The Role of Neurotrophic Factors in Autism T Nickl-Jockschat and TM Michel Department of Psychiatry and Psychotherapy, RWTH Aachen University, Aachen, Germany

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Molecular Psychiatry (2011) 16, 478–490 & 2011 Macmillan Publishers Limited All rights reserved 1359-4184/11 www.nature.com/mp FEATURE REVIEW The role of neurotrophic factors in autism T Nickl-Jockschat and TM Michel Department of Psychiatry and Psychotherapy, RWTH Aachen University, Aachen, Germany Autism spectrum disorders (ASDs) are pervasive developmental disorders that frequently involve a triad of deficits in social skills, communication and language. For the underlying neurobiology of these symptoms, disturbances in neuronal development and synaptic plasticity have been discussed. The physiological development, regulation and survival of specific neuronal populations shaping neuronal plasticity require the so-called ‘neurotrophic factors’ (NTFs). These regulate cellular proliferation, migration, differentiation and integrity, which are also affected in ASD. Therefore, NTFs have gained increasing attention in ASD research. This review provides an overview and explores the key role of NTFs in the aetiology of ASD. We have also included evidence derived from neurochemical investigations, gene association studies and animal models. By focussing on the role of NTFs in ASD, we intend to further elucidate the puzzling aetiology of these conditions. Molecular Psychiatry (2011) 16, 478–490; doi:10.1038/mp.2010.103; published online 12 October 2010 Keywords: autism; autism spectrum disorders; BDNF; genes; neurotrophic factors; NT-3 Introduction Although the aetiology of ASD is still not fully understood, twin and adoption studies suggest a Approximately one child per 145 babies born in the strong genetic role in the manifestation of the United States will be diagnosed with some form of disorder.8–11 Monozygotic twins show concordance autism spectrum disorder (ASD) throughout their rates of approximately 70–90%, whereas they are only 1 lifespan according to new estimates. The differences 0–10% in dizygotic twins.12,13 However, in addition noted in individuals with autism relate to develop- to genetic risk factors, there is evidence for an associa- ment deficiencies of language, social interaction tion with a variety of other conditions, including skills, repetitive and stereotyped movements and prenatal exposure to noxae such as alcohol, behaviours, hyperactivity, sensory disturbances, thalidomide or sodium-valproate as well as obstetric 2,3 restricted interests and more rarely self-injury. complications, pre- and post-natal brain damage, Additional challenging aspects of ASD are comorbid chromosomal aberrations such as fragile X-syndrome, 4 disorders, such as epilepsy, gastrointestinal pro- tuberous sclerosis and 22q11.2 deletion syndrome 5 6 blems and sleep disorder. The clinical presentation among others.14–16 of autism is complex and variable, and therefore the One of the most consistent findings in autism is an term ASD is often used in this context. According to increased brain size during development.17–20 Chil- the ICD-10 (International Statistical Classification of dren with autism seem to undergo an abnormally Diseases and Related Health Problems, Tenth Revi- accelerated brain growth during development.18,19,21–23 sion), ASD is described as a pervasive developmental It has been suggested that the formation of neuronal disorder. Differentiation from other developmental connections or the elimination of inappropriate disorders such as Rett syndrome, which show over- connections does not proceed in the typical manner. lapping symptoms and a similar neurobiology to Striking neuropathological findings, such as fewer ASD, is not always easy, especially in the very early Purkinje cells, smaller neuronal size and decreased stages. Rett syndrome is a comparatively rare disorder dendritic branches in subjects diagnosed with ASD, with clinical proximity to ASD, but in contrast to have been reported for various brain regions, such as ASD, a mono-genetic background can be defined in a the cerebellum,24–28 the hippocampus and the amyg- 7 majority of cases. Rett syndrome, which affects dale.25,26 Magnetic resonance imaging studies have girls only, is characterized by a profound learning also shown grey and white matter changes such as disability following early normal development, with a reduced neuronal and axodendendritic pruning in consistent cluster of clinical features. autism.29–34 Lately, inflammatory processes have also been discussed in the aetiopathology of autism.28 A Correspondence: Dr TM Michel, Department of Psychiatry and vast body of research has been undertaken in the last Psychotherapy, RWTH Aachen University, Pauwelsstrasse 30, decade to elucidate the underlying pathophysiology Aachen, D-52074, Germany. E-mail: [email protected] of autism. Received 13 January 2010; revised 31 August 2010; accepted 6 The development and maintenance of the central September 2010; published online 12 October 2010 nervous system is influenced by several different Neurotrophic factors in autism T Nickl-Jockschat and TM Michel 479 mechanisms, one of the most prominent being low affinity,59–62 but can be regulated by receptor neurotrophic factors (NTFs).35–41 dimerization, structural modifications or association NTFs do not only have a key role in processes such with the p75 receptor.63,64 as brain development and maintenance of neurons Substrate binding leads to Trk dimerization and, and their dentrites throughout life, but they also therefore, to trans-autophosphorylation at two tyrosine critically influence the formation and elimination of residues (Tyr490 and Tyr785) in the cytoplasmatic neuronal connections. They have been discussed in domain of the receptor, activating the intracellular many studies as promising candidates responsible for signalling cascade.62 A key molecule interacting with part of the alterations seen in autism.35–43 these phosphotyrosine motifs is the Src homologous NTFs comprise a range of different protein super- and collagen-like (Shc) adaptor protein. Shc links families. At least six factors belong to the neurotro- Trk signalling to two major signalling pathways: the phin family: nerve growth factor (NGF), brain-derived Ras/Raf/ERK and the phosphatidylinositol-3 kinase growth factor (BDNF), neurotrophin (NT)-3, NT-4, (PI3K) pathway. NT-5 and NT-6.44–47 The neurotrophins are a family of After activation, Shc interacts with Grb2. Regarding closely related proteins that were first identified as the Ras/Raf/ERK pathway, Grb2 then binds to SOS survival factors for sympathetic and sensory neu- (son of sevenless). The Shc/Grb2/SOS complex rons.48 The core functions of neurotrophins during attaches itself to the membrane through the inter- neurodevelopment include regulation of cell prolif- action of Shc with the phosphorylated receptor, eration, migration and survival. They also modulate and mediates signalling to the Ras/mitogen-activated axonal and dendritic outgrowth, synapse formation protein kinase pathway.65,66 The neurotrophins’ and other neuroplastic processes.49 ability to activate Raf depends on Rap1, a small Further neurotrophic superfamilies include neuro- endosomal G-protein.67 The active Ras/Raf/ERK path- kines such as ciliary NTF (CNTF) and leukaemia way influences, for example, transcription of the inhibitory factor (LIF), insulin-like growth factors cyclic AMP-response element (CREB) transcription (for example, IGF-1 and IGF-2), as well as the vast factor. Overall, this pathway has effects on the cell transforming growth factor-b (TGF-b) superfamily (for cycle, neurite outgrowth and synaptic plasticity.68 example, TGF-b1, -b2 and -b3), and their distant Alternatively, Shc-bound Grb2 can activate PI3K relative glial cell line-derived neurotrophic factor through the Gab1 (Grb2-associated binder-1). PI3K (GDNF). Additionally, there are a variety of other can propagate cellular survival through Akt (protein proteins that can at least partly exert an influence on kinase B) activities,65 and also mitogenic signalling, neurotrophic functions, although they are not con- cell survival, cytoskeletal remodelling and vesicular sidered as NTFs themselves. trafficking.69 Furthermore, individual NTFs and their receptors Binding of phospholipase-Cg to activate Trk con- are quite distinct and are subject to considerable stitutes an additional, Shc-independent pathway, changes in the course of neural development.50,51 resulting in the release of inositol phosphates and The proteins of the neurotrophin family have a activation of protein kinase C.65,70 molecular weight of 13 kDa (NGF) to 27 kDa (BDNF, Through a different set of adaptor proteins, p75 NT-3) and high isoelectric points (9–10.5). BDNF is signalling results in increases in Jun N-terminal one of the most abundant NTFs in mammalian brains. kinase, nuclear factor-kB and ceramide.71 P75 is The neurotrophin genes, like other peptide growth capable of mediating apoptosis in a pathophysio- factors, encode a precursor peptide.52,53 Thus, the logical context, for example, after seizure or inflam- protein forms of neurotrophins exist in the human mation72,73 and—in oligodendrocytes—after spinal brain, both in the mature and in its precursor form injury,74 and also physiologically during neurodeve- (for example, proBDNF). The precursor form is lopment.75 secreted in both a basal and an activity-dependent Surprisingly, pro-neurotrophins display higher fashion and is processed extracellularly to its mature affinities for the p7556 and are more effective form by proteolytic cleavage.54–56 inductors of p75-dependent apoptosis.56,74 Thus, Only one frequent, nonconservative
Recommended publications
  • Microrna Function: Multiple Mechanisms for a Tiny RNA?

    Microrna Function: Multiple Mechanisms for a Tiny RNA?

    Downloaded from rnajournal.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW MicroRNA function: Multiple mechanisms for a tiny RNA? RAMESH S. PILLAI Friedrich Miescher Institute for Biomedical Research, 4002 Basel, Switzerland ABSTRACT MicroRNAs are sequence-specific regulators of post-transcriptional gene expression in many eukaryotes. They are believed to control the expression of thousands of target mRNAs, with each mRNA believed to be targeted by multiple microRNAs. Recent studies have uncovered various mechanisms by which microRNAs down-regulate their target mRNAs and have linked a well- known subcellular structure, the cytoplasmic processing bodies (PBs) to the microRNA pathway. The finding that microRNAs are misexpressed in cancers has reinforced the idea that their regulatory roles are very important. Keywords: microRNAs; miRNPs; translational repression; P-bodies; Argonaute INTRODUCTION that the forced overexpression of miRNAs can lead to the development of tumors (He et al. 2005). MicroRNAs (miRNAs) have come a long way from being Another pathway that uses small RNAs as sequence-spe- an oddity of worms when they were first discovered over 10 cific regulators is the RNA interference (RNAi) pathway, years ago (Lee et al. 1993) to be recognized now as novel which is an evolutionarily conserved response to the pres- agents exercising post-transcriptional control over most ence of double-stranded RNA (dsRNA) in the cell (Meister eukaryotic genomes. They are a family of 21–25-nucleotides and Tuschl 2004; Filipowicz 2005). The dsRNAs are cleaved (nt)-long RNAs expressed in a wide variety of organisms into 20-base pair (bp) duplexes of small-interfering RNAs ranging from plants to worms and humans.
  • 422.Full.Pdf

    422.Full.Pdf

    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Research Dioxin receptor and SLUG transcription factors regulate the insulator activity of B1 SINE retrotransposons via an RNA polymerase switch Angel Carlos Roma´n,1 Francisco J. Gonza´lez-Rico,1 Eduardo Molto´,2,3 Henar Hernando,4 Ana Neto,5 Cristina Vicente-Garcia,2,3 Esteban Ballestar,4 Jose´ L. Go´mez-Skarmeta,5 Jana Vavrova-Anderson,6 Robert J. White,6,7 Lluı´s Montoliu,2,3 and Pedro M. Ferna´ndez-Salguero1,8 1Departamento de Bioquı´mica y Biologı´a Molecular, Facultad de Ciencias, Universidad de Extremadura, 06071 Badajoz, Spain; 2Centro Nacional de Biotecnologı´a (CNB), Consejo Superior de Investigaciones Cientı´ficas (CSIC), Department of Molecular and Cellular Biology, Campus de Cantoblanco, C/Darwin 3, 28049 Madrid, Spain; 3Centro de Investigacio´n Biome´dica en Red de Enfermedades Raras (CIBERER), ISCIII, Madrid, Spain; 4Chromatin and Disease Group, Cancer Epigenetics and Biology Programme, Bellvitge Biomedical Research Institute (IDIBELL), Barcelona 08907, Spain; 5Centro Andaluz de Biologı´a del Desarrollo, CSIC-Universidad Pablo de Olavide, 41013 Sevilla, Spain; 6College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow G12 8QQ, United Kingdom; 7Beatson Institute for Cancer Research, Glasgow, G61 1BD, United Kingdom Complex genomes utilize insulators and boundary elements to help define spatial and temporal gene expression patterns. We report that a genome-wide B1 SINE (Short Interspersed Nuclear Element) retrotransposon (B1-X35S) has potent in- trinsic insulator activity in cultured cells and live animals. This insulation is mediated by binding of the transcription factors dioxin receptor (AHR) and SLUG (SNAI2) to consensus elements present in the SINE.
  • Activating Transcription Factor 6 Derepression Mediates Neuroprotection in Huntington Disease

    Activating Transcription Factor 6 Derepression Mediates Neuroprotection in Huntington Disease

    Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease José R. Naranjo, … , Jia-Yi Li, Britt Mellström J Clin Invest. 2016;126(2):627-638. https://doi.org/10.1172/JCI82670. Research Article Neuroscience Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. Find the latest version: https://jci.me/82670/pdf The Journal of Clinical Investigation RESEARCH ARTICLE Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease José R. Naranjo,1,2 Hongyu Zhang,3 Diego Villar,1,2 Paz González,1,2 Xose M. Dopazo,1,2 Javier Morón-Oset,1,2 Elena Higueras,1,2 Juan C.
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function

    Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function

    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
  • An HMG I/Y-Containing Repressor Complex and Supercolled DNA Topology Are Critical for Long-Range Enhancer-Dependent Transcription in Vitro

    An HMG I/Y-Containing Repressor Complex and Supercolled DNA Topology Are Critical for Long-Range Enhancer-Dependent Transcription in Vitro

    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press An HMG I/Y-containing repressor complex and supercolled DNA topology are critical for long-range enhancer-dependent transcription in vitro Rajesh Bagga and Beverly M. Emerson 1 Regulatory Biology Laboratory, The Salk Institute for Biological Studies, La Jolla, California 92037 USA The 3' enhancer of the T cell receptor s.chain (TCR~) gene directs the tissue- and stage-specific expression and V(D)Jrecombination of this gene locus. Using an in vitro system that reproduces TCRoL enhancer activity efficiently, we show that long-range promoter-enhancer regulation requires a T cell-specific repressor complex and is sensitive to DNA topology. In this system, the enhancer functions to derepress the promoter on supercoiled, but not relaxed, templates. We find that the TCRoL promoter is inactivated by a repressor complex that contains the architectural protein HMG I/Y. In the absence of this repressor complex, expression of the TCR~ gene is completely independent of the 3' enhancer and DNA topology. The interaction of the T cell-restricted protein LEF-1 with the TCR~ enhancer is required for promoter derepression. In this system, the TCR~ enhancer increases the number of active promoters rather than the rate of transcription. Thus, long-range enhancers function in a distinct manner from promoters and provide the regulatory link between repressors, DNA topology, and gene activity. [Key Words: TCR genes; transcription; enhancers; HMG I/Y; derepression; DNA topology] Received December 27, 1996; revised version accepted January 14, 1997. The widespread importance of long-range promoter- Giaever 1988; Rippe et al.
  • Accurate Breakpoint Mapping in Apparently Balanced Translocation Families with Discordant Phenotypes Using Whole Genome Mate-Pair Sequencing

    Accurate Breakpoint Mapping in Apparently Balanced Translocation Families with Discordant Phenotypes Using Whole Genome Mate-Pair Sequencing

    Accurate Breakpoint Mapping in Apparently Balanced Translocation Families with Discordant Phenotypes Using Whole Genome Mate-Pair Sequencing Aristidou, Constantia; Koufaris, Costas; Theodosiou, Athina; Bak, Mads; Mehrjouy, Mana M; Behjati, Farkhondeh; Tanteles, George; Christophidou-Anastasiadou, Violetta; Tommerup, Niels; Sismani, Carolina Published in: PLOS ONE DOI: 10.1371/journal.pone.0169935 Publication date: 2017 Document version Publisher's PDF, also known as Version of record Document license: CC BY Citation for published version (APA): Aristidou, C., Koufaris, C., Theodosiou, A., Bak, M., Mehrjouy, M. M., Behjati, F., Tanteles, G., Christophidou- Anastasiadou, V., Tommerup, N., & Sismani, C. (2017). Accurate Breakpoint Mapping in Apparently Balanced Translocation Families with Discordant Phenotypes Using Whole Genome Mate-Pair Sequencing. PLOS ONE, 12(1), [e0169935]. https://doi.org/10.1371/journal.pone.0169935 Download date: 29. sep.. 2021 RESEARCH ARTICLE Accurate Breakpoint Mapping in Apparently Balanced Translocation Families with Discordant Phenotypes Using Whole Genome Mate-Pair Sequencing Constantia Aristidou1,2, Costas Koufaris1, Athina Theodosiou1, Mads Bak3, Mana M. Mehrjouy3, Farkhondeh Behjati4, George Tanteles5, Violetta Christophidou- Anastasiadou6, Niels Tommerup3, Carolina Sismani1,2* a1111111111 a1111111111 1 Department of Cytogenetics and Genomics, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus, 2 The Cyprus School of Molecular Medicine, The Cyprus Institute of Neurology and Genetics, a1111111111
  • Insulators Targets Pcg Proteins to a Downstream Promoter

    Insulators Targets Pcg Proteins to a Downstream Promoter

    Developmental Cell 11, 117–124, July, 2006 ª2006 Elsevier Inc. DOI 10.1016/j.devcel.2006.05.009 PRE-Mediated Bypass of Two Short Article Su(Hw) Insulators Targets PcG Proteins to a Downstream Promoter Itys Comet,1 Ekaterina Savitskaya,2,3 dependent on the chromatin surrounding the transgene Bernd Schuettengruber,1 Nicolas Ne`gre,1,4 (barrier activity). Second, when an insulator is placed Sergey Lavrov,1,5 Aleksander Parshikov,2 between an enhancer and a promoter, it can prevent Franc¸ois Juge,1,6 Elena Gracheva,2,7 the enhancer from activating the promoter (enhancer Pavel Georgiev,2,* and Giacomo Cavalli1,* blocking activity). 1 Institute of Human Genetics The Drosophila Su(Hw) insulator, from the gypsy retro- Centre National de la Recherche Scientifique transposon, contains 12 binding sites for the Su(Hw) 141 rue de la Cardonille protein and can block enhancer-promoter interactions F-34396 Montpellier Cedex 5 in a Su(Hw)-dependent manner when inserted between France them (Cai and Levine, 1995; Geyer and Corces, 1992; 2 Department of the Control of Genetic Processes Scott et al., 1999). On the other hand, two intervening Institute of Gene Biology Su(Hw) insulators restore enhancer access to down- Russian Academy of Sciences stream promoters (Cai and Shen, 2001; Muravyova Moscow 119334 et al., 2001). This ability, which is shared by other insula- Russia tor elements (Gruzdeva et al., 2005; Melnikova et al., 2004), was suggested to depend on pairing of the two in- sulators that might bring the upstream enhancer in the Summary vicinity of the downstream promoter.
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses

    Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses

    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
  • REVIEW ARTICLE the Genetics of Autism

    REVIEW ARTICLE the Genetics of Autism

    REVIEW ARTICLE The Genetics of Autism Rebecca Muhle, BA*; Stephanie V. Trentacoste, BA*; and Isabelle Rapin, MD‡ ABSTRACT. Autism is a complex, behaviorally de- tribution of a few well characterized X-linked disorders, fined, static disorder of the immature brain that is of male-to-male transmission in a number of families rules great concern to the practicing pediatrician because of an out X-linkage as the prevailing mode of inheritance. The astonishing 556% reported increase in pediatric preva- recurrence rate in siblings of affected children is ϳ2% to lence between 1991 and 1997, to a prevalence higher than 8%, much higher than the prevalence rate in the general that of spina bifida, cancer, or Down syndrome. This population but much lower than in single-gene diseases. jump is probably attributable to heightened awareness Twin studies reported 60% concordance for classic au- and changing diagnostic criteria rather than to new en- tism in monozygotic (MZ) twins versus 0 in dizygotic vironmental influences. Autism is not a disease but a (DZ) twins, the higher MZ concordance attesting to ge- syndrome with multiple nongenetic and genetic causes. netic inheritance as the predominant causative agent. By autism (the autistic spectrum disorders [ASDs]), we Reevaluation for a broader autistic phenotype that in- mean the wide spectrum of developmental disorders cluded communication and social disorders increased characterized by impairments in 3 behavioral domains: 1) concordance remarkably from 60% to 92% in MZ twins social interaction; 2) language, communication, and and from 0% to 10% in DZ pairs. This suggests that imaginative play; and 3) range of interests and activities.
  • Derepression of Human Embryonic -Globin Promoter by a Locus-Control

    Derepression of Human Embryonic -Globin Promoter by a Locus-Control

    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 14669–14674, December 1998 Biochemistry Derepression of human embryonic z-globin promoter by a locus-control region sequence (transgenic miceyenhancerypassive repressionycompetitive factor bindingyglobin switch) B.-L. HUANG*†,I.R.FAN-CHIANG*†,S.C.WEN*, H.-C. KOO*, W. Y. KAO*, N. R. GAVVA‡, AND C.-K. JAMES SHEN*‡§ *Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Republic of China; and ‡Section of Molecular and Cellular Biology, University of California, Davis, CA 95616 Communicated by James C. Wang, Harvard University, Cambridge, MA, September 28, 1998 (received for review August 12, 1998) ABSTRACT A multiple protein–DNA complex formed at consist of six nuclear factor-binding motifs (10) that are a human a-globin locus-specific regulatory element, HS-40, occupied in vivo in an erythroid lineage-specific and develop- confers appropriate developmental expression pattern on mental stage-specific manner (11, 12). These include three human embryonic z-globin promoter activity in humans and GATA-1 motifs (b, c, and d), two NF-E2yAP1 motifs (59 and transgenic mice. We show here that introduction of a 1-bp 39), and a GT motif (Fig. 1A). In vitro binding studies indicated y mutation in an NF-E2 AP1 sequence motif converts HS-40 that the GT motif predominately binds the ubiquitous Sp1 into an erythroid-specific locus-control region. Cis-linkage factor (13). The GATA-1 motifs bind the GATA family of with this locus-control region, in contrast to the wild-type transcription factors, including the erythroid-enriched HS-40, allows erythroid lineage-specific derepression of the y z GATA-1 (14).
  • CADPS2 (NM 001009571) Human Tagged ORF Clone – RC220606

    CADPS2 (NM 001009571) Human Tagged ORF Clone – RC220606

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC220606 CADPS2 (NM_001009571) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CADPS2 (NM_001009571) Human Tagged ORF Clone Tag: Myc-DDK Symbol: CADPS2 Synonyms: CAPS2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC220606 representing NM_001009571 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGGACCCGTCTTCCAGCGAAGAGGAGTCGGACGAGGGGCTGGAAGAGGAAAGCCGCGATGTGCTGG TGGCAGCCGGCAGCTCGCAGCGAGCTCCTCCAGCCCCGACTCGGGAAGGGCGGCGGGACGCGCCGGGGCG CGCGGGCGGCGGCGGCGCGGCCAGATCTGTGAGCCCGAGCCCCTCTGTGCTCAGCGAGGGGCGAGACGAG CCCCAGCGGCAGCTGGACGATGAGCAGGAGCGGAGGATCCGCCTGCAGCTCTACGTCTTCGTCGTGAGGT GCATCGCGTACCCCTTCAACGCCAAGCAGCCCACCGACATGGCCCGGAGGCAGCAGAAGCTTAACAAACA ACAGTTGCAGTTACTGAAAGAACGGTTCCAGGCCTTCCTCAATGGGGAAACCCAAATTGTAGCTGACGAA GCATTTTGCAACGCAGTTCGGAGTTATTATGAGGTTTTTCTAAAGAGTGACCGAGTGGCCAGAATGGTAC AGAGTGGAGGGTGTTCTGCTAATGACTTCAGAGAAGTATTTAAGAAAAACATAGAAAAACGTGTGCGGAG TTTGCCAGAAATAGATGGCTTGAGCAAAGAGACAGTGTTGAGCTCATGGATAGCCAAATATGATGCCATT TACAGAGGTGAAGAGGACTTGTGCAAACAGCCAAATAGAATGGCCCTAAGTGCAGTGTCTGAACTTATTC TGAGCAAGGAACAACTCTATGAAATGTTTCAGCAGATTCTGGGTATTAAAAAACTGGAACACCAGCTCCT TTATAATGCATGTCAGCTGGATAACGCAGATGAACAAGCAGCCCAGATCAGAAGGGAACTTGATGGCCGG CTGCAATTGGCAGATAAAATGGCAAAGGAAAGAAAATTCCCCAAATTTATAGCAAAAGATATGGAGAATA
  • Impaired Secretion of Brain-Derived Neurotrophic Factor and Neuropsy- Chiatric Diseases Naoki Adachi and Hiroshi Kunugi*

    Impaired Secretion of Brain-Derived Neurotrophic Factor and Neuropsy- Chiatric Diseases Naoki Adachi and Hiroshi Kunugi*

    The Open Neuroscience Journal, 2008, 2, 59-64 59 Open Access Impaired Secretion of Brain-Derived Neurotrophic Factor and Neuropsy- chiatric Diseases Naoki Adachi and Hiroshi Kunugi* Department of Mental Disorder Research, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Tokyo 187-8502, 4-1-1, Ogawahigashi, Tokyo, 187-8502, Japan Abstract: Recent studies have elucidated mechanisms of brain-derived neurotrophic factor (BDNF) secretion, and im- paired secretion of BDNF may be involved in the pathogenesis of several neuropsychiatric diseases. The huntingtin gene, for example, has been shown to regulate vesicular transport of BDNF, which may play a role in the neurodegeneration present in Huntington's disease. In animal studies, mice lacking calcium-dependent activator protein for secretion 2 (CADPS2), which is involved in the activity-dependent release of BDNF, showed several phenotypes including autistic behavior. A single nucleotide polymorphism that results in an amino-acid change (Val66Met) in the BDNF gene has been shown to cause a decline in the function of BDNF vesicular sorting and has been reported to be associated with behavioral and intermediate phenotypes (e.g., episodic memory) in humans. In this review, we introduce recent progress in the mo- lecular mechanisms of BDNF secretion and discuss its possible role in the pathophysiology and treatment of neuropsy- chiatric diseases. INTRODUCTION of transmembrane receptor proteins: the tyrosine kinase Trk (tropomyosin-related kinase) receptors and the low affinity Brain-derived neurotrophic factor (BDNF), a member of common neurotrophin receptor (p75NTR). Neurotrophins the neurotrophin family, has been implicated in a broad are expressed in a precursor form (pro-neurotrophins) and range of processes that are important for neuronal survival are proteolytically processed to a mature form.