in several studies, the employed treatment and/or change in eating habits may significantly affect the changes in the gut mycobiome [21,25–29]. Pathogens 2021, 10, 1119 6 of 11

Data pointing to differences in the gut mycobiome between patients in the active phase of the disease vs. patients in remission (observed in this study as well) suggest that fungal dysbiosis may be involved in inflammation and disease induction, or is the result of chronic inflammation [21,24,25]. It seems interesting that the initial endeavors to support standard therapy with antifungal preparations have so far yielded promising results. Giving the mice an antifungal drug (fluconazole) resulted in alleviating the symptoms of the disease [19], while the application of antifungal drugs in a group of pediatric patients with UC contributed to a significant decrease in the UC activity rate, alleviation of clinical symptoms and improvement of the endoscopic and histological images [20]. Research limited to the participation of archaea in IBD has not yet provided definite results. In our study, we have not observed statistical differences in the predominance of archaea between groups. However, it is worth noting that M. smithii was the most common and most numerous in the group of children with active CD. In turn, in the group of patients in remission the amount of this methanogen DNA decreased (Figure4). Results different from ours were obtained by Scanlan et al [30]. These researchers found that the presence of methanogens is less likely to be found in patients with IBD than in healthy people. Among patients with CD, the number of individuals positive for methanogens oscillated at around 30%, among patients with UC at 24%, while in the healthy control, the presence of methanogens was found in 50% of the examined individuals. Furthermore, Blais-Lecours et al. [31] detected that the species M. smithii was occurring with the same frequency in both the afflicted and healthy people, while the immunogenic species M. stadtmanae was three times more often found in people with IBD. Such varying results probably stem from different ages of the patients under examination. Our study covered children and adolescents up to 18 years of age, while the mean age of patients in the studies mentioned above was >40 years; what is more, they had been suffering from their ailments for many years. Already in the early 1980s, it was established that the production of methane escalates with age, which is later explained by the increase in the prevalence of methanogens in elderly people [32]. Perhaps age is the factor that determines the composition and number of archaea. Whereas the differences detected between patients with IBD and the control group later on result from the impact of the disease, long-term inflammatory process in the gastrointestinal tract, the therapy employed, changes in diet, or are a result of bacterial/fungal dysbiosis, which creates an optimal environment for the development of individual species of archaea. Results similar to ours were reported by Chechoud et al [33], who, similar to this study, took into consideration pediatric patients and did not observe significant differences between the presence of archaea in children with IBD compared to healthy children. Importantly, the investigators demonstrated that archaea were detected much less frequently in children than in adults [33]. These observations seem to confirm the assumptions that the composition of the “archaeobiome” is to a large extent determined by age, while the changes observed in adult patients with IBD are probably a secondary effect of the disease, but not the factor inducing the disease. Perhaps archaea contribute to the reappearance of exacerbations or support inflammation in adult patients; however, on the basis of such a small number of studies and non-optimized detection methods, it is not possible to clearly outline their role in the course of inflammatory bowel diseases. Although there is more and more evidence that autoimmune diseases are a conse- quence of a maladaptive immune system, mediated by the gut microbiota, the specific microbe responsible for the development of IBD has not been determined yet. Numerous studies expose changes concerning the composition of fungi and bacteria in patients with IBD; however, they do not give a clear answer as to whether the observed dysbiosis is a factor inducing the disease in genetically predisposed individuals or if it is only a secondary effect of the disease. The role of archaea is yet unknown, but the observed changes in their composition make one take a broader look at these microorganisms in order to determine their exact role in human health and disease. In conclusion, the results presented above were obtained using the qPCR method, which allows for a precise quantification of selected species of microorganisms. The use Pathogens 2021, 10, 1119 7 of 11

of next-generation sequencing (NGS) would allow for a much more complete taxonomic picture of the mycobiome and archeobiome, but in this work we focused on the species most often described in the literature.

4. Materials and Methods 4.1. Patients Pediatric patients aged 2 to 18 years with confirmed Crohn’s disease were recruited for the study at the University Children’s Hospital in Krakow. The diagnoses were made on the basis of the clinical picture, as well as endoscopic, histopathological and radiological examinations, according to the revised Porto criteria [34]. The study protocol was approved by the Jagiellonian University Bioethics Committee (No. 1072.6120.21.2020) on 23 January 2020. Patients were recruited into two research groups, which were compared to the control group. The first group consisted of children with newly diagnosed CD and disease activity assessed according to the PCDAI score >10 points. The second group included children with previously diagnosed CD who were in clinical remission at the moment of inclusion into the study (PCDAI ≤ 10 points). The inclusion criteria were as follows: age from 2 to 18 years; diagnosis of CD; informed consent to participate in the study signed by the patients’ parents or legal guardians or by the patients themselves if they were over 16 years of age. The exclusion criteria included: lack of an established diagnosis; antibiotic therapy up to 3 months prior to entering the study; the use of probiotic preparations up to 3 months before entering the study; confirmed lactose and gluten intolerance; irritable bowel syndrome; immunodeficiencies and neoplastic diseases. The control group included healthy children, not treated with antibiotics or supplemented with probiotics at least in the 3 months before the start of the study. Volunteers for this group were recruited in a non-hospital setting. All patients with CD had their basic blood count parameters and biochemical examinations determined and, additionally, fecal samples were collected in order to evaluate selected groups of Archaea and yeast fungi. On the basis of the clinical picture and test results, PCDAI was assessed. All biochemical analyses were conducted at the University Children’s Hospital in Krakow. Stool samples were delivered under ultra-low freezing conditions (−80 ◦C) in sterile containers to the Department of Microbiology, Jagiellonian University Medical College, where DNA was isolated and further analyses were carried out.

4.2. DNA Extraction from the Stool Samples The fecal samples were thawed and 150 mg of each material were precisely weighed (to determine the number of microbial cells in 1 g of stool at a subsequent stage). Isolation of fungal and archaeal DNA was carried out using an increased efﬁciency Genomic Mini AX Stool kit (A&A Biotechnology, Gdansk, Poland) along with our previously described modiﬁcation [3,21,25] involving enzymatic lysis with lysozyme (Sigma, Saint Louis, MO, USA), mutanolysin, lyticase (A&A Biotechnology, Gdansk, Poland ) and buffer with β- mercaptoethanol (Sigma, Saint Louis, MO, USA), as well as mechanical lysis using the FastPrep homogenizer (MP Biomedicals, Irvine, CA, USA).

4.3. Quantitative Real-Time PCR (qPCR): The samples obtained through the isolation process were tested for the presence of the following fungi: Malassezia spp., C. tropicalis, and C. neoformans, and two methanogenic species of archaea: M. stadtmanae and M. smithii. These particular species were selected as they were frequently found in fecal samples and due to their representativeness as well as the possibility to make references to the work of other researchers. Detection was conducted using TaqMan probes with the FAM reporter dye (Genomed, Warszawa, Poland). The composition of the reaction mixture was as follows: 2 µL DNA, 5 µL Real- Time PCR Mix Probe (A&A Biotechnology, Gdansk, Poland), 0.2 µL primers each (20 mM, Genomed, Warsaw, Poland), 0.6 µL TaqMan probe (10 mM, Genomed, Warsaw, Poland), 2 µL water (A&A Biotechnology, Gdansk, Poland). The probe and primer sequences Pathogens 2021, 10, x FOR PEER REVIEW 8 of 11

species of archaea: M. stadtmanae and M. smithii. These particular species were selected as they were frequently found in fecal samples and due to their representativeness as well as the possibility to make references to the work of other researchers. Detection was conducted using TaqMan probes with the FAM reporter dye (Genomed, Warszawa, Poland). The composition of the reaction mixture was as follows: 2 μL DNA, 5 μL Real-Time PCR Mix Probe (A&A Biotechnology, Gdansk, Poland), 0.2 μL primers each (20 mM, Genomed, Pathogens 2021Warsaw,, 10, 1119 Poland), 0.6 μL TaqMan probe (10 mM, Genomed, Warsaw, Poland), 2 μL water 8 of 11 (A&A Biotechnology, Gdansk, Poland). The probe and primer sequences used are summarized in Table 1. After preparing the reaction mixture, the samples were transferred into optical strips dedicated to CFX96 thermal cycler (BioRad, Hercules, CA, USA). All used are summarized in Table1. After preparing the reaction mixture, the samples were DNA samples weretransferred tested in into duplicate. optical strips The dedicatedreactions towere CFX96 supplemented thermal cycler with (BioRad, negative Hercules, CA, control containingUSA). water All instead DNA samples of DNA were and tested positive in duplicate. control containing The reactions the were DNA supplemented of the with appropriate referencenegative strain control of the containing species waterstudied instead (M. offurfur DNA ATCC and positive 14521, controlC. tropicalis containing the ATCC 13803, C. neoformansDNA of the ATCC appropriate 204092, reference M. smithii strain DSM of the861, species M. stadtmanae studied ( M.DSM furfur 3091).ATCC 14521, The reactions wereC. tropicalisconductedATCC in accordance 13803, C. neoformans with theATCC thermal 204092, programsM. smithii setDSM out in 861, TableM. stadtmanae 1. The point at whichDSM 3091).the amplification The reactions signal were conductedwas read inwas accordance the reaction with cycle the thermal in which programs set the product growthout reached in Table1 the. The established point at which cycle the threshold ampliﬁcation (Ct) cutoff. signal wasStandard read wascurves the reaction cycle in which the product growth reached the established cycle threshold (Ct) cutoff. were generated from 10-fold serial dilutions (101 to 107 CFU/mL—Colony Forming Standard curves were generated from 10-fold serial dilutions (101 to 107 CFU/mL—Colony Unit/mL) of everyForming reference Unit/mL) strain of everyfungi referenceand from strain 10-fold of fungi serial and dilutions from 10-fold of reference serial dilutions of archaeal DNA. Withreference the established archaeal DNA. Ct Withpoint the on established the standard Ct point curve, on the standardnumbers curve, of par- the numbers ticular microorganismsof particular or their microorganisms DNA concentrations or their DNAwere concentrationscalculated in positive were calculated samples in positive (Figure 5). samples (Figure5).

FigureFigure 5. Standard 5. Standard curves generatedcurves generated from known from numbers known numbers for respective for respective microorganisms: microorganisms: (A)—C. tropicalis (A)—,(C.B )—C. tropicalis, (B)—C. neoformans, (C)—Malassezia spp., (D)—M. smithii, (E)—M. stadtmanae. Pathogens 2021neoformans, 10, x FOR,(C PEER)—Malassezia REVIEW spp., (D)—M. smithii,(E)—M. stadtmanae. 9 of 11 Pathogens 20212021,, 1010,, xx FORFOR PEERPEER REVIEWREVIEW 99 ofof 1111

Table 1. Real-time PCRTable primer/probe 1. Real-time PCRsequences primer/probe and PCR sequences parameters and PCRfor detecting parameters respective for detecting microorganisms. respective microorganisms.

0 0 Primer and ProbePrimer and Probe Sequence (5Sequence′ to 3′) (5 to 3 )Thermal Thermal Cycling Cycling Programme Programme References References Primer and Probe Sequence (5′′ toto 33′′)) Thermal Cycling Programme References C. tropicalis 2 min at 50 °C C. tropicalis GCGGTAGGAGAATTGCGTT 2 min at 50 °C C. tropicalisC. tropicalis GCGGTAGGAGAATTGCGTTGCGGTAGGAGAATTGCGTT 2 min at 50 °C Forward primer GCGGTAGGAGAATTGCGTTTCATTATGCCAACATCCTAGGTTTA 10 min at 95 °C Forward primerForward primer TCATTATGCCAACATCCTAGGTTTA 10 min at 95 °C [35] [35] TCATTATGCCAACATCCTAGGTTTA6-FAM-CGCAGTCCTCAGTCTAGGCTGGCAG- [35] Reverse primerReverse primerProbeTCATTATGCCAACATCCTAGGTTTA 15 s at 95 °C [35] Reverse primer 6-FAM-CGCAGTCCTCAGTCTAGGCTGGCAGBHQ-1 -BHQ-1 15 s at 95 °C 45× Probe 6--FAM--CGCAGTCCTCAGTCTAGGCTGGCAG--BHQ--1 1 min at 60 °C 45× Probe 1 min at 60 °C C. neoformans 2 min at 50 °C C. neoformans GCCGCGACCTGCAAAG 2 min at 50 °C Forward primerC. neoformans GCCGCGACCTGCAAAGGCCGCGACCTGCAAAG 10 min at 95 °C Forward primer GGTAATCACCTTCCCACTAACACAT 10 min at 95 °C [36] Reverse primerForward primer GGTAATCACCTTCCCACTAACACATGGTAATCACCTTCCCACTAACACAT 15 s at 95 °C [36][36] [ 36] Reverse primerReverse primerProbe 6-FAM-ACGTCGGCTCGCC6-FAM-ACGTCGGCTCGCC-BHQ-1-BHQ-1 15 s at 95 °C 4545×× Probe 6--FAM--ACGTCGGCTCGCC--BHQ--1 1 min at 60 °C 45× Probe 1 min at 60 °C Malassezia spp. 2 min at 94 °C Malassezia spp. GTAGACTCCATCTAAAGCTAAAT 2 min at 94 °C Forward primer GTAGACTCCATCTAAAGCTAAAT 20 s at 94 °C Forward primerMalassezia spp. CTTTTAACTCTCTTTCCAAAGTGTAGACTCCATCTAAAGCTAAAT 20 s at 94 °C [37] Reverse primerForward primer CTTTTAACTCTCTTTCCAAAGTCTTTTAACTCTCTTTCCAAAGT 20 s at 50 °C 45× [37][37] [ 37] Reverse primer 6-FAM-CCCTCACGGTACTTGTTCGCT-BHQ-1 20 s at 50 °C 45× ProbeReverse primerProbe6--FAM--CCCTCACGGTACTTGTTCGCT6-FAM-CCCTCACGGTACTTGTTCGCT-BHQ-1--BHQ--1 30 s at 60 °C Probe 30 s at 60 °C M. smithii M. smithii CCGGGTATCTAATCCGGTTC 15 min at 95 °C Forward primer CCGGGTATCTAATCCGGTTC 15 min at 95 °C Forward primer CTCCCAGGGTAGAGGTGAAA 30 s at 95 °C [38] Reverse primer CTCCCAGGGTAGAGGTGAAA 30 s at 95 °C 45× [38][38] Reverse primer 6-FAM-CCGTCAGAATCGTTCCAGTCAG-BHQ-1 1 min at 60 °C 45× Probe 6--FAM--CCGTCAGAATCGTTCCAGTCAG--BHQ--1 1 min at 60 °C Probe M. stadtmanae M. stadtmanae AGGAGCGACAGCAGAATGAT 15 min at 95 °C Forward primer AGGAGCGACAGCAGAATGAT 15 min at 95 °C Forward primer CAGGACGCTTCACAGTACGA 30 s at 95 °C [38] Reverse primer CAGGACGCTTCACAGTACGA 30 s at 95 °C 4545×× [38][38] Reverse primer 6-FAM-TGAGAGGAGGTGCATGGCCG-BHQ-1 1 min at 60 °C 45× Probe 6--FAM--TGAGAGGAGGTGCATGGCCG--BHQ--1 1 min at 60 °C Probe 4.4. Statistical Analysis 4.4. Statistical Analysis Analyses of nominal variables were performed using the Chi square test. The Krus- Analyses of nominal variables were performed using the Chi square test. The Krus- kal–Wallis test was applied to compare the numbers of fungal and archaeal cells in all kal–Wallis test was applied to compare the numbers of fungal and archaeal cells in all groups under study. In order to determine the significance between particular groups, a groups under study. In order to determine the significance between particular groups, a post-hoc test of multiple comparisons of mean ranks was used for all groups. The result post--hoc test of multiple comparisons of mean ranks was used for all groups. The result was deemed statistically significant when p < 0.05. Correlation between the variables was was deemed statistically significant when p < 0.05. Correlation between the variables was assessed using the Spearman’s rank correlation coefficient. All statistical analyses were assessed using the Spearman’s rank correlation coefficient. All statistical analyseslyses werewere carried out using the Statistica 13.3 software (StatSoft Inc., Tulsa, OK, USA). carriedcarried outout usingusing thethe StatisticaStatistica 13.313.3 softwaresoftware (StatSoft(StatSoft Inc.,Inc., Tulsa,Tulsa, OOK,, USA).USA). Author Contributions: Conceptualization, A.K., D.S., T.G.; methodology, A.K., D.S., T.B., T.G.; val- Author Contributions: Conceptualization, A.K..,, D.S.,D.S., T.G.;T.G.; methodology,methodology, A.K.,A.K., D.SD.S..,, T.BT.B..,, T.G.;T.G.; val-validation, D.S., T.G.; formal analysis, A.K., D.S., K.K.-D., T.G.; investigation, A.K.; resources, D.S., idation,idation, D.S., D.S., T.G.; T.G.; formal formal analysis, analysis, A.K.,A.K., D.S D.S..,, K.K K.K..--D., T.G.; investigation, A.K..;; resources, resources, D.S., D.S., K.K.-D., T.G.; data curation, T.G.; writing—original draft preparation, A.K; writing—review and K.K..--D., T.G.; data curation, T.G.; writing—original draft preparation, A.K; writing—reviewreview andand editing, D.S., K.K.-D., T.B., T.G.; visualization, A.K.; supervision, D.S., T.G.; project administration, editing,editing, D.SD.S..,, K.KK.K..--D., T.B.,, T.G.; visualization, A.K.; supervision, D.S.,, T.G.; project administration, A.K., D.S., T.G.; funding acquisition, A.K. All authors have read and agreed to the published version A.K.,, D.S..,, T.GT.G..;; fundingfunding acquisition,acquisition, A.K.A.K. AllAll authorsauthors havehave readread andand agreedagreed toto thethe publishedpublished versionversion of the manuscript. of the manuscript. Funding: This research was funded by the National Science Center in Poland, grant number Funding: This research was funded by the National Science Center in Poland, grant number 2019/33/N/NZ5/00698. 2019/33/N/NZ5/00698.2019/33/N/NZ5/00698. Institutional Review Board Statement: The study was approved by the Jagiellonian University Bi- InstitutionalInstitutional ReviewReview BoardBoard Statement:Statement: The studystudy waswas approvedapproved byby thethe JagiellonianJagiellonian UniversityUniversity Bi-Bi- oethics Committee (No. 1072.6120.21.2020) on 23 January 2020. oethics Committee (No. 1072.6120.21.2020) on 2323 JanuaryJanuary 2020.2020. Informed Consent Statement: Informed consent was obtained from all subjects involved in the InformedInformed Consent Consent Statement: Statement: InformedInformed consent consent was was obtained obtained from from all all subjects subjects involved involved in in thethe study. study.study. Data Availability Statement: The data presented in this study are not publicly available as a matter Data Availability Statement: The data presented in this study are not publicly available as a matter of confidentiality. However, these data are available upon request from the corresponding author. of confidentiality. However, these data are available upon request from the corresponding author. Acknowledgments: Language translation: Catherine Ridgetile; Statistical analysis: Kamil Drozdz. Acknowledgments: Language translation: Catherine Ridgetile; Statistical analysis: Kamil Drozdz. Conflicts of Interest: The authors declare no conflict of interest. Conflicts of Interest: The authors declare no conflict of interest. References References 1. Khanna, S.; Raffals, L.E. The Microbiome in Crohn’s Disease: Role in Pathogenesis and Role of Microbiome Replacement Ther- 1.1. Khanna, S.; Raffals, L.E. The Microbiome in Crohn’’ss Disease:Disease: RoleRole inin PathogenesisPathogenesis andand RoleRole ofof MicrobiomeMicrobiome ReplacementReplacement Ther-Ther- apies. Gastroenterol. Clin. N. Am. 2017, 46, 481–492. apies.apies. Gastroenterol. Clin. N. Am. 20172017,, 4646,, 481481––492.492.

Pathogens 2021, 10, x FOR PEER REVIEW 9 of 11 Pathogens 2021, 10, x FOR PEER REVIEW 9 of 11

Primer and Probe Sequence (5′ to 3′) Thermal Cycling Programme References PrimerC. tropicalis and Probe Sequence (5′ to 3′) Thermal2 Cycling min at 50 Programme °C References C. tropicalis GCGGTAGGAGAATTGCGTT 2 min at 50 °C Forward primer GCGGTAGGAGAATTGCGTT 10 min at 95 °C Forward primer TCATTATGCCAACATCCTAGGTTTA 10 min at 95 °C [35] Reverse primer TCATTATGCCAACATCCTAGGTTTA 15 s at 95 °C [35] Reverse primer 6-FAM-CGCAGTCCTCAGTCTAGGCTGGCAG-BHQ-1 15 s at 95 °C 45× Probe 6-FAM-CGCAGTCCTCAGTCTAGGCTGGCAG-BHQ-1 1 min at 60 °C 45× C. neoformansProbe 12 minmin atat 6050 °C°C C. neoformans GCCGCGACCTGCAAAG 2 min at 50 °C Forward primer GCCGCGACCTGCAAAG 10 min at 95 °C Forward primer GGTAATCACCTTCCCACTAACACAT 10 min at 95 °C [36] Reverse primer GGTAATCACCTTCCCACTAACACAT 15 s at 95 °C [36] Reverse primer 6-FAM-ACGTCGGCTCGCC-BHQ-1 15 s at 95 °C 45× PathogensProbe2021 , 10, 1119 6-FAM-ACGTCGGCTCGCC-BHQ-1 1 min at 60 °C 45× 9 of 11 MalasseziaProbe spp. 12 minmin atat 6094 °C°C Malassezia spp. GTAGACTCCATCTAAAGCTAAAT 2 min at 94 °C Forward primer GTAGACTCCATCTAAAGCTAAAT 20 s at 94 °C Forward primer CTTTTAACTCTCTTTCCAAAGT 20 s at 94 °C [37] Reverse primer CTTTTAACTCTCTTTCCAAAGT 20 s at 50 °C 45× [37] Reverse primer 6-FAM-CCCTCACGGTACTTGTTCGCTTable 1.-BHQCont.-1 20 s at 50 °C 45× Probe 6-FAM-CCCTCACGGTACTTGTTCGCT-BHQ-1 30 s at 60 °C M.Probe smithii Primer and Probe Sequence (50 to 30) Thermal30 s at Cycling 60 °C Programme References M. smithii CCGGGTATCTAATCCGGTTC 15 min at 95 °C Forward primer CCGGGTATCTAATCCGGTTC 15 min at 95 °C Forward primerM. smithii CTCCCAGGGTAGAGGTGAAACCGGGTATCTAATCCGGTTC 30 s at 95 °C [38] Reverse primerForward primer CTCCCAGGGTAGAGGTGAAACTCCCAGGGTAGAGGTGAAA 30 s at 95 °C 45× [38] [38] Reverse primer 6-FAM-CCGTCAGAATCGTTCCAGTCAG-BHQ-1 1 min at 60 °C 45× ProbeReverse primerProbe6-FAM-CCGTCAGAATCGTTCCAGTCAG6-FAM-CCGTCAGAATCGTTCCAGTCAG-BHQ-1-BHQ-1 1 min at 60 °C M. stadtmanaeProbe M. stadtmanaeM. stadtmanae AGGAGCGACAGCAGAATGATAGGAGCGACAGCAGAATGAT 15 min at 95 °C Forward primer AGGAGCGACAGCAGAATGAT 15 min at 95 °C Forward primerForward primer CAGGACGCTTCACAGTACGACAGGACGCTTCACAGTACGA 30 s at 95 °C 45× [38][ 38] Reverse primerReverse primerProbe CAGGACGCTTCACAGTACGA6-FAM-TGAGAGGAGGTGCATGGCCG-BHQ-1 30 s at 95 °C [38] Reverse primer 6-FAM-TGAGAGGAGGTGCATGGCCG-BHQ-1 1 min at 60 °C 45× Probe 6-FAM-TGAGAGGAGGTGCATGGCCG-BHQ-1 1 min at 60 °C Probe 4.4. 4.4.Statistical Statistical Analysis Analysis 4.4. Statistical Analysis AnalysesAnalyses of nominal of nominal variables variables were were performed performed using using the the Chi Chi square square test. test. The The Krus- Kruskal– kal–WallisWallisAnalyses testtest of was was nominal applied applied variables to to compare compare were the performedthe numbers numbers ofusing fungalof fungal the andChi and archaealsquare archaeal test. cells Thecells in allKrus- in groupsall kalgroups–Wallisunder under study.test study. was In orderapplied In order to determineto to compare determine the the significance the numbers significance of between fungal between particularand archaealparticular groups, cells groups, ain post-hoc all a groupsposttest-hoc under of test multiple ofstudy. multiple comparisons In order comparisons to ofdetermine mean of ranks mean the was significanceranks used was for used allbetween groups. for all particular Thegroups. result Thegroups, was result deemed a pwasoststatistically- deemedhoc test ofstatistically significantmultiple comparisonssignificant when p < 0.05.when of Correlationmean p < 0.05. ranks Correlation between was used the between for variables all groups. the was variables assessedThe result was using wasassessed thedeemed Spearman’s using statistically the Spearman’s rank significant correlation rank when coefficient. correlation p < 0.05. All coefficient. Correlation statistical All analyses between statistical were the anavariables carriedlyses out werewas using assessedcarriedthe Statisticaout using using the 13.3the Spearman’s Statistica software (StatSoft13.3rank software correlation Inc., Tulsa,(StatSoft coefficient. OK, Inc., USA). Tulsa, All statistical OK, USA). ana lyses were carried out using the Statistica 13.3 software (StatSoft Inc., Tulsa, OK, USA). Author Contributions: Conceptualization, A.K., D.S., T.G.; methodology, A.K., D.S., T.B., T.G.; val- Author Contributions: Conceptualization, A.K., D.S., T.G.; methodology, A.K., D.S., T.B., T.G.; Authoridation, Contributions: D.S., T.G.; formal Conceptualization, analysis, A.K., A.K D.S..,, K.KD.S.,.- D.,T.G.; T.G.; methodology, investigation, A.K., A.K D.S.; ., resources, T.B., T.G.; D.S.,val- validation, D.S., T.G.; formal analysis, A.K., D.S., K.K.-D., T.G.; investigation, A.K.; resources, D.S., idation,K.K.-D., D.S.,T.G.; T.G.;data formalcuration, analysis, T.G.; writing A.K., D.S—original., K.K.- D.,draft T.G.; preparation, investigation, A.K; A.Kwriting.; resources,—review D.S., and K.K.-D., T.G.; data curation, T.G.; writing—original draft preparation, A.K; writing—review and K.Kediting,.-D., D.ST.G.;., K.Kdata.- D.,curation, T.B., T.G.; T.G.; visualization, writing—original A.K.; supervision,draft preparation, D.S., T.G.; A.K; project writing administration,—review and editing, D.S., K.K.-D., T.B., T.G.; visualization, A.K.; supervision, D.S., T.G.; project administration, editing,A.K., D.S D.S., T.G., K.K.; funding.-D., T.B. acquisition,, T.G.; visualization, A.K. All authors A.K.; supervision, have read and D.S. agreed, T.G.; to project the published administration, version A.K., D.S., T.G.; funding acquisition, A.K. All authors have read and agreed to the published version A.K.of the, D.S manuscript.., T.G.; funding acquisition, A.K. All authors have read and agreed to the published version of theof manuscript. the manuscript. Funding: This research was funded by the National Science Center in Poland, grant number Funding: Funding:2019/33/N/NZ5/00698. This This research research was wasfunded funded by the by National the National Science Science Center Center in Poland, in Poland, grant grant number number 2019/33/N/NZ5/00698.2019/33/N/NZ5/00698. Institutional Review Board Statement: The study was approved by the Jagiellonian University Bi- InstitutionaloethicsInstitutional Committee Review Review (No. Board 1072.6120.21.2020) Board Statement: Statement: The on studyThe 23 January studywas approved was 2020. approved by the Jagiellonian by the Jagiellonian University University Bi- oethicsBioethics Committee Committee (No. 1072.6120.21.2020) (No. 1072.6120.21.2020) on 23 January on 23 January 2020. 2020. Informed Consent Statement: Informed consent was obtained from all subjects involved in the Informedstudy.Informed Consent Consent Statement: Statement: InformedInformed consent consent was was obtained obtained from from all subjects all subjects involved involved in the in the study.study. Data Availability Statement: The data presented in this study are not publicly available as a matter Dataof confidentiality.Data Availability Availability Statement:However, Statement: these The data Thedata datapresented are available presented in this upon in study this request study are not from are publicly not the publicly corresponding available available as a author. matter as a matter of confidentiality.of confidentiality. However, However, these these data dataare available are available upon upon request request from from the corresponding the corresponding author. author. Acknowledgments: Language translation: Catherine Ridgetile; Statistical analysis: Kamil Drozdz. Acknowledgments:Acknowledgments: LanguageLanguage translation: translation: Catherine Catherine Ridgetile; Ridgetile; Statistical Statistical analysis: analysis: Kamil Kamil Drozdz. Drozdz. Conflicts of Interest: The authors declare no conflict of interest. ConflictsConflicts of Interest: of Interest: The authorsThe authors declare declare no conflict no conflict of interest. of interest. References ReferencesReferences 1. Khanna, S.; Raffals, L.E. The Microbiome in Crohn’s Disease: Role in Pathogenesis and Role of Microbiome Replacement Ther- 1. Khanna, S.; Raffals, L.E. The Microbiome in Crohn’s Disease: Role in Pathogenesis and Role of Microbiome Replacement 1. Khanna,apies. Gastroenterol. S.; Raffals, L.E.Clin. The N. Am.Microbiome 2017, 46 ,in 481 Crohn–492.’ s Disease: Role in Pathogenesis and Role of Microbiome Replacement Ther- apies.Therapies. Gastroenterol.Gastroenterol. Clin. N. Am. Clin. 2017 N., Am. 46, 4812017–492., 46, 481–492. [CrossRef][PubMed] 2. Kowalska-Duplaga, K.; Gosiewski, T.; Kapusta, P.; Sroka-Oleksiak, A.; W˛edrychowicz, A.; Pieczarkowski, S.; Ludwig- Słomczyńska,A.H.; Wołkow, P.P.; Fyderek, K. Differences in the intestinal microbiome of healthy children and patients with newly diagnosed Crohn’s disease. Sci. Rep. 2019, 9, 18880. [CrossRef] 3. Salamon, D.; Gosiewski, T.; Krawczyk, A.; Sroka-Oleksiak, A.; Duplaga, M.; Fyderek, K.; Kowalska-Duplaga, K. Quantitative changes in selected bacteria in the stool during the treatment of Crohn’s disease. Adv. Med. Sci. 2020, 65, 348–353. [CrossRef] 4. Matricon, J.; Barnich, N.; Ardid, D. Immunopathogenesis of Inflammatory Bowel Disease. Self Nonself 2010, 1, 299–309. [CrossRef] [PubMed] 5. Sartor, R.B. Therapeutic manipulation of the enteric microflora in inflammatory bowel disease: Antibiotics, probiotics and prebiotics. Gastroenterology 2004, 126, 1620–1633. [CrossRef][PubMed] 6. Radwan, P.; Radwan-Kwiatek, K.; Skrzydło-Radomańska,B. The role of enteric microflora in inflammatory bowel disease. Gastroenterol. Rev. 2009, 4, 1–6. 7. Wang, A.Y.; Popov, J.; Pai, N. Fecal microbial transplant for the treatment of pediatric inflammatory bowel disease. Word J. Gastroenterol. 2016, 22, 10304–10315. [CrossRef] Pathogens 2021, 10, 1119 10 of 11

8. Rabizadeh, S.; Rhee, K.J.; Wu, S.; Huso, D.; Gan, C.M.; Golub, J.E.; Wu, X.; Zhang, M.; Sears, C.L. Enterotoxigenic Bacteroides fragilis: A potential instigator of colitis. Inflamm. Bowel Dis. 2007, 13, 1475–1483. [CrossRef] 9. McNees, A.L.; Markesich, D.; Zayyani, N.R.; Graham, D.Y. Mycobacterium paratuberculosis as a cause of Crohn’s disease. Expert. Rev. Gastroenterol. Hepatol. 2015, 9, 1523–1534. [CrossRef] 10. Jeyanathan, M.; Boutros-Tadros, O.; Radhi, J.; Semret, M.; Bitton, A.; Behr, M.A. Visualization of Mycobacterium avium in Crohn’s tissue by oil-immersion microscopy. Microbes Infect. 2007, 9, 1567–1573. [CrossRef][PubMed] 11. Zhang, L.; Man, S.M.; Day, A.S.; Leach, S.T.; Lemberg, D.A.; Dutt, S.; Stormon, M.; Otley, A.; O’Loughlin, E.V.; Magoffin, A.; et al. Detection and isolation of Campylobacter species other than C. jejuni from children with Crohn’s disease. J. Clin. Microbiol. 2009, 47, 453–455. [CrossRef] 12. Kaakoush, N.O.; Mitchell, H.M. Campylobacter concisus—A new player in intestinal disease. Front. Cell. Infect. Microbiol. 2012, 2, 4. [CrossRef][PubMed] 13. Miquel, S.; Peyretaillade, E.; Claret, L.; de Vallée, A.; Dossat, C.; Vacherie, B.; Zineb, E.; Segurens, B.; Barbe, V.; Sauvanet, P.; et al. Complete genome sequence of Crohn’s disease-associated adherent-invasive E. coli strain LF82. PLoS ONE 2010, 5, e12714. [CrossRef] 14. Martinez-Medina, M.; Aldeguer, X.; Lopez-Siles, M.; González-Huix, F.; López-Oliu, C.; Dahbi, G.; Blanco, J.E.; Blanco, J.; Garcia- Gil, L.J.; Darfeuille-Michaud, A. Molecular diversity of Escherichia coli in the human gut: New ecological evidence supporting the role of adherent-invasive E. coli (AIEC) in Crohn’s disease. Inflamm. Bowel Dis. 2009, 15, 872–882. [CrossRef] 15. Underhill, D.M.; Iliev, I.D. The mycobiota: Interactions between commensal fungi and the host immune system. Nat. Rev. Immunol. 2014, 14, 405–416. [CrossRef] 16. Joossens, S.; Reinisch, W.; Vermeire, S.; Sendid, B.; Poulain, D.; Peeters, M.; Geboes, K.; Bossuyt, X.; Vandewalle, P.; Oberhuber, G.; et al. The value of serologic markers in indeterminate colitis: A prospective follow-up study. Gastroenterology 2002, 122, 1242–1247. [CrossRef] 17. Reese, G.E.; Constantinides, V.A.; Simillis, C.; Darzi, A.W.; Orchard, T.R.; Fazio, V.W.; Tekkis, P.P. Diagnostic precision of anti-Saccharomyces cerevisiae antibodies and perinuclear antineutrophil cytoplasmic antibodies in inflammatory bowel disease. Am. J. Gastroenterol. 2006, 101, 2410–2422. [CrossRef] 18. Hoarau, G.; Mukherjee, K.; Gower-Rousseau, C.; Hager, C.; Chandra, J.; Retuerto, M.A.; Neut, C.; Vermeire, S.; Clemente, J.; Colombel, J.F.; et al. Bacteriome and Mycobiome Interactions Underscore Microbial Dysbiosis in Familial Crohn’s Disease. Mbio 2016, 7, e01250-16. [CrossRef][PubMed] 19. Iliev, I.D.; Funari, V.A.; Taylor, K.D.; Nguyen, Q.; Reyes, C.N.; Strom, S.P.; Brown, J.; Becker, C.A.; Fleshner, P.R.; Dubinsky, M.; et al. Interactions between commensal fungi and the C-type lectin receptor Dectin-1 influence colitis. Science 2012, 336, 1314–1317. [CrossRef][PubMed] 20. Zwolinska-Wcislo, M.; Brzozowski, T.; Budak, A.; Kwiecień,S.; Sliwowski, Z.; Drozdowicz, D.; Trojanowska, D.; Rudnicka-Sosin, L.; Mach, T.; Konturek, S.J.; et al. Effect of Candida colonization on human ulcerative colitis and the healing of inflammatory changes of the colon in the experimental model of colitis ulcerosa. J. Physiol. Pharmacol. 2009, 60, 107–118. 21. Krawczyk, A.; Sroka-Oleksiak, A.; Kowalska-Duplaga, K.; Fyderek, K.; Gosiewski, T.; Salamon, D. Impact of biological treatment on intestinal microbiome in children with Crohn’s disease. World Sci. News 2018, 104, 252–263. 22. Limon, J.J.; Tang, J.; Li, D.; Wolf, A.J.; Michelsen, K.S.; Funari, V.; Gargus, M.; Nguyen, C.; Sharma, P.; Maymi, V.I.; et al. Malassezia Is Associated with Crohn’s Disease and Exacerbates Colitis in Mouse Models. Cell Host Microbe 2019, 25, 377–388. [CrossRef] 23. Liguori, G.; Lamas, B.; Richard, M.L.; Brandi, G.; da Costa, G.; Hoffmann, T.W.; Di Simone, M.P.; Calabrese, C.; Poggioli, G.; Langella, P.; et al. Fungal Dysbiosis in Mucosa-associated Microbiota of Crohn’s Disease Patients. J. Crohn’s Colitis 2016, 10, 296–305. [CrossRef] 24. Li, Q.; Wang, C.; Tang, C.; He, Q.; Li, N.; Li, J. Dysbiosis of gut fungal microbiota is associated with mucosal inflammation in Crohn’s disease. J. Clin. Gastroenterol. 2014, 48, 513–523. [CrossRef] 25. Kowalska-Duplaga, K.; Krawczyk, A.; Sroka-Oleksiak, A.; Salamon, D.; W˛edrychowicz,A.; Fyderek, K.; Gosiewski, T. Dependence of Colonization of the Large Intestine by Candida on the Treatment of Crohn’s Disease. Pol. J. Microbiol. 2019, 68, 121–126. [CrossRef][PubMed] 26. Lewis, J.D.; Chen, E.Z.; Baldassano, R.N.; Otley, A.R.; Griffiths, A.M.; Lee, D.; Bittinger, K.; Bailey, A.; Friedman, E.S.; Hoffmann, C.; et al. Inflammation, Antibiotics, and Diet as Environmental Stressors of the Gut Microbiome in Pediatric Crohn’s Disease. Cell Host Microbe 2015, 18, 489–500. [CrossRef] 27. Stamatiades, G.A.; Ioannou, P.; Petrikkos, G.; Tsioutis, C. Fungal infections in patients with inflammatory bowel disease: A systematic review. Mycoses 2018, 61, 366–376. [CrossRef] 28. Lam, S.; Zuo, T.; Ho, M.; Chan, F.K.L.; Chan, P.K.S.; Ng, S.C. Review article: Fungal alterations in inflammatory bowel diseases. Aliment Pharmacol. Ther. 2019, 50, 1159–1171. [CrossRef][PubMed] 29. Gevers, D.; Kugathasan, S.; Denson, L.A.; Vázquez-Baeza, Y.; Van Treuren, W.; Ren, B.; Schwager, E.; Knights, D.; Song, S.J.; Yassour, M.; et al. The treatment-naive microbiome in new-onset Crohn’s disease. Cell Host Microbe 2014, 15, 382–392. [CrossRef] [PubMed] 30. Scanlan, P.D.; Shanahan, F.; Marchesi, J.R. Human methanogen diversity and incidence in healthy and diseased colonic groups using mcrA gene analysis. BMC Microbiol. 2008, 8, 79. [CrossRef] Pathogens 2021, 10, 1119 11 of 11

31. Blais-Lecours, P.; Marsolais, D.; Berberi, M.; Hache, C.; Bourdages, R.; Duchaine, C. Increased Prevalence of Methanosphaera stadtmanae in Inflammatory Bowel Diseases. PLoS ONE 2014, 9, e87734. [CrossRef][PubMed] 32. Peled, Y.; Gilat, T.; Liberman, E.; Bujanover, Y.J. The development of methane production in childhood and adolescence. Pediatr. Gastroenterol. Nutr. 1985, 4, 575–579. [CrossRef][PubMed] 33. Chehoud, C.; Albenberg, L.G.; Judge, C.; Hoffmann, C.; Grunberg, S.; Bittinger, K.; Baldassano, R.N.; Lewis, J.D.; Bushman, F.D.; Wu, G.D. Fungal Signature in the Gut Microbiota of Pediatric Patients With Inflammatory Bowel Disease. Inflamm. Bowel Dis. 2015, 21, 1948–1956. [CrossRef] 34. Levine, A.; Koletzko, S.; Turner, D.; Escher, J.C.; Cucchiara, S.; de Ridder, L.; Kolho, K.L.; Veres, G.; Russell, R.K.; Paerregaard, A.; et al. European Society of Pediatric Gastroenterology, Hepatology, and Nutrition. J. Pediatr. Gastroenterol. Nutr. 2014, 58, 795–806. [CrossRef][PubMed] 35. Brinkman, N.E.; Haugland, R.A.; Wymer, L.J.; Byappanahalli, M.; Whitman, R.L.; Vesper, S.J. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water. Appl. Environ. Microbiol. 2003, 69, 1775–1782. [CrossRef][PubMed] 36. Veron, V.; Simon, S.; Blanchet, D.; Aznar, C. Real-time polymerase chain reaction detection of Cryptococcus neoformans and Cryptococcus gattii in human samples. Diagn. Microbiol. Infect. Dis. 2009, 65, 69–72. [CrossRef] 37. Xie, Z.; Ran, Y.; Zhang, H.; Zhang, M.; Wan, H.; Li, C. An analysis of the Malassezia species distribution in the skin of patients with pityriasis versicolor in Chengdu, China. Sci. World J. 2014, 182596. 38. Dridi, B.; Henry, M.; El Khéchine, A.; Raoult, D.; Drancourt, M. High prevalence of Methanobrevibacter smithii and Methanosphaera stadtmanae detected in the human gut using an improved DNA detection protocol. PLoS ONE 2009, 4, e7063. [CrossRef]