Effects of Er:YAG and Diode Laser Irradiation on Dental Pulp Cells and Tissues

International Journal of Molecular Sciences

Article Effects of Er:YAG and Diode Laser Irradiation on Dental Pulp Cells and Tissues

Shunjiro Yamakawa 1, Takahiko Niwa 2, Takeo Karakida 3, Kazuyuki Kobayashi 4, Ryuji Yamamoto 3, Risako Chiba 3, Yasuo Yamakoshi 3,* and Noriyasu Hosoya 1 1 Department of Endodontology, School of Dental Medicine, Tsurumi University, 2-1-3 Tsurumi, Tsurumi-ku, Yokohama 230-8501, Japan; [email protected] (S.Y.); [email protected] (N.H.) 2 Department of Periodontology, School of Dental Medicine, Tsurumi University, 2-1-3 Tsurumi, Tsurumi-ku, Yokohama 230-8501, Japan; [email protected] 3 Department of Biochemistry and Molecular Biology, School of Dental Medicine, Tsurumi University, 2-1-3 Tsurumi, Tsurumi-ku, Yokohama 230-8501, Japan; [email protected] (T.K.); [email protected] (R.Y.); [email protected] (R.C.) 4 Department of Dental Hygiene, Tsurumi Junior College, 2-1-3 Tsurumi, Tsurumi-ku, Yokohama 230-8501, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-45-580-8479

Received: 18 July 2018; Accepted: 13 August 2018; Published: 17 August 2018

Abstract: Vital pulp therapy (VPT) is to preserve the nerve and maintain healthy dental pulp tissue. Laser irradiation (LI) is beneﬁcial for VPT. Understanding how LI affects dental pulp cells and tissues is necessary to elucidate the mechanism of reparative dentin and dentin regeneration. Here, we show how Er:YAG-LI and diode-LI modulated cell proliferation, apoptosis, gene expression, protease activation, and mineralization induction in dental pulp cells and tissues using cell culture, immunohistochemical, genetic, and protein analysis techniques. Both LIs promoted proliferation in porcine dental pulp-derived cell lines (PPU-7), although the cell growth rate between the LIs was different. In addition to proliferation, both LIs also caused apoptosis; however, the apoptotic index for Er:YAG-LI was higher than that for diode-LI. The mRNA level of odontoblastic gene markers—two dentin sialophosphoprotein splicing variants and matrix metalloprotease (MMP)20 were enhanced by diode-LI, whereas MMP2 was increased by Er:YAG-LI. Both LIs enhanced alkaline phosphatase activity, suggesting that they may help induce PPU-7 differentiation into odontoblast-like cells. In terms of mineralization induction, the LIs were not signiﬁcantly different, although their cell reactivity was likely different. Both LIs activated four MMPs in porcine dental pulp tissues. We helped elucidate how reparative dentin is formed during laser treatments.

Keywords: Er:YAG laser; diode laser; dental pulp cell; apoptosis; gene; matrix metalloprotease; transforming growth factor-beta

1. Introduction Vital pulp therapy (VPT) encompasses clinical interventions to preserve the nerve as much as possible, and to maintain healthy pulp tissue. VPT is carried out to reverse pulpal injury, and promote continued root development and apical closure, and to accomplish root canal therapy regarding dental literature. Phototherapy with various lasers has been widely accepted for its analgesic effects and promotion of wound healing to treat stomatitis, dentin hypersensitivity, temporomandibular joint disorder, periodontal disease, and caries [1–4]. In root canal therapy, the laser contributes to sterilization, disinfection, drying, and transpiration of infected dentin in root canal. The laser that penetrates into the tissue is used for coagulation of the exposed pulp, thereby creating the biological bases for the formation of reparative dentin.

Int. J. Mol. Sci. 2018, 19, 2429; doi:10.3390/ijms19082429 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2018, 19, 2429 2 of 22

Erbium-doped yttrium aluminum garnet (Er:YAG) lasers have numerous applications in a wide range of not only medical, but also dental ﬁelds. Er:YAG lasers have high water absorbency compared to CO2 and neodymium-doped yttrium aluminum garnet (Nd:YAG) lasers [5]. Due to this characteristic, Er:YAG lasers are well absorbed in biological tissues containing water, and used for various treatments, such as cementum transpiration of the root surface, tartar, bone tissue, and gingival soft tissue [6–11]. Unlike Er:YAG lasers, which are absorbed on the tissue surface, diode lasers are transmitted to internal tissue and used for incision, hemostatic coagulation, and pain relief for intraoral soft tissue [12,13]. Research in vitro has demonstrated that laser irradiation (LI) promotes cell migration and proliferation [14,15], mitochondrial respiration [16–18], protein synthesis [14,19] and bone formation [20]. Dental pulp stem cells (DPSCs) have a mesenchymal stem cell (MSC) phenotype, and the potential to differentiate into multiple cell types, including odontoblasts, osteoblasts, chondrocytes, cardiomyocytes, hepatocytes, neuron, liver cells, and pancreatic islet β cells. In addition, DPSCs are also used for induced pluripotent stem (iPS) cell creation and priming. DPSCs are generally assumed to differentiate into each cell type by expressing marker genes, enhancing alkaline phosphatase (ALP) activity and forming precipitated nodules. In dental research, dental pulp tissues containing DPSCs have been used to establish a number of odontoblastic cell lines from rat [21,22], mouse [23], cow [24], pig [25], and human [26,27]. Pulp capping materials, such as calcium hydroxide and mineral trioxide aggregate, induce reparative dentin formation by causing the release of growth factors from the dentin matrix [28]. A variety of factors, such as bone morphogenetic protein (BMP) [29,30], ﬁbroblast growth factors [31], and transforming growth factor beta (TGF-β), regulate dental pulp cell differentiation [32,33] and odontoblastic differentiation, many of which are associated with ectoderm–mesenchyme molecular interactions. TGF-β released from the dentin matrix and extracellular matrix molecules can induce the differentiation of progenitor/stem cells into odontoblast-like cells [28], but the dynamics and mechanisms of how LI affects DPSC odontoblastic differentiation remain unknown. In addition, little is known about how LI elicits changes in dental pulp tissues. Here, we report the effects of Er:YAG-LI and diode-LI on proliferation, apoptosis, gene expression, mineralization induction, and protease activation in dental pulp cells and tissues.

2. Results

2.1. Cell Proliferation Rate of PPU-7 We established a porcine dental pulp-derived cell line (PPU-7) (see Figures A1 and A2 in Appendix A.1, Figure A3 in Appendixs A.2 and A.3 in AppendixA) and investigated the effects of Er:YAG-LI and diode-LI on proliferation (Figure1). In MTS assay (Figure1A), the proliferation rate under diode-LI was the same as that in the control (no LI), and the cells reached confluence in the first day. By contrast, the proliferation rate under Er:YAG-LI in the first day was approximately half of that under diode-LI, and the cells reached confluence in the second day. On the third day, cell proliferation under the diode laser rapidly decreased at the same rate as the control, whereas the Er:YAG laser-treated cells showed a gradual downward trend. The decrease in proliferative rates for Er:YAG-LI and diode-LI were the same by the fifth day. The number of PPU-7 was counted on day 0, 1, 2, and 3 after laser irradiation (Figure1B). The cell number after Er:YAG-LI and diode-LI was almost the same as that in the control without laser irradiation in the first day. However, the cell number of Er:YAG-LI began to decrease in the second day, and it was lower than control (1.42-fold) and diode-LI (1.51-fold) in the third day. Compared with control and diode-LI, the cell population doubling level of PPU-7 until day 3 required time with Er:YAG-LI (Figure1C). Int. J. Mol. Sci. 2018, 19, 2429 3 of 22 Int. J. Mol. Sci. 2018, 19, x FOR PEER REVIEW 3 of 23

FigureFigure 1. 1. EffectEffect of laserlaser irradiationirradiation (LI) (LI) on on PPU-7 PPU-7 proliferation proliferation incubated incubated for for different different periods. periods. (A) MTS(A) MTSassay. assay. PPU-7 PPU-7 after after Er:YAG-LI Er:YAG-LI (red), (red), diode-LI diode-LI (blue), (blue), and and without without LI LI (grey) (grey) on on day day 0, 0, 1, 1, 2, 2, 3, 3, and and 5, 5,were were cultured cultured at at a a ﬁnal final volume volume of of 120 120µ μL/wellL/well forfor 11 hh atat 37 ◦°C.C. MTS reagent was was added, added, and and an an absorbanceabsorbance of of 450 450 nm nm was was recorded recorded using using a a microplate microplate reader reader ( (nn == 10 10 tests tests per per sample). sample). Values Values are are thethe meanmean ±± standardstandard errorerror (* (* pp << 0.01, 0.01, Steel’s Steel’s test). test). (B (B) )The The number number of of PPU-7 PPU-7 cells. cells. PPU-7 PPU-7 cells cells were were countedcounted on on day day 0, 0, 1, 1, 2, 2, and and 3 3 after after laser laser irradiation irradiation (** (** pp << 0.05, 0.05, Steel’s Steel’s test). test). (C (C) )Cell Cell population population doubling doubling levellevel against against days days after after laser laser irradiation. irradiation. Data Data are aremeans means ± standard± standard error error(** p < (** 0.05,p < Steel’s 0.05, Steel’stest). test).

2.2.2.2. Apoptosis Apoptosis of of PPU-7 PPU-7 ApoptoticApoptotic bodies bodies were were observed observed in in hematoxylin-eosin hematoxylin-eosin (HE)-stained (HE)-stained sections sections of of PPU-7 PPU-7 cells cells exposedexposed to to Er:YAG-LI, Er:YAG-LI, diode-LI, diode-LI, or or no no LI LI (control) (control) (Figure (Figure 22).). Eosinophilic apoptotic bodies in the HE-stainedHE-stained PPU-7 PPU-7 sections, sections, detected detected by by light light microscopy microscopy on on days days 1 1 and and 3, 3, are are shown shown in in Figure Figure 2A,B,2A,B, respectively.respectively. The The same same PPU-7 PPU-7 wells wells were were used used for an for immunohistochemical an immunohistochemical cleaved cleaved caspase-3 caspase-3 assay (CASP3assay (CASP3 in Figure in Figure 2A,B).2 A,B). In contrast In contrast to the to negative the negative controls controls (NC in(NC Figure in Figure 2A,B),2A,B), putative putative pre- apoptoticpre-apoptotic cells cellswere were observed, observed, which which were were characterized characterized by a bybrown a brown antibody antibody stain stain primarily primarily in the in cytoplasm.the cytoplasm. We Wefurther further quantitated quantitated the the occurrence occurrence of of cleaved cleaved caspase-3-positive caspase-3-positive cells. cells. The The total total numbernumber of of caspase-3-positive caspase-3-positive apoptotic apoptotic events events counted counted for for three three groups, groups, and and the the apoptotic apoptotic indices indices (AIs)(AIs) calculated calculated for for the the treatment treatment groups groups are are shown shown in in Figure Figure 2C.2C. In the control, less than 6% of the cellscells exhibited exhibited detectable detectable caspase-3 caspase-3 (5.43 (5.43 ±± 0.73%0.73% on on day day 1 1 and and 4.01 4.01 ±± 0.45%0.45% on on day day 3). 3). AIs AIs in in the the Er:YAGEr:YAG laser-treated laser-treated PPU-7 were 8.81 ± 0.82%0.82% on on day day 1, 1, and and 14.2 14.2 ±± 1.03%1.03% on on day day 3, 3, whereas whereas the the diode diode laser-treatedlaser-treated PPU-7 PPU-7 cells cells had an AI of 8.51 ± 0.76%0.76% on on day day 1 1 and and 6.81 6.81 ±± 0.51%0.51% on on day day 3. 3. AIs AIs in in both both LI LI groupsgroups were were significantly signiﬁcantly higher thanthan inin thethe controlcontrol (approximately (approximately 1.63-fold 1.63-fold on on day day 1 and1 and 3.53-fold 3.53-fold on onday day 3 for3 for the the Er:YAG Er:YAG laser, laser, and and 1.57-fold 1.57-fold on on day day 1 and 1 and 1.70-fold 1.70-fold on on day day 3 for 3 for the the diode diode laser). laser).

Int. J. Mol. Sci. 2018, 19, 2429 4 of 22 Int. J. Mol. Sci. 2018, 19, x FOR PEER REVIEW 4 of 23

Figure 2.2. EffectEffect ofof LILI onon apoptosisapoptosis inin PPU-7.PPU-7. ImmunohistochemicalImmunohistochemical detection of apoptosis in PPU-7PPU-7 on (A)) dayday 11 andand ((BB)) dayday 33 followingfollowing LI.LI. EosinophilicEosinophilic apoptoticapoptotic bodiesbodies inin hematoxylin-eosin-stainedhematoxylin-eosin-stained PPU-7 detected by by transmitted-light transmitted-light microscopy microscopy (HE) (HE) (magnification: (magniﬁcation: 400×). 400 Apoptotic×). Apoptotic bodies bodies in PPU- in PPU-77 stained stained by cleaved by cleaved caspase-3 caspase-3 antibody antibody (CASP3); (CASP3); the the control control was was processed processed without primary primary antibody (NC). The images areare highhigh magniﬁcationmagnification ofof thethe areaarea boxedboxed inin thethe Figure.Figure. ((CC)) ApoptoticApoptotic indicesindices inin PPU-7PPU-7 withwith oror withoutwithout laserlaser treatment.treatment. EachEach ofof thethe apoptoticapoptotic indices waswas calculatedcalculated asas thethe percentage ofof the the whole whole PPU-7 PPU-7 population. population. Values Values are are the the mean mean percentage percentage± standard ± standard error error (* p < (* 0.01, p < Steel’s0.01, Steel’s test). test). No Laser: No Laser: control control without without LI. LI.

Int. J. Mol. Sci. 2018, 19, 2429 5 of 22 Int. J. Mol. Sci. 2018, 19, x FOR PEER REVIEW 5 of 23

2.3.2.3. Effect of LI on Differentiation andand GeneGene ExpressionExpression inin PPU-7PPU-7 WeWe nextnext investigatedinvestigated thethe effecteffect ofof LILI onon genegene expressionexpression inin PPU-7.PPU-7. TheThe gene expression ofof aa panel ofof odontoblastic, osteoblastic,osteoblastic, andand chondrocyticchondrocytic markersmarkers inin PPU-7PPU-7 onon dayday 33 following LI was analyzed usingusing qPCR qPCR (Figure (Figure3 ). 3). We We quantified quantified the the mRNA mRNA expression expression of of the the odontoblastic odontoblastic differentiation differentiation markersmarkers matrix metalloproteases 2 (Mmp2) andand 2020 ((Mmp20Mmp20),), andand twotwo productsproducts fromfrom thethe full-lengthfull-length dentindentin sialophosphoproteinsialophosphoprotein (DSPP) (DSPP) transcript: transcript: a segmenta segment containing containing both both the the dentin dentin glycoprotein glycoprotein and dentinand dentin phosphoprotein phosphoprotein (DGP+DPP) (DGP+DPP) coding coding regions regions (Dspp-v1 (Dspp-v1), and), and a smaller a smaller segment segment specific specific for thefor dentinthe dentin sialoprotein sialoprotein (DSP)-only (DSP)-only transcript transcript (Dspp-v2 (Dspp-v2). The). The expression expression of Mmp20of Mmp20, Dspp-v1, Dspp-v1, and, andDspp-v2 Dspp- significantlyv2 significantly increased increased compared compared with with that inthat the in control the control (no LI) (no under LI) diode-LIunder diode-LI by 1.48-fold by 1.48-fold for Mmp20 for, 1.93-foldMmp20, for1.93-foldDspp-v1 forand Dspp-v1 16.2-fold and for 16.2-foldDspp-v2 . for In contrast,Dspp-v2.Mmp2 In contrast,mRNA Mmp2 significantly mRNA increased significantly after Er:YAG-LIincreased after to 1.32-fold Er:YAG-LI higher tothan 1.32-fold the control. higher We than also the amplified control. runt-related We also amplified transcription runt-related factor 2 (transcriptionRunx2) and osteocalcin factor 2 (Runx2 (OC)) asand osteoblastic osteocalcin differentiation (OC) as osteoblastic markers differentiation and type II collagen markers (andCol IItype) as II a chondrocyticcollagen (Col II differentiation) as a chondrocytic marker. differentiation mRNA levels marker. significantly mRNA decreased levels significantly after both decreased LIs, Er:YAG-LI after (0.74-foldboth LIs, Er:YAG-LI for OC, 0.55-fold (0.74-fold for Runx2 for OCand, 0.55-fold 0.81-fold forfor Runx2Col IIand) and 0.81-fold diode-LI for (0.73-fold Col II) and for diode-LIOC, 0.58-fold (0.73- forfoldRunx2 for OCand, 0.58-fold 0.87-fold for for ColRunx2 II), compared and 0.87-fold with those for Col in theII), control. compared Moreover, with those the two in the LIs affected control. theMoreover, expression the oftwo TGF- LIsβ affectedisoforms, the which expression was significantly of TGF-β isoforms, reduced which (Er:YAG-LI: was significantly 0.80-fold for reducedTgf-β1, 0.74-fold(Er:YAG-LI: for 0.80-foldTgf-β2 and for 0.70-fold Tgf-β1, 0.74-fold for Tgf-β for3; diode-LI: Tgf-β2 and 0.77-fold 0.70-fold for forTgf- Tgf-β3β1, 0.76-fold; diode-LI: for 0.77-foldTgf-β2 and for 0.79-foldTgf-β1, 0.76-fold for Tgf- βfor3) Tgf-β2 compared and with0.79-fold that infor the Tgf-β3 control.) compared with that in the control.

FigureFigure 3.3. Effect of LI on gene expression inin PPU-7.PPU-7. The mRNA expression assessed byby qPCR analysisanalysis ofof MMP2 MMP2 ( (Mmp2Mmp2),), MMP20 MMP20 ( (Mmp20Mmp20),), DSPP-variant DSPP-variant 1 1 ( (Dspp-v1Dspp-v1),), and and DSPP-variant DSPP-variant 2 2 ( (Dspp-v2Dspp-v2)) as as odontoblasticodontoblastic differentiationdifferentiation markers;markers; osteocalcinosteocalcin ((OCOC)) andand runt-related transcriptiontranscription factorfactor 2 (Runx2) asas osteoblastic osteoblastic differentiation differentiation markers; markers; type II collagen collagen ( (Col II II)) as as a a chondrogenic chondrogenic differentiation differentiation marker;marker; and and three three TGF- TGF-ββ isoforms isoforms ( (Tgf-Tgf-β1,β1, Tgf- Tgf-β2β2 and and Tgf- Tgf-β3β3).). Each ratio was was normalized normalized using using glyceraldehyde-3-phosphateglyceraldehyde-3-phosphate dehydrogenase dehydrogenase (Gapdh (Gapdh) as) the as reference the reference gene, and gene, the relative and the abundance relative ofabundanceDspp-v1, ofDspp-v2 Dspp-v1, Mmp2, Dspp-v2, Mmp20, Mmp2, ,OC Mmp20, Runx2, OC, Col, Runx2 II, Tgf-, Colβ II1,, Tgf-β1Tgf-β2,, Tgf-β2 and Tgf-, andβ3 Tgf-β3in PPU-7 in PPU-7 was generatedwas generated based based on a on mathematical a mathematical model model for relative for relative quantiﬁcation quantification in a in qPCR a qPCR system. system. Values Values are theare means the means± standard ± standard error errorof 6 culture of 6 culture wells. The wells. asterisk The asterisk(*) on the (*) bar on graph the bar indicates graph a indicates signiﬁcant a differencesignificant (*differencep < 0.05, (* Mann–Whitney p < 0.05, Mann–WhitneyU test) between U test) between samples samples with and with without and without LI. NL: LI. no NL: LI; Er:no LI; Er:YAG-LI; Er: Er:YAG-LI; DI: diode-LI. DI: diode-LI.

SinceSince ALP is is known known to to be be a akey key differentiation differentiation marker marker for for identifying identifying mesenchymal mesenchymal cells, cells, we wefurther further investigated investigated the theeffects effects of LI of on LI onPPU-7 PPU-7 ALP ALP activity activity (Figure (Figure 4).4 The). The control control ALP ALP activity activity on onday day 3 was 3 was 1.0, 1.0, whereas whereas both both LIs LIs significantly signiﬁcantly enhanced enhanced inherent inherent ALP ALP activity activity in PPU-7 cells cells (approximately(approximately 1.20-fold1.20-fold forfor Er:YAG-LIEr:YAG-LI and and 1.33-fold1.33-fold for for diode-LI). diode-LI).

Int. J. Mol. Sci.Int. 2018 J. Mol., 19 Sci., x2018 FOR, 19 PEER, 2429 REVIEW 6 of 22 6 of 23

Int. J. Mol. Sci. 2018, 19, x FOR PEER REVIEW 6 of 23

Figure 4. Effect of LI on ALP activity in PPU-7. ALP-inducing activity in PPU-7 after 3 days of Figure 4. EffectFigure 4. of Effect LI on of LI ALP on ALP activity activity in in PPU-7. PPU-7. ALP-inducing ALP-inducing activity activity in PPU-7 in after PPU-7 3 days after of 3 days of exposure toto a Er:YAGEr:YAG laserlaser (Er:YAG-LI)(Er:YAG-LI) oror aa diodediode laserlaser (Diode-LI)(Diode-LI) ((nn= = 6).6). NoNo Laser:Laser: control without exposure toLI. a Values Er:YAG areare thethe laser meanmean (Er:YAG-LI) ±± standard error or (* a p diode< 0.01, 0.01, Steel’s Steel’slaser test). (Diode-LI) (n = 6). No Laser: control without LI. Values are the mean ± standard error (* p < 0.01, Steel’s test). 2.4. Effect of LI on Mineralization Induction in PPU-7 2.4. Effect of LI Toon examineMineralization examine the the effect effect Induction of of LIs LIs on onin mineralizationPPU-7 mineralization inducibility, inducibility, we we cultured cultured PPU-7 in a a mineralization-inducing culture culture medium medium (Figure (Figure5), and 5), nodule and nodule formation formation and mineralization and mineralization capacity To examinewerecapacity assessed were the with assessed effect Alizarin ofwith Red LIs Alizarin S on staining Red mineralization (Figure S staining5A). On (Figure day inducibility, 7 5A). following On day the we 7 mineralization following cultured the PPU-7 in a mineralization-inducinginduction,mineralization precipitated induction, culture nodules precipitated medium were evidentnodules (Figure in were plates evident 5), with and Alizarinin plates nodule Redwith S Alizarin formation staining, Red in contrastS andstaining, mineralization to controlin contrast cells to not control induced cells for not mineralization. induced for mineralization. Interestingly, Interestingly, the semi-cylindrical the semi-cylindrical peeled portion peeled was capacity wereobservedportion assessed was in allobserved wells with (n in= all 6) ofAlizarinwells Er:YAG-LI. (n = 6) Redof Er:YAG-LI. S staining (Figure 5A). On day 7 following the mineralizationWe induction, also also quantitatively quantitatively precipitated analyzed analyzed nodules PPU-7 calcium were evident content (Figurein plates5 B). 5B). Onwith On day day Alizarin 7 7 following following Red S staining, in contrastmineralization to control cells induction, induction, not inducedthere there were were forno no significant mineralization. signiﬁcant differences differences Interestingly, among among the thecontrol, control,the Er:YAG-LI, semi-cylindrical Er:YAG-LI, and peeled portion wasanddiode-LI. observed diode-LI. in all wells (n = 6) of Er:YAG-LI. We also quantitatively analyzed PPU-7 calcium content (Figure 5B). On day 7 following mineralization induction, there were no significant differences among the control, Er:YAG-LI, and diode-LI.

Figure 5.5. Effect of LI onon mineralizationmineralization nodulenodule formationformation inin PPU-7.PPU-7. (A) NoduleNodule cultures withwith andand withoutwithout mineralization induction were stained with 1% AlizarinAlizarin RedRed SS onon dayday 7.7. NoduleNodule formationformation waswas apparentapparent inin PPU-7PPU-7 afterafter thethe twotwo laserlaser treatmentstreatments (Er:YAG-LI andand diode-LI),diode-LI), inin contrastcontrast toto cellscells not induced for mineralizationmineralization (Normal Med.). Mineralization nodules in PPU-7 also formed under mineralization induction conditions without LI (Control). (Control). ( (BB)) The calcium content of PPU-7 PPU-7 was was determined on on day day 7 7after after mineralization mineralization induction. induction. Values Values are the are means the means ± standard± standard error of 6 error culture of 6wells. culture wells.

Figure 5. Effect of LI on mineralization nodule formation in PPU-7. (A) Nodule cultures with and without mineralization induction were stained with 1% Alizarin Red S on day 7. Nodule formation was apparent in PPU-7 after the two laser treatments (Er:YAG-LI and diode-LI), in contrast to cells not induced for mineralization (Normal Med.). Mineralization nodules in PPU-7 also formed under mineralization induction conditions without LI (Control). (B) The calcium content of PPU-7 was determined on day 7 after mineralization induction. Values are the means ± standard error of 6 culture wells.

Int. J. Mol. Sci. 2018, 19, x FOR PEER REVIEW 7 of 23 Int. J. Mol. Sci. 2018, 19, 2429 7 of 22 2.5. Effect of LI on Protease Activation in Dental Pulp Tissue 2.5. EffectIn ofaddition LI on Protease to the above Activation cell-based in Dental experiments, Pulp Tissue we investigated the effect of LI on dental pulp tissues. Following LI, the minced pulp tissues were incubated with Ca2+ or EDTA, and extracted with In addition to the above cell-based experiments, we investigated the effect of LI on dental pulp Tris-guanidine buffer; the soluble fraction was analyzed by zymography (Figure 6). Protease activity tissues. Following LI, the minced pulp tissues were incubated with Ca2+ or EDTA, and extracted with was barely detected in a gelatin zymogel incubated with EDTA (Figure 6A, left). After gelatin Tris-guanidine buffer; the soluble fraction was analyzed by zymography (Figure6). Protease activity zymography incubation with Ca, LI enhanced the intensity of the four proteases, which have was barely detected in a gelatin zymogel incubated with EDTA (Figure6A, left). After gelatin molecular weights of approximately 110 kDa, 100 kDa, 65 kDa, and 55 kDa (Figure 6A, right). Figure zymography incubation with Ca, LI enhanced the intensity of the four proteases, which have molecular 6B shows the densitometry analysis of the four protease bands. The intensity level of the control (no weights of approximately 110 kDa, 100 kDa, 65 kDa, and 55 kDa (Figure6A, right). Figure6B shows LI) was set to 1.0, and the intensity of each protease band after Er:YAG-LI increased 1.52-fold for 110 the densitometry analysis of the four protease bands. The intensity level of the control (no LI) was set kDa, 1.23-fold for 100 kDa, and 1.14-fold for 55 kDa. There was little change between the control and to 1.0, and the intensity of each protease band after Er:YAG-LI increased 1.52-fold for 110 kDa, 1.23-fold Er:YAG-LI for the 65 kDa protease band. Likewise, the intensity level of each protease band after for 100 kDa, and 1.14-fold for 55 kDa. There was little change between the control and Er:YAG-LI for diode-LI increased 1.13-fold for 110 kDa, 1.65-fold for 100 kDa, 1.38-fold for 65 kDa, and 1.20-fold for the 65 kDa protease band. Likewise, the intensity level of each protease band after diode-LI increased 55 kDa. 1.13-fold for 110 kDa, 1.65-fold for 100 kDa, 1.38-fold for 65 kDa, and 1.20-fold for 55 kDa.

FigureFigure 6. Effect6. Effect of of LI LI on on porcine porcine dental dental pulp pulp tissues. tissues. (A ()A Zymogram) Zymogram using using a gelatine a gelatine gel gel as theas the substrate substrate 2+ incubatedincubated with with EDTA EDTA (left) (left) or Caor 2+Ca(right). (right). Ten Ten micrograms micrograms of of protein protein extracted extracted from from porcine porcine dental dental pulppulp tissues tissues were were used used for for zymography. zymography. ((BB)) DensitometryDensitometry analysis of of 110 110 kDa, kDa, 100 100 kDa, kDa, 65 65 kDa, kDa, and and55 55 kDa kDa protease protease bands. bands. The The intensity intensity of the proteaseprotease bandsbands on on the the gelatin gelatin zymogel zymogel was was determined determined usingusing ImageJ ImageJ software software and and normalized normalized to theto the intensity intensity of NLof NL to compareto compare the the effect effect of LI.of LI. NL: NL: without without LI;LI; Er: Er: Er:YAG-LI; Er:YAG-LI; Dl: Dl: diode-LI. diode-LI.

2.6.2.6. Effect Effect of LIof LI on on TGF- TGF-ββ Activation Activation SinceSince we we previously previously observed observed that that MMP2 MMP2 and and MMP11 MMP11 activate activate TGF- TGF-β1β1 in in porcine porcine dental dental pulp pulp tissuestissues and and odontoblasts odontoblasts [34 [34],], we we further further attempted attempted to to directly directly activate activate recombinant recombinant human-latent human-latent TGF-TGF-β1β1 (rh-latent (rh-latent TGF- TGF-β1)β1) with with Er:YAG Er:YAG and and diode diode lasers lasers by by measuring measuring ALP ALP activity activity in in human human periodontalperiodontal ligament ligament (HPDL) (HPDL) cells cells (see (see Appendix Appendix A.5 A.5 in in Appendix AppendixA) A) (Figure (Figure7). Following7). Following the the laser laser irradiationsirradiations and and HCl HCl treatment treatment (positive (positive control), control), we added we added the TGF- the βTGF-β11 sample sample to the to HPDL the HPDL cells and cells measuredand measured ALP activity ALP activity after 3 after days 3 of days incubation. of incubation. Although Although the rh-latent the rh-latent TGF-β TGF-β11 was activated was activated by HCl,by neitherHCl, neither laser irradiationslaser irradiations affected affected rh-latent rh-latent TGF-β TGF-β11 activation. activation.

Int. J. Mol. Sci. 2018, 19, 2429 8 of 22 Int. J. Mol. Sci. 2018, 19, x FOR PEER REVIEW 8 of 23

FigureFigure 7. 7. InIn vitro vitro activation of latent TGF-β1 TGF-β1 by by Er:YAG-LI Er:YAG-LI and diode-LI. ALP-inducing activity activity of of HPDLHPDL cells cells after after 3 3of of exposure exposure to Er:YAG to Er:YAG laser laser(Er:YAG-LI), (Er:YAG-LI), diode laser diode (Diode-LI), laser (Diode-LI), and HCl andtreatment HCl treatment(HCl) (n = (HCl) 6). No (n Laser: = 6). No control Laser: without control LI. without Values areLI. theValues mean are± thestandard mean error± standard (* p < 0.05,error Steel’s (* p < 0.05, test). Steel’s test). 3. Discussion 3. Discussion We have, so far, characterized the dentin non-collagenous proteins and the dynamics of TGF-β in dentin–pulpWe have, so complex far, characterized using pigs the as dentin an experimental non-collagenous model. proteins In order and to takethe dynamics advantage of ofTGF-β their ininformation, dentin–pulp we complex used the using same pigs animal as modelan experimental for the present model. study. In order to take advantage of their information,Low-power we used laser the irradiation same animal (LPLI) model promotes for the present proliferation study. by cellular stimulating signal pathwaysLow-power [35,36 ], laser and delaying irradiation cell (LPLI) differentiation promotes by inducingproliferation cell activation by cellular and stimulating proliferation signal [37]. pathwaysLow-power [35,36], Er:YAG-LI and delaying promotes cell osteoblastdifferentiation proliferation by inducing via cell the activation activation and of MAPK/ERKproliferation [37]. in a Low-powermouse-derived Er:YAG-LI osteoblastic promotes cell line osteoblast [38] and increases proliferation cell proliferation, via the activation differential of protein MAPK/ERK expression, in a mouse-derivedand ALP activity osteoblastic in human gingival cell line fibroblasts [38] and [ increases39,40] and cell HPDL proliferation, cells [41]. Low-power differential diode-LI protein expression,also boosts proliferationand ALP activity in human in human dental gingival pulp-derived fibroblasts fibroblast-like [39,40] and cells HPDL [42] cells and in[41]. human Low-power cervical diode-LIcancer-derived also boosts cells (HeLa proliferation cells) [43 in]. Using human human dental periodontal pulp-derived ligament fibroblast-like (HPDL) cells, cells we [42] previously and in humanshowed cervical that Er:YAG-LI cancer-derived significantly cells (HeLa increased cells) the [43]. cell Using growth human at day periodontal 3 (Figure A4 ligament)[41]. However, (HPDL) cells,this result we previously led us to investigateshowed that the Er:YAG-LI cell growth significantly rate up to increased day 3 (i.e., the day cell 1 andgrowth day at 2) day following 3 (Figure the A4)laser [41]. irradiation. However, In this the result present led study us to using investigate PPU-7 the cell cell line, growth we demonstrated rate up to day that 3 the(i.e., cell day growth 1 and day rate 2)after following Er:YAG-LI the waslaser slow irradiation. on day 1,In and the thepresent cell population study using doubling PPU-7 timecell line, was we increased. demonstrated This finding that thesuggests cell growth that Er:YAG-LI rate after Er:YAG-LI affects the was cell growthslow on rightday 1, after and laserthe cell irradiation. population Moreover, doubling wetime found was increased.that the cell This growth finding rate suggests after Er:YAG-LI that Er:YAG-LI and diode-LI affects wasthe cell different growth between right after the twolaser LIs irradiation. on day 1, Moreover,although the we cellfound number that the was cell the growth almost rate same. after This Er:YAG-LI finding may and suggest diode-LI that was part different of the cell,between after theEr:YAG-LI, two LIs on ismoving day 1, although towards the apoptosis, cell number besides was the the cell almost growth. same. Thus, This we finding demonstrated may suggest that boththat partEr:YAG-LI of the andcell, diode-LIafter Er:YAG-LI, promoted is proliferationmoving towards in PPU-7, apoptosis, although besides the the cell cell growth growth. rate upThus, to daywe demonstrated3 was different that between both Er:YAG-LI the two LIs. and This diode-LI finding promoted suggests proliferation that each LI in may PPU-7, affect although metabolic the ratecell growthearly in rate cell differentiation,up to day 3 was in different addition between to the difference the two inLIs. the This irradiation finding period,suggests time, that andeach output LI may of affectboth lasers.metabolic rate early in cell differentiation, in addition to the difference in the irradiation period, time, Inand addition output of to both promoting lasers. proliferation, high-fluence LPLI inhibits cell viability and induces apoptosisIn addition [35,44 , to45 ]. promoting It has been proliferation, shown that high-fluence low-power LPLI HeNe inhibits irradiation cell viability induces apoptosis and induces by apoptosisaccelerating [35,44,45]. Ca2+ uptake It has into been the shown mitochondria that low-power [46]. Both HeNe histopathologic irradiation and induces proteomic apoptosis analyses by acceleratinghave revealed Ca that2+ uptake Er:YAG-LI into the causes mitochondria apoptosis [46]. in the Both skin histopathologic [47]. Diode-LI and has proteomic also been shownanalyses to haveinduce revealed apoptosis that in Er:YAG-LI human retinal causes pigment apoptosis epithelial in the [48 ].skin We [47]. previously Diode-LI showed has also that thebeen morphology shown to induceof HPDL apoptosis cells at day in 2 human following retinal Er:YAG-LI pigment possessed epithelial theirregular [48]. We forms previously compared showed to that of that control the morphology(i.e., no laser of irradiation) HPDL cells (Figure at day A42 following)[41]. This Er:YAG-LI result led possessed us to investigate the irregular apoptosis forms study compared in detail. to thatIn the of presentcontrol study,(i.e., no although laser irradiation) the rate of (Figure apoptosis A4) induced [41]. This by result laser irradiationled us to investigate varies by laserapoptosis type, studyoutput, in irradiationdetail. In the distance, present and study, irradiation although time, the rate our inof vitroapoptosisstudy induced demonstrated by laser that irradiation Er:YAG-LI varies and by laser type, output, irradiation distance, and irradiation time, our in vitro study demonstrated that Er:YAG-LI and diode-LI for PPU-7 cause approximately 14.2% and 6.8% apoptosis, respectively, at

Int. J. Mol. Sci. 2018, 19, 2429 9 of 22 diode-LI for PPU-7 cause approximately 14.2% and 6.8% apoptosis, respectively, at day 3. Our results suggest that each LI has distinct effects on intrinsic apoptotic pathways via mitochondrial changes. In general, caspase-3 plays a key role in the execution phase of cell apoptosis via extrinsic, intrinsic, or perforin/granzyme pathways [49,50]. Surprisingly, caspase-3 upregulates compensatory cell growth by inducing the production of prostaglandin E2 [51,52]. In fact, we demonstrated that PPU-7 cells were able to proliferate, although the rates of cell growth and apoptosis on days 1 and 3 following LI varied, depending upon the laser characteristics. This suggests that VPT using a laser helps dental pulp cells adapt to an environment of harmful side-effects, such as apoptosis. In rat molars, diode-LI increased dentin matrix protein 1 (DMP1) and osteopontin mRNA expression in the coronal pulp, followed by the formation of reparative dentin and the co-localization of DMP1 and osteopontin immunoreactivity at the site at which this tissue first appeared [53]. We previously generated two PCR amplification products from full-length DSPP (Dspp-v1) and DSP-only (Dspp-v2) transcripts. Both Dspp-v1 and Dspp-v2 products are predominantly expressed in odontoblasts, with only trace expression of the Dspp-v1 transcript detected in dental pulp, and Dspp-v2 transcript is predominantly expressed in dental pulp [54]. This study demonstrated that diode-LI enhanced the expression of both Dspp mRNAs, especially Dspp-v2, but Er:YAG-LI did not contribute substantially. Our findings suggest that diode-LI have more dominant potency to induce the gene expression of dentin non-collagenous proteins. In addition to the expression of dentin non-collagenous proteins, MMP mRNA is also expressed in pulp and odontoblasts, where MMPs play an important role in dentin matrix formation. MMP2, MMP3, MMP8, MMP9, MMP14, and MMP20 are the main MMPs that have been identified in pulp, odontoblasts, and predentin/dentin [55–60]. Our previous study showed that Mmp11, and both Mmp2 and Mmp20 mRNAs, are predominantly expressed in porcine dental pulp tissues and odontoblasts, respectively [34]. In this study, we demonstrated that Er:YAG-LI enhanced Mmp2 mRNA in PPU-7 cells, whereas diode-LI increased Mmp20 expression. Judging from the expression of the two Dspp mRNAs, it is likely that odontoblastic gene expression in PPU-7 is regulated by the reactivity of cells based on the specific characteristics of two lasers. ALP is believed to be the initial marker of mesenchymal cell differentiation into hard tissue-forming cells, such as osteoblasts or odontoblasts [61,62]. We demonstrated that both LIs enhanced ALP activity in PPU-7. Considering that both LIs reduced the expression of osteoblastic and chondrocytic marker genes, our findings suggest that LI induces the differentiation of PPU-7 into odontoblast-like cells. Alizarin Red S staining has been widely used to evaluate calcium deposits in cell cultures [63]. We found that Er:YAG-LI was likely to damage a portion of the cell. When we repeated this experiment with the Er:YAG laser (n = 5), the same phenomenon was observed (data not shown). It is currently unknown if this damage was caused by human error during the laser treatment or by characteristics of the laser (i.e., the Er:YAG laser is absorbed on the tissue surface, whereas the diode laser is transmitted to the internal tissue). Interestingly, we also demonstrated that there were few differences in the amount of calcium deposits between the two LIs. Although both LIs exhibited minimal effect on mineralization induction, our data suggest that Er:YAG-LI might cause transient or persistent cell shrinkage. TGF-β is a potent regulator of cell growth, cell differentiation, and extracellular matrix deposition [64]. There are three TGF-β isoforms (TGF-β1, TGF-β2 and TGF-β3) in mammals, which stimulate matrix secretion in odontoblasts, are mitogenic to pulp cells, and possess a potential inductive effect for dental pulp cell differentiation [65]. We previously separated protein samples obtained from dental pulp tissue into four fractions. TGF-β1 activity, in vivo, was detected in the fourth fraction using the ALP-HPDL system (Figure A5). TGF-β was activated by acid [66], and MMP proteolytic degradation of the latent TGF-β complex [67,68]. Our previous study showed that the active forms of two MMPs (MMP2 and MMP11) are present in dental pulp tissues (Figure A5). Moreover, our previous in vitro study showed that the incubation of rh-latent TGF-β1, without rhMMP2 or rhMMP11, exhibited only trace levels of ALP-inducing activity, whereas treatment with rhMMP2 or Int. J. Mol. Sci. 2018, 19, 2429 10 of 22 rhMMP11 enhanced the ALP-inducing activity (Figure A6), and active forms of TGF-β1 enhance the expression of Dspp-v1, Dspp-v2, and Mmp20 genes by activated TGF-β1 [34]. In this study, we found that both Er:YAG-LI and diode-LI were involved in the activation of four MMPs in dental pulp tissues. This finding led us to confirm that LI can activate latent TGF-β directly, or via MMP activation. Our preliminary study showed that ALP activity was inhibited when HPDL cells were cultured with MMP2 inhibitor for 5 days after Er:YAG-LI (Figure A7). This result suggests that the activated MMP2 by laser irradiation is further activated TGF-β. In addition, our previous study showed that rh-latent TGF-β1 is not directly activated by Er:YAG-LI [41] in HPDL cells. This in vitro study demonstrated that laser irradiation might not affect the activation of rh-latent TGF-β1 in HPDL cells. Considering the qPCR analysis and ALP assay shown in Figures3 and4, our findings suggest that both LIs possess indirect differentiation-promoting effects on odontoblasts through the enhancement of odontoblastic gene expression by the activation of MMPs. Further studies are required to investigate the canonical and/or non-canonical TGF-β pathway, for better understanding how both human and porcine cells responded to both LIs in the same manner.

4. Methods All of the animal experiments were approved by the Institutional Animal Care Committee and the Recombination DNA Experiment and Biosafety Committee of the Tsurumi University School of Dental Medicine. (Project identiﬁcation code #1318, 1 December 2015).

4.1. LI of Porcine Dental Pulp Cells (PPU-7) The cell line (PPU-7) was established from porcine dental pulp cells by our group (see Appendix A.4 in the AppendixA). PPU-7 cells were plated on a 96-well plate (Corning Inc., Corning, NY, USA) at a density of 1 × 104 cells/well or on chamber slides (Matsunami Glass Ind., LTD., Osaka, Japan) at a density of 1 × 104 cells/well. Cells were cultured in standard medium for 24 h. For genetic studies, subconﬂuent PPU-7 cells were irradiated with a Er:YAG laser (Erwin AdvErL, Morita, Kyoto, Japan) at 50 mJ (10 pps) for 10 s, or a high-power diode laser (OSADA LIGHTSURGE SQUARE5, Osada, Tokyo, Japan) with a 1W continuous wave for 10 s on a 96 well plate. For immunohistochemical studies, subconﬂuent PPU-7 cells were irradiated with an Er:YAG laser at 50 mJ (10 pps) for 30 s or a high-power diode laser with a 1W continuous wave for 30 s on the chamber slide. All laser irradiations on PPU7 cells were carried out without medium, at a distance of 2 cm, in sweeping motion. PPU-7 cells not exposed to LI were used as a control. PPU-7 cells were incubated for 1 or 3 days, and characterized by MTS assay, apoptosis detection, qPCR, and ALP assay.

4.2. Cell Proliferation Assay The cells were plated on 96-well plates (n = 6) at a density of 1500 cells/well in standard medium, ◦ and cultured at 37 C in a humidiﬁed 5% CO2 atmosphere. The culture medium was changed every other day. The proliferation rate of the cells on six 96-well plates was determined on days 1, 2, 3, and 5 using a CellTiter 96®AQuous One Solution Cell Proliferation Assay (MTS assay) (Promega Corporation, Madison, WI, USA).

4.3. Assessment of Apoptosis by Immunohistochemistry On day 1 and 3 after LI, PPU-7 cells on chamber slides were fixed with 4% paraformaldehyde for 15 min at room temperature and incubated in a blocking solution (1% BSA, 10% normal goat serum) for 1 h at room temperature. For primary antibody application, the dilution of anti-cleaved caspase-3 monoclonal antibody (Cell Signaling, Danvers, MA, USA) was used at 1:500, and the cells were incubated overnight at 4 ◦C. For secondary antibody application, diluted HRP-conjugated goat anti-rabbit IgG H&L antibody (abcam, Cambridge, UK) was used at 1:500, and the cells were incubated for 1 h at room temperature. The positive signal was detected using 3,3-diaminobenzidine (DAB) (TaKaRa, Kusatsu, Japan) as a staining substrate. Sections were counterstained to observe clear tissue Int. J. Mol. Sci. 2018, 19, 2429 11 of 22 and cell morphology using hematoxylin. Light micrographs were obtained using a Canon EOS Kiss X8i (Canon, Tokyo, Japan) camera on an optical microscope (OLYMPUS BX50, Olympus, Tokyo, Japan). The number of apoptotic cells present on a chamber slide expressed as a fraction of the total number of cells, named the “apoptotic index,” was used to evaluate apoptotic state. The number of activated caspase-3-labeled apoptotic cells and bodies was calculated in 30 high power fields (HPFs; objective X400, field diameter 640 µm). The apoptotic index was calculated as the percentage of the whole PPU-7 population.

4.4. Quantitative Polymerase Chain Reaction (qPCR) Analysis RNA from PPU-7 cells on day 3 after LI was extracted using a High Pure RNA Isolation Kit (Roche Diagnostics GmbH, Mannheim, Germany). After the purified total RNA (6 µL) was reverse transcribed, a reaction mixture containing SYBR Green PCR master mix (Roche), supplemented with 0.5 µM forward and reverse primers, and 2 µL cDNA as a template was made. The specific primer sets were designed using Primer-BLAST software (available online: http://www.ncbi.nlm.nih.gov/tools/primer-blast). The specific primer sets and running conditions are shown in Table A1 in the AppendixA. GAPDH was used as a reference gene. The normalization of each ratio using relative MMP quantification data (Mmp2 and Mmp20), two DSPP variants (Dspp-v1 and Dspp-v2), Runx 2, OC, Col II, and TGF-βs (TGF-β1, TGF-β2, and TGF-β3) in comparison to a reference gene (Gapdh) was generated based on a mathematical model for the relative quantification of qPCR. All of the values are represented as the means ± standard error (SEM). Statistical significance (*) was determined using a Mann–Whitney U test. In all cases, p < 0.05 was regarded as statistically significant.

4.5. ALP Assay PPU-7 cells were plated on a 96 well plate at a density of 3.16 × 104 cells/cm2, and cultured in standard medium for 24 h. The ALP activity of each well was measured as described previously [69]. The cells on day 3 after LI were washed once with phosphate buffered saline (PBS), and ALP activity was assayed using 10 mM p-nitrophenylphosphate as the substrate in 100 mM 2-amino-2-methyl-1,3-propanediol-HCl buffer (pH 10.0) containing 5 mM MgCl2 and incubated for 5 min at 37 ◦C. Adding 0.2 M NaOH quenched the reaction, and the absorbance at 405 nm was read on a plate reader.

4.6. Formation of Precipitated Nodules in PPU-7 Cells PPU-7 cells were grown on a 48 well plate at an initial density of 3.16 × 104 cells/cm2 and cultured in standard medium for 24 h. Following LI, the medium was changed to mineralization-inducing medium containing 10 mM β-glycerophosphate and 50 µM ascorbic acid. The cells were further cultured up to day 7, and mineralization was visualized using Alizarin Red S staining. After ﬁxation with a 4% paraformaldehyde neutral buffer solution for 30 min, the cells were stained with 1% Alizarin Red S (Sigma-Aldrich, St. Louis, MO, USA) solution for 10 min, washed with distilled water, and photographed. Additionally, PPU-7 cells were grown on a 48-well plate at an initial density of 3.16 × 104 cells/cm2. After incubation for 24 h, the medium was changed to mineralization medium, and the cells were cultured up to day 7. Each well on the plates was rinsed with PBS, and Ca2+ was dissolved in 0.2 mL of 0.5 N HCl by gentle rocking for 1 h. The calcium concentration in the eluate was spectrophotometrically determined at 570 nm by following color development with a Ca2+ assay kit (Calcium C-Test Wako, Wako Pure Chemical Industries, Ltd., Osaka, Japan). All of the values were normalized against the cultivation area.

4.7. LI of Porcine Dental Pulp Tissues and Protein Extraction Tooth germs of permanent molars were surgically extracted from the mandible of deceased 5-month-old pigs (n = 10) within one hour after slaughter from the Meat Market of the Metropolitan Central Wholesale Market (Shinagawa, Tokyo, Japan). Pulp tissue (17 g) pulled from tooth germs Int. J. Mol. Sci. 2018, 19, 2429 12 of 22 was briefly rinsed in ice-cold sterile PBS to remove blood cells, and minced with a surgical blade. Minced pulp tissue (1 g each) was irradiated with an Er:YAG laser at 50 mJ (10 pps) for 60 s or a high-power diode laser with a 1W continuous wave for 60 s on a petri dish. The pulp sample was transferred into a conical tube (15 mL) and incubated in 5 mL of 50 mM Tris-HCl buffer (pH 7.4) ◦ containing 10 mM CaCl2 or 10 mM EDTA for 20 h at 37 C. Following incubation, the buffer was removed by centrifugation, and the pulp tissues were suspended in 50 mM Tris-HCl/4 M guanidine buffer (pH 7.4) containing protease inhibitor cocktail (23 mM 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF), 100 mM EDTA, 2 mM bestatin, 0.3 mM E-64 and 0.3 mM pepstatin A (Sigma-Aldrich)) and homogenized using a PHYSCOTRON micro-homogenizer (MICROTEC, Co., Ltd., Funabashi, Chiba, Japan), for 30 s at half speed. Insoluble material was pelleted by centrifugation (15,900 g). The supernatant was desalted with an Amicon Ultra centrifugal filter (0.5 mL, MW = 3000 cut off) (Merck Millipore, Darmstadt, Germany) and characterized by SDS-PAGE and zymography.

4.8. Zymography Zymography was performed using Novex 10% Zymogram Gelatin Gel (Life Technologies/Invitrogen/Thermo Fisher Scientiﬁc, Waltham, MA, USA) or Precast Casein Zymogram Gel (Cosmo Bio Co., LTD., Tokyo, Japan). Samples were dissolved in NuPAGE LDS sample buffer (Invitrogen), and electrophoresis was performed at 30 mA for approximately 1 h with Novex Tris Glycine SDS running buffer (Life Technologies/Invitrogen/Thermo Fisher Scientiﬁc). The gel was shaken gently in 2.5% Triton X-100 solution for 1 h at room temperature with one buffer change, and incubated overnight with or without 10 mM EDTA in 50 mM Tris–HCl (pH 7.4) containing 10 mM CaCl2. Proteinase activities were visualized as unstained bands after the gel was stained with Coomassie Brilliant Blue R-250 (CBB) (Bio-Rad Laboratories, Hercules, CA, USA). The apparent molecular weights of the protein bands were estimated by comparison with DynaMarker Protein MultiColor III (BioDynamics Laboratory Inc., Tokyo, Japan).

4.9. In Vitro Activation of Latent TGF-β1 by LI Recombinant human latent TGF-β1 (rh-latent TGF-β1, Cell Signaling Technology, Danvers, MA, USA) was added to a 96 well plate at a concentration of 125 ng/25 µL, and irradiated with an Er:YAG laser at 50 mJ (10 pps) for 10 s, or a high-power diode laser with a 1W continuous wave for 10 s. In addition, rh-latent TGF-β1 (100 ng/20 µL) was incubated with 20 µL of 0.1 N HCl for 1 h at room temperature in a microtube. Following laser irradiation or HCl treatment, rh-latent TGF-β1 was added to subconﬂuent HPDL cells (1.0 × 104 cells/well on 96 well plate) at a ﬁnal concentration of 3.2 ng/mL. Following incubation for 3 days, each reaction sample was characterized using the ALP-HPDL system (see Appendix A.5 in the AppendixA).

4.10. Statistical Analysis For the MTS and ALP assays, AIs, and qPCR and calcium analyses, all of the values are represented as the means ± standard errors. Statistical signiﬁcance (*) was determined using a Mann–Whitney U test for qPCR analysis and a nonparametric Steel’s test for the MTS and ALP assays and the AIs and calcium analysis. In all of the tests, p < 0.01 for MTS and ALP assays and p < 0.05 for AIs, qPCR and calcium analyses were regarded as statistically signiﬁcant.

5. Conclusions During dental treatment with lasers, it is necessary to understand the mechanism of reparative dentin formation. We summarize the potential biological reaction mechanism of the cellular response to Er:YAG and diode lasers in porcine dental pulp cells and tissues in Figure8. Beside apoptosis, both Er:YAG and diode lasers activate some MMPs in dental pulp. Alternatively, Er:YAG laser enhances the expression and presumably production of Mmp2. Activated MMPs are further involved in the activation of latent TGF-β1, followed by the differentiation of odontoblasts Int. J. Mol. Sci. 2018, 19, 2429 13 of 22 and the enhancement of odontoblastic gene expression by activated TGF-β1. Moreover, both lasers promote the differentiation of odontoblasts and the expression of odontoblastic-marker genes through otherInt. J. factors. Mol. Sci. 2018 In, endodontic 19, x FOR PEER therapy, REVIEW the present study helped elucidate how reparativedentin 13 of 23 is formed by laser treatment for pulp exposure. Further studies are required to understand TGF-β signalingunderstand downstream TGF-β signaling molecules downstream (i.e., canonical molecules and/or (i.e., non-canonical canonical TGF- and/orβ pathway) non-canonical and elucidate TGF-β thepathway) morphological and elucidate and histological the morphological efﬁcacy ofand lasers histological in animal efficacy experiments. of lasers Moreover,in animal experiments. it is necessary to expandMoreover, the it experiments is necessary to with expand human the cells.experiments with human cells.

FigureFigure 8. Proposed8. Proposed biological biological reaction reaction mechanism mechanism in porcine dental dental pulp pulp cells cells and and tissues tissues induced induced byby Er:YAG-LIEr:YAG-LI and and diode-LI. diode-LI.

Author Contributions: Conceptualization, S.Y., Y.Y. and N.H.; Formal Analysis, T.N., K.K., R.Y., R.C. and T.K.; AuthorInvestigation, Contributions: S.Y. andConceptualization, Y.Y., Data Curation, S.Y., S.Y.,Y.Y. and T.N., N.H.; T.K., Formal R.Y., R.C. Analysis, and Y.Y.; T.N., Writing-OriginalK.K., R.Y., R.C.and Draft T.K.; Investigation,Preparation, S.Y. S.Y. and and Y.Y., Y.Y.; Data Writing-Review Curation, S.Y., & Editing, T.N., T.K., Y.Y. R.Y., R.C. and Y.Y.; Writing-Original Draft Preparation, S.Y. and Y.Y.; Writing-Review & Editing, Y.Y. Funding: This study was supported by a JSPS KAKENHI Grant-in-Aid for Scientific Research (C26462982, Funding: This study was supported by a JSPS KAKENHI Grant-in-Aid for Scientific Research (C26462982, 15K11233,15K11233, 17K11975 17K11975 and and 18K09630) 18K09630) and and the the MEXT-Supported MEXT-Supported Program for for the the Strategic Strategic Research Research Foundation Foundation at at PrivatePrivate Universities Universities (S1511018). (S1511018). Acknowledgments:Acknowledgments:We We thank thank Drs. Drs. Ichiro Ichiro Saito Saito from from the the Department Department of of Pathology Pathology and and Yoshinobu Yoshinobu Asada Asada from from the Departmentthe Department of Pediatric of Pediatric Dentistry Dentistry at the Schoolat the School of Dental of Dental Medicine, Medicine, Tsurumi Tsurumi University University for their forsupport. their support. We also thankWe Showaalso thank Yakuhin Showa Kako Yakuhin Co. Ltd.Kako (Tokyo, Co. Ltd. Japan) (Tokyo, for Japan) their help.for their We help. thank We Dr. thank Hiroyasu Dr. Hiroyasu Yamaguchi Yamaguchi from the Departmentfrom the Department of General Dentistryof General and Dentistry Clinical and Education Clinical Education at the School at the of DentalSchool of Medicine, Dental Medicine, Tsurumi Tsurumi University (Tsurumi,University Yokohama, (Tsurumi, Japan), Yokohama, who servedJapan), aswho a scientific served as advisor. a scientific advisor. Conflicts of Interest: The authors declare no conflict of interest. Conflicts of Interest: The authors declare no conflict of interest. Abbreviations Abbreviations

MTS 3-[4,5,dimethylthiazol-2-yl]-5-[3-carboxymethoxy-phenyl]-2-[4-sulfophenyl]-23-[4,5,dimethylthiazol-2-yl]-5-[3-carboxymethoxy-phenyl]-2-[4-sulfophenyl]-2H-tetrazoliumH-tetrazolium inner MTS mRNA messengerinner ribonucleic acid qPCRmRNA quantitative messenger polymerase ribonucleic chain acid reaction EDTAqPCR ethylenediaminetetraacetic quantitative polymerase acid chain reaction SDSEDTA sodium ethylenediaminetetraacetic dodecyl sulfate acid PAGESDS polyacrylamide sodium dodecyl gel electrophoresis sulfate kDaPAGE kilodalton polyacrylamide gel electrophoresis HeNekDa helium-neon kilodalton HeNe helium-neon HPFs high-power ﬁelds HPFs high-power fields GAPDH glyceraldehyde-3-phosphate dehydrogenase GAPDH glyceraldehyde-3-phosphate dehydrogenase

Int. J. Mol. Sci. 2018, 19, 2429 14 of 22

Appendix A

Appendix A.1. Immortalization of Porcine Pulp Cells and ALP Expression We established porcine dental pulp-derived cell lines using the porcine animal model. Following the transfection with pSV3-neo plasmid, we incubated over 20 G418-resistant colonies. However, as most of the cell growth was stopped, we selected 8 clones (PPU-1, -3, -7, -10, -12, -16, -17, and -18). The immortalized pulp cells’ morphology was ﬁbroblast-like (Figure A1A). Since alkaline phosphatase (ALP) has been believed to be the initial marker for the differentiation of mesenchymal cells into hard tissue-forming cells, such as osteoblasts or odontoblasts [61,62], we determined the inherent ALP activity of the eight immortalized pulp cell lines. Both PPU-3 and PPU-7 cell lines possessed high inherent ALP activity, whereas the PPU-16 cell line had a trace of ALP activity (Figure A1B). We further investigated the effects of BMP2 and TGF-β1 on ALP activity of eight immortalized pulp cells along with the determination of inherent ALP activity. The addition of BMP2 enhanced an increasing ratio of ALP activity in PPU-10 (~1.5-fold) and PPU-16 (~2.2-fold) cell lines, when the activity of control (i.e., when eight immortalized pulp cells were cultured without any cytokines) was 1 (Figure A2A). When we cultured those two cell lines with BMP2 and LDN-193189, which is a selective BMP signaling inhibitor, the ALP activity level was decreased to below baseline. ALP activity of other cell lines (PPU-1, -3, -7, -12, -17, and -18) with the addition of BMP2 was almost baseline levels. Although PPU-16 possessed the lowest ALP activity of the eight clones, it showed the highest increase in ALP activity in response to BMP2. In contrast, the addition of TGF-β1 decreased ALP activity in each pulp cell below baseline (Figure A2B). When we cultured each pulp cell with TGF-β1 and SB431542, which is a speciﬁc and selective inhibitor of TGF-β type I activating receptor-like kinase (ALK) receptors, the ALP activity was restored to near baseline levels. Based on these experimental results, we selected two cell lines: PPU-7, possessing the high inherent ALP activity, andInt. PPU-16, J. Mol. Sci. showing 2018, 19, x FOR the PEER high REVIEW reactivity for BMP2. 15 of 23

Figure A1. Cont.

Figure A1. Morphology and inherent alkaline phosphatase (ALP) activity of porcine dental pulp- derived cell lines. (A) Eight dental pulp-derived cell lines (PPU-1, -3, -7, -10, -12, -16, -17, and -18) are shown. Bars = 50 μm. (B) Inherent ALP activity of the respective cell lines. Data bars are means ± standard error (SEM) of 6 culture wells.

Figure A2. Effect of BMP2 and TGF-β1 on inherent ALP activity of porcine dental pulp-derived cell lines. Effect of (A) BMP2 with or without LDN-193189, and (B) TGF-β1 with or without SB431542. Values of inherent ALP activity are indicated as the fold increase, when the activity of the control was 1. Data are means ± standard error (SEM) of 6 culture wells (* p < 0.05).

Int.Int. J. Mol.J. Mol. Sci. Sci. 2018 2018, 19, 19, x, FORx FOR PEER PEER REVIEW REVIEW 15 15 of of 23 23

Int. J. Mol. Sci. 2018, 19, 2429 15 of 22

Figure A1. Morphology and inherent alkaline phosphatase (ALP) activity of porcine dental pulp- FigureFigure A1.A1. MorphologyMorphology and and inherent inherent alkaline alkaline phosphatase phosphatase (ALP) (ALP) activity activity of porcine of porcine dental dental pulp- derived cell lines. (A) Eight dental pulp-derived cell lines (PPU-1, -3, -7, -10, -12, -16, -17, and -18) are pulp-derivedderived cell lines. cell lines.(A) Eight (A )dental Eight pulp-derived dental pulp-derived cell lines cell (PPU-1, lines -3, (PPU-1, -7, -10, -3,-12, -7, -16, -10, -17, -12, and -16, -18) -17, are shown. Bars = 50 μm. (B) Inherent ALP activity of the respective cell lines. Data bars are means ± andshown. -18) areBars shown. = 50 μm. Bars (B =) 50Inherentµm. (B ALP) Inherent activity ALP of activitythe respective of the respective cell lines. cellData lines. bars Data are barsmeans are ± standard error (SEM) of 6 culture wells. meansstandard± standard error (SEM) error of (SEM)6 culture of 6 wells. culture wells.

FigureFigureFigure A2. A2.A2. EffectEffect Effect of ofof BMP2 BMP2BMP2 and and and TGF-β1 TGF- TGF-β1β 1on onon inherent inherentinherent ALP ALPALP activity activityactivity of ofof porcine porcineporcine dental dentaldental pulp-derived pulp-derivedpulp-derived cell cellcell lines.lines.lines. Effect EffectEffect of ofof (A ((A)A )BMP2) BMP2BMP2 with withwith or oror without withoutwithout LDN-193189, LDN-193189,LDN-193189, and andand (B ((B)B )TGF-β1) TGF-TGF-β1β 1with withwith or oror without withoutwithout SB431542. SB431542.SB431542. ValuesValuesValues of of of inherent inherent inherent ALP ALP ALP activity activity activity are are are indicated indicated indicated as as the the fold fold increase, increase, when when thethe the activityactivity activity ofof of thethe the controlcontrol control waswas was 1. 1.Data 1.Data Data are are are means means means± ± standardstandard± standard errorerror error (SEM)(SEM) (SEM) ofof of 66 cultureculture6 culture wellswells wells (*(* p (*p<

Appendix A.2. Cell Proliferation Rate We investigated the effects of BMP2 and TGF-β1 on cell proliferation in the PPU-7 and PPU-16 cell lines and expressed cell density using a semi-logarithmic scale to judge the logarithmic growth phase by linearity (Figure A3A). TGF-β1 treatment inhibited the cell proliferation in both PPU-7 and PPU-16 cell lines, whereas BMP2 treatment inhibited the cell proliferation in PPU-7 cell line only. No significant differences were observed between the control and BMP2 treatment in the PPU-16 cell line. Compared with the control, the cell population doubling time of PPU-7 increased significantly with BMP2 or TGF-β1 treatment (Figure A3B). TGF-β1 treatment significantly increased the doubling time of the PPU-16 cell line, but BMP2 treatment did not (Figure A3B).

Appendix A.2. Cell Proliferation Rate We investigated the effects of BMP2 and TGF-β1 on cell proliferation in the PPU-7 and PPU-16 cell lines and expressed cell density using a semi-logarithmic scale to judge the logarithmic growth phase by linearity (Figure A3A). TGF-β1 treatment inhibited the cell proliferation in both PPU-7 and PPU-16 cell lines, whereas BMP2 treatment inhibited the cell proliferation in PPU-7 cell line only. No significant differences were observed between the control and BMP2 treatment in the PPU-16 cell line. Compared with the control, the cell population doubling time of PPU-7 increased significantly with BMP2 or TGF-β1 treatment (Figure A3B). TGF-β1 treatment significantly increased the doubling time of the PPU-16 cell line, but BMP2 treatment did not (Figure A3B).

Appendix A.3. Gene Expression in PPU-7 and PPU-16 Cell Lines Gene expression of a panel of odontoblastic markers in both PPU-7 and PPU-16 cell lines at 1, 3, and 7 days following BMP2 or TGF-β1 treatments was analyzed by qPCR (Figure A3C). We amplified two products from the full-length Dspp transcript: a segment containing the DGP+DPP coding region (DSPP-v1), and a smaller segment specific for the DSP-only transcript (DSPP-v2). In addition to those dentin markers, we checked the expression of ALP as the initial marker for the differentiation of dental pulp cells. Expression levels of DSPP-v1, DSPP-v2, and ALP in PPU-7 cell line were higher Int.than J. Mol.those Sci. in2018 PPU-16, 19, 2429 cell line throughout the culture period. Comparing the effects of BMP216 ofand 22 TGF-β1, both BMP2 and TGF-β1 treatments upregulated both DSPP-v1 and DSPP-v2 expression levels in PPU-7 cell line at 7 days. Both BMP2 and TGF-β1 treatments also gradually upregulated β lineALP at expression 7 days. Both level BMP2 in the and PPU-7 TGF- cell1 treatmentsline, but TGF-β1 also gradually treatment upregulated did not affect ALP the expression PPU-16 cell level line. in β theThus, PPU-7 based cell upon line, all but the TGF- above1 treatmentresults, we did selected not affect PPU-7 the cell PPU-16 line for cell the line. present Thus, study. based upon all the above results, we selected PPU-7 cell line for the present study.

Figure A3. EffectEffect ofof BMP2BMP2 and and TGF- TGF-β1β1 on on proliferation proliferation and and gene gene expression expression of PPU-7of PPU-7 and and PPU-16 PPU-16 cell celllines. lines. (A) Cell(A) densityCell density plotted plotted on a semi-logarithmicon a semi-logarithmic scale wasscale used was to used judge to the judge logarithmic the logarithmic growth phasegrowth by phase linearity, by linearity, which was which determined, was determined, in turn, every in turn, day every for 6 day days. for (B 6) days. Cell population (B) Cell population doubling doublinglevel against level days against in culture days followingin culture transfection.following transfection. Data are means Data± arestandard means ± error standard (SEM) error of 6 culture(SEM) wells.of 6 culture BMP2 wells. and TGF- BMP2β1 and in PPU-7 TGF-β1 or BMP2in PPU-7 in PPU-16 or BMP2 significantly in PPU-16 requiredsignificantly time required (* p < 0.05). time (C (*) Thep < 0.05).mRNA (C expression) The mRNA by expression qPCR analysis by qPCR of DSPP-variant analysis of DSPP-variant 1 (DSPP-v1, 1left), (DSPP-v1, DSPP-variant left), DSPP-variant 2 (DSPP-v2, 2 (DSPP-v2,middle), and middle), ALP (right). and ALP Each (right).ratio was Each normalized ratio was to glyceraldehyde-3-phosphate normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a reference gene, and the relative quantification data of DSPP-v1, DSPP-v2, and ALP in PPU-7 or PPU-16 were generated on the basis of a mathematical model for relative quantification in a qPCR system (n = 6 PPU-7 or PPU-16). All expression levels are indicated as the increasing or decreasing ratio, when the mRNA level of control (Day 1) was 1. Data are means ± standard error (SEM) (* p < 0.05). N.D.: not determined.

dehydrogenase (GAPDH) as a reference gene, and the relative quantification data of DSPP-v1, DSPP- v2, and ALP in PPU-7 or PPU-16 were generated on the basis of a mathematical model for relative quantification in a qPCR system (n = 6 PPU-7 or PPU-16). All expression levels are indicated as the increasing or decreasing ratio, when the mRNA level of control (Day 1) was 1. Data are means ± standard error (SEM) (* p < 0.05). N.D.: not determined.

Appendix A.4. Cell Line Isolation, Transfection, and Establishment from Porcine Dental Pulp Cells Tooth germs of permanent incisors were surgically extracted from the mandibles of deceased 5- month-old pigs (n = 10) within one hour after slaughter from the Meat Market of Metropolitan Central Wholesale Market (Shinagawa, Tokyo, Japan). Pulp tissue pulled out from tooth germs was briefly rinsed in ice-cold sterile PBS to remove blood cells, minced with a surgical blade, and digested in a solution of 0.1% collagenase and 0.2% dispase II (Wako Pure Chemical Industries, Osaka, Japan) for 1 h at 37 °C with gentle shaking. The released cells were passed through a 70 μm cell strainer (BD Falcon, Bedford, MA, USA) and washed three times with PBS by centrifugation. The cells were then cultured in alpha Minimum Essential Medium (αMEM) (Gibco/Life Technologies, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS) and antibiotics (50 U/mL of penicillin, 50 μg/mL of Int. J. Mol. Sci. 2018, 19, 2429 17 of 22 streptomycin, Gibco) at 37 °C in a humidified 5% CO2 atmosphere. Pulp cells isolated from porcine tooth germs were plated at subconfluent cell densities, and transfected with the pSV3-neo plasmid (ATCC 37150) using Lipofectamine 2000 (Invitrogen/Life Technologies, Carlsbad, CA, USA) in in accordance with the manufacturer’s instructions. The pSV3-neo plasmid expresses the SV40 accordance with the manufacturer’s instructions. The pSV3-neo plasmid expresses the SV40 large T- large T-antigen for immortalization and neomycin phosphotransferase for selection. Two days after antigen for immortalization and neomycin phosphotransferase for selection. Two days after transfection, the cells were re-plated at low density and selected with 0.35 mg/mL of geneticin (G418) transfection, the cells were re-plated at low density and selected with 0.35 mg/mL of geneticin (G418) (ATCC, Manassas, VA, USA). The cells were cultured in media containing G418 until colonies were (ATCC, Manassas, VA, USA). The cells were cultured in media containing G418 until colonies were visible. Individual colonies were isolated with cloning cylinders and maintained in the standard visible. Individual colonies were isolated with cloning cylinders and maintained in the standard medium at 37 ◦C in a humidiﬁed 5% CO atmosphere. medium at 37 °C in a humidified 5% CO2 atmosphere. Appendix A.5. ALP-HPDL System Appendix A.5. ALP-HPDL System TheThe human human periodontal ligament ligament (HPDL) (HPDL) cells cells were were plated plated on a 96-well on a 96-well plate at platea density at aof density3.16 4 2 of×3.16 104 cells/cm× 10 cells/cm2, and were, and cultured were in cultured the standard in the medium standard for medium 24 hrs. The for medium 24 hrs. was The changed medium to was α changedgrowth tomedium growth with medium 50 nM with of 1α,25(OH) 50 nM of2D 1 3 (EMD,25(OH) Millipore2D3 (EMD Corp., Millipore Billerica, Corp., MA, Billerica,USA). Measuring MA, USA). Measuringthe ALP activity the ALP in activityeach well in was each described well was previously described [69]. previously After 72 [additional69]. After hours 72 additional of incubation, hours of incubation,the cells were the washed cells were once washed with phosphate once with buffered phosphate saline buffered (PBS), and saline ALP (PBS),activity and was ALP assayed activity using was assayed10 mM usingp-nitrophenylphosphate 10 mM p-nitrophenylphosphate as the substrate in as 100 the mM substrate 2-amino-2-methyl-1,3- in 100 mM 2-amino-2-methyl-1,3- propanediol-HCl ◦ propanediol-HClbuffer (pH 10.0) containing buffer (pH 5 mM 10.0) MgCl containing2, and incubated 5 mM MgClfor 5 min2, and at 37 incubated °C. After quenching for 5 min with at 370.2 C. AfterM NaOH, quenching the absorbance with 0.2 M at NaOH, 405 nm thewas absorbance read using ata plate 405 nmreader. was read using a plate reader.

Int. J. Mol. Sci. 2018, 19, x FOR PEER REVIEW 18 of 23 Figure A4. Effect of Er:YAG-LI on HPDL cells proliferation incubated for different periods [41].

(A) MTSFigure (3-(4,5,dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfophenyl)-2 A4. Effect of Er:YAG-LI on HPDL cells proliferation incubated for different periods H[41].-tetrazolium, (A) inner salt)MTS assay. (3-(4,5,dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfophenyl)-2H-tetrazolium, HPDL after Er:YAG-LI (red) and without LI (grey) on day 0, 3, 5, and 7 were inner cultured at a ﬁnalsalt) volume assay. ofHPDL 120 afterµL/well Er:YAG-LI for 1 (red) h at 37and◦C. without MTS LI reagent (grey) wason day added, 0, 3, 5, andand an7 were absorbance cultured at of a 450 nm final volume of 120 μL/well for 1 h at 37 °C. MTS reagent was added, and an absorbance of 450 nm was recorded using a microplate reader (n = 10 tests per sample). Values are the mean ± standard error was recorded using a microplate reader (n = 10 tests per sample). Values are the mean ± standard (* p < 0.05error and (* p **< 0.05p < 0.01,and ** Mann–Whitney p < 0.01, Mann–WhitneyU test). U (test).B) Morphological (B) Morphological changes changes of of HPDL HPDL cells at at day 2 followingday Er:YAG-LI.2 following Er:YAG-LI. (scale bar (scale = 200 barµm). = 200 μm).

Figure A5. Cont.

Figure A5. Isolation and detection of active forms of TGF-β, MMP2 and MMP11 in porcine dental pulp [33]. (a) Heparin-sepharose chromatogram of extracts from porcine dental pulp detected at 280 nm absorbance. Downward-pointing arrows represent the starting points of the step gradient with 0.05, 0.1, and 0.2 M NaCl. (b) ALP-inducing activity of HPDL cells with (+) or without (−) the addition of SB431542 to fractions P1–P4 isolated by chromatography. Recombinant human TGF-β1 with a carrier (0.3 ng/mL) (TGF-β1) was used as a positive control for the detection of ALP-inducing activity in HPDL cells. The data show the average value of six measurements. (c) A gelatin zymogram of fractions P1–P4 incubated without (left) or with (right) EDTA. (d,e) Western blots of fractions P1–P4 with specific antibodies against (d) MMP2 and (e) MMP11.

Figure A6. In vitro activation of latent TGF-β1 by MMP2 or MMP11 [33]. Latent TGF-β1 was incubated with rhMMP2 or rhMMP11. ALP-inducing activity of HPDL cells exposed to (a) latent TGF-β1 only

Int. J. Mol. Sci. 2018, 19, x FOR PEER REVIEW 18 of 23

Figure A4. Effect of Er:YAG-LI on HPDL cells proliferation incubated for different periods [41]. (A) Int. J. MTSMol. Sci. (3-(4,5,dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfophenyl)-2H-tetrazolium, 2018, 19, x FOR PEER REVIEW inner 18 of 23 salt) assay. HPDL after Er:YAG-LI (red) and without LI (grey) on day 0, 3, 5, and 7 were cultured at a finalFigure volume A4. Effect of 120 of μL/wellEr:YAG-LI for on1 h HPDL at 37 °C.cells MTS proliferation reagent was incubated added, for and different an absorbance periods of[41]. 450 (A nm) wasMTS recorded (3-(4,5,dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfophenyl)-2H-tetrazolium, using a microplate reader (n = 10 tests per sample). Values are the mean ± standard inner errorsalt) assay.(* p < 0.05HPDL and after ** pEr:YAG-LI < 0.01, Mann–Whitney (red) and without U test). LI (grey) (B) Morphological on day 0, 3, 5, changesand 7 were of culturedHPDL cells at a at dayfinal 2 volumefollowing of Er:YAG-LI.120 μL/well (scalefor 1 hbar at =37 200 °C. μm). MTS reagent was added, and an absorbance of 450 nm was recorded using a microplate reader (n = 10 tests per sample). Values are the mean ± standard error (* p < 0.05 and ** p < 0.01, Mann–Whitney U test). (B) Morphological changes of HPDL cells at day 2 following Er:YAG-LI. (scale bar = 200 μm).

Int. J. Mol. Sci. 2018, 19, 2429 18 of 22

Figure A5.FigureIsolation A5. Isolation and and detection detection of of active active forms forms ofof TGF-β, TGF-β MMP2, MMP2 and and MMP11 MMP11 in porcine in porcine dental dental pulp [33pulp]. (a )[33]. Heparin-sepharose (a) Heparin-sepharose chromatogram chromatogram of of extracts extracts from from porcineporcine dental dental pulp pulp detected detected at 280 at 280 nm absorbance.nmFigure absorbance. Downward-pointing A5. Isolation Downward-pointing and detection arrows of arrowsactive represent forms represent of the TGF-β, startingthe starting MMP2 points pointsand MMP11 of of the the stepstepin porcine gradient dental with with 0.05, 0.05,pulp 0.1, [33]. and (a) 0.2Heparin-sepharose M NaCl. (b) ALP-inducing chromatogram activity of extracts of HPDL from cells porcine with (+) dental or without pulp detected (−) the addition at 280 0.1, and 0.2 M NaCl. (b) ALP-inducing activity of HPDL cells with (+) or without (−) the addition of ofnm SB431542 absorbance. to fractionsDownward-pointing P1–P4 isolated arrows by chromatography.represent the starting Recombinant points of the human step gradient TGF-β1 withwith a β SB431542carrier0.05, to 0.1, fractions (0.3 and ng/mL) 0.2 P1–P4M (TGF-β1)NaCl. isolated (b) wasALP-inducing used by chromatography. as a positiveactivity ofcontrol HPDLRecombinant for cells the with detection (+) or human withoutof ALP-inducingTGF- (−) the addition1 withactivity a carrier (0.3 ng/mL)inof HPDL SB431542 (TGF- cells. toβ 1) The fractions was data used show P1–P4 as the isolated a positiveaverage by value chromatography. control of six for measurements. the Recombinant detection (c) of humanA ALP-inducing gelatin TGF-β1 zymogram with activity aof in HPDL cells.fractionscarrier The (0.3 P1–P4 data ng/mL) incubated show (TGF-β1) the without average was used (left) value as ora positive with of six (right) measurements.control EDTA. for the (d ,detectione) (Westernc) A gelatinof blotsALP-inducing of zymogram fractions activity P1–P4 of fractions P1–P4 incubatedwithin HPDL specific cells. without antibodies The (left)data against show or with the(d) (right)MMP2average and EDTA.value (e) ofMMP11. (d six,e ) measurements. Western blots (c of) A fractions gelatin zymogram P1–P4 with of speciﬁc antibodiesfractions against P1–P4 (d) incubated MMP2 and without (e) MMP11.(left) or with (right) EDTA. (d,e) Western blots of fractions P1–P4 with specific antibodies against (d) MMP2 and (e) MMP11.

Figure A6. In vitro activation of latent TGF-β1 by MMP2 or MMP11 [33]. Latent TGF-β1 was incubated with rhMMP2 or rhMMP11. ALP-inducing activity of HPDL cells exposed to (a) latent TGF-β1 only Figure A6. In vitro activation of latent TGF-β1 by MMP2 or MMP11 [33]. Latent TGF-β1 was incubated Figure A6. In vitro activation of latent TGF-β1 by MMP2 or MMP11 [33]. Latent TGF-β1 was incubated Int. J. withMol. Sci. rhMMP2 2018, 19 or, x FORrhMMP11. PEER REVIEW ALP-inducing activity of HPDL cells exposed to (a) latent TGF-β1 only 19 of 23 with rhMMP2 or rhMMP11. ALP-inducing activity of HPDL cells exposed to (a) latent TGF-β1 only (Latent),(Latent), latent latent TGF-TGF-β1β1 with with rh-MMP2 rh-MMP2 (Latent+MMP2), (Latent+MMP2), and rh-MMP2 and rh-MMP2 only (MMP2) only samples, (MMP2) and samples, and ALP-inducingALP-inducing activity activity of HPDL HPDL cells cells exposed exposed to (b) to latent (b) latentTGF-β1 TGF- only β(Latent),1 only latent (Latent), TGF-β1 latent with TGF-β1 with rh-MMP11rh-MMP11 (Latent+MMP11) (Latent+MMP11) and and rh-MMP11 rh-MMP11 only only(MMP11) (MMP11) samples samples (n = 6). (n = 6).

Figure A7.FigureIn vitroA7. Inactivation vitro activation of endogenous of endogenous TGF- TGF-β1β1 in in HPDL HPDL cells cells cultured cultured with withor without or without MMP2 MMP2 inhibitor after Er:YAG-LI. HPDL cells were incubated without (−) or with (+) 500 pM of InSolution inhibitor after Er:YAG-LI. HPDL cells were incubated without (−) or with (+) 500 pM of InSolution GM6001 (MMP2 inhibitor)(Calbiochem/Merck Millipore, Darmstadt, Germany) for 5 days after GM6001Er:YAG-LI. (MMP2 inhibitor)(Calbiochem/MerckEndogenous TGF-β activity in HPDL Millipore, cells was evaluated Darmstadt, by determining Germany) ALP-inducing for 5 days after Er:YAG-LI.activity Endogenous in HPDL cells TGF- (n =β 6).activity in HPDL cells was evaluated by determining ALP-inducing activity in HPDL cells (n = 6). Table A1. Selected primers, size of amplified product for qPCR analysis shown in main Figure 3.

Gene Sequence (5′–>3′) Size (bp) qPCR Protocol (45 Cycles) F CCGACGTGGCCAATTACAAC Mmp2 96 R GGTCCAGATCAGGCGTGTAG F ATGCAGCTTACGAAGTGGCT Mmp20 95 R GGGAGGACCTTGCATTTGGA F CCCAGAAACCCAATCAGAGA Dspp-v1 300 R TATGTGTTTTGCTGGGTCCA F CCCAGAAACCCAATCAGAGA Dspp-v2 149 R GGGAAGGAAGGGGAGAATTT F CAACTTCCTGTGCTCTGTGC Runx2 119 Denaturation 95 °C 10 s R CCGCCATGACAGTAACCACA F CCAGGCAGATGCAAAGCCTA OC 96 Annealing 60 °C 10 s R CGCCTGAGTCTCTTCACCAC F CCAGATTGAGAGCATCCGCA Col II 142 Extension 72 °C 10 s R CATGGCGTCCAAAGTGCATC F GCCTGCTGAGGCTCAAGTTA Tgf-β1 131 R ATCAAAGGACAGCCACTCCG F GCGCTACATCGACAGCAAAG Tgf-β2 143 R TGCAGCAGGGACAGTGTAAG F CTGTGCGTGAATGGCTCTTG Tgf-β3 93 R TATCCCCGTTGGGCTGAAAG F CCATCACCATCTTCCAGGAG Gapdh 346 R ACAGTCTTCTGGGTGGCAGT

References

Int. J. Mol. Sci. 2018, 19, 2429 19 of 22

Table A1. Selected primers, size of ampliﬁed product for qPCR analysis shown in main Figure3.

Gene Sequence (50→30) Size (bp) qPCR Protocol (45 Cycles) F CCGACGTGGCCAATTACAAC Mmp2 96 R GGTCCAGATCAGGCGTGTAG F ATGCAGCTTACGAAGTGGCT Mmp20 95 R GGGAGGACCTTGCATTTGGA F CCCAGAAACCCAATCAGAGA Dspp-v1 300 R TATGTGTTTTGCTGGGTCCA F CCCAGAAACCCAATCAGAGA Dspp-v2 149 R GGGAAGGAAGGGGAGAATTT F CAACTTCCTGTGCTCTGTGC Runx2 119 Denaturation 95 ◦C 10 s R CCGCCATGACAGTAACCACA F CCAGGCAGATGCAAAGCCTA OC 96 Annealing 60 ◦C 10 s R CGCCTGAGTCTCTTCACCAC F CCAGATTGAGAGCATCCGCA Col II 142 Extension 72 ◦C 10 s R CATGGCGTCCAAAGTGCATC F GCCTGCTGAGGCTCAAGTTA Tgf-β1 131 R ATCAAAGGACAGCCACTCCG F GCGCTACATCGACAGCAAAG Tgf-β2 143 R TGCAGCAGGGACAGTGTAAG F CTGTGCGTGAATGGCTCTTG Tgf-β3 93 R TATCCCCGTTGGGCTGAAAG F CCATCACCATCTTCCAGGAG Gapdh 346 R ACAGTCTTCTGGGTGGCAGT

References

1. Yilmaz, H.G.; Albaba, M.R.; Caygur, A.; Cengiz, E.; Boke-Karacaoglu, F.; Tumer, H. Treatment of recurrent aphthous stomatitis with Er,Cr:YSGG laser irradiation: A randomized controlled split mouth clinical study. J. Photochem. Photobiol. B 2017, 170, 1–5. [CrossRef][PubMed] 2. Seiﬁ, M.; Ebadifar, A.; Kabiri, S.; Badiee, M.R.; Abdolazimi, Z.; Amdjadi, P. Comparative effectiveness of low level laser therapy and transcutaneous electric nerve stimulation on temporomandibular joint disorders. J. Lasers Med. Sci. 2017, 8, S27–S31. [CrossRef][PubMed] 3. Bhardwaj, A.; Jafri, Z.; Sultan, N.; Sawai, M.; Daing, A. Periodontal ﬂap surgery along with vestibular deepening with diode laser to increase attached gingiva in lower anterior teeth: A prospective clinical study. J. Nat. Sci. Biol. Med. 2018, 9, 72–76. [PubMed] 4. Zeini Jahromi, N.; Ghapanchi, J.; Pourshahidi, S.; Zahed, M.; Ebrahimi, H. Clinical evaluation of high and low-level laser treatment (CO2vsInGaAlp diode laser) for recurrent aphthous stomatitis. J. Dent. 2017, 18, 17–23. 5. Hale, G.M.; Querry, M.R. Optical constants of water in the 200-nm to 200-microm wavelength region. Appl. Opt. 1973, 12, 555–563. [CrossRef][PubMed] 6. Aoki, A.; Ando, Y.; Watanabe, H.; Ishikawa, I. In vitro studies on laser scaling of subgingival calculus with an Erbium:YAG Laser. J. Periodontol. 1994, 65, 1097–1106. [CrossRef][PubMed] 7. Aoki, A.; Miura, M.; Akiyama, F.; Nakagawa, N.; Tanaka, J.; Oda, S.; Watanabe, H.; Ishikawa, I. In vitro evaluation of Er:YAG laser scaling of subgingival calculus in comparison with ultrasonic scaling. J. Periodontal Res. 2000, 35, 266–277. [CrossRef][PubMed] Int. J. Mol. Sci. 2018, 19, 2429 20 of 22

8. Sasaki, K.M.; Aoki, A.; Ichinose, S.; Ishikawa, I. Morphological analysis of cementum and root dentin after Er:YAG laser irradiation. Lasers Surg. Med. 2002, 31, 79–85. [CrossRef][PubMed] 9. Sasaki, K.M.; Aoki, A.; Ichinose, S.; Ishikawa, I. Ultrastructural analysis of bone tissue irradiated by Er:YAG laser. Lasers Surg. Med. 2002, 31, 322–332. [CrossRef][PubMed] 10. Sasaki, K.M.; Aoki, A.; Ichinose, S.; Yoshino, T.; Yamada, S.; Ishikawa, I. Scanning electron microscopy

and fourier transformed infrared spectroscopy analysis of bone removal using Er:YAG and CO2 lasers. J. Periodontol. 2002, 73, 643–652. [CrossRef][PubMed] 11. Sawabe, M.; Aoki, A.; Komaki, M.; Iwasaki, K.; Ogita, M.; Izumi, Y. Gingival tissue healing following Er:YAG Laser ablation compared to electrosurgery in rats. Lasers Med. Sci. 2015, 30, 875–883. [CrossRef][PubMed] 12. Zare, D.; Haerian, A.; Molla, R.; Vaziri, F. Evaluation of the effects of diode (980 nm) laser on gingival inflammation after nonsurgical periodontal therapy. J. Lasers Med. Sci. 2014, 5, 27–31. [PubMed] 13. Ortega-Concepcion, D.; Cano-Duran, J.A.; Pena-Cardelles, J.F.; Paredes-Rodriguez, V.M.; Gonzalez-Serrano, J.; Lopez-Quiles, J. The application of diode laser in the treatment of oral soft tissues lesions. A literature review. J. Clin. Exp. Dent. 2017, 9, e925–e928. [CrossRef] [PubMed] 14. Avci, P.; Gupta, A.; Sadasivam, M.; Vecchio, D.; Pam, Z.; Pam, N.; Hamblin, M.R. Low-level laser (light) therapy (LLLT) in skin: Stimulating, healing, restoring. Semin. Cutan. Med. Surg. 2013, 32, 41–52. [PubMed] 15. Amaroli, A.; Ravera, S.; Parker, S.; Panfoli, I.; Benedicenti, A.; Benedicenti, S. Effect of 808 nm diode laser on swimming behavior, food vacuole formation and endogenous ATP production of paramecium primaurelia (Protozoa). Photochem. Photobiol. 2015, 91, 1150–1155. [CrossRef][PubMed] 16. Amaroli, A.; Ravera, S.; Parker, S.; Panfoli, I.; Benedicenti, A.; Benedicenti, S. The protozoan, paramecium primaurelia, as a non-sentient model to test laser light irradiation: The effects of an 808 nm infrared laser diode on cellular respiration. Altern. Lab. Anim. 2015, 43, 155–162. [PubMed] 17. Amaroli, A.; Parker, S.; Dorigo, G.; Benedicenti, A.; Benedicenti, S. Paramecium: A promising non-animal bioassay to study the effect of 808 nm infrared diode laser photobiomodulation. Photomed. Laser Surg. 2015, 33, 35–40. [CrossRef][PubMed] 18. Amaroli, A.; Ravera, S.; Parker, S.; Panfoli, I.; Benedicenti, A.; Benedicenti, S. 808-nm laser therapy with a flat-top handpiece photobiomodulates mitochondria activities of paramecium primaurelia (protozoa). Lasers Med. Sci. 2016, 31, 741–747. [CrossRef][PubMed] 19. Lipovsky, A.; Oron, U.; Gedanken, A.; Lubart, R. Low-level visible light (llvl) irradiation promotes proliferation of mesenchymal stem cells. Lasers Med. Sci. 2013, 28, 1113–1117. [CrossRef][PubMed] 20. Santinoni, C.D.; Oliveira, H.F.; Batista, V.E.; Lemos, C.A.; Verri, F.R. Influence of low-level laser therapy on the healing of human bone maxillofacial defects: A systematic review. J. Photochem. Photobiol. B 2017, 169, 83–89. [CrossRef][PubMed] 21. Hayashi, Y.; Imai, M.; Goto, Y.; Murakami, N. Pathological mineralization in a serially passaged cell line from rat pulp. J. Oral Pathol. Med. 1993, 22, 175–179. [CrossRef][PubMed] 22. Nagata, T.; Yokota, M.; Ohishi, K.; Nishikawa, S.; Shinohara, H.; Wakano, Y.; Ishida, H.

1α,25-dihydroxyvitamin D3 stimulation of osteopontin expression in rat clonal dental pulp cells. Arch. Oral Biol. 1994, 39, 775–782. [CrossRef] 23. MacDougall, M.; Selden, J.K.; Nydegger, J.R.; Carnes, D.L. Immortalized mouse odontoblast cell line MO6-G3 application for in vitro biocompatibility testing. Am. J. Dent. 1998, 11, S11–S16. [PubMed] 24. Thonemann, B.; Schmalz, G. Bovine dental papilla-derived cells immortalized with HPV 18 E6/E7. Eur. J. Oral Sci. 2000, 108, 432–441. [CrossRef][PubMed] 25. Iwata, T.; Yamakoshi, Y.; Simmer, J.P.; Ishikawa, I.; Hu, J.C. Establishment of porcine pulp-derived cell lines and expression of recombinant dentin sialoprotein and recombinant dentin matrix protein-1. Eur. J. Oral Sci. 2007, 115, 48–56. [CrossRef][PubMed] 26. Kamata, N.; Fujimoto, R.; Tomonari, M.; Taki, M.; Nagayama, M.; Yasumoto, S. Immortalization of human dental papilla, dental pulp, periodontal ligament cells and gingival ﬁbroblasts by telomerase reverse transcriptase. J. Oral Pathol. Med. 2004, 33, 417–423. [CrossRef][PubMed] 27. Galler, K.M.; Schweikl, H.; Thonemann, B.; D’Souza, R.N.; Schmalz, G. Human pulp-derived cells immortalized with Simian Virus 40 T-antigen. Eur. J. Oral Sci. 2006, 114, 138–146. [CrossRef][PubMed] 28. Begue-Kirn, C.; Smith, A.J.; Loriot, M.; Kupferle, C.; Ruch, J.V.; Lesot, H. Comparative analysis of TGF beta s, BMPs, IGF1, msxs, ﬁbronectin, osteonectin and bone sialoprotein gene expression during normal and in vitro-induced odontoblast differentiation. Int. J. Dev. Biol. 1994, 38, 405–420. [PubMed] Int. J. Mol. Sci. 2018, 19, 2429 21 of 22

29. Yang, X.; van der Kraan, P.M.; van den Dolder, J.; Walboomers, X.F.; Bian, Z.; Fan, M.; Jansen, J.A. STRO-1 selected rat dental pulp stem cells transfected with adenoviral-mediated human bone morphogenetic protein 2 gene show enhanced odontogenic differentiation. Tissue Eng. 2007, 13, 2803–2812. [CrossRef][PubMed] 30. Ohazama, A.; Tucker, A.; Sharpe, P.T. Organized tooth-specific cellular differentiation stimulated by BMP4. J. Dent. Res. 2005, 84, 603–606. [CrossRef][PubMed] 31. Shimabukuro, Y.; Ueda, M.; Ozasa, M.; Anzai, J.; Takedachi, M.; Yanagita, M.; Ito, M.; Hashikawa, T.; Yamada, S.; Murakami, S. Fibroblast growth factor-2 regulates the cell function of human dental pulp cells. J. Endod. 2009, 35, 1529–1535. [CrossRef][PubMed] 32. Tjaderhane, L.; Koivumaki, S.; Paakkonen, V.; Ilvesaro, J.; Soini, Y.; Salo, T.; Metsikko, K.; Tuukkanen, J. Polarity of mature human odontoblasts. J. Dent. Res. 2013, 92, 1011–1016. [CrossRef][PubMed] 33. Li, Y.; Lu, X.; Sun, X.; Bai, S.; Li, S.; Shi, J. Odontoblast-like cell differentiation and dentin formation induced with TGF-β1. Arch. Oral Biol. 2011, 56, 1221–1229. [CrossRef][PubMed] 34. Niwa, T.; Yamakoshi, Y.; Yamazaki, H.; Karakida, T.; Chiba, R.; Hu, J.C.; Nagano, T.; Yamamoto, R.; Simmer, J.P.; Margolis, H.C.; et al. The dynamics of TGF-β in dental pulp, odontoblasts and dentin. Sci. Rep. 2018, 8, 4450. [CrossRef][PubMed] 35. Gao, X.; Chen, T.; Xing, D.; Wang, F.; Pei, Y.; Wei, X. Single cell analysis of PKC activation during proliferation and apoptosis induced by laser irradiation. J. Cell. Physiol. 2006, 206, 441–448. [CrossRef][PubMed] 36. Gao, X.; Xing, D. Molecular mechanisms of cell proliferation induced by low power laser irradiation. J. Biomed. Sci. 2009, 16, 4. [CrossRef][PubMed] 37. Shefer, G.; Oron, U.; Irintchev, A.; Wernig, A.; Halevy, O. Skeletal muscle cell activation by low-energy laser irradiation: A role for the MAPK/ERK pathway. J. Cell. Physiol. 2001, 187, 73–80. [CrossRef] 38. Aleksic, V.; Aoki, A.; Iwasaki, K.; Takasaki, A.A.; Wang, C.Y.; Abiko, Y.; Ishikawa, I.; Izumi, Y. Low-level Er:YAG laser irradiation enhances osteoblast proliferation through activation of MAPK/ERK. Lasers Med. Sci. 2010, 25, 559–569. [CrossRef][PubMed] 39. Ogita, M.; Tsuchida, S.; Aoki, A.; Satoh, M.; Kado, S.; Sawabe, M.; Nanbara, H.; Kobayashi, H.; Takeuchi, Y.; Mizutani, K.; et al. Increased cell proliferation and differential protein expression induced by low-level Er:YAG laser irradiation in human gingival fibroblasts: Proteomic analysis. Lasers Med. Sci. 2015, 30, 1855–1866. [CrossRef][PubMed] 40. Pourzarandian, A.; Watanabe, H.; Ruwanpura, S.M.; Aoki, A.; Ishikawa, I. Effect of low-level Er:YAG Laser irradiation on cultured human gingival fibroblasts. J. Periodontol. 2005, 76, 187–193. [CrossRef][PubMed] 41. Kobayashi, K.; Niwa, T.; Yamakawa, S.; Saito, M.; Yamazaki, Y.; Hosoya, N.; Gomi, K.; Yamakoshi, Y. The effects of Er:YAG laser irradiation on cultured human periodontal ligament cells. J. Jpn. Soc. Laser Dent. 2016, 27, 84–89. (In Japanese) [CrossRef] 42. Yoshida, M.; Kumamoto, H.; Ooya, K.; Mayanagi, H. Histopathological and immunohistochemical analysis of calcifying odontogenic cysts. J. Oral Pathol. Med. 2001, 30, 582–588. [CrossRef][PubMed] 43. Nakashima, M.; Hirata, K.; Taki, E.; Shinoda, K.; Gomyo, S.; Sekine, I. The effect of GaAlAs laser power on cultured cells. J. Jpn. Soc. Laser Dent. 1995, 38, 1408–1423. (In Japanese) 44. Gross, A.J.; Jelkmann, W. Helium-neon laser irradiation inhibits the growth of kidney epithelial cells in culture. Lasers Surg. Med. 1990, 10, 40–44. [CrossRef][PubMed] 45. Lubart, R.; Wollman, Y.; Friedmann, H.; Rochkind, S.; Laulicht, I. Effects of visible and near-infrared lasers on cell cultures. J. Photochem. Photobiol. B 1992, 12, 305–310. [CrossRef] 46. Breitbart, H.; Levinshal, T.; Cohen, N.; Friedmann, H.; Lubart, R. Changes in calcium transport in mammalian sperm mitochondria and plasma membrane irradiated at 633 nm (HeNe laser). J. Photochem. Photobiol. B 1996, 34, 117–121. [CrossRef] 47. Pan, T.L.; Wang, P.W.; Lee, W.R.; Fang, C.L.; Chen, C.C.; Huang, C.M.; Fang, J.Y. Systematic evaluations of skin damage irradiated by an erbium:YAG laser: Histopathologic analysis, proteomic profiles, and cellular response. J. Dermatol. Sci. 2010, 58, 8–18. [CrossRef][PubMed] 48. Barak, A.; Goldkorn, T.; Morse, L.S. Laser induces apoptosis and ceramide production in human retinal pigment epithelial cells. Investig. Ophthalmol. Vis. Sci. 2005, 46, 2587–2591. [CrossRef][PubMed] 49. Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [CrossRef] [PubMed] 50. Harrington, H.A.; Ho, K.L.; Ghosh, S.; Tung, K.C. Construction and analysis of a modular model of caspase activation in apoptosis. Theor. Biol. Med. Model. 2008, 5, 26. [CrossRef][PubMed] Int. J. Mol. Sci. 2018, 19, 2429 22 of 22

51. Huang, Q.; Li, F.; Liu, X.; Li, W.; Shi, W.; Liu, F.F.; O’Sullivan, B.; He, Z.; Peng, Y.; Tan, A.C.; et al. Caspase 3-mediated stimulation of tumor cell repopulation during cancer radiotherapy. Nat. Med. 2011, 17, 860–866. [CrossRef][PubMed] 52. Ohsawa, S.; Hamada, S.; Asou, H.; Kuida, K.; Uchiyama, Y.; Yoshida, H.; Miura, M. Caspase-9 activation revealed by semaphorin 7A cleavage is independent of apoptosis in the aged olfactory bulb. J. Neurosci. 2009, 29, 11385–11392. [CrossRef][PubMed] 53. Shigetani, Y.; Ohkura, N.; Yoshiba, K.; Ohshima, H.; Hosoya, A.; Yoshiba, N.; Okiji, T. GaAlAs laser-induced pulp mineralization involves dentin matrix protein 1 and osteopontin expression. Oral Dis. 2016, 22, 399–405. [CrossRef][PubMed] 54. Yamamoto, R.; Oida, S.; Yamakoshi, Y. Dentin sialophosphoprotein-derived proteins in the dental pulp. J. Dent. Res. 2015, 94, 1120–1127. [CrossRef][PubMed] 55. Palosaari, H.; Ding, Y.; Larmas, M.; Sorsa, T.; Bartlett, J.D.; Salo, T.; Tjaderhane, L. Regulation and interactions of MT1-MMP and MMP-20 in human odontoblasts and pulp tissue in vitro. J. Dent. Res. 2002, 81, 354–359. [CrossRef][PubMed] 56. Sulkala, M.; Tervahartiala, T.; Sorsa, T.; Larmas, M.; Salo, T.; Tjaderhane, L. Matrix metalloproteinase-8 (MMP-8) is the major collagenase in human dentin. Arch. Oral Biol. 2007, 52, 121–127. [CrossRef][PubMed] 57. Sulkala, M.; Larmas, M.; Sorsa, T.; Salo, T.; Tjaderhane, L. The localization of matrix metalloproteinase-20 (MMP-20, enamelysin) in mature human teeth. J. Dent. Res. 2002, 81, 603–607. [CrossRef][PubMed] 58. Sulkala, M.; Paakkonen, V.; Larmas, M.; Salo, T.; Tjaderhane, L. Matrix metalloproteinase-13 (MMP-13, collagenase-3) is highly expressed in human tooth pulp. Connect. Tissue Res. 2004, 45, 231–237. [CrossRef] [PubMed] 59. Mazzoni, A.; Pashley, D.H.; Tay, F.R.; Gobbi, P.; Orsini, G.; Ruggeri, A., Jr.; Carrilho, M.; Tjaderhane, L.; Di Lenarda, R.; Breschi, L. Immunohistochemical identiﬁcation of MMP-2 and MMP-9 in human dentin: Correlative FEI-SEM/TEM analysis. J. Biomed. Mater. Res. A 2009, 88, 697–703. [CrossRef][PubMed] 60. Mazzoni, A.; Papa, V.; Nato, F.; Carrilho, M.; Tjaderhane, L.; Ruggeri, A., Jr.; Gobbi, P.; Mazzotti, G.; Tay, F.R.; Pashley, D.H.; et al. Immunohistochemical and biochemical assay of MMP-3 in human dentine. J. Dent. 2011, 39, 231–237. [CrossRef][PubMed] 61. Sloan, A.J.; Rutherford, R.B.; Smith, A.J. Stimulation of the rat dentine-pulp complex by bone morphogenetic protein-7 in vitro. Arch. Oral Biol. 2000, 45, 173–177. [CrossRef] 62. Chen, S.; Gu, T.T.; Sreenath, T.; Kulkarni, A.B.; Karsenty, G.; MacDougall, M. Spatial expression of Cbfa1/Runx2 isoforms in teeth and characterization of binding sites in the DSPP gene. Connect. Tissue Res. 2002, 43, 338–344. [CrossRef][PubMed] 63. Puchtler, H.; Meloan, S.N.; Terry, M.S. On the history and mechanism of alizarin and alizarin red s stains for calcium. J. Histochem. Cytochem. 1969, 17, 110–124. [CrossRef][PubMed] 64. Gold, L.I.; Jussila, T.; Fusenig, N.E.; Stenback, F. TGF-β isoforms are differentially expressed in increasing malignant grades of HaCaT keratinocytes, suggesting separate roles in skin carcinogenesis. J. Pathol. 2000, 190, 579–588. [CrossRef] 65. Sloan, A.J.; Smith, A.J. Stimulation of the dentine-pulp complex of rat incisor teeth by transforming growth factor-β isoforms 1–3 in vitro. Arch. Oral Biol. 1999, 44, 149–156. [CrossRef] 66. Nocera, M.; Chu, T.M. Characterization of latent transforming growth factor-beta from human seminal plasma. Am. J. Reprod. Immunol. 1995, 33, 282–291. [CrossRef][PubMed] 67. Stetler-Stevenson, W.G.; Aznavoorian, S.; Liotta, L.A. Tumor cell interactions with the extracellular matrix during invasion and metastasis. Annu. Rev. Cell Biol. 1993, 9, 541–573. [CrossRef][PubMed] 68. Yu, Q.; Stamenkovic, I. Cell surface-localized matrix metalloproteinase-9 proteolytically activates TGF-β and promotes tumor invasion and angiogenesis. Genes Dev. 2000, 14, 163–176. [PubMed] 69. Nagano, T.; Oida, S.; Suzuki, S.; Iwata, T.; Yamakoshi, Y.; Ogata, Y.; Gomi, K.; Arai, T.; Fukae, M. Porcine enamel protein fractions contain transforming growth factor-β1. J. Periodontol. 2006, 77, 1688–1694. [CrossRef][PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).