Towards integrated multi-species management of Australia’s SE reef fisheries: A Tasmanian example

Stewart Frusher, Colin Buxton, Neville Barrett, David Tarbath, Kevin Redd, Jayson Semmens, Hugh Pederson, Joe Valentine and Michaela Guest

Project No. 2004/013 Towards integrated multi-species management of Australia’s SE reef fisheries: A Tasmanian example

Stewart Frusher 1, Colin Buxton 1, Neville Barrett 1, David Tarbath 1, Kevin Redd 1,2 , Jayson Semmens 1, Hugh Pederson 1,3 , Joe Valentine 1,3 , Michaela Guest 1,3

Addresses 1. Tasmanian Aquaculture and Fisheries Institute, University of Tasmania, Marine Research Laboratories, Nubeena Crescent, Taroona, 7053 Tasmania 2. School of Zoology, University of Tasmania, Sandy Bay, 7005 Tasmania 3. QMS Post-Doctoral Fellow, Cebtre of Marine Science, University of Tasmania, Sandy Bay, 7005 Tasmania

Project Number 2004/013 © Fisheries Research and Development Corporation and the Tasmanian Aquaculture and Fisheries Institute 2009.

This work is copyright. Except as permitted under the Copyright Act 1968 (Cth), no part of this publication may be reproduced by any process, electronic or otherwise, without the specific written permission of the copyright owners. Neither may information be stored electronically in any form whatsoever without such permission.

ISBN 978-1-86295-535-6

Preferred way to cite: Frusher S, Buxton C, Barrett N, Tarbath D, Redd S, Semmens J, Hugh Pederson, Valentine J & Guest M (2009). Towards integrated multi-species management of Australia’s SE reef fisheries: A Tasmania example . Report to Fisheries Research and Development Corporation. No. 2004/013. Tasmanian Aquaculture & Fisheries Institute, University of Tasmania.

DISCLAIMER The authors do not warrant that the information in this book is free from errors or omissions. The authors do not accept any form of liability, be it contractual, tortious or otherwise, for the contents of this book or for any consequences arising from its use or any reliance placed upon it. The information, opinions and advice contained in this book may not relate to, or be relevant to, a reader's particular circumstances. Opinions expressed by the authors are the individual opinions of those persons and are not necessarily those of the publisher or research provider. &'1*=4+=(439*398=

NON-TECHNICAL SUMMARY ...... 1
Objectives ...... 2
Outcomes achieved ...... 2
Keywords ...... 4

Acknowledgments ...... 4

Background ...... 5

Need ...... 7

Objectives ...... 8

1
DETERMINING THE INTERSPECIFIC RELATIONSHIP BETWEEN ABALONE AND ROCK LOBSTER ...... 9

1.1
Size structure of cryptic and emergent abalone and correlations with predators and competitors...... 10
Introduction ...... 10
Methods ...... 10
Results ...... 10
Summary of findings ...... 10
Discussion ...... 11

1.2
Determing size-specific predation of abalone, and the dynamics of lobster predation on abalone ...... 12
Introduction ...... 12
Methods ...... 12
Results ...... 12
Summary of findings ...... 12
Discussion ...... 13
Performance indicators ...... 13

2
EVALUATING THE EFFECT OF ABALONE FISHING ON THE COMMUNITY STRUCTURE OF THE REEF ...... 14

2.1
Evaluation of the decline in extent of commercially viable abalone reef in eastern Tasmania relative to fishing pressure...... 15
Introduction ...... 15
Methods ...... 16
(a) History of fishing ...... 16
(b) Data collection ...... 22
Results ...... 23
Responses to questions ...... 23
Changes in fished coastline ...... 45
Conclusions ...... 47

2.2 Biological and environmental correlates of reefs with contrasting abalone densities ...... 53
Introduction ...... 53
Methods ...... 54
Study sites ...... 54
Survey protocol...... 56
Analysis ...... 58
Results ...... 59
Biological correlates of reefs with contrasting abalone densities ...... 59

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = .= = Environmental characteristics of reefs with contrasting abalone densities ...... 74
Discussion ...... 75
Evidence for abalone as a structuring influence on subtidal reef communities ...... 75
Factors affecting abundance of understorey organisms ...... 76
Limitations of correlative approach to infer effects of abalone depletion ...... 77
Factors influencing resilience of reefs to abalone fishing ...... 78
Conclusions ...... 79

3
DETERMINING THE DIET OF ROCK LOBSTERS ...... 81

3.1
Evaluation of methods for determining rock lobster diet, with particular emphasis on non-destructive sampling ...... 82
Introduction ...... 82
Methods and results ...... 82
Discussion ...... 84
DNA primer development ...... 85

3.2
Evaluation of stable isotopes and fatty acid signature methodology ...... 88
Introduction ...... 88
Materials and methods ...... 88
Results and discussion ...... 88
Performance indicators ...... 89

4
COMPARISON OF THE FORAGING RANGE AND HABITAT USAGE BY LOBSTERS IN FISHED AND UNFISHED REGIONS ...... 90
Introduction ...... 90
Methods ...... 91
Site selection ...... 91
Habitat classification and feature identification ...... 92
Lobster tagging and telemetry ...... 94
Telemetry data processing and analysis ...... 95
Results ...... 97
Timing of movement activity ...... 97
Home range area ...... 106
Distance travelled ...... 112
Habitat utilisation ...... 114
Discussion ...... 117

Benefits ...... 122

Further development ...... 122

Planned outcomes ...... 123

APPENDICES ...... 125

Appendix 1 The effect of predator-prey and competitive interactions on size at emergence in black-lip abalone ( Hailotis rubra ) in a Tasmanian MPA ...... 125
Abstract ...... 125
Introduction ...... 126
Methods ...... 127
Site selection ...... 127
Survey techniques ...... 127
Statistical analysis ...... 128
Results ...... 129
Patterns in abalone size at emergence and population size structure ...... 129
Relationships with predators and competitors ...... 133
Discussion ...... 136

.. = 74/*(9=34_=,**.2*+- = Appendix 2 Population structuring of black-lip abalone Haliotis rubra by the southern rock lobster Jasus edwardsii ...... 138
Abstract ...... 138
Introduction ...... 139
Methods ...... 140
Site selection ...... 140
Abalone shell survey ...... 145
Statistical analysis ...... 145
Results ...... 146
Predation mortality indices ...... 146
Size-specific predation...... 152
Discussion ...... 156
Importance of rock lobsters ...... 156
Predation intensity and rate ...... 156
Size-specific predation...... 157

Appendix 3 Diver questionnaire ...... 159

Appendix 4 Table of summarised responses to questions ...... 161

Appendix 5 Maps of the five blocks showing place-names referred to in text ...... 171

Appendix 6 A molecular approach to identify prey of the southern rock lobster ...... 174
Abstract ...... 174
Introduction ...... 174
Materials and methods ...... 176
Feeding trials ...... 176
Faecal material collection ...... 177
DNA extraction...... 178
PCR amplification ...... 178
Results ...... 180
Feeding trials ...... 180
Discussion ...... 181
Acknowledgements ...... 182

Appendix 7 Trophic effects of fishing southern rock lobster ( Jasus edwardsii ) shown by combined fatty acid and stable isotope analyses ...... 183

Appendix 8 Evidence of abalone ( Haliotis rubra ) diet from combined fatty acid and stable isotope analyses 203
Abstract ...... 203
Introduction ...... 204
Methods ...... 205
Statistical analyses ...... 208
Results ...... 209
Discussion ...... 214
Separation of phyla using chemical tracers ...... 214
Abalone diet ...... 216
Acknowledgements ...... 218

Appendix 9: Intellectual Property ...... 219

Appendix 10: Staff ...... 219

REFERENCES ...... 220
= =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ... = =

=

!4389*(-3.(&1=8:22&7>=

,**.2*+-= 4<&7)8= .39*,7&9*)= 2:19.885*(.*8= 2&3&,*2*39= 4+= %:897&1.&8= =7**+=+.8-*7.*8a=%=&82&3.&3=*=&251*= = 7.3(.5&1=.3;*89.,&947a= 9*<&79=*7:8-*7= %))7*88a= &82&3.&3=6:&(:19:7*=]=.8-*7.*8=389.9:9*== = 7.;&9*=&,=.3= = 4'&79=&8_`=1**+= = *1a=*-=0,,1=1,11= &=a=*-=0,,1=2*-/= = +2&.1a=,9*<&79_7:8-*7 :9&8_*):_&:== = +48.3;*89.,&947a= +41.3=,:=943= %))7*88a = &82&3.&3=6:&(:19:7*=]=.8-*7.*8=389.9:9*== = 7.;&9*=&,=.3= = 4'&79=&8_`=1**+= = +48.3;*89.,&947a = !*;.11*=,&77*99 = %))7*88a = &82&3.&3=6:&(:19:7*=]=.8-*7.*8=389.9:9*== = 7.;&9*=&,=.3= = 4'&79=&8_`=1**+= = = +48.3;*89.,&947a = -&;.)=&7'&9- = %))7*88a = &82&3.&3=6:&(:19:7*=]=.8-*7.*8=389.9:9*== = 7.;&9*=&,=.3= = 4'&79=&8_`=1**+= = +48.3;*89.,&947a = .*;.3=/*)) = %))7*88a = &82&3.&3=6:&(:19:7*=]=.8-*7.*8=389.9:9*== = 7.;&9*=&,=.3= = 4'&79=&8_`=1**+= = +48.3;*89.,&947a = 0&>843=*22*38 = %))7*88a = &82&3.&3=6:&(:19:7*=]=.8-*7.*8=389.9:9*== = 7.;&9*=&,=.3= = 4'&79=&8_`=1**+= = +48.3;*89.,&947a = 1:,-=*)*7843 = %))7*88a = &82&3.&3=6:&(:19:7*=]=.8-*7.*8=389.9:9*== = 7.;&9*=&,=.3= = 4'&79=&8_`=1**+= =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = += = =

= = +48.3;*89.,&947a = 04*=2&1*39.3* = %))7*88a = &82&3.&3=6:&(:19:7*=]=.8-*7.*8=389.9:9*== = 7.;&9*=&,=.3= = 4'&79=&8_`=1**+= = +48.3;*89.,&947a =
.(-&*1&=3:*89 = %))7*88a = &82&3.&3=6:&(:19:7*=]=.8-*7.*8=389.9:9*== = 7.;&9*=&,=.3= = 4'&79=&8_`=1**+= = 4'/*(9.;*8= +_ 4=)*9*72.3*=9-*=.25&(9=4+=74(0=14'89*7=+.8-.3,=43=&'&143*=545:1&9.43=)>3&2.(8 = ,_ 4=*;&1:&9*=9-*=*++*(9=4+=&'&143*=+.8-.3,=43=9-*=(422:3.9>=897:(9:7*=4+=9-*=7**+ = -_ 4=:3)*789&3)=74(0=14'89*7=57*)&947857*>=7*1&9.438-.58`=5&79.(:1&71>=.3=7*1&9.43=94=(-&3,*8= 9-&9=2&>=-&;*=4((:77*)=&8=&=(438*6:*3(*=4+=+.8-.3, =

4:9(42*8=&(-.*;*)= 54;.3,= +742= &= 8.3,1*= 85*(.*8= &88*882*39= &5574&(-= 9-&9= -&8= '**3= 9-*= '*3(-2&70= .3= +.8-*7.*8=,14'&11>=94=&3=&5574&(-=9-&9=*3(425&88*8='74&)*7=*(48>89*2=.88:*8=7*6:.7*8= '49-=3*<=2*9-4)8=&3)=3*<=(43(*598_=-.8=574/*(9=:8*)=9-*=&'&143*=&3)=74(0=14'89*7= +.8-*7.*8= .3= +&89*73= &82&3.&= &8= &= 1&'47&947>= +47= <-.(-= 94= 97.&1= 3*<= 2*9-4)8= 9-&9= <4:1)= :3)*75.3= &3= *(48>89*2= &5574&(-= 94= +.8-*7.*8= 2&3&,*2*39= +5= 47= *(48>89*2='&8*)=+.8-*7.*8=2&3&,*2*39=+5_= = 7*(*39=7*8*&7(-=.394=9-*=7*':.1).3,=)>3&2.(8=4+=&'&143*=&3)=74(0=14'89*7=545:1&9.438= <.9-.3=&=2&7.3*=5749*(9*)=&7*&=5=.)*39.+.*)=9-*=549*39.&1=+47=.39*7&(9.43='*9<**3= 9-*8*= 545:1&9.438_= 83)*789&3).3,= 9-*8*= .39*7&(9.438= <&8= (438.)*7*)= .25479&39= .+= 2&3&,*2*39= )*(.8.438= <*7*= &.2*)= &9= 459.2.8.3,= 9-*= '*3*+.9= +742= 9-*= (42'.3*)= 7*84:7(*_= 9*243897&9.3,= 9-*8*= .39*7&(9.438= <&8= 8**3= &8= 9-*= +.789= 89*5= '>= <-.(-= 94= *3,&,*= 89&0*-41)*78= 84= 9-&9= 9-*>= (4:1)= 7*(4,3.8*= 9-&9= 2&3&,.3,= *.9-*7= +.8-*7>= 8*5&7&9*1>=(4:1)=.25&.7=9-*=574):(9.;.9>=4+=9-*=49-*7=+.8-*7>_=== = -*= 0*>= 4'8*7;&9.43= .3= 9-*= 5= <&8= 9-&9= 9-*= 2*).:2= 8.?*= (1&88= 4+= &'&143*= <&8= 2.88.3,= (425&7*)= 94= &)/&(*39= +.8-*)= 8.9*8_= 9= <&8= (438.)*7*)= 9-&9= 9-*= .3(7*&8*= .3= 14'89*7=&':3)&3(*=&3)=8.?*=<.9-.3=9-*=5=<&8=&=57.2&7>=)7.;*7=+47=9-.8=4'8*7;&9.43_= 88.3,=89&3)&7)=8:7;*>8=9*(-3.6:*8=<*=<*7*=&'1*=94=.)*39.+>=9-&9=&'&143*=*2*7,*=&9=&= 1&7,*7=8.?*=<.9-.3=9-*=5=&3)=9-&9=9-.8=<&8=574'&'1>=&='*-&;.4:7&1=7*85438*=94=9-*= 14'89*7='.42&88`=9-*=57*8*3(*=4+=1&7,*7=14'89*78=47='49-_= = =8*7.*8=4+=2&3.5:1&9.;*=*=5*7.2*398=.)*39.+.*)=9-&9=3*<1>=*2*7,*39=&'&143*=<*7*=9*3= 9.2*8=247*=1.0*1>=94='*=(438:2*)='>=74(0=14'89*78=9-&3=*.9-*7=3438*2*7,*39=&'&143*= 47=1&7,*7=&'&143*=9-&9=-&)=*2*7,*)=*&71.*7=&3)=9-*7*+47*=8:7;.;*)=9-*=3*<1>=*2*7,*39=

,= 74/*(9=34_=,**.2*+- = =

5-&8*_=88.3,=&=34;*1=&5574&(-=9-&9=1.30*)=&'&143*=8-*11=2&70.3,8=94=14'89*7=&99&(08`= <*= <*7*= &'1*= 94= 574;.)*= +:79-*7= 8:55479.3,= *;.)*3(*= 9-&9= 14'89*78= <*7*= .25479&39= 57*)&9478=4+=&'&143*=&3)=9-&9=9-*=&':3)&3(*=&3)=1&7,*7=8.?*=4+=14'89*78=.3=9-*=5= 7*8:19*)=.3=-.,-*7=2479&1.9.*8_= = ;-.1*= 9-*= &'4;*= 4:9(42*8= .3).(&9*)= 9-&9= 14'89*78= ).)= 57*)&9*= 43= &'&143*`= <*= :3)*79440=&=(42'.3*)=89&'1*=.84945*=&3)=+&99>=&(.)=8.,3&9:7*=&5574&(-=94=*;&1:&9*=9-*= .25479&3(*= 4+= &'&143*= 94= 14'89*7= ).*9_= 19-4:,-= 9-.8= 2*9-4)= ).)= )*9*(9= ).++*7*3(*8= '*9<**3=).*98=4+=74(0=14'89*7=+4:3)=.3=58=&3)=+.8-*)=7*,.438`=9-*=(4397.':9.43=4+= &'&143*=94=9-*=).*9=<&8=7*1&9.;*1>=2.347_=,9&'1*=.84945*8=&3)=+&99>=&(.)=8.,3&9:7*8=&7*= 3472&11>= 4'9&.3*)= +742= 9.88:*= 8&251*8= 94= 574;.)*= .3+472&9.43= 43= ).*9&7>= .9*28= .3,*89*)=4;*7=5*7.4)8=4+=2439-8`=)*5*3).3,=43=9.88:*=9:734;*7=7&9*8_=3=(4397&89`=<*= *;&1:&9*)=9-*=:8*=4+=247*=7*(*39=)*;*1452*398=.3=).*9&7>=9<=9*(-3414,>=94=.)*39.+>= 0*>=).*9&7>=.9*28=9-&9=-&)='**3=.3,*89*)=4;*7=5*7.4)8=4+=+8-=)&>8_=;*=<*7*=&'1*=94= )*;*145= &= 6:.(0= &3)= 34381*9-&1= 9*(-3.6:*= +47= *=97&(9.3,= 8&251*8= +47= ).*9&7>= 9<= &3&1>8.8=9-&9=*3&'1*)=14'89*78=94='*=7*9:73*)=94=9-*.7=51&(*=4+=(&59:7*=*_,_=.3=58=47= 94= 9-*= +.8-*7= +47= +:9:7*= 1.;*= *=5479_= 9<= 2&70*78= <*7*= )*;*145*)= +47= 85*(.+.(= 57*>= .9*28= 8:(-= &8= &'&143*`= 9-*= (42243= :7(-.3= &3)= 9-*= .3;&8.;*= 143,= 85.3*)= :7(-.3_= 6:&7.:2=97.&18=-&;*=)*243897&9*)=9-&9=9-*=8.,3&1=(&3='*=)*9*(9*)='*9<**3=/=&3)=0*= -4:78= &+9*7= .3,*89.43= 4+= 9-*= 57*>= .9*2_= -.8= &114<8= +47= ).*9&7>= .3+472&9.43= 94= '*= 4'9&.3*)=+742=14'89*78=9-&9=-&;*='**3=(&59:7*)=.3=97&58=1*+9=43=9-*=+.8-.3,=,74:3)8=+47= :5=94=-=)&>8_=-*=9<=).*9&7>=2*9-4)=-41)8=(438.)*7&'1*=5742.8*=+47=*;&1:&9.3,=9-*= .39*7&(9.438='*9<**3=57*)&9478=&3)=9-*.7=57*>=.3=2&7.3*=*(48>89*28_= = .3&11>`= <*= 97.&11*)= &(4:89.(= 9*1*2*97>= &8= &= 2*9-4)= 94= :3)*789&3)= 9-*= '*-&;.4:7&1= 7*85438*8= 4+= 14'89*78= .38.)*= &3)= 4:98.)*= 58_= -*7*= -&;*= '**3= ;*7>= +*<= 8:(-= '*-&;.4:7&1=89:).*8=:3)*79&0*3=43=14'89*7=&3)=343*=9-&9=&))7*88=9-*=*++*(98=4+=+.8-.3,= 43=*(48>89*2=:8&,*_=88.3,=9-*=1&9*89=9*(-3414,>=.3=&(4:89.(=9*1*2*97>=<*=<*7*=&'1*=94= )*243897&9*=9-&9=+.8-.3,=-&8=.25&(9*)=43=14'89*7='*-&;.4:7_=9=<&8=&184=8:757.8.3,=94= +.3)= 9-&9= 14'89*7= &(9.;.9>= 5&99*738= <.9-.3= 9-*= 5= )*243897&9*)= &= )*,7**= 4+= 8*,7*,&9.43= '*9<**3= 82&11= &3)= 1&7,*= 14'89*78= 4+= *&(-= 8*== &3)= 9-&9= 9-*8*= ).++*7*39= &(9.;.9>=5&99*738=<*7*=349=7*+1*(9*)=.3=(&9(-&'.1.9>=4+=14'89*7=.3=97&58_= = -*=8*(43)=(42543*39=4+=9-.8=7*5479=<&8=94=*;&1:&9*=9-*=*++*(9=4+=&'&143*=+.8-.3,=43= .38-47*=7**+=*(48>89*28_=-*=+.789=8*(9.43=4+=9-.8=(42543*39=:8*)=+.8-*78=034<1*),*= 94= *;&1:&9*= -.8947.(&1= (-&3,*8_= >:9(42*8= +742= +.8-*78= .39*7;.*<8= .3).(&9*)= 9-&9= 9-*= +.8-*)= &7*&= 4+= 7**+8= .8= )>3&2.(= &3)= .8= &++*(9*)= '>= &= (4251*== 7*1&9.438-.5= '*9<**3= &'&143*=&':3)&3(*`=9-*=&24:39=4+=(&9(-=94='*=9&0*3=?=&3)=9-*=+.3&3(.&1=7*<&7)8= 94= &'&143*= ).;*78_= .8-*78= 89&9*)= 9-&9= &'&143*= 545:1&9.438= +1:(9:&9*)= 7*,.43&11>= &19-4:,-=&=,*3*7&1=97*3)=.3=247*=7*8.1.*39=2*&8:7*)=&8=9-*=4'8*7;*)=&'.1.9>=94=7*(4;*7= +742=+.8-.3,=545:1&9.438=<*7*=+4:3)=+:79-*7=84:9-=.3=&82&3.&_=9.;*78=&184=349*)=&= <.)*=7&3,*=4+=*(48>89*2=(-&3,*8=9-&9=-&)=&184=4((:77*)=4;*7=9-*=5&89=-*=>*&78_=5489= ).;*78= 7*(4,3.8*)= 9-&9= 9-*= &'&143*= 545:1&9.438= 9-&9= 9-*>= <*7*= +.8-.3,= -&)= '**3=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = -= = =

8*;*7*1>= )*51*9*)_= 19-4:,-= 349= (438.89*39= &(7488= &11= ).;*78`= 8*;*7&1= .)*39.+.*)= 9-&9= &+9*7=9-*=7*24;&1=4+=&'&143*`= 57*+*77*)=&'&143*=-&'.9&9= (-&3,*)= 94= 1*88= 57*+*77*)= -&'.9&9_= -.8= <&8= &(034<1*),*)= &8= &= (-&3,*= +742= (7:8948*= (47&11.3*= &1,&1= ??= )42.3&9*)= -&'.9&9= 94= -&'.9&9= )42.3&9*)= '>= 8*88.1*= .3;*79*'7&9*8= &3)= +41.48*= &1,&*= `_== = .8-*7=034<1*),*=<&8=&184=8:55479*)='>=&3=*25.7.(&1=89:)>=4+=.38-47*=7**+8_=;-.1*= +.3*= 8(&1*= -&'.9&9= 57*+*7*3(*8= (4:1)= 349= '*= .)*39.+.*)= .3= 9-.8= 89:)>`= 9-*= 7*,.43&1= ).++*7*3(*8=349*)='>=+.8-*78=<*7*=).89.3,:.8-&'1*_=3=5&79.(:1&7`=9-*7*=<&8=&=(-&3,*=.3= :3)*78947>= (422:3.9>= (42548.9.43= +742= 3479-= 94= 84:9-`= &19-4:,-= 9-*= (9*&438= 7*,.43= .3= 84:9-= *&89*73= &82&3.&= <&8= 8:'89&39.&11>= ).++*7*3(*= 94= 49-*7= 8.9*8= 43= 9-*= +&89=?4&89_=== = = 3=(43(1:8.43`=9-.8=574/*(9=-&8=)*243897&9*)=&=7&3,*=4+=34;*1=&3)=.334;&9.;*=<&>8=94= &))7*88=85*(.*8=.39*7&(9.438=&3)=5&9-8=9-*=<&>=+47=&3=.2574;*)=:3)*789&3).3,=4+=9-*= *++*(98= 4+= +.8-.3,= 43= *(48>89*28_= 25479&391>`= .9= 8-4<*)= 9-&9= &= 3:2'*7= 4+= +&(9478= 7&3,.3,=+742=9-*=:8*=4+=+.8-*78=034<1*),*=94=9-*=:8*=4+=7*(*39=9*(-3414,.(&1=&);&3(*8= <*7*= *6:&11>= ;&1:&'1*= .3= 574;.).3,= 9-*= 8(.*3(*= 3*(*88&7>= 94= :3)*75.3= 9-*= 24;*= 94<&7)8=&3=.39*,7&9*)=2:19.885*(.*8=&5574&(-=94=+.8-*7.*8=2&3&,*2*39_== = .*><47)8= 39*,7&9*)=&88*882*39`=&'&143*`=74(0=14'89*7`=89&'1*=.84945*8`=+&99>=&(.)8`=9<=).*9&7>= 2&70*78`=&(4:89.(=9*1*2*97>`=-42*=7&3,*`=85*(.*8=.39*7&(9.438=

%(034<1*),2*398= ;*= &(034<1*),*= 9-*= 8:55479= 4+= 9-*= A5,= 489)4(947&1= 7*8*&7(-= 574,7&2= 9-&9= 574;.)*)= 54898)4(97&1= 8(-41&78-.58= 94= 97= :,-= *)*7843`= 97= B4*= C&1*39.3*= &3)= 97= 5.(-&*1&=D:*89_== 57=B:89.3=:118=574;.)*)=9*(-3.(&1=8:55479=94=9-*=574/*(9_= 97= ,.243= B&72&3= 574;.)*)= 80.118= .3= 9<= ).*9&7>= &3&1>8.8= &3)= 97= *9*7= <.(-418= 574;.)*)=*=5*79.8*=.3=1.5.)=8.,3&9:7*=&3&1>8.8_= 74+*8847=?7&.,=B4-3843=(488:5*7;.8*)=57=E*;.3=7*))_= = ;*=<4:1)=1.0*=94=&(034<1*),*=9-*=-*15=574;.)*)=94=:8='>=9-*=).;*78`='49-=5&89=&3)= 57*8*39`= .39*7;.*<*)= +47= 9-.8= 89:)>_= ;*= 5&79.(:1&71>= &557*(.&9*= 9-*.7= 5&9.*3(*= &3)= (438.)*7&9.43=.3=9-*=+&(*=4+=8**2.3,1>=*3)1*88=6:*89.438`=&3)=9-&30=9-*2_=;*=<4:1)= &184= 1.0*= 94= &(034<1*),*= 9-*= 5&79= 51&>*)= '>= 574(*88478`= +&(947>= <470*78`= &3)= 89&++= +742=9-*=;&7.4:8=2&3.+*89&9.438=4+=9-*=&82&3.&3=,4;*732*398=+.8-*7.*8=)*5&792*39_=

.= 74/*(9=34_=,**.2*+- = =

*7!%8=/4/= = ,**.2*+-= 4<&7)8=.39*,7&9*)=2:19.885*(.*8=2&3&,*2*39=4+= %:897&1.&8==7**+=+.8-*7.*8a=%=&82&3.&3=*=&251*=

,&(0,74:3) = 38-47*= 7**+= *(48>89*28= 8:55479= &82&3.&8= 2489= .25479&39= +.8-*7.*8`= ;&1:*)= &9= &5574=.2&9*1>= N+/*= 2.11.43= .3= ,**+= 7+= ,**,_= 5&3&,*2*39= 4+= 9-*8*= +.8-*7.*8= -&8= 97&).9.43&11>= '**3= 85*(.*8= '&8*)b= -4<*;*7`= 9-*7*= .8= &= ,74<.3,= )*2&3)= +47= 247*= .39*,7&9*)= 2&3&,*2*39=<.9-=(1*&7=(438.)*7&9.43=4+=9-*=*(48>89*2=9-&9=8:554798=9-*=+.8-*7>=*(48>89*2= '&8*)=2&3&,*2*39=:=+5_=

3= &= 1*99*7= 94= 78= .3= ,**-`= 79?= -.,-1.,-9*)= 9-.8= 3**)`= 89&9.3,= 9-&9= &19*73&9.;*= +.8-*7.*8= 2&3&,*2*39=897:(9:7*8=&3)=2*9-4)8=9-&9=574;.)*=+47=+5=<&8=&=3&9.43&1=3**)=94=*38:7*=9-&9= +.8-*7.*8=3&9:7&1=7*84:7(*8=&7*=:8*)=.3=&=8:89&.3&'1*=<&>_

83)*789&3).3,= 9-*=*++*(98= 4+= +.8-.3,= .8= &3=.25479&39= (42543*39= 4+= 9-.8=&8= *=97&(9.43= 4+= 0*>= 7**+= 85*(.*8= -&8= 9-*= 549*39.&1= 94= &19*7= *(48>89*2= +:3(9.43_= 47= *=&251*`= 7*(*39= 89:).*8= .3= &82&3.&= &3)= <*<= I*&1&3)= 8:,,*89= 57*)&9.43= '>= 14'89*78= 2&>= 51&>= &= 5.;49&1= 741*= .3= 897:(9:7.3,=9-*.7=-&'.9&9_=7*8*&7(-=.3=9-*=5&7.&=81&3)=2&7.3*=5749*(9*)=&7*&=5=8:,,*898= 9-&9=9-*=(:77*39=574):(9.;.9>=4+=&'&143*=894(08=43=9-*=*&89=(4&89=2&>='*=):*=94=7*1&9.;*1>=14<= 57*)&9.43= 57*88:7*= +742= )*57*88*)= 74(0= 14'89*7= 894(08= :=943= *9= &1_= 79?= +3332+0,_= ?:77*391>`=2&3&,*2*39=4+=9-*=74(0=14'89*7=+.8-*7>=9&7,*98=7*':.1).3,=4+=9-*='.42&88=<.9-4:9= (438.)*7&9.43= 4+= 9-*= .25&(98= 43= 49-*7= 85*(.*8_= 4= 459.2.8*= 9-*= '*3*+.98= 4+= '49-= +.8-*7.*8`= 2&3&,*2*39=3**)8=94=&((4:39=+47=9-.8=.39*7&(9.43_

3=7*85438*=94=8*;*7&1=574548&18=.3=9-*=,**-=74:3)=9-&9=&))7*88*)=9-.8=.88:*`=79?=47,&3.8*)= &= <4708-45= .3= 5*1'4:73*= 94= ).8(:88= &= (447).3&9*)= &5574&(-= 94= +5`= +4(:8.3,= 43= 9-*= ,+= 7*,.43_=-.8=574548&1=).7*(91>=&))7*88*8=9-*=4:9(42*8=4+=9-*=<4708-45_=9=':.1)8=43=8*;*7&1= *=.89.3,= 7*8*&7(-= 574/*(98= &3)= -&8= 4'/*(9.;*8= 7*1&9.3,= 94= 85*(.+.(= 6:*89.438= &884(.&9*)= <.9-= 4'8*7;*)=5&99*738_=-*=574/*(9=.8=.)*&11>=51&(*)=94=45*7&9.43&1.8*=9-*=+,9=&,*3)&=+47=+.8-*7.*8= &3)= .3+4728= 3&9:7&1= 7*84:7(*= 2&3&,*2*39= <75= 4'/*(9.;*8= +47= (4&89&1= 2&7.3*= 8>89*28_= ,.,3.+.(&391>`=(411&'47&9.438='*9<**3=,79=&3)==<.11=574;.)*=&=841.)=+4:3)&9.43=+47=9-.8= 3*<=897&9*,.(=+4(:8_=

-*= 4:9(42*8= 4+= 9-.8= <470= <.11= &184= .3(1:)*= &= +7&2*<470= +47= &= 2:19.885*(.*8= 2&3&,*2*39= &5574&(-=+47=&'&143*=&3)=74(0=14'89*7=+.8-*7.*8_=-.8=.3(1:)*8=9-*=*3;.7432*39&1=&((7*).9&9.43= 89&3)&7)8= 4+= '49-= :897&1.&3= &3)= +:9:7*= .39*73&9.43&1= 8(-*2*8= 94= .2574;*= :897&1.&8= 7*5:9&9.43=&8=&=6:&1.9>=8*&+44)=*=5479*7_=

3= >(94'*7= ,**,`= = (43;*3*)= &= <4708-45= <.9-= .3):897>= &3)= ,4;*732*39= 94= .)*39.+>= &= ;.8.43= &3)= 143,89*72= 897&9*,>= +47= &))7*88.3,= 7*8*&7(-= 94= :3)*75.3= *(48>89*28'&8*)= 2&3&,*2*39_==

3=8:22&7>`=9-7**='74&)=&7*&8=<*7*=.)*39.+.*)=+47=9-*=3*=9=+*=>*&78a

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = /= =

+_= 54;.3,=94<&7)8=&=7.80=&88*882*39=&5574&(-=94=.39*,7&9*)=85*(.*8=2&3&,*2*39_ ,_= 83)*789&3).3,=9-*=.25&(98=4+=+.8-.3,=43=*(48>89*2=-*&19-_ -_= D&.3.3,=&=,7*&9*7=:3)*789&3).3,=4+=9&7,*9=&3)='>8(&9(-=85*(.*8=.39*7&(9.438_

9:*= 94= 9-*= 8(&1*= 4+= 9-*= 574'1*2`= 9-*= .3.9.&1= +4(:8= <&8= 7*897.(9*)= 94= 9-*= 7**+= *(48>89*2= 9-&9= 8:554798= &82&3.&8= 0*>= 14'89*7`= &'&143*= &3)= 8(&1*+.8-= +.8-*7.*8`= 247*= 85*(.+.(&11>= 9-*= *&89= (4&89= <-*7*= +.8-.3,= 57*88:7*= -&8= '**3= 9-*= 2489= .39*38*= &3)= +.8-*)= 894(08= &7*= 2489= -*&;.1>= .25&(9*)_= 74(0= 14'89*7= &3)= &'&143*= +.8-*7.*8= <*7*= (438.)*7*)= 94= '*= 7*1&9.;*1>= '*3.,3= <.9-= 7*85*(9=94=9-*=5->8.(&1=*++*(98=4+=+.8-.3,=&3)='>8(&9(-=85*(.*8='49-=7*9&.3*)=&3)=34387*9&.3*)_= -*= 7*8*&7(-= 57.47.9.*8= <*7*= 9-:8= ).7*(9*)= &9= *;&1:&9.3,= 9-*= *(48>89*2= (438*6:*3(*8= 4+= 7*24;&1= 4+= 9-*= 9&7,*9= 85*(.*8`= &3)= 9-*= .39*7&(9.438= '*9<**3= 9-*= 0*>= 9&7,*9= &3)= 34389&7,*9= 85*(.*8_=

3= 5&7(-= ,**-= &= 897&9*,.(= 51&33.3,= <4708-45= <.9-= ,4;*732*39= &3)= .3):897>= <&8= -*1)= 94= )*;*145=9-*=,**-:,**2=&82&3.&3=.8-*7.*8=&3)=6:&(:19:7*=7*8*&7(-=1&3_=-.8=<4708-45= (43+.72*)= 9-*= 3**)= +47= &82&3.&= 94= )*;*145= &= 897&9*,.(= 7]9= 7*85438*= 94= *(48>89*28'&8*)= 2&3&,*2*39_= = -.8= 574/*(9= <.11= (4397.':9*= 94= +5= '>= &))7*88.3,= 8*;*7&1= (47*= .88:*8= .3(1:).3,= -&'.9&9= :9.1.8&9.43=4+=0*>=*=514.9*)=85*(.*8`=85*(.*8=.39*7&(9.438=9-&9=-&;*=&=0*>=741*=.3=897:(9:7.3,=9-*= (422:3.9>`=&3)=9745-.(=)>3&2.(8=+44)=<*'8_== = -*= 574/*(9= <.11= 574,7*88.;*1>= ':.1)= 1&>*78= 4+= .3+472&9.43= 94= &.)= 4:7= :3)*789&3).3,= 4+= 9-*= )>3&2.(8=4+=&82&3.&3=7**+=*(48>89*28_=3.9.&1=<470=<.11=)*9*72.3*=-&'.9&9=:9.1.8&9.43=4+=0*>= (422*7(.&11>= +.8-*)=7**+= 85*(.*8= ':.1).3,= 43= 79?= +3332+0,_= 3= 9-.8=574548&1= 4:7= 85*(.+.(= 9&80=<.11='*=94=+4(:8=43=&'&143*=&3)=74(0=14'89*7_=,9:)>=8.9*8=<.11='*=(4257*-*38.;*1>=2&55*)= 94= 574;.)*= &= '&8*1.3*= 4+= 9-*= *=9*39= &3)= 6:&1.9>= 4+= -&'.9&9= *_,_= &1,&128543,*2(47&11.3*= (4;*7`= )41*7.9*= '4:1)*7828&3)8943*= 8-*1;*8_= ,:7;*>8= :8.3,= 14<= 1.,-9= &3)= .3+7&87*)= 3.,-9= 9.2*= ;.*<.3,=:3)*7<&9*7=;.)*4=(&2*7&8`=9-*=1&9*89=)*;*1452*398=.3=&(4:89.(=9&,8=&3)=;.8:&1=).;*7= 4'8*7;&9.438=<.11= '*= :8*)= 94= )*9*72.3*= -&'.9&9=:9.1.8&9.43_= >= (425&7.3,= :3+.8-*)=8.9*8=&3)= +.8-*)=8.9*8`=<*=<.11=&))7*88=9-*=6:*89.43=4+=<-&9=(-&3,*8=-&;*=4((:77*)=.3=-&'.9&9=:9.1.8&9.43= ):*=94=9-*=7*24;&1=&3)=8:'8*6:*39=)*(1.3*=.3=)*38.9>=4+=1&7,*7=&3.2&18_

>;*7= 9-.8= -&'.9&9= 1&>*7= <*= <.11= ':.1)= &= 3*<= 1&>*7= +4(:8*)= 43= 85*(.*8= .39*7&(9.438_= ,&.3= +4114<.3,= 9-*= 7*6:*898= 4+= 8= 89&0*-41)*78`= 4:7= .3.9.&1= +4(:8= <.11= '*= 43= &'&143*:&1,&1= (422:3.9>=.39*7&(9.438=&3)=74(0=14'89*7:&'&143*=.39*7&(9.438_

-*=3*=9=1&>*7=9-&9=.8='*.3,=574548*)=.3=9-.8=574/*(9=.8=94=*=5147*=9745-.(=)>3&2.(8_=19-4:,-= 9-.8= .8= &= (4251*== &3)= .22*38*= 9&80`= 4:7= .3.9.&1= +4(:8= .8= 94= *=5147*= 9-*= 549*39.&1= 4+= 9<= 2&70*78= 94= .)*39.+>= 57*>= .9*28= 4+= 74(0= 14'89*78_= >= :8.3,= &= 2.=9:7*= 4+= 97&).9.43&1= 8942&(-2+47*,:9= &3&1>8*8= &3)= &6:&7.&= 97.&18`= <*= &.2= 94= )*9*72.3*= 9-*= &'.1.9>= 4+= 9<= 9*(-3414,>=94=574;.)*='49-=6:&39.9&9.;*=&3)=6:&1.9&9.;*=2*&8:7*8=4+=57*)&9.43_=+=8:((*88+:1`= <*=51&3=94=*89&'1.8-=&=9<=1.'7&7>=4+=7**+=47,&3.828=9-&9=(&3='*=:8*)=94=8(7**3=9-*=8942&(-= (439*39=47=+&*(&1=2&9*7.&1=4+=&3>=549*39.&1=57*)&947_=

-*= 9&808= .)*39.+.*)= .3= *&(-= 4+= 9-*= &'4;*= 2*39.43*)= 1&>*78= -&;*= '**3= (42'.3*)= .3= 9-.8= 574548&1=&3)=7*57*8*39=9-*=+.789=89&,*=4+=8=1&7,*7=897&9*,.(=+4(:8_

0= 74/*(9=34_=,**.2*+- = =

!**)= -.8= 574/*(9= .8= 9-*= +.789= 4+= &= 1&7,*7= 897&9*,.(= +4(:8= 9-&9= 24;*8= &<&>= +742= 85*(.*88'&8*)= 2&3&,*2*39=94<&7)8=.39*,7&9*)=*(48>89*2=2&3&,*2*39_=9=<.11=,.;*=.25*9:8=94a= = & :3)*789&3).3,=9-*=.251.(&9.438=4+=2&3&,*2*39=4+=43*=7*84:7(*=43=&349-*7= ' 2*&8:7.3,=9-*=.25&(98=4+=.3(7*&8*)=:9.1.8&9.43=4+=9-*=2&7.3*=*(48>89*2=43=9-*=-*&19-=4+=&11= (42543*398= 4+= 9-*= *(48>89*2= *_,_= (422*7(.&1= &3)= 7*(7*&9.43&1= +.8-.3,`= 94:7.82`= &6:&(:19:7*= ( *89&'1.8-.3,= '&8*1.3*= )&9&= 9-&9= (&3= '*= :8*)= 94= 243.947= *3;.7432*39&1= (-&3,*= *_,_= .3974):(*)=5*898`=,14'&1=<&72.3,= ) 2**9.3,=9-*=.3(7*&8.3,=3**)=4+=(438:2*78=+47=*3;.7432*39&1=&((7*).9&9.43=*_,_=5,?`=+_= -.8=.8=5&79.(:1&71>=9-*=(&8*=+47=).;*78.+.(&9.43=4+=+:9:7*=2&70*98_== = -.8=574/*(9=&))7*88*8=8*;*7&1=&85*(98=4+=:897&1.&8=5&7.3*=,(.*3(*=&3)=*(-3414,>=1&3_= 74,7&2=+=:=83)*789&3).3,=9-*=5&7.3*=+(48>89*2= >'/*(9.;*=0a=4=:3)*789&3)=9-*='.414,.(&1=574(*88*8=.3=:897&1.&8=4(*&38== >'/*(9.;*=1a=4=:3)*789&3)=9-*=)>3&2.(8=4+=:897&1.&8=2&7.3*=-&'.9&98=&3)=*(48>89*28== 74,7&2=,=:=88.3,=&3)=?&7.3,=+47=9-*=5&7.3*=+3;.7432*39= >'/*(9.;*= +a= 4= *38:7*= 9-*= 2&.39*3&3(*= 4+= -*&19->= &3)= 5745*71>= +:3(9.43.3,= *(48>89*28= 9-74:,-=9-*=)*;*1452*39=&3)=&551.(&9.43=4+=*++*(9.;*=243.947.3,=&3)=&88*882*39=574(*):7*8= &3)=8:89&.3&'1*=2&3&,*2*39=57&(9.(*8== >'/*(9.;*=0a=4=.2574;*=9-*=574):(9.;.9>=&3)=8:89&.3&'.1.9>=4+=<.1)=-&7;*89=+.8-*7.*8`=&3)=94= .2574;*= :3)*789&3).3,= 4+= 9-*= 7*1&9.438-.5= '*9<**3= +.8-*)= 894(08= &3)= 9-*= *(48>89*28= 9-&9= 8:55479=9-*2_== = -*=574/*(9=&))7*88*8=79?8=897&9*,.(=;.8.43=94=24;*=94<&7)8=&88*882*39=&3)=2&3&,*2*39= 4+=:897&1.&8=+.8-*7.*8=&9=9-*=*(48>89*2=1*;*1=7&9-*7=9-&3=9-*=8.3,1*=85*(.*8=1*;*1_==(43(*73=.3= *2'7&(.3,= .39*,7&9*)= 2:19.885*(.*8= 47= *(48>89*28'&8*)= 2&3&,*2*39= .8= 9-*= '7*&)9-= 4+= *(48>89*2= .88:*8= 9-&9= (&3= '*= 9&(01*)_= >= +4(:8.3,= 43= 85*(.+.(= .88:*8= .)*39.+.*)= '>= 4:7= 89&0*-41)*78`= 9-.8= 574/*(9= -&8= 9-*= 549*39.&1= 94= )*243897&9*= 9-*= '*3*+.98= 4+= 2:19.885*(.*8= 2&3&,*2*39=.3=9<4=4+=,+=:897&1.&8=2489=;&1:&'1*=+.8-*7.*8`=&3)=9-*=3**)=+47=9-.8=&5574&(-= 94='*=&)459*)=&8=9-*=+:9:7*=2&3&,*2*39=+7&2*<470_= = -*= 3**)= 94= )*;*145= &3)= &551>= 3*<= 2*9-4)8= .8= (47*= 94= .2574;.3,= 4:7= :3)*789&3).3,= 4+= 2&7.3*=*(48>89*28_=-.8=574/*(9=*3(425&88*8=9-.8=3**)=<.9-=9-*=:8*=4+=.3+7&87*)=&3)=14<=1.,-9= ;.)*4=9*(-3414,>`=&(4:89.(=9*1*2*97>=&3)=9<=).*9&7>=89:).*8`=&11=4+=<-.(-=7*57*8*39=+7439.*7= 9*(-3414,.*8_= = 9= 9-*= &87=;.1)+.8-= ,97&9*,.(=1&33.3,= ;4708-45= -*1)=.3= ,**-= 94=)*;*145= &82&3.&8= ,**.:,**3=,97&9*,.(=.8-*7.*8=1&3`='49-=.3):897>=&3)=,4;*732*39=7*(4,3.8*)=9-&9=&=-*&19->= &3)=574):(9.;*=7**+=*(48>89*2=.8=*88*39.&1=+47=2&=.2.8.3,=9-*=84(.&1`=*(4342.(=&3)=&*89-*9.(= 7*9:738=94=7:7&1=(4&89&1=545:1&9.438=.3=&82&3.&_== = 9=9-*=,4:9-*73=.8-*7.*8=5&3&,*2*39=;4708-45=,5;=-*1)=.3=<4;*2'*7=,**-`=2&3&,*78= -.,-1.,-9*)= 9-7**= 8*5&7&9*= &5574&(-*8= 9-&9= 3**)*)= 94= '*= &))7*88*)= .3= 5:78:.3,= *(48>89*28 '&8*)=2&3&,*2*39_=-*8*=<*7*=&=8>89*28=&5574&(-=9-&9=)*8(7.'*)=&=2&3&,*2*39=:3.9=&3)=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 1= =

.3(47547&9*)= &11= .35:98= .394= 9-*= 8>89*2= *_,_= ;*89*735479= &>= &3)= &884(.&9*)= (&9(-2*398`= D7*&9=:897&1.&3=.,-9b=&=7.80=&88*882*39=&5574&(-b=&3)=&3=:3)*789&3).3,=4+=574(*88*8=9-&9= )7.;*= 8>89*28_= 8= &5574&(-= 9-&9= +4(:8*8= 43= :3)*789&3).3,= 574(*88= '&8*)= 43= 4'8*7;*)= 5&99*738= <&8= *3)478*)= '>= 9-*= ,5;_= 9= <&8= 349*)= 9-&9= = <&8= .3= 9-*= '*89= 548.9.43= 94= :3)*79&0*= 9-.8= 7*8*&7(-= .3= &= (489= *++*(9.;*= 2&33*7= &8= 9-.8= &5574&(-= 8:.9*)= 5489,7&):&9*= 89:).*8_ =

4'/*(9.;*8= +_ 4=)*9*72.3*=9-*=.25&(9=4+=74(0=14'89*7=+.8-.3,=43=&'&143*=545:1&9.43=)>3&2.(8 = ,_ 4=*;&1:&9*=9-*=*++*(9=4+=&'&143*=+.8-.3,=43=9-*=(422:3.9>=897:(9:7*=4+=9-*=7**+ = -_ 4=:3)*789&3)=74(0=14'89*7=57*)&947857*>=7*1&9.438-.58`=5&79.(:1&71>=.3=7*1&9.43=94=(-&3,*8= 9-&9=2&>=-&;*=4((:77*)=&8=&=(438*6:*3(*=4+=+.8-.3,_= =

2= 74/*(9=34_=,**.2*+- = =

+= -*9*72.3.3,=9-*=.39*785*(.+.(= 7*1&9.438-.5='*9<**3=&'&143*= &3)=74(0=14'89*7=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 3= =

+_+= .?*=897:(9:7*=4+=(7>59.(=&3)=*2*7,*39= &'&143*=&3)=(477*1&9.438=<.9-=57*)&9478= &3)=(425*9.9478_= = 73974):(9.43= -*= 89743,= (477*1&9.43= '*9<**3= )*(7*&8.3,= &'&143*= &':3)&3(*= &3)= .3(7*&8.3,= 14'89*7= &':3)&3(*28.?*= <.9-.3= 9-*= 5&7.&= 81&3)= 2&7.3*= 7*8*7;*= 8:,,*898= 9-&9= 14'89*7= &3)= &'&143*= +.8-*7.*8= 2&>= '*= (148*1>= .39*77*1&9*)_= 4<*;*7`= 9-*7*= &7*= 8*;*7&1= 549*39.&1= (&:8*8= 4+= 9-*= 4'8*7;*)=)*(1.3*=.3=9-*=&':3)&3(*=4+=&'&143*=&3)=&11=3**)=*=&2.3&9.43_=-*=57*8*3(*=4+=1&7,*= &'&143*=2&>=.3(7*&8*=.397&885*(.+.(=(425*9.9.43`=7*8:19.3,=.3=)*1&>*)=*2*7,*3(*=&3)247=-.,-*7= /:;*3.1*= 2479&1.9>_= 3(7*&8*)= 57*)&947= 3:2'*78= 14'89*7= &3)= +.8-= 2&>= 1*&)= 94= )*1&>*)= *2*7,*3(*=.3=7*85438*=94='*-&;.47&1=(-&3,*8_=.3&11>`=.3(7*&8*)=57*)&947=3:2'*7828.?*8=2&>= 7*8:19=.3=-.,-*7=1*;*18=4+=57*)&9.43_=+=&2.3.3,=9-*=549*39.&1=.39*7&(9.438='*9<**3=&3)=<.9-.3= 85*(.*8=7*6:.7*8=&=(42'.3&9.43=4+=(477*(9.43&1=&3)=*=5*7.2*39&1=&5574&(-*8_== =
*9-4)8= -*=2*9-4)8=&7*=)*8(7.'*)=.3=)*9&.1='>=*)*78*3=*9=&1=,**2=8**=55*3).==+_= = /*8:198= -*=7*8:198=&7*=)*8(7.'*)=.3=)*9&.1='>=*)*78*3=*9=&1=,**2=8**=55*3).==+_=

:22&7>=4+=+.3).3,8= = 8:7;*>= 4+= 9-*= +*= 8.9*8= 7*;*&1*)= &= 247*= 9-&3= /*= 2.11.2*97*= ).++*7*3(*= .3= 8.?*= 4+= *2*7,*39=&'&143*=&(7488=9-*=8.9*8_=-*=57*).(9*)=8.?*=4+=*2*7,*39=&'&143*=/*=4+=9-*= 545:1&9.43= <&8= (438.)*7&'1>= -.,-*7= &9= 9-*= +.;*= 8.9*8= .38.)*= 9-*= 2&7.3*= 7*8*7;*= (425&7*)=94=8.9*8=.3=&)/&(*39=+.8-*)=-&'.9&98_== = ,.,3.+.(&39=7*1&9.438-.58='*9<**3=9-*=8.?*=4+=*2*7,*39=&'&143*=574'&'.1.9>=4+=/*=4+= 9-*= 545:1&9.43= *2*7,*39= &9= &= 57*).(9*)= 8-*11= 1*3,9-= &3)= 74(0= 14'89*7= &':3)&3(*= -*_**,`= 7,-*_1+= &3)= &;*7&,*= 74(0= 14'89*7= 8.?*= -*_***.`= 7,-*_2+= -&;*= '**3= .)*39.+.*)_= ,.9*8= <.9-= -.,-= 74(0= 14'89*7= &':3)&3(*= 8:55479*)= &'&143*= 545:1&9.438= <.9-= 1&7,*7= 8.?*= &9= *2*7,*3(*_= ,.2.1&71>`= 8.9*8= <.9-= 1&7,*7= 14'89*78= 2*&3= (&7&5&(*= 1*3,9-=8:55479*)=&'&143*=545:1&9.438=<.9-=1&7,*7=*2*7,*39=&'&143*_== = 3=(4397&89`=9-*=5&99*738= .3=&'&143*=8.?*=&9=*2*7,*3(*=<*7*=349=)*5*3)*39=:543=9-*= )*38.9>=4+=9-*=2489=(42243=(7&'`=
1&,:8.&=(-&'7:8 `=47=&=8:.9*=4+=57*)&947>=)*2*78&1= +.8-*8= .3(1:).3,= 9-*= 1&'7.)8= 49&1&'7:8= 9*97.(:8= &3)=
.(9.1&'7:8= 1&9.(1&;.:8= <-.(-= &7*= 57*)&9478=4+=/:;*3.1*=&'&143*=*18*<-*7*=.3=9*25*7&9*=:897&1.&_=

+* = 74/*(9=34_=,**.2*+- = =

-.8(:88.43= -*=(1*&7=.3).7*(9=*++*(9=4+=14'89*7=+.8-.3,=43=&'&143*=545:1&9.438=<&8=94=(-&3,*=9-*= 8.?*=4+=*2*7,*3(*_=>:98.)*=9-*=2&7.3*=7*8*7;*`=.3=9-*=57*8*3(*=4+=14<*7=3:2'*78=&3)= 82&11*7= 8.?*)= 14'89*78`= 247*= 9-&3= -&1+= 4+= 9-*= &3.2&18= '*14<= 9-*= 2.3.2:2= 1*,&1= 8.?*= <*7*= *2*7,*39= //_= -.8= +7&(9.43= <&8= ,7*&91>= 7*):(*)= .38.)*= 9-*= 2&7.3*= 7*8*7;*= +0= <-*7*= .3).;.):&18= ,7*&9*7= 9-&3= 9-*= 2.3.2:2= 1*,&11>= *=514.9&'1*= 8.?*= 4+= +-0= 2.11.2*97*8=&((4:39*)=+47=247*=9-&3=-&1+=9-*=545:1&9.43=(425&7*)=94=&)/&(*39=&7*&8= <-*7*=+.8-.3,=-&8=7*):(*)=9-*=3:2'*7=4+=*=514.9&'1*=.3).;.):&18=94=1*88=9-&3=,*=4+= 9-*=545:1&9.43_== = -*=(-&3,*=.3=8.?*=&9=*2*7,*3(*=<.9-=14'89*7=8.?*=&3)=)*38.9>=-&8=.251.(&9.438=+47=9-*= &88*882*39=&3)=2&3&,*2*39=4+=&'&143*=545:1&9.438_=?&9(-&'.1.9>=&3)=9-:8=(&9(-=7&9*8= <.11= )*(1.3*= .3= &7*&8= <-*7*= 14'89*7= )*38.9>= &3)= &;*7&,*= 8.?*= .8= -.,-*7= &8= &= 1&7,*7= 5479.43=4+=9-*=1*,&1=8.?*)=545:1&9.43=<.11=7*2&.3=-.))*3_=?&9(-=7&9*8=<4:1)=9-*7*+47*= 3**)= 94= '*= 89&3)&7).8*)= &,&.389= 14'89*7= )*38.9>= &3)= 8.?*= .3= 7*,.438= <-*7*= 9-*7*= &7*= 8:'89&39.&1=).++*7*3(*8_=:79-*7247*`=9-*=:8*=4+=:3)*78.?*)=&'&143*=&8=&3=.3).(&947=4+= 549*39.&1= 7*(7:.92*39= 94= 9-*= +.8-*7>= <4:1)= '*= '.&8*)= .+= 74(0= 14'89*7= &':3)&3(*= &3)= 8.?*=;&7.*)='*9<**3=8&251.3,=7*,.438_= = .3&11>`=9-*7*=<&8=34=.3).(&9.43=9-&9=9-*=).++*7*3(*=.3=9-*=8.?*=(42548.9.43=4+=14'89*78= .38.)*= 9-*= 2&7.3*= 7*8*7;*= <&8= ):*= 94= &'&143*= *2*7,.3,= &9= 9-*= +.8-*)= &7*&= 8.?*= &9= *2*7,*3(*=&3)='*.3,=57*)&9*)=:543='>=9-*=1&7,*7=14'89*78=.3=9-*=7*8*7;*_== = 9*9&.1*)=)*8(7.59.438=4+=9-*=8.?*=897:(9:7*=&3)=&':3)&3(*=4+=14'89*78=&3)=&'&143*=.3= 9-*= 5&7.&= 81&3)= 2&7.3*= 7*8*7;*= &3)= &)/&(*39= +.8-*)= 7*,.438= &7*= 574;.)*)= .3= 55*3).==+_== =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ++ = =

+_,= -*9*72.3,=8.?*885*(.+.(=57*)&9.43=4+= &'&143*`=&3)=9-*=)>3&2.(8=4+=14'89*7= 57*)&9.43=43=&'&143*= = 73974):(9.43= ,*(9.43=+_+=)*243897&9*)=9-&9=.3(7*&8*)=)*38.9.*8=4+=14'89*78=&3)=1&7,*7=14'89*78=(&3=.25&(9=43= &'&143*= '>= (-&3,.3,= 9-*.7= '*-&;.4:7_= '&143*8= <*7*= +4:3)= 94= *2*7,*= &9= &= 1&7,*7= 8.?*= .3= 7*,.438=<-*7*=9-*=)*38.9>=&3)=&;*7&,*=8.?*=4+=14'89*78=<&8=8:'89&39.&11>=1&7,*7=*)*7843=*9=&1`= ,**2_=;-.1*=9-.8=+.3).3,=5&791>=&))7*88*8=9-*=(43(*73=4;*7=9-*=1&(0=4+=82&11*7=54898*2*7,*39= &'&143*= .3= 9-*= 2&7.3*= 7*8*7;*`= &8= (425&7*)= 94= +.8-*)= 8.9*8`= .9= )4*8= 349= &))7*88= 9-*= .88:*= 4+= 4;*7&11=57*)&9.43=4+=&'&143*='>=74(0=14'89*78_=3=5&79.(:1&7`=.+=&3=.3(7*&8*=.3=9-*='.42&88=&3)= 8.?*= 4+= 14'89*78= 7*8:198= .3= .3(7*&8*)= 57*)&9.43= 43= &'&143*= 9-*3= 9-*= (:77*39= 2&3&,*2*39= 4'/*(9.;*= 4+= 9-*= 14'89*7= +.8-*7>= 94= 7*':.1)= '.42&88= 2&>= &);*78*1>= .25&(9= 43= 9-*= &'&143*= +.8-*7>_== = >+=(:77*39=.39*7*89=.8=9-*=3**)=94=-&;*=247*=1&7,*=14'89*78=1+-/=22=?O=43=7**+8=.3=&3=&99*259= 94=57*;*39=9-*=+472&9.43=4+= '&77*38='>= *397489*5-&3:8 _=-*=1&9*7=.8='*(42.3,=247*=&':3)&39= 43=&82&3.&3=7**+8=):*=94=(1.2&9*=(-&3,*=&3)=-&8=9-*=549*39.&1=94=)*3:)*=:5=94=/*=4+=7**+8`= 8.2.1&7=94=<,;=<-*7*=.9=47.,.3&9*8=8**=O.3,=*9=&1`=,**2_=+=&'&143*=57*)&9.43=<&8=-.,-*7=):*= 94= .3(7*&8*)= 3:2'*78= 4+= 1&7,*= 14'89*78= 9-*3= 9-*= &'&143*= ?= <4:1)= 3**)= 94= '*= 7*):(*)_= 4<*;*7`=9-.8=7*):(9.43=.8=:31.0*1>=94='*=&8=,7*&9=&8=9-*=)*(1.3*=.3=&':3)&3(*=4+=&'&143*=.+= *=9*38.;*='&77*38='*(42*=*89&'1.8-*)=&8=+*<=&'&143*=&7*=+4:3)=43='&77*38_= = -.8=8*(9.43=.8=&.2*)=&9=:3)*789&3).3,=9-*=57*)&947:57*>=7*1&9.438-.5='*9<**3=&'&143*=&3)= 74(0=14'89*78_= =
*9-4)8= -*=2*9-4)8=&7*=)*8(7.'*)=.3=)*9&.1='>=*)*78*3=*9=&1=.3=57*88=8**=55*3).==,_= = /*8:198= -*=7*8:198=&7*=)*8(7.'*)=.3=)*9&.1='>=*)*78*3=*9=&1= .3=57*88=8**=55*3).==,_=

:22&7>=4+=+.3).3,8= <*<1>= *2*7,*39= &'&143*= .38.)*= 9-*= 5= <*7*= &12489= +*= 9.2*8= 247*= 1.0*1>= 94= *=5*7.*3(*= 57*)&9.43= (425&7*)= 94= 54898*2*7,*39= &):198= .3= 9-*= 8&2*= -&'.9&9_= 7*8 *2*7,*39= &'&143*`= 9-&9= &7*= 3472&11>= -.))*3= +742= 57*)&9478`= *=5*7.*3(*)= 8.2.1&7= 1*;*18= 4+= 57*)&9.43= (425&7*)= 94= 5489= *2*7,*39= &'&143*_= 3= (4397&89`= .3= +.8-*)= 8.9*8= 9-*7*=&55*&7*)=94='*=34=).++*7*3(*=.3=9-*=7*1&9.;*=1.0*1.-44)=4+=2479&1.9>='*9<**3=9-*= 9-7**= 8.?*= (1&88*8_= -*= 8.?*= &9= <-.(-= &'&143*= *2*7,*= +742= (7>58.8= &55*&78= 94= '*= &=

+, = 74/*(9=34_=,**.2*+- = =

2&/47=+&(947=)*9*72.3.3,=9-*.7=8:8(*59.'.1.9>=94=57*)&9.43=2479&1.9>=&3)=9-*7*=<&8=34= 4;*7&11=8.?*=57*+*7*3(*=+47=&'&143*='>=74(0=14'89*78_== = +=&2.3&9.43= 4+= *259>= 8-*118= +4114<.3,= 9-*= 9*9-*7.3,= *=5*7.2*39= .3).(&9*)= 9-&9= 9-*= 3:2'*7=4+=&'&143*=2479&1.9.*8=).7*(91>=&997.':9*)=94=74(0=14'89*78='>=9-*=57*8*3(*=4+= (-.5=2&708=43=9-*=2&7,.3=4+=8-*118=<&8=-.,-*7=.38.)*=9-*=5=(425&7*)=94=&)/&(*39= +.8-*)= 8.9*8_= -*= 7&3,*= 4+= 8-*11= 8.?*8= <.9-= 9-*8*= (-&7&(9*7.89.(= (-.5= 2&708= <&8= &184= '74&)*7=&9=8.9*8=.38.)*=9-*=5`=<-*7*=74(0=14'89*7=&':3)&3(*=&3)=&;*7&,*=8.?*=<*7*= *1*;&9*)`=(43+.72.3,=9-&9=74(0=14'89*7=8.?*=51&>8=&=741*=.3=&'&143*=2479&1.9>_ = = -*= (42'.3&9.43= 4+= 7*8:198= +742= 9-*= 2&3.5:1&9.;*= *=5*7.2*398= &3)= 8:7;*>8= :3)*79&0*3=8-4<*)=9-&9= &8:8=*)<&7)8.. =.8=&3=.25479&39=57*)&947=4+= &1.49.8=7:'7&= &3)= 9-&9=9-*=1.0*1.-44)=4+=2479&1.9>=.8=7*1&9*)=94=9-*=&':3)&3(*=&3)=8.?*=4+=74(0=14'89*78_== = -.8(:88.43= -*8*=7*8:198=)*243897&9*=9-&9=74(0=14'89*78=&7*=&3=.25479&39=57*)&947=4+=&'&143*=&3)= &3=.3(7*&8*=.3=9-*=&;*7&,*=8.?*=&3)=&':3)&3(*=4+=14'89*78=.8=1.0*1>=94=1*&)=94=.3(7*&8*)= &'&143*=57*)&9.43_== = 39*7885*(.*8=2&3&,*2*39=4+=9-*8*=9<4=85*(.*8=.3=&3=*(48>89*28=(439*=9=.8=(438.)*7*)= .25479&39=.+=459.2&1=:9.1.8&9.43=4+='49-=7*84:7(*8=.8=94='*=&(-.*;*)_=:79-*7=7*8*&7(-=94= 459.2.8*=*(4342.(='*3*+.98=+742=9-*=(42'.3*)=:8*=4+=9-*=7*84:7(*=.8=7*6:.7*)_= = *7+472&3(*=.3).(&9478== .= 7*5479= 43= 9-*= 57*)&9478= <.9-.3= &3)= 4:98.)*= 9-*= 5&7.&= 81&3)= 5&7.3*= 7*8*7;*= .3(1:).3,=8.?*=85*(.+.(=57*)&9.43='>=).++*7*39=8.?*=(&9*,47.*8=4+=14'89*78_== = -*=7*5479=.)*39.+.*8=74(0=14'89*78=&8=9-*=2&.3=57*)&9478=4+=&'&143*=.38.)*=&3)=4:98.)*= 9-*= 5&7.&= 81&3)= 5&7.3*= 7*8*7;*_= 8= 9-*= 2479&1.9>= 4+= 3*<1>= &3)= 5489= *2*7,*39= &'&143*= <&8= 349= 8.,3.+.(&391>= ).++*7*39= '*9<**3= 9-*= 74(0= 14'89*7= .3(1:8.43= 97*&92*39= &3)=5&79.&1=(&,*8=<-*7*=&11=49-*7=57*)&9478=<*7*=&;&.1&'1*`=49-*7=57*)&9478=(4397.':9*= 94=;*7>=1.991*=2479&1.9>_= = -*=7*5479=.)*39.+.*8=9-&9=1&7,*7=14'89*78=(438:2*=&='74&)*7=8.?*=7&3,*=4+=&'&143*_= = ..=C.8:&1=&3)=<7.99*3=)4(:2*39&9.43=4+=&'&143*=57*)&9.43=)>3&2.(8='>=14'89*78_= = -*= 7*5479= )4(:2*398= 9-*= 2&33*7= .3= <-.(-= 14'89*78= 57*)&9*= :543= &'&143*= 9-74:,-= ;.8:&1= 4'8*7;&9.43= .3= &6:&7.:2= &3)= 4+= 9*9-*7*)= &'&143*_= -*8*= 4'8*7;&9.438= -.,-1.,-9*)=&=5&99*73=4+= (-.5=2&708=9-&9=.3).(&9*=14'89*7=57*)&9.43=&(9.;.9.*8_=-*8*= 2&708=<*7*=8:'8*6:*391>=:8*)=94=.)*39.+>=9-* =5745479.43=4+=&'&143*=8-*118=9-&9=(4:1)= '*=&997.':9*)=94=14'89*7=.25&(98_== =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +- = = ,= ;&1:&9.3,=9-*=*++*(9=4+=&'&143*= +.8-.3,=43=9-*=(422:3.9>= 897:(9:7*=4+=9-*=7**+=

+. = 74/*(9=34_=,**.2*+- = =

,_+= ;&1:&9.43=4+=9-*=)*(1.3*=.3=*=9*39=4+= (422*7(.&11>=;.&'1*=&'&143*=7**+=.3=*&89*73= &82&3.&=7*1&9.;*=94=+.8-.3,=57*88:7*= = 73974):(9.43= 83)*789&3).3,=9-*=7*1&9.438-.58=4+=2&7.3*=-*7'.;47*8=<.9-=9-*.7=-&'.9&9=.8=.25479&39= +47= .2574;.3,= 034<1*),*= 4+= 7**+= *(414,>= &3)= 2&3&,*2*39= 4+= 7**+8'&8*)= +.8-*7.*8= D.81&843 =*9=&1 _`=,***b=*,3*7=&3)=9&>943`=,***b=B*33.3,8 =*9=&1 _`=,**+_=3=&82&3.&8= &'&143*=+.8-*7>`=&=3:2'*7=4+=).;*78=-&;*=(438.89*391>=7*5479*)=9-&9=9-*>=-&;*=349.(*)= (-&3,*8= 94= 7**+8= +4114<.3,= *=9*38.;*= )*51*9.43= 4+= &'&143*= 545:1&9.438= '>= +.8-.3,`= 8:,,*89.3,= &= 1*;*1= 4+= .39*7)*5*3)*3(>= '*9<**3= &'&143*= &3)= -&'.9&9_= -*8*= (-&3,*8= .3(1:)*= 9-*= 7*):(9.43= .3= (4;*7&,*= 4+= (7:8948*= (47&11.3*= &1,&*= &3)= .98= 8:'8*6:*39= 7*51&(*2*39= '>= 8*).2*39`= 49-*7= *3(7:89.3,= 47,&3.828= &3)= &1,&*_= -*= .22*).&9*= .251.(&9.438=94=9-*=+.8-.3,=.3):897>=.3(1:)*=&=7*):(9.43=4+=-&'.9&9=9>5*=&884(.&9*)=<.9-= &'&143*= 7*(7:.92*39= ,-*5-*7)= &3)= :73*7`= +32/b= 5(,-&3*= &3)= ,2.9-`= +322= &3)= (438*6:*391>=+:79-*7=)*51*9.43=94=1*;*18='*>43)=<-.(-=&'&143*=2&>='*=;.&'1>=+.8-*)_= = >;*7+.8-.3,=&3)=8:'8*6:*39=)*51*9.43=1*&).3,=94=9-*=(411&58*=4+=&'&143*=545:1&9.438= 43=.3).;.):&1=7**+8=&3)=5&798=4+=9-*=(4&89=&7*=(42243=574'1*28=9:,&3=&3)=9&;.8`= +33-b= ,-*5-*7)= &3)= &0*7`= +332b= E&754; = *9= &1 _`= ,***= &3)= &7*= ).++.(:19= 94= )*9*(9= E**8.3,= &3)= &0*7`= +332_= ;-.1*= (&9(-= 89&9.89.(8= 8-4<= 9-&9= 4;*7&11= 9-*= &82&3.&3= '1&(01.5=&'&143*=+.8-*7>=-&8='**3=7*1&9.;*1>=74':89`=.3).(&9.438=4+=)*51*9.43=&3)=1488=4+= 574):(9.43= -&;*= '**3= *;.)*39= .3= 5&798= 4+= 9-*= +.8-*7>_= 4114<.3,= >*&78= 4+= +.8-.3,= &9= &55&7*391>=8:89&.3&'1*=1*;*18`=842*=7*5479.3,=&7*&8='14(08=4+=9-*=&'&143*=+.8-*7>=.3= 3479-8*&89= &82&3.&= *=5*7.*3(*)= 7&5.)= )*(1.3*8= .3= &33:&1= (&9(-= 94= 1*88= 9-&3= +*= 4+= 9-*.7= +472*7= 1*;*18= &7'&9- = *9= &1 _`= ,**1_= -*8*='14(08= &7*= 1&7,*= 9*38= 4+= 0.142*97*8`= &3)=(438*6:*391>=9-*=-.8947>=4+=&'&143*=574):(9.43=+742=.3).;.):&1=7**+8=<.9-.3=9-*2= .8=:3034<3_=4<*;*7`=842*=).;*78=<-4=43(*=<470*)=*=9*38.;*1>=&143,=9-*=(4&891.3*= 8&>= 9-&9= 2&3>= 4+= 9-*= 7**+8= &7*= 34<= 944= )*51*9*)= 94= <&77&39= *(4342.(&11>= ;.&'1*= +.8-.3,`=&3)=+.8-.3,=&(9.;.9>=.8=(43(*397&9*)=43=9-*=7*2&.3.3,=574):(9.;*=7**+8_=-*>= 8&>=9-&9=9-.8=-&8=&184=4((:77*)=.3=49-*7=57*;.4:81>=574):(9.;*=5&798=4+=9-*=&82&3.&3= +.8-*7>_= -*= 7*54798= 4+= )*51*9.43= &3)= (-&3,.3,= -&'.9&9`= &19-4:,-= (438.89*39`= &7*= 349= <.)*857*&)`= 5*7-&58= '*(&:8*= 9-74:,-= *(4342.(= 3*(*88.9>`= ).;*78= 8945= ;.8.9.3,= 7**+8= 9-&9= &7*= 34= 143,*7= 574):(9.;*_= 3= &)).9.43`= 9-*= &82&3.&3= &'&143*= +.8-*7>= (4;*78= &= ;&89= &7*&= &3)= 9-*= 14(&9.43= &3)= -.8947>= 4+= 574):(9.43= +742= 7**+8= *=.898= 431>= &8= +7&,2*398= 4+= 034<1*),*= &243,= .3).;.):&1= ).;*78_= -.8= 574/*(9= <&8= *89&'1.8-*)= 94= .)*39.+>= &3)= 14(&9*= )*51*9*)= 7**+8= .3= *&89*73= &82&3.&= '>= (411&9.3,= 9-.8= 034<1*),*= &3)= (425&7.3,= <-*7*= ).;*78= +.8-*)= &9= ;&7.4:8= 89&,*8= 9-74:,-4:9= 9-*= 1.+*= 4+= 9-*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +/ = =

+.8-*7>_= 9= <&8= .39*3)*)= 9-&9= &= '74&)= 5.(9:7*= 4+= 9-*=85&9.&1=(4;*7&,*=4+=9-*=894(0=&9= ;&7.4:8=89&,*8=9-74:,-4:9=9-*=-.8947>=4+=9-*=+.8-*7>=<4:1)=*2*7,*_=3=5&79.(:1&7`=9-*= 85&9.&1=*=9*39=4+=&3>=)*(1.3*=(4:1)='*=&88*88*)='>=2&55.3,=(4&89=<-*7*=).;*78=+.8-*)= .3=9-*=*&71>=>*&78=4+=9-*=+.8-*7>=&3)=(425&7.3,=.9=<.9-=1&9*7=>*&78_== -*= .3+472&9.43=,&9-*7*)=+742=9-.8=574/*(9=<.11='*=:8*)= .3=9<4=<&>8_=-*=+.789= .8=94= (43+.72= <-*9-*7= &3>= )*(1.3*= .3= (422*7(.&11>= ;.&'1*= 7**+= -&8= 4((:77*)_= +`= &8= (&9(-= 89&9.89.(8= 8:,,*89`= 9-*7*= -&8= '**3= &= )*(1.3*`= 9-*3= 247*= 6:*89.438= &7*= 7&.8*)a= .8= 9-*= )*(1.3*=43,4.3,=47=).)=.9=4((:7=*&71.*7=.3=9-*=-.8947>=4+=9-*=+.8-*7>`=9-*7*&+9*7=1*&;.3,=&= 89&'1*=&7*&=4+=574):(9.;*=7**+
=4=<-&9=(&3=9-*=)*(1.3*='*=&997.':9*)
=+=9-*=)*(1.3*=.8= 43,4.3,=&3)=9-*=&33:&1=(&9(-=.8='*.3,=9&0*3=+742=&=574,7*88.;*1>=82&11*7=&7*&=4+=7**+`= 9-*3=9-.8=2&>=-&;*=.251.(&9.438=+47=894(0=&88*882*39_=,-4:1)=9-*=&7*&=4+=574):(9.;*= 7**+='*=9&0*3=.394=(438.)*7&9.43=<-*3=8*99.3,8=1.2.98=43=(&9(-
= ,*(43)`= 9-*= .3+472&9.43= <.11= '*= :8*)= &8= &= 89&79.3,= 54.39= 94= *=5147*= 9-*= 3&9:7*= &3)= *=9*39=4+=-&'.9&9=(-&3,*8=&884(.&9*)=<.9-=&3>=574):(9.;*=7**+=)*(1.3*_=-.8=7*1&9*8=94= 9-*=8*(43)=5&79=4+=9-.8=574/*(9a=94=(425&7*='.414,.(&1=&3)=*3;.7432*39&1=(477*1&9*8=4+= 7**+8= 9-&9= (439.3:*= 94= 8:89&.3= (422*7(.&1= &'&143*= +.8-.3,= <.9-= 7**+8= 9-&9= 34= 143,*7= 8:55479=&=;.&'1*=+.8-*7>_=9=.8=*88*39.&1=9-&9=9-*=7**+8='49-=&(9.;*1>=+.8-*)=&3)=)*51*9*)= '*=.)*39.+.*)=+47=:8*=.3=9-*=8*(43)=5&79_=9=&184='*(42*8=.25479&39=.+=82&11=85&9.&1=8(&1*= 243.947.3,= '*(42*8= &(-.*;&'1*= .3= 9-*= &82&3.&3= +.8-*7>= &3)= 9-*7*= .8= &3>= .3;*89.,&9.43= 4+= 9-*= (-&7&(9*7.89.(8= 4+= 7**+8= <.9-= 7*,&7)=94=;&7.&'.1.9>=.3=7*8.1.*3(*=4+= 9-*.7=&'&143*=545:1&9.438=94=+.8-.3,_==
*9-4)8= &=1.8947>=4+=+.8-.3,= +++*(98= 4+= &'&143*= +.8-.3,= <*7*= &88:2*)= 94= '*= 2489= 57434:3(*)= &3)= -*3(*= 247*= *&8.1>= )*9*(9*)= .3= &7*&8= <.9-= 9-*= ,7*&9*89= 1*;*18= 4+= )*51*9.43`= &3)= 57*8:2&'1>= 1*88= *&8.1>=8**3=.3=&7*&8=<.9-=89&'1*=&3)=-.,-=1*;*18=4+=&'&143*=&':3)&3(*_=-*7*=-&;*='**3= 34=8:((*88+:1=1&7,*88(&1*=&':3)&3(*=243.947.3,=574/*(98=:3)*79&0*3=.3=&82&3.&`=84= 9-*7*= .8= 34= ).7*(9= *;.)*3(*= 9-&9= .3).(&9*8= 9-&9= 894(0= 1*;*18= <*7*= +472*71>= -.,-*7_= 4<*;*7`=.3+*7*3(*8=&'4:9=894(0=1*;*18=(&3='*=2&)*='>=(425&7.3,=(-&3,*8=.3=1*;*18=4+= (&9(-=47=574):(9.43=9-74:,-4:9=9-*=(4:78*=4+=9-*=+.8-*7>`=5&79.(:1&71>=<.9-=034<1*),*= 4+= 9-*= (7.9.(&1= *;*398= *_,_= 2&3&,*2*39= (4397418`= 2&70*9= +&(9478= 2&)*= ):7.3,= 9-*= -.8947>=4+=9-*=+.8-*7>=.,:7*=+b=.3=49-*7=<47)8`=574):(9.;.9>=.8=&=+:3(9.43=4+=&'&143*= &':3)&3(*=,-*5-*7) =*9=&1 _`=,**+_=

+0 = 74/*(9=34_=,**.2*+- = =

Tasmanian abalone fishery ITQ's and TAC 1959-2006 TAC introduced: reduced from License limitation introduced TAC set at 3806t 3806t to Abalone 2095t Increases in TAC fishing Local between following starts in processing 1985 and introduction of Block 23 commences Beach price 1989 increases 15-fold zoneing, rebuilding between 1970 and of stocks 1997-2002

1955 1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 Licenses made First quota Abalone transferrable compliance fishing measure: commences Reported Live landings rule introduction in Blocks landings stops shore-based of catch 13 and 14 peak at fishing dockets > 4500t Fishing starts in Abalone fishing Blocks 28 and 30 license introduced = *.,:7*=+= .2*1.3*=4+=*;*398=&++*(9.3,=574):(9.43=&3)= 7*5479.3,= 4+= (&9(-= .3= 9-*= &82&3.&3= &'&143*=+.8-*7>`=+3/3:,**0= -*= &'&143*= +.8-*7>= 6:.(01>= *=9*3)*)= &74:3)= &82&3.&8= (4&891.3*= ):7.3,= .98= +472&9.;*=>*&78`=&3)=<.9-.3=+*=>*&78`=9-*=&33:&1=(&9(-=.3(7*&8*)=7&5.)1>_=-*7*=&7*=34= 7*(47)8=4+=&33:&1=574):(9.43=7*5479*)='>='14(0=57.47=94=+31/`=':9=.9=.8=034<3=9-&9=9-*= *&89*73= -&1+= 4+= &82&3.&= 574):(*)= 2489= 4+= 9-*= (&9(-_= 3*()49&1= .3+472&9.43= 8:,,*89*)=9-&9=&9=1*&89=-&1+=9-*=*&71>=(&9(-=<&8=9&0*3=+742=/:89=+.;*='14(08`=3*&7=9-*= +.8-.3,=54798=4+=94;*7='14(08=+-=&3)=+.`=9:3&11*>=14(0=,-`=.(-*34=14(0=,2=&3)= ,9=*1*38=14(0=-*=.,:7*=,_== -*8*= '14(08= <*7*= 4+= 5&79.(:1&7= .39*7*89= '*(&:8*= &= 8.,3.+.(&39= 5&798= 4+= 9-*= &33:&1= (&9(-=<*7*=47=89.11=&7*=9&0*3=+742=9-*.7=<&9*78`=&3)='=9-*7*=<*7*=1&7,*=)*(1.3*8=.3= &33:&1= (&9(-= '*9<**3= ).++*7*39= 5*7.4)8= 4+= 9-*= +.8-*7>_= += 9-*7*= <*7*= *3;.7432*39&1= (438*6:*3(*8=4+=&'&143*=)*51*9.43`=9-*3=9-*>=<*7*=247*=1.0*1>=94='*=+4:3)= .3=9-*8*= '14(08_= =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +1 = =

30 St Helens

Bicheno 28 100 Kilometres

Dunalley 23

Dover 14 13 = *.,:7*=,= &89*73=&82&3.&`=8-4<.3,=9-*=94<38=&3)=(4&891.3*=5742.3*39=.3=9-*=*&71>=-.8947>=4+= 9-*= &'&143*= +.8-*7>_= -*= 3:2'*78= 4+= 9-*= &7*&8= '14(08= +742= <-.(-= (&9(-= <&8= 7*5479*)=&7*=8-4<3`=&3)=9-*.7='4:3)&7.*8=.3).(&9*)='>=1.3*8_= ?&9(-=89&9.89.(8=+742=9-*=*&71>=>*&78=4+=9-*=+.8-*7>=&7*=349=7*1.&'1*=.,:7*=-_=:).98=4+= ).;*78= &3)= 574(*88478= .3(42*= '>= 9-*= :897&1.&3= &=&9.43= >++.(*= ):7.3,= 9-*= +32*8= *=548*)=<.)*857*&)=:3)*787*5479.3,=4+=(&9(-*8_=-*=*&71.*89=(&9(-*8=<*7*=7*5479*)=94= 9-*= &82&3.&3= 9*5&792*39= 4+= ,7.(:19:7*= 43= ,*3*7&1= +.8-= 7*9:738= 57.47= 94= +300`=':9= *89.2&9*8= 4+= &33:&1= 574):(9.43= 57*5&7*)= +742= 9-*2= &7*= :3&;&.1&'1*_= -*= *&71.*89= *89.2&9*8=89&79.3,=+30.=4+=&33:&1=&'&143*=(&9(-=<*7*=57*5&7*)=+742=7*9:738=8:551.*)= '>= 574(*88478`= ':9= '*(&:8*= 2:(-= 4+= 9-*= (&9(-= .3= 9-*= *&71>= 5&79= 4+= 9-*= +.8-*7>= <&8= 574(*88*)=.39*789&9*`=9-*=949&1=4+=9-*=1&3).3,8=574(*88*)=.3=&82&3.&=<&8=1*88=9-&3=9-*= 949&1=(&9(-_== 3= +30/`= ).;*78= <*7*= 7*6:.7*)= 94= '*= 1.(*38*)= 94= +.8-= +47= &'&143*_= 742= +300`= 9-*= 9*5&792*39= 4+= ,7.(:19:7*= (411*(9*)= 2439-1>= (&9(-= 949&18= +742= 9-*= 80.55*7= 4+= 9-*= ;*88*1= +742= <-.(-= 1.(*38*)= ).;*78= 45*7&9*)`= &19-4:,-= .3= 57&(9.(*`= 9-*= 80.55*7= <&8= 4+9*3=43*=4+=9-*=).;*78`=.+=349=9-*=431>=).;*7_=-*7*=<*7*=1&7,*=).8(7*5&3(.*8='*9<**3= 9-*=574(*8847=&3)=).;*7=&33:&1=949&1=(&9(-*8`=&3)='*9<**3=+300=&3)=+311`=574(*8847= &33:&1=949&18=<*7*=&1<&>8=,7*&9*7=9-&3=).;*7=&33:&1=949&18`=)*85.9*=5&79=4+=9-*=(&9(-= '*.3,=574(*88*)=4:98.)*=&82&3.&_==

+2 = 74/*(9=34_=,**.2*+- = =

6000 Corrected estimates

5000 Processor returns

Diver returns 4000

3000 Tonnes

2000

1000

0 = 1960 1962 1964 1966 1968 1970 1972 1974 1976 1978 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 2006 *.,:7*=-= 89.2&9*8=4+=&33:&1=574):(9.43=9433*8=+742=9-*=&82&3.&3=&'&143*=+.8-*7>`=+30*: ,**0_=7.47=94=9-*=.3974):(9.43=4+=7B8=&3)=&=%+=.3=+32/`=&33:&1=574):(9.43=<&8= 74:9.3*1>= :3)*787*5479*)_= -*= *&71.*89= (&9(-*8= 57*= +30.= <*7*= 7*5479*)= 43= ,*3*7&1= +.8-=7*9:738`=':9=&33:&1=949&1=(&9(-*8=&7*=:3&;&.1&'1*_=-*=&82&3.&3=-*5&792*39=4+= %,7.(:19:7*=(411*(9*)=2439-1>=7*9:738=4+=(&9(-=5:7(-&8*)='>=&82&3.&3=574(*88478= 574(*8847=7*9:738`=89&79.3,=.3=0:1>=+30._=89.2&9*8=4+=&33:&1=574(*8847=949&18=).)=349= .3(1:)*= &82&3.&3= (&9(-*8= 574(*88*)= .3= 49-*7= 89&9*8_= ,*9<**3= +300= &3)= +32.`= 9-*= -*5&792*39=4+=%,7.(:19:7*=(411*(9*)=2439-1>=7*9:738=4+=(&9(-='>='14(0=89&79.3,=.3= +300= +742= 9-*= 80.55*78= 4+= '4&98= 45*7&9.3,= .3= 9-*= &'&143*= +.8-*7>= ).;*7= 7*9:738_= *742=+32/`=(&9(-*8=<*7*=7*5479*)=43=&=)&.1>='&8.8=).7*(91>='>=).;*78`=&3)=(&9(-=949&18= '*(&2*=247*=&((:7&9*_=%=9-.7)=8*7.*8=4+=574):(9.43=949&18=<&8=*89.2&9*)=94=&((4:39= +47= :3)*787*5479.3,_= 89.2&9*8= <*7*= .3.9.&11>= )*7.;*)= +742= &3*()49*8`= 5&79.&11>= 8:55479*)= '>= ).;*78= ).&7.*8= +30*:00_= ,*9<**3= +301= &3)= +32.`= &= ,*= (477*(9.43= +&(947=<&8=&551.*)=94=9-*=-.,-*7=4+=9-*=).;*78=&3)=574(*88478=949&18_=,*9<**3=+32/= &3)=+33.`=9-*=(477*(9.43=+&(947=<&8=-&1;*)`=&3)=-&1;*)=&,&.3='*9<**3=+33/=&3)=+333_= +&9(-=949&18=<*7*=349=(477*(9*)=&+9*7=+333_= ;.)*857*&)=(43(*73='>=).;*78=&'4:9=+&11.3,=894(0=1*;*18=.3=9-*=*&71>=+32*8=1*)=94=9-*= .3974):(9.43= 4+= 4:95:9= 2&3&,*2*39= (4397418= .3).;.):&1= 97&38+*7&'1*= 6:49&8= A= &3)=&=949&1=&114<&'1*=(&9(-=?`=.3=+32/_=9=<&8=349=:39.1=9-*=)*;*1452*39=4+=9-*8*= (4397418=9-&9=897.(9*7=(4251.&3(*=2*&8:7*8=<*7*=.3974):(*)=(&9(-*8=<*7*=7*6:.7*)=94= '*= &((:7&9*1>= <*.,-*)= &3)= 7*5479*)= &+9*7= 1&3).3,= &3)= *89.2&9*8= 4+= &33:&1= (&9(-= '*(&2*=247*=7*1.&'1*_=+;*3=84`=+47=2&3>=>*&78=9-&9=+4114<*)`=.9=<&8=349.(*)=9-&9=842*= 574(*88478= <*7*= &(-.*;.3,= 2:(-= -.,-*7= >.*1)8= 4+= 574):(9= 9-&3= 9*(-3.(&11>= 5488.'1*= +742=9-*=&'&143*=9-&9=<*7*=7*5479*)=841)=94=9-*2_=9=.8=9-*7*+47*=&88:2*)=9-&9=(&9(-*8= 7*2&.3*)= :3)*787*5479*)= <*11= .394= 9-*= +33*8`= <-*3= 2&/47= (-&3,*8= 9-&9= *38:7*)= ,7*&9*7=1*;*18=4+=(4251.&3(*=<.9-=(&9(-87*5479.3,=7*6:.7*2*398=<*7*=.3974):(*)_= 4= (425*38&9*= +47= :3)*787*5479.3,`= &= 9-.7)= 8*7.*8= 4+= &33:&1= (&9(-= *89.2&9*8= <&8= 57*5&7*)_= +89.2&9*8= 4+= (&9(-= '*9<**3= +30*= &3)= +31*= <*7*= )*7.;*)= :8.3,= &3*()49&1= *89.2&9*8= 4+= 9-*= (&9(-*8= 4+= *&71>= ).;*78`= 5&79.&11>= 8:55479*)= '>= 5*7843&1= 7*(47)8 0**5.3,=&3)=/4:73&18_=+89.2&9*8=4+=&33:&1=(&9(-='*9<**3=+31+=&3)=+333=<*7*=)*7.;*)= '>=&)).3,=&=(477*(9.43=+&(947=94=9-*=-.,-*7=4+=9-*=).;*78=47=574(*88478=&33:&1=949&18_= D:.)*)= '>= .3+472&9.43= +742= +472*7= ).;*78`= 574(*88478= &3)= +.8-*7.*8= 4++.(*78`= 9-.8=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +3 = =

(477*(9.43= +&(947= <&8= &7'.97&7.1>= 8*9= &9= ,*= +47= 9-*= 5*7.4)= '*9<**3= +31+= &3)= +32/_= *9<**3=+32/=&3)=+33.`=9-*=(477*(9.43=+&(947=<&8=7*):(*)=94=+*`=&3)='*9<**3=+33/= &3)=+333`=7*):(*)=94=/_=?&9(-=949&18=<*7*=&((*59*)=&8=(4251*9*=&+9*7=+333_= -*= &33:&1= (&9(-= 949&18= +47= 9-*= +.;*= 7*5479.3,= '14(08= <*7*= 57*5&7*)= +742= 89&9*= ,4;*732*39=(&9(-=)&9&=).;*78=7*9:738`=&3)=(438*6:*391>`=*&71>=574):(9.43=.8=:3)*78 *89.2&9*)=.,:7*=._=9=.8=349=&557457.&9*=94=&551>=&=(477*(9.43=+&(947=4;*7=8:(-=82&11= 85&9.&1=8(&1*8`='*(&:8*=).;*78=+7*6:*391>=24;*)=9-*.7=45*7&9.438='*9<**3='14(08=&3)= 9-*7*= .8= 34= .3+472&9.43= &'4:9= '*9<**38>*&7= ;&7.&9.43= .3= 9-*= 85&9.&1= ).897.':9.43= 4+= (&9(-_=4<*;*7`=94=,&.3=&='*99*7=&557*(.&9.43=4+=9-*='14(08=574):(9.;.9>`=9-*=8.?*=4+= 9-*.7=*&71.*7=&33:&1=(&9(-*8=8-4:1)='*=(438.)*7*)=.3=9-*=(439*=9=4+=9-*=(477*(9*)=8.?*=4+= 9-*=89&9*=(&9(-_= -*=(&9(-=-.8947.*8=4+='14(08=+.`=,2=&3)=-*=&7*=5&79.(:1&71>=2.81*&).3,_=-*>=89&79=<.9-= 7*1&9.;*1>=14<=':9=7.8.3,=1*;*18=4+=(&9(-=+4114<*)='>=)*(1.3*8`=,.;.3,=9-*=.257*88.43=4+= 7&5.)1>= )*;*145.3,= +.8-*7.*8= +4114<*)= '>= &= 8<.+9= '442= &3)= 8:'8*6:*39= ':89`= 8:,,*89.3,=9-&9=9-*.7=894(08=<*7*=4+=1.2.9*)=574):(9.;.9>_=-.8=.8=349=9-*=(&8*_=-*=8.?*= 4+= 9-*= (477*(9*)= *89.2&9*8= 4+= 89&9*<.)*= 574):(9.43= .3=9-*=+*=>*&78=57.47=94=+31/`=9-*= 2.87*5479.3,= 4+= (&9(-*8= &3)= 9-*= 574=.2.9>= 4+= 9-*= '14(08= 94= +.8-.3,= 54798= 2*&3= 9-&9= 9-*8*='14(08=-&)=&=2:(-=143,*7=-.8947>=4+=-.,-=1*;*18=4+=574):(9.43=9-&3=.8=&55&7*39_= -*8*=<*7*=&243,=9-*=2489=574):(9.;*=5&798=4+=9-*=+.8-*7>_=19-4:,-=4:95:9=(4397418= 1.2.9*)= 9-*= 8.?*= 4+= &33:&1= (&9(-*8= +742= +32/`= 9-*.7= 14<*7= >.*1)8= .3= 1&9*7= >*&78= &7*= 1&7,*1>=&997.':9&'1*=94=)*51*9.43_=+=*3;.7432*39&1=*++*(98=&997.':9&'1*=94=)*51*9.43=4+= &'&143*='>=+.8-.3,=*=.89`=9-*3=9-*>=8-4:1)='*=*;.)*39=.3=9-*8*='14(08_=

,* = 74/*(9=34_=,**.2*+- = =

400 Block 13

300

200 Tonnes 100

0

350 Block14 300 250 200 150 Tonnes 100 50 0

100 Block 23 80

60

40 Tonnes 20

0

200 Block 28

150

100 Tonnes 50

0

300 Block 30 250 200 150

Tonnes 100 50 0

1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 = *.,:7*=.= %33:&1= 574):(9.43= 9433*8= +742= 9-*= +.;*= 7*5479.3,= '14(08`= +31/= 94= ,**0_= +&9(-= 7*5479.3,= <&8= .3974):(*)= .3= +300`= ':9= (&9(-*8= 7*5479*)= '>= '14(0= 57.47= 94= +31/= &7*= :3&;&.1&'1*_=,14(0=-*=<&8=(148*)=94=+.8-.3,=.3=,**0_=+&9(-*8=<*7*=*=9*38.;*1>=:3)*78 7*5479*)=):7.3,=2:(-=4+=9-*=*&71>=-&1+=4+=9-*=+.8-*7>`=&3)=&33:&1=574):(9.43=57.47=94= 9-*=.3974):(9.43=4+=(&9(-=)4(0*9.3,`=7B8=&3)=&=%+=.3=9-*=2.)=+32*8=<&8=574'&'1>= 2:(-=,7*&9*7=9-&3=.3).(&9*)_=73=&11='14(08`=*=(*59=,14(0=+-`=7*5479*)=&33:&1=(&9(-*8= 97*3)= )4<3<&7)`= (438.89*39= <.9-= +&11.3,= &'&143*= 545:1&9.438_= 73= ,14(0= +-`= 7*(*39= )*(1.3*8=(&3='*=&997.':9*)=94=7*):(9.438=.3=%+_= 14(08=+-=&3)=,-=8-4<=).++*7*39=5&99*738=4+=&33:&1=(&9(-_=+&71>=&33:&1=(&9(-=949&18=.3= 14(0=,-=<*7*=7*1&9.;*1>=82&11=0+**=9433*8`=':9=&3*()49&1=.3+472&9.43=.3).(&9*8=9-&9=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,+ = =

9-.8= '14(0= <&8= 43*= 4+= 9-*= 2489= -*&;.1>= +.8-*)= &7*&8= &9= 9-*= 89&79= 4+= 9-*= +.8-*7>`= 9-&9= &33:&1=(&9(-*8=.3=9-*=+*=>*&78=57.47=94=+31/=<*7*=-.,-*7=9-&3=.3=9-*=+4114<.3,=+*=>*&78`= &3)=9-&9='>=+31/`=545:1&9.438=<*7*=.3=)*(1.3*=43=2&3>=7**+8_=3=(4397&89`=9-*=+.8-*7>=.3= 14(0=+-=-&8='**3=74':89_=-*=).5=.3=574):(9.43=):7.3,=9-*=1&9*=+32*8=<&8=574'&'1>= ):*=247*=94=7*):(9.438=.3=?=9-&3=)*51*9.43`=&3)=9-*=.3(7*&8*)=(&9(-=.3=9-*=>*&78= 9-&9= +4114<*)= 8:,,*898= 89&'1*= 47= 7.8.3,= 894(0= 1*;*18_= -*= .3(7*&8*= (477*8543)8= 94= 9-*= 9.2*=<-*3=49-*7='14(08=<*7*=)*(1.3.3,`=8:,,*89.3,=9-&9=).;*78=24;*)=9-*7*=+742=9-*= 247*= )*51*9*)= 5&798= 4+= 9-*= +.8-*7>_= 4898,***= (&9(-= )*(1.3*8= (&3= '*= &997.':9*)= 94= 7*):(9.438= .3= +&89*73= I43*= ?_= >+= 9-*= +.;*= '14(08`= 14(0= +-= 2.,-9= '*= *=5*(9*)= 94= 8-4<= 9-*= 1*&89= *3;.7432*39&1= *++*(98= &997.':9&'1*= 94= &'&143*= +.8-.3,= '*(&:8*= 4+= .98= 247*=89&'1*=894(0=1*;*18_= ='=-&9&=(411*(9.43= 39*7;.*<8=<*7*=(43):(9*)=<.9-=).;*78=<-4=<*7*=&(9.;*=.3=9-*=+.8-*7>=+742=.98=*&71.*89= >*&78_=-*=.39*7;.*<8=<*7*=)*8.,3*)=94=(411*(9=.3+472&9.43=&'4:9=<-*7*=).;*78=+.8-*)`= (-&3,*8=.3=894(0=1*;*18=&3)=-&'.9&9`=&8=<*11=&8=(-&3,*8=94=9-*.7=45*7&9.438=9-&9=2.,-9= -&;*= &++*(9*)= 9-*= <&>= 9-&9= 9-*>= +.8-*)= &3)= -4<= 9-*>= +.8-*)_= -*= .39*7;.*<= 574(*88= .3;41;*)= &80.3,= &= 89&3)&7)= 8*9= 4+= 6:*89.438= 55*3).== -`= <-.(-= .3(1:)*)= &= ).8(:88.43=4+=<-*7*=9-*>=-&)=+.8-*)=<.9-.3=9-*=+.;*='14(08_== 9.;*78=<.9-=(&9(-=-.8947.*8=+742=9-7**=0*>=5*7.4)8=<*7*=8*1*(9*)=+47=.39*7;.*<_=-*8*= 5*7.4)8= <*7*= .3.9.&11>= .39*3)*)= 94='*= 57*8+32.= *&71>= ,74:5`= +32.= &3)= 1&9*7= 2.))1*= ,74:5`=&3)=(:77*39`=-.,-=;41:2*=).;*78_=+32.=<&8=(438.)*7*)=.25479&39='*(&:8*=*&89= (4&89=&'&143*=574):(9.43=89&79*)=94=)*(1.3*= +742=9-&9=54.39_=4<*;*7`=&+9*7=9-*=+.789= +*<= .39*7;.*<8= .9= '*(&2*= &55&7*39= 9-&9= )*51*9.43= &3)= (438*6:*39= (-&3,*8= .3= 9-*= 85&9.&1= ).897.':9.43= 4+= *++479=4((:77*)= 2:(-= *&71.*7= .3= 9-*= -.8947>=4+= 9-*= +.8-*7>`= &3)= 9-&9=9-*=7**+8=+.8-*)='>=9-*=2.))1*=(&9*,47>=).;*78=<*7*=*88*39.&11>=9-*=8&2*=&8=9-48*= +.8-*)='>=(:77*39=).;*78_=,:'8*6:*391>=9-*=(&9*,47.*8=<*7*=&2*3)*)=94=57*8+31,=*&71>= ,74:5`=+31,=&3)=1&9*7=2.)=,74:5`=&3)=(:77*39=).;*78`=&3)=247*=*&71>=,74:5=&3)=1*88= 2.))1*=,74:5=).;*78=<*7*=.39*7;.*<*)=9-&3=47.,.3&11>=574548*)_=,42*=).;*78=+.8-*)= &(7488=247*=9-&3=43*=4+=9-*=5*7.4)8=&3)=<*7*=&88.,3*)=94=9-*=,74:5=(477*8543).3,=94= 9-*=>*&7=.3=<-.(-=9-*>=89&79*)=+.8-.3,_= 9.;*78= <*7*= 8*1*(9*)= '&8*)= :543= 9-*= 1.0*1.-44)= 9-&9= 9-*>= (4:1)= 8:551>= :8*+:1= .3+472&9.43_= O.898= 4+= 549*39.&1= .39*7;.*<**8= <*7*= 2&)*= :8.3,= 8*&7(-*8= 4+= &7(-.;&1= 2&9*7.&1= (&9(-= 7*9:738`= 2.3:9*8= 4+= 2**9.3,8`= )*5&792*39&1= 2*248= &3)= 7*(422*3)&9.438= +742= 5*451*= <-4= <470*)= .3= 9-*= .3):897>_= ?7.9*7.&= +47= 8*1*(9.43= .3(1:)*)= 9-*.7= 57*)42.3&39= +.8-.3,= &7*&`= 9-*= 5*7.4)= ):7.3,= <-.(-= 9-*>= +.8-*)= &3)= 9-*.7=&;&.1&'.1.9>=+47=.39*7;.*<_=-*=8*1*(9.43=4+=1&9*7=).;*78=<&8=2&)*=*&8.*7=<.9-=9-*= &;&.1&'.1.9>= 4+= (425:9*7.8*)= (&9(-= )&9&`= ':9= &184= )*5*3)*)= 1&7,*1>= 43= 7*(422*3)&9.438=+742=49-*7=).;*78=&3)=+.8-=574(*88478_== -*= 6:*89.433&.7*= (4257.8*)= +2= 6:*89.438= &'4:9= 9-*= ).897.':9.43= 4+= +.8-.3,= &(9.;.9>`= +.8-.3,= 2*9-4)8= :8*)= '>= 9-*= ).;*78= &3)= 9-*= *3;.7432*39= .3= <-.(-= 9-*>= +.8-*)_= 4= 2.3.2.8*= &3>= '.&8= 9-74:,-= +47(*)= 7*85438*8= 94= .39*7;.*<= 6:*89.438`= 9-*= .39*7;.*<=

,, = 74/*(9=34_=,**.2*+- = =

574(*88= <&8= .3+472&1`= <.9-= ).;*78= )*8(7.'.3,= 9-*.7= 1.;*8= .3= 9-*= +.8-*7>_= 38<*78= 94= 2489=6:*89.438=<*7*=4'9&.3*)=:3574259*)_=-.8=&114<*)=9-*2=94=574;.)*=*=97&=)*9&.1= &'4:9=*;*398=:3(433*(9*)=<.9-=9-.8=574/*(9`=':9=4+=,7*&9=.39*7*89=.3=.98=4<3=7.,-9=*_,_= +.789= 8.,-9.3,8= 4+= *397489*5-&3:8 `= &'&143*= 2479&1.9>= *;*398= &3)= 8-&70= &99&(08_= -*= .39*7;.*<8= <*7*= (43):(9*)= <.9-= 9-*= :3)*789&3).3,= 9-&9= 5*7843&1= .3+472&9.43= <&8= (43+.)*39.&1_= -*= 2&58= :8*)= 94= 14(&9*= +.8-.3,= &7*&8= <*7*= 24891>= +742=9-*=+a,/`***=&82&5=8*7.*8= 574):(*)='>=9;`=':9=&184=.3(1:)*)=+a+**`***=&82&58`=9-*==&'.9&9=5&5=8*7.*8= &3)= 7<= (-&798_= 9.;*78= <*7*= &184= *3(4:7&,*)= 94= )7&<= 9-*.7= 4<3= 2:)= 2&58_= ?-&3,*8= .3= 9-*= ).897.':9.43= 4+= 574):(9.;*= &'&143*= 7**+= ):7.3,= 9-*= -.8947>= 4+= 9-*= +.8-*7>= <*7*= .)*39.+.*)= '>= (425&7.3,= 9-*= 2&58= 574):(*)= '>= 9-*= 9-7**= ,74:58= 4+= ).;*78_= 9=<&8=47.,.3&11>=574548*)=9-&9=&=).;*7=+742=*&(-=4+=9-*=*&71>=&3)=(:77*39=,74:58='*= 9&0*3=94=9-*=+.8-.3,='14(08='>='4&9`=+.789=94= ,74:3)=97:9-=9-*.7=2&58`=&3)=8*(43)=94= 8**= .+= 9-*= ;.8.9= <4:1)= 574259= +:79-*7= .3+472&9.43_= -.8= 5&79= 4+= 9-*= 51&3= <&8= &'&3)43*)=&+9*7=9-*=+.789=97.5`='*(&:8*=.9='*(&2*=&55&7*39=9-&9=034<1*),*=4+=9-*=7**+8= &3)= -4<= 9-*>= -&)= (4397.':9*)= 94= 9-*= 574):(9.43= 4+= 9-*= +.8-*7>= <.9-.3= &= '14(0= <&8= +7&,2*39*)=&243,=2&3>=).;*78`=&3)=9-&9=94='*=8:((*88+:1`=&11=9-*=).;*78=.39*7;.*<*)= -&)= 94= '*= 57*8*39= 43= 9-*= '4&9_= -*= 57*8*3(*= 4+= /:89= 9<4= .3).;.):&18= .3= 9-*= '4&9= 574):(*)=.3+472&9.43=9-&9=(4:1)=349='*=7*(43(.1*)=<.9-=9-&9=+742=9-*=49-*7=).;*78=&3)= <&8=247*=(43+:8.3,=7&9-*7=9-&3=-*15+:1_= /*8:198= -.79>89-7**=).;*78=<*7*=.39*7;.*<*)a=+0=*&71>=,74:5`=1=2.))1*=,74:5=&3)=+*=(:77*39= ).;*78_=,42*=&243,=9-*=*&71>=&3)=2.))1*=,74:58=&7*=89.11=(:77*39=).;*78`=':9='*(&:8*= 9-*>=<*7*=.39*7;.*<*)=&'4:9=9-*.7=*&71.*89=>*&78`=9-*>=<*7*=51&(*)=.3=9-*=&557457.&9*= (&9*,47.*8_==9&'1*=4+=8:22&7.8*)=7*85438*8=2&>='*=+4:3)=.3=55*3).==._=-*=51&(*8= 7*+*77*)=94=.3=9-*.7=7*85438*8=&7*=8-4<3=.3=2&58=4+=*&(-='14(0=.3=55*3).==/_= = /*85438*8=94=6:*89.438= -*=+.789=9<4=6:*89.438=&80*)=+47=+:11=3&2*=&3)=(439&(9=)*9&.18_= :*89.43=-a=.)=>4:=0**5=&=).&7>=47=14,'440=4+=&'&143*=+.8-.3,
= ,*;*3= ).;*78= 8.== +742= 9-*= *&71>= ,74:5= 0*59= &= /4:73&1= 4+= 9-*.7= &'&143*= +.8-.3,= &(9.;.9.*8_=>3*=).;*78=8*9=4+=/4:73&18=<&8=)*8974>*)_=.;*=4+=9-*=*&71>=).;*78=/4:73&18= <*7*= 8**3_= -7**= 4+= 9-*8*= <*7*= 5:7*1>= 4+= +.8-.3,= )*9&.18`= 1.89.3,= (&9(-*8`= ).;*= 9.2*8`= 51&(*8= &3)= 8&1*8_= -*= 49-*7= 9<4= ).&7.*8= (42'.3*)= *;*398= .3= 9-*= ).;*78= 5*7843&1= 1.+*= 2&77.&,*8`= '.79-8`= )*&9-8= *9(_= <.9-= +.8-.3,`= &3)= .3(1:)*)= 57.(*8= 7*(*.;*)`= )*9&.18= 4+= '4&9= 2&.39*3&3(*`= &3)= (&9(-= )*9&.18_= -*8*= /4:73&18= <*7*= 5&79.(:1&71>= -*15+:1= .3= (4774'47&9.3,= .3+472&9.43= 9-&9= <&8= 7*(*.;*)= +742= 49-*7= ).;*78= <-4= ).)= 349= 0**5= 14,'4408`=':9=7*1.*)=43=2*247>_= = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,- = =

:*89.43=.a=#-&9=>*&78=<*7*=>4:=&(9.;*1>=.3;41;*)=.3=(422*7(.&1=&'&143*=).;.3,
= ,9&79= &3)= +.3.8-= >*&78= <*7*= (43+.72*)= +742= 9;8= (&9(-= )&9&'&8*= <-*7*= 7*(47)8= *=.89*)_= :*89.43=/a=4<=41)=<*7*=>4:=<-*3=>4:=89&79*)
= -*7*=<&8=&=<.)*=;&7.&9.43=.3=&,*8='*9<**3=+1=&3)=./_=-*=(:77*39=,74:5=4+=).;*78= ,*3*7&11>= 89&79*)= ).;.3,= +47= &'&143*= &9= &3= 41)*7= &,*= 9-&3= 9-*= *&71.*7= ,74:58`= 57*8:2&'1>='*(&:8*=9-*=247*=7*(*39=-.,-=(&5.9&1=(4898=4+=*397>=94=9-*=+.8-*7>=)*9*77*)= >4:3,*7=5*451*_= :*89.43=0a=#-&9=<&8=>4:7='&(0,74:3)='*+47*=>4:=89&79*)
= &_ ;-&9=574259*)=>4:=94=89&79=).;.3,
= '_ ;&8=>4:7=+&2.1>=.3;41;*)=.3=9-*=+.8-.3,=.3):897>
= (_ ;-*7*=).)=>4:=,74<=:5=.+=7&.8*)=.3=&82&3.&
= )_ 4<=).)=>4:=+.789='*(42*=&<&7*=4+=9-*=&'&143*=+.8-*7>
= *_ 9.)=>4:=034<=&3>=49-*7=).;*78=&9=9-*=9.2*=9-&9=>4:=89&79*)
= 9:7.3,=9-*=+30*8=&3)=1*8`=9-*7*=<&8=&=<.)*857*&)=5*7(*59.43=&243,=9-*=(422:3.9>= 9-&9=).;.3,=<&8=&=-&?&7)4:8=&(9.;.9>_=,&+*=).;.3,=57&(9.(*8=<*7*=54471>=:3)*78944)`= &3)=842*=4+=9-*=*&71>=).;*78=<*7*=.3/:7*)='>=)*(4257*88.43=8.(03*88_=3=&)).9.43`=9-*= '*&(-=57.(*=4+=&'&143*=+1:(9:&9*)`=&3)=842*9.2*8=9-*=2&70*9=89455*)=':>.3,=+.8-_=-*= -*&19-=&3)=*(4342.(=+&(9478=)*9*77*)=2&3>=549*39.&1=*397&398=94=9-*=+.8-*7>=<-4=<*7*= :3+&2.1.&7=<.9-=(45.3,=<.9-=9-*=1*;*1=4+=7.80_=;-&9=&997&(9*)=9-*=.39*7;.*<**8
= 9=.8=&12489=97.9*=94=8&>=9-&9=&'&143*=).;.3,=.3;41;*8=&=(42'.3&9.43=4+=9<4=).89.3(91>= ).++*7*39= &(9.;.9.*8= := (422*7(.&1= +.8-.3,= &3)= ).;.3,_= 4<*;*7`= <-.1*= 1&(0= 4+= 57.47= .3;41;*2*39=.3=*.9-*7=4+=9-*8*=&(9.;.9.*8=).)=349=57*(1:)*=1&9*7=.3;41;*2*39=.3=&'&143*= ).;.3,`=2489=4+=9-48*=.39*7;.*<*)=<*7*=57*;.4:81>=.3;41;*)=<.9-=43*=4+=9-*=&(9.;.9.*8`= 57.3(.5&11>=).;.3,_== 4:7=4+=9-*=*&71>=,74:5=-&)=(422*7(.&11>=+.8-*)=&'&143*=47=49-*7=).;*8+.8-*7>=85*(.*8= 8:(-= &8= 2:88*18= .3= 479= -.11.5= &>= 47= 9-*= <*<= ,4:9-= ;&1*8= 84:9-= (4&89`= &3)= -&)= 24;*)= 94= &82&3.&= &+9*7= -*&7.3,= +742= &884(.&9*8= &'4:9= &82&3.&8= 1&7,*= &3)= (425&7&9.;*1>=:394:(-*)=&'&143*=894(08_=>9-*78`=-4<*;*7`=-&)=&12489=34=034<1*),*= 47= :3)*789&3).3,= 4+= (422*7(.&1= +.8-.3,_= 5489`= ':9= 349= &11= -&)= 57.47= 7*(7*&9.43&1= 83470*11.3,= *=5*7.*3(*_= >+= 9-*= *&71>= ,74:5`= 431>= 9-7**= -&)= 2:(-= *=5*7.*3(*= <.9-= :3)*7<&9*7= '7*&9-.3,= *6:.52*39= ':9= &9= &= 9.2*= <-*3= .98= :8&,*= <&8= 2:(-= 247*= 1.2.9*)b=.3=(4397&89`=&11=(:77*39=).;*78=-&)=57*;.4:8=(4257*88*)=&.7=).;.3,=*=5*7.*3(*_= 54891>`=9-*=*&71>=,74:5=<*7*=85*&7+.8-*72*3`=&3)=9-*>=<*7*=*=5*7.*3(*)=&9=8*&7(-.3,= +47=&3)=(411*(9.3,=+.8-=:3)*7<&9*7_=-*8*=*&71>=).;*78=<*7*=&997&(9*)=94=&'&143*=).;.3,= '*(&:8*=9-*>=8&<=.9=&8=&3=*=9*38.43=4+=9-*.7=7*(7*&9.43&1=&(9.;.9.*8_== -*=*&71>=3438).;*78=<*7*=.385.7*)=94=9&0*=:5=&'&143*=).;.3,='>=842*=(-&3(*=*;*39= 43*= := &= 3*<85&5*7= &79.(1*= 43= 9-*= 3*<= &'&143*= +.8-*7>= <-.1*= -*= <&8= ;.8.9.3,=

,. = 74/*(9=34_=,**.2*+- = =

&82&3.&`=&349-*7=:=&3=*3(4:39*7=<.9-=&3=&'&143*=).;*7=<-4=<&8=&=5&88*3,*7=.3=-.8= 9&=._=-*8*=*&71>=3438).;*78=-&)=247*=.3=(42243=<.9-=9-*=2.))1*8,74:5=&3)=(:77*39= ).;*78`= <-4= ,*3*7&11>= 8&.)= 9-&9= 9-*>= <*7*= &997&(9*)= '>= 9-*= 1.+*89>1*= 47= 9-*= +.3&3(.&1= 455479:3.9.*8=4++*7*)='>=9-*=+.8-.3,=.3):897>`=5&79.(:1&71>=&'&143*=).;.3,_= 3= 5&79`= 9-.8= 6:*89.43= <&8= .39*3)*)= 94= 8-4<= 9-*= *=9*39= 94= <-.(-= 9-*= *&71>= &'&143*= +.8-*7>= 7*1.*)= :543= 9-*= 97&).9.43&1= +.8-*7.*8= 74(0= 14'89*7`= 8-&70= ):7.3,= .98= )*;*1452*39_=5&3>=4+=9-*=1&7,*=97&).9.43&1=&82&3.&3=+.8-.3,=+&2.1.*8=-&;*=574):(*)= &9= 1*&89= 43*= &'&143*= ).;*7`= 84= .9= 8**2*)= 14,.(&1= 9-&9= 9-*>= 2.,-9= '*= .3897:2*39&1= .3= +472.3,=842*=4+=9-*=*&71>=+.8-.3,=9*(-3.6:*8=&3)=2*9-4)8_=4<*;*7`=431>=43*=4+=9-*= *&71>= 7*8543)*398= (&2*= +742= &= +.8-.3,= +&2.1>_= ;-.1*= 842*= 4+= 9-*= 2*9-4)8= <*7*= )*7.;*)=+742=49-*7=+.8-*7.*8=249-*7=8-.58`=9*3)*7=).3,-.*8`=2489=3*<=*397&398=.3=9-*= *&71>=,74:5=-&)=34=(422*7(.&1=+.8-.3,='&(0,74:3)_=-*>=<*7*=).;*78`=349=+.8-*72*3_== 9= .8= (43(1:)*)= 9-&9= <-.1*= 842*= 4+= 9-*= *&71.*89= &'&143*= ).;*78= <*7*= +742= +.8-.3,= '&(0,74:3)8= &3)= <*7*= 7*85438.'1*= +47= 842*= 4+= 9-*= )*;*1452*39= 4+= 9-*= +.8-*7>`= .2574;*2*398= .3= 2*9-4)8= &3)= 9*(-3414,.(&1= )*;*1452*398= :8:&11>= (&2*= ;.&= 3*<= *397&398= 94= 9-*= +.8-*7>= +742= 9-*= 2&.31&3)_= -*8*= .2574;*2*398= .3(1:)*)= 9-*= :8*= 4+= (-&7(4&1= &.7= +.19*78`= 85*(.&1= &.78'7*&9-.3,= -48*= &8= &= 7*51&(*2*39= +47= ,&7)*3= -48*= &3)= 2*8-='&,8=3*98=7*51&(.3,=-*88.&3='&,8_= :*89.43=1a=#-&9=8479=4+=*6:.52*39=).)=>4:=:8*=.3.9.&11>
= &_ 7:3&'4:9=47=+.8-.3,='4&9
= '_ 4<=;*-.(1*
= (_ 9.)=>4:=:8*=&=)*(0-&3)=.3.9.&11>
= )_ 9.)=>4:=<470=+742=&3(-47*)='4&98=<.9-=143,=-48*8
= *_ ;*98:.9=:=-4<=).)=>4:=(45*=<.9-=(41)
= +_ ;*7*=>4:=9&:,-9=94=).;*=:=.+=84`='>=<-4
== ,_ ;*7*=>4:=&=).;*7=57.47=94=&'&143*=+.8-.3,
= )7**=).;*78= -*=+.789=4+=9-*=*&71>=&'&143*=).;*78=<*7*=+7**=).;*78=:8*)=83470*1_=,42*=<*7*=8-47*8 '&8*)`= 45*7&9.3,= +742= 82&11= 97:(08= 47= (43;*79*)= (&78`= <-.1*= 49-*78= <470*)= +742= ).3,-.*8=&3)=1&7,*7=45*3='4&98_=-*=8-47*8'&8*)=45*7&9.438=<*7*=24891>=.3=9-*=84:9-8 *&89=&3)=*&89`=7*8543)*398=+.8-.3,=&74:3)=9-*=47*89.*7=&3)=&82&3=5*3.38:1&8`=7:3>= 81&3)=&3)=9+397*(&89*&:==?-&33*1`=.(-*34=&3)=9-*=D&7)*38_=3=+30-`=9<4=C.(947.&3= ).;*78= ;.8.9*)= ,2.9-943`= ,9&31*>= &3)= ?4:9&= 74(08`= ':9= ).)= 349= 9-.30= 2:(-= 4+= 9-*= 549*39.&1=+47=).;.3,=9-*7*`=&3)=8*991*)=&9=.(-*34_=-*=*&71>='4&9=45*7&9.438=8**2=94= -&;*='**3=24891>='&8*)=.3=94;*7_= >5.(&11>`=9-*=+7**=).;*78=8<&2=<.9-=&=3*9=8:85*3)*)=&9=9-*=8:7+&(*=+742=&=97:(0=9:'*_= -*8*= 3*98= <*7*= 1&7,*= *34:,-= 94= -41)= 0**= 54:3)8= 5,1*= 0.14,7&28= 4+= &'&143*_= -*= ).;*78= )74;*= 9-74:,-= 5&))4(08= &3)= &143,= (4&89&1= 97&(08= 94= &3= *397>= 54.39= 43= 9-*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,/ = =

8-47*`=8<&2=:39.1=9-*>=85499*)=&'&143*='*14<`=).;*)=&3)=(411*(9*)=9-*2`=7*9:73.3,=94= 9-*= 8:7+&(*= <-*7*= 9-*>= )7455*)= 9-*= &'&143*= .3= 9-*= 3*9_= ,(7*<)7.;*78= &3)= 24).+.*)= 03.;*8=<*7*=:8*)=94=+1.5=9-*=&'&143*=+742=9-*=7**+_=?&9(-=7&9*8=;&7.*)=,7*&91>='*9<**3= ).;*78`=842*=&;*7&,.3,=&=3*9=47=1*88=5*7=)&>`=<-.1*=49-*78=&;*7&,*)=9<4=3*98`=&3)=43=&= ,44)=)&>=1&3)*)=+4:7=3*98_=-*=)*59-=7&3,*=94=<-.(-=9-*>=<470*)=&184=;&7.*)_=5489= ).;*)= 1*88= 9-&3= ,*= +**9= 50= 2*97*8`= ':9= 9<4= 4+= 9-*= 7*8543)*398= <470*)= 94= ./= +**9= 7*,:1&71>=&3)=4((&8.43&11>=).;*)=94=247*=9-&3=0*=+**9_= +&71>= ).;*78= <*7*= -&25*7*)= '>= &= 1&(0= 4+= 574(*88.3,= .3+7&897:(9:7*= 9-&9= 1&9*7= ).;*78= 9&0*= +47= ,7&39*)_= 7.47= 94=9-*= )*;*1452*39= 4+= &= 14(&1= 2&70*9`= 2489= 574):(9= <&8= &.78 +7*.,-9*)= 94= ':>*78= &3)= (&33*7.*8= .3= 5*1'4:73*_= 3= +30.`= 4=&11= &3)= ;&99= 89&79*)= ':>.3,= &'&143*= .3= 9-*= 84:9-8*&89`= &3)= .3= +300`= ,&+(41= 89&79*)= (&33.3,= &'&143*= &9= 5&7,&9*_= -*= 2&70*9= <&39*)= &'&143*= 2*&98`= 84= 9-*= ).;*78= -&)= 94= 8-:(0= 9-*.7= (&9(-= '*+47*=9-*>=(4:1)=8*11=.9_=,42*=).;*78=).;*)=&11=)&>`=)7&,,.3,=9-*.7=3*98=4394=9-*=8-47*= <-*7*= 9-*>= <*7*= 1*+9= 4;*73.,-9_= -*= +4114<.3,= )&>`= 9-*= &'&143*= <*7*= 8-:(0*)= &3)= 9-*3=(411*(9*)=+47=8-.52*39=94=9-*=':>*7_=>9-*78=&19*73&9*1>=).;*)=&3)=8-:(0*)_=-*= 2*&98= <*7*= 851.9= +742= 9-*.7= 8-*118= <.9-= &= 24).+.*)= 5&.39= 8(7&5*7= .394= +,8,&1143= ,&1;&3.8*)=,&7'&,*='.38_=-*>=<*7*=0*59=7*&)>=+47=8-.52*39='>=*.9-*7=8947.3,=9-*='.38= .3=&=+7**?*7=47=8&19.3,=9-*=2*&98=.3=9-*='.38_= 3=+301=&=3*<=7:1*=<&8=.3974):(*)=94=9-*=+.8-*7>=7*6:.7.3,=).;*78=94=8*11=+.8-=.3=&=1.;*= (43).9.43=94=9-*=574(*88478_=9=<&8=2:(-=247*=).++.(:19=+47=9-*=8-47*8'&8*)=45*7&9478= 94=24;*=9-*=*=97&=<*.,-9=4+=1.;*=&'&143*=(_+_=2*&98=&143,=9-*=74:,-=':8-=97&(08=4+=9-*= (4&89`=&3)=(438*6:*391>=9-*>=89&79*)=<470.3,=+742='4&98_=*7*=9-*>=+4:3)=+7**=).;.3,= ).8&);&39&,*4:8= <-*3= (425*9.3,= +47= 9-*= 7*84:7(*= <.9-= ).;*78= '7*&9-.3,= &.7= :3)*7<&9*7`=&3)=9-*>=7&5.)1>=(43;*79*)=94=.98=:8*_= *3)*7<&9*7='7*&9-.3,=&55&7&9:8= ;-.1*=842*=).;*78=:8*)=,?8=+47=&='7.*+=5*7.4)`=8:7+&(*=8:551>=8>89*28=-440&-= 6:.(01>='*(&2*=:3.;*78&1_=-*8*=(4257.8*)=&=82&11=8.3,1*8(>1.3)*7=5*9741=*3,.3*=B&5`= C.11.*78`= 1&9*7= 43)&= )7.;.3,= &= 8.3,1*= 89&,*= 14<= 57*88:7*= 5= 1= '&72+**= 58.= &.7= (4257*8847=9>5.(&11>=?1.8'>_=.7=5&88*)=9-74:,-=+.19*78=&3)=&=).897.':9.43=2&3.+41)= .394=-48*8=94=9-*=).;*78='*14<`=<-4='7*&9-*)=9-74:,-=14<857*88:7*=)*2&3)8;&1;*8_= 9.;*78=<*7*=,7*&91>=(43(*73*)=&'4:9=9-*=6:&1.9>=4+=&.7=9-&9=9-*>='7*&9-*)_=>5.(&11>= 9-*=&.7=<&8=+.19*7*)=9-74:,-=(49943=<&89*=47=8&3.9&7>=3&50.38=94=7*24;*=4.1=5&79.(1*8_= 3=9-*=1&9*=+30*8`=).;*78=<-4=-&)=24;*)=94=&82&3.&=+742=&'&143*=+.8-*7.*8=43=9-*= 2&.31&3)=.3974):(*)=(-&7(4&1=+.19*78`=&19-4:,-=9-*8*=<*7*=(7:)*=&3)=2&)*=.3*++*(9.;*= '>=24.89:7*_= >7.,.3&11>`=2.3*7&1=4.18=<*7*=:8*)=&8=&=1:'7.(&39=.3=9-*=(4257*88478`=':9`=.3=9-*='*1.*+= 9-&9= 2.3*7&1= 4.1= <&8= 54.8434:8= &3)= <4:1)= )&2&,*= 9-*.7= 1:3,8`= 2&3>= 8<.9(-*)= 94= ;*,*9&'1*=(440.3,=4.18_=-*8*=<*7*=5447=1:'7.(&398`=-4<*;*7`=&3)=1*+9=)*548.98=.3=9-*= 5.8943=,744;*8=(&:8.3,=9-*=7.3,8=94=89.(0=&3)=*3&'1*=82&11=6:&39.9.*8=4+=4.1=94=*39*7=9-*= (4257*88.43= (-&2'*7_= ;-*3= 9-*= (4257*88478= '*(&2*= -49= ):7.3,= :8*= *_,_= <-*3= 7:33.3,=&9=-.,-=7*;41:9.438=94=8:551>=).;*78=<470.3,=)**5=.9=<&8=9-4:,-9=9-&9=5&79.&1=

,0 = 74/*(9=34_=,**.2*+- = =

':73.3,= 4+= 9-*= 4.1= 9440= 51&(*`= .3974):(.3,= (&7'43= 2434=.)*= .394= 9-*= &.7_= 7&,.(&11>`= 9-*7*= <*7*= 8*;*7&1= )*&9-8= &243,= -440&-= ).;*78= &997.':9*)= 94= (&7'43= 2434=.)*= 54.843.3,_= 3= 9-*= +31*8= 85*(.&11>= +472:1&9*)= 5*9741*:28'&8*)= (4257*8847= 4.18= '*(&2*=545:1&7`=&3)=247*=7*(*391>=).;*78=-&;*=8<.9(-*)=94=8>39-*9.(=4.18=)*;*145*)= +47=14<857*88:7*=&.78'7*&9-.3,=(4257*88478_= -*= +.789= ).;.3,= -48*8= <*7*= C?= ,&7)*3= -48*_= ;-*3= 9-*>= '*(&2*= -49= 9-74:,-= &= (42'.3&9.43= 4+= 8:31.,-9`= 2&(-.3*7>= -*&9= &3)= &.7= 57*88:7*`= 9-*= 57*88:7*= (&:8*)= 14(&1.8*)= .3+1&9.43`= 851.99.3,= &3)= .22*).&9*= &.7= 1488`= +47(.3,= 9-*= ).;*7= 94= 6:.(01>= 8:7+&(*_=-.3=9<.3*=(4:9&=(47)=<&8=4+9*3=<7&55*)=&74:3)=94=7*.3+47(*=9-*=+.789=+*= 2*97*8=4+=-48*`=':9=+&.1:7*8=<*7*=89.11=(42243_=:7548*=)*8.,3*)=&.7='7*&9-.3,=-48*= <&8= .3974):(*)= 94= 9-*= +.8-*7>= ;.&= 2&.31&3)= ).;*78= .3= 9-*= 2.)= 94= 1&9*= +30*8`= &3)= *1.2.3&9*)=9-.8=574'1*2_= 4257*88*)=&.7=).;*78= -*=*&71>=).;*78=:8.3,=-440&-=:3.98=:8:&11>=<470*)=+742='4&98`=*.9-*7=&143*=47=<.9-= &349-*7=).;*7_=-*='4&98=<*7*=&3(-47*)=&9=9-*=).;*=8.9*_=-*=).;*78=<470*)=&74:3)=9-*= '4&9`=*&(-=1.2.9*)='>=9-*=1*3,9-=4+=-48*_=-*=&'&143*=<*7*=(411*(9*)=.3=-*88.&3=549&94= 8&(08`=94=<-.(-=&=(4.1*)=745*=&3)=82&11=':4>=<*7*=&99&(-*)_==(&3;&8=1.+9='&,=<&8=&184= &99&(-*)=94=9-*=8&(0`=84=9-&9=9-*=':4>&3(>=4+=9-*=8&(0=4+=&'&143*=(4:1)='*=7*,:1&9*)= &3)=*&8.1>=24;*)=&74:3)=9-*=7**+_=;-*3=9-*=8&(0=<&8=+:11=50*=0,`=9-*=).;*7=1*9=9-*= ':4>=+14&9=94=9-*=8:7+&(*=&3)=8<&2='&(0=94=9-*='4&9=<-*7*=-*=(411*(9*)=&=3*<=8&(0=&3)= ':4>_=;-*3=-*=3**)*)=94=8-.+9=9-*='4&9`=*.9-*7=&9=9-*=*3)=4+=9-*=)&>=47=<-*3=24;.3,= 94=&=+7*8-=).;*=8.9*`=-*=)74;*=9-*='4&9=&74:3)=94=*&(-=':4>=&3)=5:11*)=:5=9-*=8&(08=4+= &'&143*= .394= 9-*= '4&9_= -*= 2*8-*)= '&,8= (:77*391>= .3= :8*= <*7*= .3974):(*)= 94= 9-*= +.8-*7>='>=).;*78=+742=84:9-*73=<,;=47=5&11&(449&=C.(947.&=):7.3,=9-*=1&9*=+30*8`= &3)=6:.(01>=7*51&(*)= 9-*=549&94=8&(08_=3.9.&11>=9-*>=<*7*=1&7,*`=&3)=(4:1)=-41)=+/*= 0.14,7&28_=?:77*39=).;*78=9>5.(&11>=:8*=3*98=4+=43*=6:&79*7=9-.8=(&5&(.9>_= 8=&'&143*=(&9(-*8='*(&2*=247*=85&78*1>=).897.':9*)`=).;*78=+4:3)=9-&9=9-*>=-&)=94= 24;*= 9-*= '4&9= 247*= +7*6:*391>_= 54;.3,= '4&98= <&8= 9.2*= (438:2.3,= &3)= (4251*=`= 5&79.(:1&71>= .+= 247*= 9-&3= 43*= ).;*7= <&8= +.8-.3,= +742= .9`= &3)= 842*= 1&7,*7= '4&98= -&)= 9-7**=).;*78_=+=&=).;*7=7&3=4:9=4+=+.8-`=&3)=<&39*)=94=24;*`=47=-*=-&)=/:25*)=.3=43= )*51*9*)= 7**+`= -*= <4:1)= 3**)= 94= ,*9= 9-*= 49-*7= ).;*78='&(0=43=)*(0`=894<=).;*=,*&7`= <*.,-= &3(-47`= &3)= 24947= &74:3)= (411*(9.3,= 8&(08_= -.8= (4:1)= 9&0*= &3= -4:7`= <&8= <&89*+:1=4+=9.2*=&3)=*3*7,>`=&3)=).;*78=)*;.8*)=).++*7*39=897&9*,.*8=94=&;4.)=.9_= -*=+.789=897&9*,>=<&8=94=.3(7*&8*=9-*=1*3,9-=4+=-48*_=9:7.3,=9-*=+31*8`=43=1&7,*7='4&98= <.9-= 2:19.51*= ).;*78`= -48*8= :5= 94= +/**= +**9= 5/**= 2*97*8= .3= 1*3,9-= <*7*= (422431>= :8*)_=-*=-48*8=<*7*=8947*)=43=-48*=7**18=:8:&11>=+&89*3*)=94=9-*=,:3<&1*=4+=9-*='4&9`= &3)=&8=9-*=).;*7=24;*)=+:79-*7=&<&>`=-*=5:11*)=4++=247*=-48*_=7*6:*391>`=9-*=9.,-9= 7&).:8=4+=9-*=(4.18=<4:1)='*=.257*88*)=.3=9-*=-48*`=&3)=&8=.9=1&>=1448*=43=9-*=8:7+&(*`= <4:1)=.39*72*8-=<.9-=49-*7=(4.18=(&:8.3,=574).,.4:8=9&3,1*8_=9=49-*7=9.2*8`=9-*=(4.18= 4+=-48*=<4:1)=+&11='*3*&9-=&)/&(*39=(4.18=57*;*39.3,=9-*=-48*=+742=:37411.3,`=47=9-*= 7**1=<4:1)=4;*77:3=&3)=(&:8*=9-*=-48*=94=/&2=47=9&3,1*_=-*8*=574'1*28=9*9-*7*)=9-*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,1 = =

).;*7= &9= 7*):(*)= 7&3,*= &3)= 3*,&9*)= 9-*= '*3*+.98= 4+= 143,= -48*8_= 88:&11>= 9-*= '4&98= 80.55*7= 47= .+= -*= <&8= &= ).;*7= &= )*(0-&3)= 9*3)*)= 9-*= -48*8= 94= 57*;*39= 9&3,1*8= &3)= 0**5=9-*=(4257*8847=7:33.3,_=-*=143,=-48*8=2*&39=9-&9=).;*78=4+9*3=+.11*)=9-*.7='&,8= &9= ,7*&9= ).89&3(*8= +742= 9-*= '4&9_= ,<.22.3,= /**= 2*97*8= <.9-= &= +:11= 3*9= 4+= &'&143*= 8:85*3)*)= '*3*&9-= &= 1.+9= '&,= <&8= 9.2*= (438:2.3,= &3)= 9.7.3,`= 84= 9-*= 80.55*7= 47= )*(0-&3)=5*7.4).(&11>=)74;*=94=*&(-=).;*7=.3=&=).3,->=94=(-*(0=-.8=574,7*88`=(411*(9= +:11='&,8=47=+*77>=9-*=).;*7='&(0=94=9-*='4&9_== 9:7.3,=9-*=2.)8+31*8=.3=9-*=*&89=&3)= 84:9-=*&89`=).;.3,= +742=9-*=)*(0=4+=9-*=1&7,*7= '4&98= 24891>= 89455*)`= '*(&:8*= 894(08= -&)= '*(42*= 944= )*51*9*)= *;*3= +47= 9-*= 143,= -48*8`=&3)=9-*8*='4&98=*.9-*7=<*39=94=<470=43=9-*=<*89=(4&89=<-*7*=&'&143*=<*7*=89.11= &':3)&39`= 47= 9-*= ).;*78= <470*)= +742= ).3,-.*8= 47= 82&11= 7:3&'4:98= <.9-= 9-*.7= 4<3= (4257*88478_=-*8*=).3,-.*8=<*7*=(&77.*)=43=9-*=)*(0=4+=9-*=1&7,*7='4&9=249-*7=8-.5= <-*3=97&;*11.3,=47=.3=5479`=':9=7&3,*)=+&7=+742=9-*=249-*7=8-.5=<-.1*=<470.3,_=-*= ).3,-.*8=:8:&11>=(&77.*)=9<4=).;*78=47=43*=).;*7=&3)=&=)*(0-&3)_= 3= 9-*= *&71.*7= 89&,*8= 4+= 9-*= +.8-*7>= <-*3= .3(42*8= <*7*= 7*1&9.;*1>= 14<`= 2489= ).;*78= (4:1)= 349= &++47)= 94= 5&>= )*(0-&3)8`= &3)= *.9-*7= <470*)= &143*= 47= <.9-= &349-*7= ).;*7_= *&(-=57.(*8=.3(7*&8*)='>=247*=9-&3=+**='*9<**3=+31,=&3)=+31.=94=4;*7=.*=(*398=5*7= 0.14,7&2`= &3)= )*(0-&3)8= '*(&2*= &++47)&'1*_= -*= &;&.1&'.1.9>= 4+= &= )*(0-&3)= 2*&39= 9-&9=9-*=).3,->=47=7:3&'4:9=34=143,*7=-&)=94='*=&3(-47*)`=':9=(4:1)=+4114<=9-*=).;*7= &8=-*=8*&7(-*)=9-*=8-47*_=-*=).;*7=34=143,*7=-&)=94=897:,,1*='&(0=94=9-*='4&9=<.9-=&= 14&)*)='&,=4+=&'&143*=':9=.389*&)`=9-*=)*(0-&3)=548.9.43*)=9-*='4&9=(148*=94=9-*=).;*7= <-4= 34<= 431>= -&)= 94= &8(*3)= 94=4++814&)= -.8= (&9(-_= -.8= 2&)*= +.8-.3,= 247*= *++.(.*39= 9-&3=<.9-=&3(-47*)='4&98`='*(&:8*=9-*7*=<&8=7*):(*)=1488=4+=9.2*=8<.22.3,='*9<**3= 9-*= 7**+= &3)= 9-*= '4&9`= &3)= 7*):(*)= 7.80= 4+= 9-*= ).;*7= 148.3,= 97&(0= 4+= &= 5&9(-= 4+= 574):(9.;*=7**+_=>=+31.`=2489=4+=9-*=).;*78=&9=,9=*1*38=-&)=&)459*)=9-.8=2*9-4)_= =+:79-*7=)*;*1452*39=4((:77*)=.3=9-*=2.)=94=1&9*=+32*8=<.9-=9-*=:8*=4+=)7451.3*8_== )7451.3*= (438.89*)= 4+= &= 745*= <.9-= &= <*.,-9= &3)= &= 85&7*= 3*9= 43= 43*= *3)`= <-.(-= <&8= 9-74<3=94=9-*=).;*7=<470.3,=43=9-*=7**+='*14<_=-*=).;*7=(1.55*)=9-*=3*9=9-&9=-*=<&8= +.11.3,= 94= 9-*= )7451.3*`= 9440= 9-*= *259>= '&,= &3)= (439.3:*)= +.8-.3,_= -*= )*(0-&3)= -&:1*)=9-*=+.11*)=3*9=94=9-*=8:7+&(*_=9:7.3,=9-*=+33*8`=9-*=2*9-4)='*(&2*=247*=7*+.3*)= <.9-=9-*=:8*=4+=82&11*7`=1*88=':10>=3*98=<-.(-=<*7*=9-74<3=94=9-*=).;*7=&9=7*,:1&7=*_,_= +*= 2.3:9*= .39*7;&18_= 83)*7= 842*= (.7(:289&3(*`= 5&79.(:1&71>= .3= )**5*7= <&9*7`= 9-*= 2*9-4)=4++*7*)=,7*&9=.2574;*2*398=.3=*++.(.*3(>='*(&:8*=.9=*1.2.3&9*)=9-*=<470=)43*= '>=9-*=).;*7=97&385479.3,=9-*=(&9(-=+742=9-*=7**+=94=9-*='4&9_=9=<&8=8&+*7='*(&:8*=.9= 7*):(*)= 9-*= 3:2'*7= 4+= &8(*398= &3)= (438*6:*391>= 9-*= 1.0*1.-44)= 4+= )*(4257*88.43= 8.(03*88_=9=<&8=*&8.*7=+47=9-*=).;*7`='*(&:8*=.9=7*):(*)=9-*=<*.,-9=4+=&'&143*=9-&9=-*= -&)= 94= 8<.2= <.9-= &8= -*= 8*&7(-*)`= &3)= .9= 2*&39= 9-&9=-*= ).)= 349= -&;*= 94= 8<.2= &<&>= +742=&3)=549*39.&11>=148*=&=5&9(-=4+=&'&143*=<-*3=-.8='&,='*(&2*=+:11_= 19-4:,-=9-*8*=(-&3,*8=-&;*='**3=&12489=:3.;*78&11>=&)459*)`=&=+*<=).;*78=(439.3:*= 94= <470= +742= &3(-47*)= '4&98= <.9-= 1&7,*= 2*= 0.14,7&2= 3*98`= 5&79.(:1&71>= .+= 9-*>= &7*= <470.3,=&143*=47=<.9-4:9=&=)*(0-&3)`=47=.+=(43).9.438=*_,_=-.,-=894(0=1*;*18=8:.9=9-.8= 89>1*=4+=+.8-.3,_=

,2 = 74/*(9=34_=,**.2*+- = =

+'&143*=+.8-.3,='4&98= +&71>=.3=9-*=+.8-*7>=9-*7*=<&8=34=8.3,1*=89>1*=4+='4&9=8:(-=&8=9-*=:'.6:.94:8=4:9'4&7)8 54<*7*)=&1:2.3.:2=).3,->=47= 9.33>=9-&9=-&8='*(42*=(4224351&(*=9-74:,-4:9=9-*= &82&3.&3=+.8-*7>=):7.3,=9-*=1&89=9-7**=)*(&)*8_=9.;*78=:8*)=<-&9*;*7=9-*>=(4:1)=,*9= 9-&9=<4:1)=89&>=&+14&9_=-*=1&7,*7='4&98=<*7*=4+9*3=41)*7=9.2'*7=;*88*18=9-&9=-&)='**3= 7*9.7*)=+742=9-*=14'89*7=47=8-&70=.3):897.*8`=47=7.;*7=1&:3(-*8=&3)=5&88*3,*7=+*77.*8`=47= *;*3= 7*(7*&9.43&1= 54<*7'4&98= &3)= >&(-98_= -*>= (&77.*)= 47= 94<*)= 82&11*7= ).3,-.*8= +742=<-.(-=9-*=).;*78=<470*)_=.8-.3,=97.58=9440=+742=43*=94=8*;*7&1=)&>8`=&3)=9-*= (&9(-=<&8=8947*)=43=)*(0=47=.3=9&308=47=<*118=.+=&;&.1&'1*_= ,2&11*7='4&98=<*7*=7*897.(9*)=94=)&>8+.8-.3,_=839.1=9-*=1&9*=+30*8`=9-*8*=<*7*=:8:&11>= 9.2'*7=).851&(*2*39=;*88*18=<.9-=14<=54<*7*)=.3'4&7)=*3,.3*8`=':9=<*7*=&184=7*1.&39= 43=4&78=47=8&.18=+47=5745:18.43_=>:9'4&7)=54<*7*)=51><44)=&3)=+.'7*,1&88=7:3&'4:98= &55*&7*)=.3=9-*=+.8-*7>=+742=9-*=2.)8+30*8_=-*.7=:8*=,7*&91>=*=9*3)*)=9-*=).89&3(*= 9-&9= ).;*78= (4:1)= 45*7&9*= +742= 5479= ):7.3,= &= )&>`= &3)= 9-*= 82&11= ).851&(*2*39= -:118= <*7*=&'&3)43*)_== -*=51&3*.3,=-:118=<*7*=7*1&9.;*1>=*=5*38.;*`=&3)=+.3&3(.&11>='*>43)=7*&(-=4+=2&3>= ).;*78_=,42*=<*7*=5:7(-&8*)=9-74:,-=-.7*85:7(-&8*=&,7**2*398=<.9-=-.,-=7*5&>2*39= 1*;*18_= -*= .77*,:1&7= 7*9:738= +742= 9-*= &'&143*= ).;.3,= 1*+9= 2&3>= :3&'1*= 94= 2**9= 9-*= 2439-1>= 5&>2*398`= &3)= 14&3= )*+&:198= <*7*= (42243`= ,.;.3,= &'&143*= ).;*78= &= '&)= 7*5:9&9.43= &243,= 9-*= ':8.3*88= (422:3.9>_= >9-*7= ).;*78= 1*&8*)= 7:3&'4:98= +742= 7*(7*&9.43&1= '4&9= 4<3*78_= -*8*= &77&3,*2*398= +7*6:*391>= '*(&2*= ).8-&7243.4:8= '*(&:8*=9-*='4&98=<*7*=1*+9=.3=&=5447=89&9*`=):*=94=1&(0=4+=2&.39*3&3(*='>=9-*=).;*78=43= '4&98=<-.(-=<*7*=349=)*8.,3*)=+47=<470=':9=8:'/*(9=94=-.,-=1*;*18=4+=<*&7=&3)=9*&7_= 3.9.&11>=9-*=51&3*.3,=-:118=<*7*=349=97&.1*7='473*`=':9=9.*)=&9=&=/*99>=<-.189=.3=5479_=3=,9= *1*38=):7.3,=9-*=1&9*=+30*8`=:5=94=+/=7:3&'4:98='*9<**3=._/=&3)=1=2*97*8=9.*)=&9=9-*= /*99>`=<.9-=1*88*7=3:2'*78=&9=54798=+:79-*7=84:9-_=+=&=).;*7=<&39*)=94=+.8-=.3=&=).++*7*39= 7*,.43`= -*= '4774<*)= &= 97&.1*7= 94= 24;*= -.8= '4&9= 94= &349-*7= 5479`= 47= .+= 9-*= '4&9= <&8= 1*&8*)`=9-*=4<3*7=24;*)=.9`=47=-*=1*&8*)=&349-*7='4&9=.3=9-*=).++*7*39=7*,.43_=4<.3,= '4&98= '*(&2*= (42243= ):7.3,= 9-*= *&71>= +31*8`= <.9-= ,7*&9*7= &;&.1&'.1.9>= 4+= 247*= 54<*7+:1= *3,.3*8= .3= :9.1.9.*8= &3)= 9-*= .3974):(9.43= 4+= +4:78<-**1= )7.;*= 1.,-9= 97:(08`= 5&79.(:1&71>=9-*=4>49&=O&3)(7:.8*7_= #*98:.98 = 38-47*=<&9*7=9*25*7&9:7*8=.3=&82&3.&=9>5.(&11>=7&3,*='*9<**3=++J?=&3)=+3J?`=&3)= 574143,*)= .22*78.43= )*2&3)8= 842*= 9>5*= 4+= 5749*(9.43= +742= 9-*= (41)_= ,42*= 4+= 9-*= *&71>= ,74:5= <*7*= <*11= *6:.55*)= +742= 9-*= 89&79`= <.9-= +:1181*3,9-= 3*457*3*= <*98:.98_= >9-*78=89&79*)=<.9-=+449'&11=/:25*78=&3)=&=1&7,*=+.7*=43=9-*='*&(-=<-*7*=9-*>=<&72*)= :5=&9=7*,:1&7=.39*7;&18_=-*=*&71>=3*457*3*8=<*7*=-&7)=&3)=.3+1*=.'1*=&3)=(-&+*)=9-*= 80.3`= 842*9.2*8= (&:8.3,= 1&7,*= :1(*7&9.3,= 847*8_= 4= 7*):(*= (-&+.3,`= ).;*78= <47*= 894(0.3,8`=5&39>8-48*=47=.3=*=97*2*=(&8*8=&551.*)=C&8*1.3*=94=9-*.7=80.3_=+&71>=<*98:.98= <*7*= 9>5.(&11>= 8.3(-= 50= 2.11.2*97*8= 9-.(0`= :3(42+479&'1*= &3)= 9-*= ).;*78= '*(&2*= (41)=7*1&9.;*1>=6:.(01>_=9:7.3,=9-*=2.)8+31*8`=247*=+1*=.'1*=3*457*3*8=<.9-=84+9=.33*7=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,3 = =

1.3.3,8= <*7*= )*;*145*)= &3)= 9-*= *89&'1.8-2*39= 4+= 14(&1= 2&3:+&(9:7*78= 2*&39= 9-&9= (:89428+.99*)=<*98:.98=(4:1)='*=574):(*)_= 97>88:.98= '*(&2*= <.)*1>= :8*)= +47= &= 5*7.4)= ):7.3,= 9-*= +32*8`= ':9= +*<= &243,= 9-*= (:77*39=,74:5=4+=).;*78=:8*)=9-*2='*(&:8*=9-*>=<*7*=+4:3)=94='*=).++.(:19=94=:8*=.3= 8-&114<= <&9*7= &3)= :31*88= 9-*= <&9*7= <&8= :3:8:&11>= (41)`= 4++*7*)= 34= &);&39&,*= 4;*7= (43;*39.43&1=<*98:.98_= :*89.43=2a=#-&9=<*7*=9>5.(&1=<*.,-98=9-&9=>4:=1&3)*)=&9=9-*=89&79=4+=>4:7=).;.3,=(&7**7
=.)= 1&3)*)=<*.,-98=(-&3,*=,*9=82&11*7`=1&7,*7=.3=1&9*7=>*&78
= ;-&9=<*7*=).;*78=*=5*(9&9.438=4+=&3=&;*7&,*=)&>8=(&9(-`=&3)=&=,44)=(&9(-
=9.)=9-*>= (-&3,*=4;*7=9.2*
=?4397&89.3,=9-.8=(7:)*=2*&8:7*=4+=(&9(-=7&9*8=0.14,7&2=5*7=)&>= ,.;*8= &3= &5574=.2&9*= .3).(&9.43= 4+= <-*3= +.8-.3,= 89&79*)= 94= .25&(9= 43= 9-*= ;.7,.3= +.8-*7>_=9=&184=.3).(&9*8=9-*=8.?*=4+=9-*=(&9(-=7*6:.7*)=94=45*7&9*=&9=574+.9&'1*=1*;*18_= -*=*&71.*89=).;*78=<470.3,=9-*=84:9-8*&89=1&3)*)=9-*=1&7,*89=(&9(-*8_=?&9(-*8=4+=+,**= 54:3)8=<*7*=7*,&7)*)=&8=8&9.8+&(947>`=&3)=4((&8.43&11>=(&9(-*8=7*&(-*)=,.**=54:3)8_= :79-*7=3479-=&9=.(-*34=&3)=9-*=D&7)*38`=(&9(-*8=<*7*=2:(-=14<*7a='*9<**3=+**=&3)= 0**=54:3)8=5*7_=-.8=<&8=574'&'1>=349=):*=94=7*,.43&1=).++*7*3(*8=.3=;.7,.3='.42&88`= ':9= 247*= 1.0*1>= &++*(9*)= '>= ).++*7*3(*8= .3= *6:.52*39= 1*;*18= *_,_= <-*9-*7= 9-*= ).;*78= <47*= <*98:.98= 47= +449'&11= /:25*78`= 9-*= (&5&(.9>= 4+= 9-*= 2&70*9= 94= &'847'= (&9(-= &3)= 249.;&9.43=94=*&73=243*>_== -*=*&71.*89=).;*78=7*,&7)*)=&'&143*=+.8-.3,=&8=&=43*84++=&(9.;.9>b=.3=49-*7=<47)8`=9-*>= (438.)*7*)=9-&9=43(*=9-*>=-&)=(411*(9*)=9-*=&'&143*=+742=&=7**+`=1&9*7=+.8-.3,=<4:1)= 349= '*= <479-<-.1*_= <4= 4+= 9-*= *&71>= ,74:5= 8&.)= 9-*>= <*7*= 8:757.8*)= <-*3= '&)= <*&9-*7=+47(*)=9-*2=94=7*;.8.9=?4&1=4.39=43=7:3>=81&3)=43*=>*&7=&+9*7=.9=-&)='**3= *=9*38.;*1>= +.8-*)= &3)= 1*+9= .3= &3= &55&7*391>= )*51*9*)= 89&9*_= -*>= +4:3)= 9-&9= 894(0= 1*;*18=8**2*)=94=-&;*=7*,*3*7&9*)_=-.8=(-&3,*)=9-*.7=5*7(*59.43=4+=&'&143*=+.8-.3,= +742= 2.3.3,= &= 7*84:7(*= 94= &= 8:89&.3&'1*= &(9.;.9>`= &3)= +47(*)= 9-*2= 94= (438.)*7= 9-&9= 7**+8=).++*7*)=.3=574):(9.;.9>_= ?&9(-= 7*(47)8= (411*(9*)= .3(.)*39&11>= <.9-= 2&70*9= 2*&8:7.3,= 8&251*8= 8-4<= &= 7&5.)= )*(1.3*=.3=)&.1>=1&3).3,8=):7.3,=9-*=1&9*=+30*8=.3=7*5479.3,='14(08=+-=&3)=+.=84:9-8 *&89_= -*= 2&70*9= 2*&8:7.3,= 8&251*8= &184= 8-4<= &= 7&5.)= )*(1.3*= .3= 24)&1= 1*3,9-= 4+= &'&143*= 8-*118= +742= +0*= 2.11.2*97*8= .3= +301= 94= *++*(9.;*1>= 03.+*= *),*= &9= 9-*= +,1= 2.11.2*97*= 8.?*81.2.9= '>= +31/= ;.9-*785443`= +31/`= (438.89*39= <.9-= &= +:11>= *=514.9*)= +.8-*7>_=-*=*&71>=,74:58=*=5*(9&9.438=4+=(&9(-=8.?*=<*7*=14<*7=.3=9-*=2.)8+31*8=9-&3= .3=9-*=+30*8_=

-* = 74/*(9=34_=,**.2*+- = =

Average daily catch, 1967-1976

900 Block 13 800 Block 14 700 600 500 400 300 200 100 Average daily catch (kg) 0 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 = *.,:7*=/= %;*7&,*=)&.1>=1&3).3,8=4+=&'&143*`=+301:10`='14(08=+-=&3)=+._=-*8*=89&9.89.(8=<*7*= 9&0*3=+742=8&251*8=4+='4&9=1&3).3,8=&9=-4;*7=&3)=4:9-5479`=&3)=&7*=349=+742=9-*= *39.7*=(&9(-_=-*=8&251*8=<*7*=7*897.(9*)=94=8.3,1*=)&>=(&9(-*8=349=2:19.8)&>=97.58`= ':9=2&>=7*57*8*39=9-*=(&9(-*8=4+=247*=9-&3=43*=).;*7_= 5489=).;*78=.251.(.91>=(&9*,47.8*)=7**+8='>=9-*.7=894(0=1*;*18`=9-*=(&9(-=9-&9=(4:1)='*= 9&0*3=+742=9-*2=5*7=)&>=(&9(-=7&9*=&3)=(438*6:*391>`=9-*.7=574):(9.;.9>_=-*=*&71>= ,74:5=8&<=9-*=8.?*=4+=)&.1>=1&3).3,8=+&11=):7.3,=9-*=+31*8`=&3)=.3=9-*=84:9-8*&89=(148*= 94=54798`=.9=<&8=(438.)*7*)=&((*59&'1*=94=+.8-=&9=7&9*8=)4<3=94=+**=0.14,7&28=5*7=)&>= ,*= 0.14,7&28= 5*7= -4:7b= .3= 49-*7= <47)8`= 9-*= 7**+= <&8= 89.11= (438.)*7*)= 574):(9.;*= &9= 9-.8=14<=1*;*1_= -*=(:77*39=,74:5=4+=).;*78=*=5*7.*3(*)=2:(-='*99*7=(&9(-=7&9*8=10*=0.14,7&28=5*7= -4:7=):7.3,=9-*=2.)=94=1&9*=+33*8_=9:7.3,=9-.8=9.2*`=2489=7**+8=<*7*=574):(9.;*`=&3)= 9-*=-.,-=1*;*1=4+=(&9(-=9&0*3=+742=<-&9=.8=34<=034<3=&8=9-*=+&89*73=I43*=*38:7*)= 9-&9=*++479=<&8=<.)*857*&)_=4114<.3,=9-*=54898,***=)*(1.3*=.3=894(08`=(&9(-=7&9*8=43= 2&3>= 7**+8= +*11= '*14<= &((*59&'1*= 1*;*18_= .8-.3,= 5&99*738= (-&3,*)`= &3)= *++479= <&8= ).7*(9*)= 24891>= 94= 7**+8= 9-&9= 574):(*)= &'&143*= &'4;*= 9-7*8-41)= (&9(-= 7&9*8= .*:/*= 0.14,7&28=5*7=-4:7=&3)=9-*=1*88=574):(9.;*=7**+8=<*7*=7&7*1>=;.8.9*)_= :*89.43=3a=#-4=).)=>4:=24891>=8*11=94
= :*89.43=+*a=#-&9=57.(*=7&3,*=).)=>4:=7*(*.;*=+47=>4:7=+.8-
= -*=*&71.*89=8&1*8=4+=&'&143*=+3/3='>=).;*78=+742=9-*=*&71>=,74:5=<*7*=2&)*=94=&3= :3034<3= ?-.3*8*= ':>*7= .3= 4'&79`= 47= 94= &= 574(*8847= .3= 5*1'4:73*= ,4:9-= &(.+.(= ?&33*7>= 7:3= '>= 9&;.)= D.1'*79_= >9-*7= *&71>= ':>*78= .3(1:)*)= ,&+(41= &3)= C&3= O&.3*= )*1&.)*_= 9:7.3,= 9-*= *&71>= +30*8`= 9-*= 14(&1= 2&70*9= <4:1)= &((*59= 431>= 1.2.9*)= 6:&39.9.*8=4+=(&9(-`=&3)=2489=<&8=841)=94=2&.31&3)=':>*78_=9.;*78=:8:&11>=-&)=94=5&>= 9-*=(489=4+=&.7=+7*.,-9.3,=9-7**=5*3(*=5*7=54:3)=9-*.7=(&9(-=94=9-*=574(*88478=)447_=3= 842*=(&8*8=9-*=(&9(-=<&8=7*5479*)=94=-&;*=&77.;*)=854.1*)=<-.(-=2*&39=9-&9=9-*=).;*7= 7*(*.;*)=34=5&>2*39_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = -+ = =

*9<**3= +30*= &3)= +30/`= ).;*78= <*7*= 5&.)= 8.== 5*3(*= 5*7= 54:3)= 2*&98<*.,-9_= -*= ).;*78=-&)=94=851.9=9-*=2*&98=4:9=4+=9-*=8-*118='*(&:8*=9-*=2&70*9=7*6:.7*)=2*&98_=3= +301`=&=7:1*=7*6:.7.3,=9-&9=&'&143*='*=)*1.;*7*)=.3=&=1.;*=(43).9.43=94=574(*88478=<&8= .3974):(*)`= &+9*7= <-.(-= 1&3).3,8= <*7*= 5&.)= '>= 8-*11= <*.,-9`= 349= 2*&9= <*.,-9_= ,.== 5*3(*=5*7=54:3)=2*&98<*.,-9=.8=*6:.;&1*39=94=++=(*398=5*7=0.14,7&2`=47=&88:2.3,=.*= 7*(4;*7>=7&9*`=._.=(*398=5*7=0.14,7&2=8-*118<*.,-9_=4=5:9=9-.8=57.(*=.3=&=(439*2547&7>= (439*=9`=43*=).;*7=8&.)=9-&9='*9<**3=+30*=&3)=+30,=-*=(4:1)=2&0*=247*=243*>=+742= (&9(-.3,=&'&143*=43= <**0*3)8=+.8-.3,=43= ,&9:7)&>`=574(*88.3,=43=,:3)&>=9-&3=-*= (4:1)=<470.3,=&9=-.8=97&)*=&8=&=5&3*1='*&9*7=):7.3,=9-*=<**0_=349-*7=).;*7=8&.)=9-&9= -*= (4:1)= 2&0*= 247*= 243*>= .3= 43*= )&>8= +.8-.3,= 9-&3= &= (&75*39*7= (4:1)= 2&0*= .3= &= <**0_=3=+30*`=&=':.1).3,=<470*78=<&,*=&;*7&,*)=9-*=*6:.;&1*39=4+=N-/_1*=5*7=<**0`= &3)=&=14&+=4+='7*&)=(489=+/=(*398=C&251*<`=+321_=4<*;*7`=):7.3,=9-*=+30*8=97&)*= <&,*8=<*7*=7*1&9.;*1>=14<`=&3)=.9=2&>='*=247*=;&1.)= 94= (425&7*= ).++*7*3(*8= .3= 9-*= (438:2*7=57.(*=.3)*=_=-*=+30*=?=<&8=3_,=4+=9-*=,**/=.3)*==:897&1.&3=:7*&:=4+= ,9&9.89.(8`= ,**/_= 3= 94)&>8= 9*728`= &= ).;*7= <4:1)= 3**)= 94= (&9(-= &5574=.2&9*1>= -**= 0.14,7&28=4+=&'&143*=94=2&0*=N+**=3*9=4+=&.7=+7*.,-9=94=5*1'4:73*=':9='*+47*=49-*7= (4898`=47`=.3=49-*7=<47)8`=*6:.;&1*39=94=94)&>8='*&(-=57.(*_= 9:7.3,=9-*=2.)=+30*8`=&=3:2'*7=4+=574(*88478=*_,_=94;*7=.8-*7.*8`=1'*79=-425843`= *33.*=4=&11=89&79*)=':>.3,=&'&143*=.3=4'&79`=+&(.1.9&9.3,=9-*=)*;*1452*39=4+=9-*= +.8-*7>=.3=9-*=84:9-=&3)=84:9-8*&89_=7.(*8=748*=+742=8.==5*3(*=5*7=54:3)=2*&98<*.,-9= 94= ++= (*398= 5*7= 54:3)= 8-*118<*.,-9='>= +303_= D7**31.5= &'&143*= &997&(9*)= 57.(*8= :5= 94= /*=,7*&9*7_=

Abalone beach prices

100.00

10.00

1.00

0.10 $AUS (logarithmicscale) 0.01

1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 2010 = *.,:7*=0= ,*&(-=57.(*=7*(*.;*)=+47='1&(01.5=&'&143*=.3=&82&3.&='*9<**3=+30*=&3)=*59*2'*7= ,**1_= 7.47= 94= +300`= &'&143*= <*7*= 841)= '>= 2*&9= <*.,-9`= &3)= 57.(*8= -&;*= '**3= (43;*79*)=94=1.;*=<*.,-9=:8.3,=&=(43;*78.43=+&(947=4+=*_._=&71>='*&(-=57.(*8=&7*=3*9=4+= +7*.,-9`=':9=349=4+=49-*7=574(*88.3,=(4898_=7.(*=)&9&=<*7*=4'9&.3*)=+742=*&71>=).;*78`= 1&77.843= +32-`= -*5&792*39= 4+= 7.2&7>= 73):897.*8= &3)= E&9*7`= &3)= 9-*= &82&3.&3= %'&143*=+4:3(.1_=

-, = 74/*(9=34_=,**.2*+- = =

*&(-= 57.(*8= <*7*= 247*= :389&'1*= 9-&3= 9-*>= (:77*391>= &7*_= >((&8.43&11>= 9-*= 2&70*9= 89455*)=':>.3,=&3)=43=&=3:2'*7=4+=4((&8.438=*_,_=+301`=+31,`=+311:12`=+32,`=57.(*8= 51:22*9*)_=12489=&11=8&1*8=4+=574(*88*)=&'&143*=<*7*=94=B&5&3_=-*=57.(*=.389&'.1.9>= <&8=4+9*3=):*=94=2&70*9=2&3.5:1&9.43='>=4;*78*&8=':>*78=7*8:19.3,=.3=4;*78:551>=4+= 574):(9`= <-.(-= +47(*)= 57.(*= (411&58*8_= 3= +311`= 8:'89.9:9.43= 4+= ?-.1*&3= 14(4= 43(-41*5&8=(43(-41*5&8 =+47=:897&1.&3=&'&143*=43=9-*=B&5&3*8*=2&70*9=(&:8*=&=57.(*= (411&58*=.3=9-*=:897&1.&3=&'&143*=+.8-*7.*8_=D*3*7&11>`=-4<*;*7`=9-*7*=<&8=&=7&5.)=&3)= 8:89&.3*)= .3(7*&8*= .3= '*&(-= 57.(*= '*9<**3= +31*= &3)= +32+`= 7.8.3,= +742= ,2= (*398= 5*7= 0.14,7&2= 5&7(-= +31*`= 5&.)= '>= 9<>*78= &9= ,9= *1*38= 94= 4;*7= N._**= 5*7= 0.14,7&2= &77.843`=+32-`=&3)=2&3>=&243,=9-*=*&71>=,74:5=(438.)*7*)=9-&9=.9=<&8=):7.3,=9-.8= 5*7.4)=9-&9=9-*=+.8-*7>='*(&2*=57485*74:8=.,:7*=0_= :*89.43=++a=#-*7*=).)=>4:=89&79=+.8-.3,
= &_ ;-&9=7*,.43
= '_ ;-&9=94<3
= (_ ;-&9='&>8
= )_ ;-&9=)*59-8
= *_ ;*7*=49-*7=).;*78=<470.3,=3*&7'>
= +_ 3=-.3)8.,-9`=<&8=.9=&=,44)=51&(*=94=).;*=+47=&'&143*
= :*89.43=+,a=#-*7*=).)=>4:=,*9=,44)=(&9(-*8=<-*3=>4:=+.789=89&79*)
= &_ O.89=51&(*8=<-*7*=>4:=(4:1)=&1<&>8=,*9=,44)=(&9(-*8_= '_ O.89=51&(*8=9-&9=:8*)=94='*=,44)=(422*7(.&11>=;.&'1*=47='*99*7`=':9= 89455*)='*.3,=84_= ._ 9.)=&3>=4+=9-48*=51&(*8=*;*39:&11>=7*(4;*7
= .._ 4<=2&3>=>*&78=94=7*(4;*7>
= -*8*=6:*89.438=<*7*=:8:&11>=&80*)=&3)=&38<*7*)=<.9-=9-*=&.)=4+=2&58`=5&79.(:1&71>= 9-*= +a,/`***= &82&5= 8*7.*8_= = -&'.9&9= 2&58= <*7*= :8*)= .3+7*6:*391>= &3)= 9-*3= 24891>=94=14(&9*=4++8-47*=5&9(-=7**+8_='&143*=+.8-.3,=9440=51&(*=<.9-.3=431>=&=+7&(9.43= 4+= 9-*= 7**+= &7*&= 8-4<3= 43= = -&'.9&9= 2&58`= &3)= 2489= ).;*78= -&)= ).++.(:19>= 7*(43(.1.3,=9-*.7=2*247.*8=4+=7**+8=<.9-=9-*=9454,7&5->=&3)=7**+='4:3)&7.*8=8-4<3= 43=9-*=2&58_== 5489=).;*78=<*7*=7*1:(9&39=94=<7.9*84++=&=5.*(*=4+=(4&89=&8= +&.1*)=47= 34=,44)`='*(&:8*= &'&143*=&':3)&3(*=.8=;&7.&'1*`=&3)=*;*3=7*1.&'1*=7**+8=(4:1)=+.8-=54471>=&9=9.2*8_=>3*= ).;*7=574):(*)=&=14,='440=<.9-=*397.*8=8-4<.3,=&=3:2'*7=4+=(&9(-*8=9-&9=<*7*=9<.(*= 9-*= )&.1>= &;*7&,*= 4+= 9-*= 9.2*`= +742= &= 7**+= .3= 14(0= -*= 9-&9= <&8= 49-*7<.8*= 54471>= 7*,&7)*)=&3)=8*1)42=+.8-*)_=3=-.8=45.3.43`=9-*=7**+=574;.)*)=*=(*11*39=(&9(-*8`=':9= 9440=&=143,=9.2*=94=7*(4;*7='*9<**3=+.8-.3,=*;*398_=4=+:79-*7=.11:897&9*=9-*=).1*22&`= 14(0=-*=-&8=574):(*)=431>=&=82&11=+7&(9.43=0+*=4+=.98=+472*7=&33:&1=(&9(-=):7.3,= *&(-= 4+= 9-*= 5&89= +/= >*&78`= >*9= 842*= (:77*39= ).;*78= '*1.*;*= 9-&9= 9-*= '14(0= 8:554798=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = -- = =

&)*6:&9*=894(0=1*;*18_=-.8=.8='*(&:8*=:3)*7=9-*=7.,-9=(43).9.438=9-*>=(&3=1&3)=(&9(-*8= *6:&1=.3=8.?*=94=9-48*=+742='14(08=9-&9=&7*=247*=<.)*1>=7*(4,3.8*)=&8=574):(9.;*_=+;*3= 9-*=2489=)*51*9*)=7**+8=(&77>=.841&9*)=545:1&9.438=<-.(-=(&3=4((&8.43&11>='*=+.8-*)=&9= -.,-=(&9(-=7&9*8_=-*=(43;*78*=&184=&551.*8=._*_=:3)*7=842*=(.7(:289&3(*8=).;*78=(&3= -&;*= ).++.(:19>= 9&0.3,= ,44)= (&9(-*8= +742= 7**+8= 9-&9= &7*= 7*(4,3.8*)= &8= -41).3,= &':3)&39=&'&143*=894(08_= =8*(43)=).++.(:19>=&748*='*(&:8*=):7.3,=9-*=.39*7;*3.3,=>*&78=8.3(*=9-*>=-&)=89455*)= ).;.3,`=842*=*&71>=).;*78=-&)=1489=9-*=034<1*),*=4+=85&9.&1=)*9&.1=7*6:.7*)=94=)*8(7.'*= 9-*=51&(*8=<-*7*=9-*>=:8*)=94=+.8-_=9=<&8=47.,.3&11>=.39*3)*)=94=9&0*=).;*78='&(0=94=9-*= 51&(*8=<-*7*=9-*>=:8*)=94=+.8-=':9=9-.8=<&8=+4:3)=94='*=349=5&79.(:1&71>=-*15+:1=:=9-*>= 7*2&.3*)=(43+:8*)=&3)=).847.*39&9*)_== =9-.7)=).++.(:19>=89*22*)=+742=9-*=:8*=4+=9-*=9*72= (422*7(.&1=;.&'.1.9>_=9=<-&9= 54.39=)4*8=&=7**+=8945=574):(.3,=(422*7(.&11>=;.&'1*=(&9(-*8`=5&79.(:1&71>=.+=9-*=7*9:73= 94=9-*=).;*7=.3(7*&8*8=&8='*&(-=57.(*8=.3(7*&8*
=47=*=&251*`=.3=+30.`=9-*=9.7*(947=4+= .8-*7.*8`=7_=_=,(499`=<749*=94=&=57485*(9.;*=+.8-=':>*7=&);.8.3,=-.2=9-&9=9-*=&'&143*8 '*&7.3,=7**+8=&74:3)=.(-*34=-&)='**3=+.8-*)=4:9`=&3)=9-&9=9-*=':>*7=<4:1)=-&;*=94= <&.9=:39.1=247*=7**+8=(4:1)='*=+4:3)='*+47*=-*=(4:1)='*=8:551.*)=<.9-=&3>=574):(9= +742= &82&3.&_= >3*= 4+= 9-*= ).;*78= <-4= <470*)= &9= .(-*34= &9= 9-*= 9.2*= <&8= .39*7;.*<*)_= *= 8&.)= 9-&9= 9-*>= <*7*= '*.3,= 5&.)= 8.== 5*3(*= 5*7= 54:3)= +47= 2*&98_= 7*.,-9.3,=9-*=2*&98=94=5*1'4:73*=(489=9-7**=5*3(*=5*7=54:3)`=&3)=9-*>=9-4:,-9=9-&9= 9-*=3*9=7*9:73=<&8=.38:++.(.*39=94=<&77&39=+:79-*7=+.8-.3,`=5&79.(:1&71>=8.3(*=9-*>=-&)= 9&0*3=9-*=*&8.1>=&((*88.'1*=+.8-=<.9-.3=9-*=5479_== 3= (4397&89`= (:77*39= ).;*78= 7*(*.;*= &5574=.2&9*1>= N0_**= 5*7= 0.14,7&2= +47= (&9(-.3,= +&89*73= I43*= &'&143*_= -*= .3):897>= .8= -*&;.1>= (&5.9&1.8*)`= <.9-= -.,-= 43,4.3,= (4898_= >:9= 4+= 9-*= N0_**= 5*7= 0.14,7&2= +**`= 9-*= ).;*78= -&;*= 8&.)= 9-&9= 9-*>= 2:89= 7:3= &3)= 2&.39&.3='4&98=&3)=&=94<=;*-.(1*=<.9-=&884(.&9*)=(4898=+47=+:*1`=7*5&.78`=)*57*(.&9.43= 4+=;*88*18`=;*-.(1*8=&3)=2&(-.3*7>`=&3)=.38:7&3(*`=5&>=&=<&,*=94=9-*28*1;*8=&3)=&= )*(0-&3)`=5&>=.3):897>=1*;**8=&3)=1.(*38*=+**8`=&3)=&((4:39=+47='&30=.39*7*89=47=1488= 4+=455479:3.9>=43=9-*=8*;*7&1=-:3)7*)=9-4:8&3)=)411&7=(&5.9&1=;&1:*=4+=9-*.7=).;.3,= *39.91*2*39=&3)=*6:.52*39_=+=5*7.*3(*)=).;*78=-&;*=1*&739=9-&9=9-*>=(&3=431>=89&>=.3= ':8.3*88=.+=9-*.7=(&9(-*8=&7*=&'4;*=&=9-7*8-41)=1*;*1b=7**+8=9-&9=<*7*=574):(9.;*=&9=14<= (&9(-=7&9*8=<-*3=1*;*18=4+= .3):897>=(&5.9&1.8&9.43=<*7*=14<*7=&7*= 34<=*++*(9.;*1>=34= 143,*7=5&79=4+=9-*=+.8-*7>_== 3= &)).9.43`= '*(&:8*= 4+= 9-*= 7*1&9.;*1>= 82&11= 2&7,.38`= .9= <&8= *(4342.(&11>= ).8&);&39&,*4:8=+47=(:77*39=).;*78=94=74&2=9-*=(4&89=1440.3,=+47=&'&143*_=-*>=<*7*= &<&7*= 9-&9= <-*3= 9-*>= ;.8.9*)= :3+&2.1.&7= (4&89`= 9-*>= 2.,-9= +&.1= 94= (&9(-= 8:++.(.*39= &'&143*= 94= *38:7*= &= 574+.9_= -.8= <&8= &= ).8.3(*39.;*= 94= 85*3).3,= 9-*= 3*(*88&7>= 9.2*= 8*&7(-.3,= +47= +7*8-= 7**+= &3)= :3*=514.9*)= 894(08_= -*.7= '*89= ':8.3*88= 51&3= <&8= 94= -&'.9:&11>= +.8-= &7*&8= <-*7*= 9-*>= 03*<= 9-*>= <4:1)= (&9(-= +.8-_= -.8= -&8= 1.2.9*)= 9-*= 034<1*),*=4+=9-*=).897.':9.43=4+=574):(9.;*=7**+8`=&3)=.9=<&8=:3:8:&1=94=+.3)=&=(:77*39= ).;*7=<.9-=9-*=8&2*=1*;*1=4+=034<1*),*=4+=9-*=+.8-.3,=7**+8=.3=&=7*,.43`=(425&7*)=<.9-= 9-&9=4+=9-*=*&71.*7=).;*78_==

-. = 74/*(9=34_=,**.2*+- = =

3=(4397&89`=9-*=9<4=*&71.*7=,74:58=4+=).;*78=<*7*=247*=&(9.;*=*=5147*78_=49-=,74:58= 45*7&9*)=<-*3=1*;*18=4+=(&5.9&1.8&9.43=<*7*=7*1&9.;*1>=14<=&3)=9-*=).;.3,=*39.91*2*39= &3)= 6:49&= <*7*= (42'.3*)_= -*= *&71>= ,74:5= -&)= 9-*= &))*)= &);&39&,*= 4+= 9-*= 89743,= 1.0*1.-44)=4+=-.,-=(&9(-=7&9*8=<-*3=9-*>=*3(4:39*7*)=+7*8-=7**+`=&3)=9-*=2.))1*=,74:5= 7*(*.;*)=7*1&9.;*1>=1&7,*7=7*9:738=9-&3=(:77*39=).;*78_=9:7.3,=.39*7;.*<8`=).;*78=+742= '49-= ,74:58= 8&.)= 9-&9= 9-*>= 03*<= 4+= 7**+8= 9-&9= -&)= 349= '**3= +.8-*)= +47= 2&3>= >*&78= '*(&:8*=9-*>=-&)='**3=+47,499*3=47=<*7*=:3034<3=94=(:77*39=).;*78_=9*85.9*=9-*=9.2*= .39*7;&1=&3)=+7&,2*39*)=034<1*),*`=842*=*&71>=).;*78`=5&79.(:1&71>=9-48*=<-4=<*7*= 89.11=&(9.;*1>=+.8-.3,=2&3>=89.11=<470*)=.3=9-*=+.8-.3,=.3):897>=-&)=&((:7&9*=7*(&11=4+= 574):(9.;*=(4&89=&3)=7**+8`=&3)=<*7*=&'1*=94=574;.)*=)*9&.1*)=85&9.&1=.3+472&9.43_= 3= 14(0= +-= ,4:9-5479= O&,443= *&(-= 94= ;-&1*= *&)`= 7*8543)*398= +742= &11= 9-7**= ,74:58= <-4= -&)= +.8-*)= 9-*7*= (438.)*7*)= 9-&9= 9-*= &7*&= -&)= :8:&11>= 574;.)*)= ,44)= (&9(-*8_= -*>= 8&.)= 9-&9= 9-*7*= <*7*= 431>= .841&9*)= &3)= .3(438*6:*39.&1= 51&(*8= <-.(-= (4:1)='*=(438.)*7*)=&8=+472*71>=574):(9.;*=':9=34<=3438574):(9.;*=*_,_=82&11=5&9(-= 7**+=3*&7=D*47,*==74(0_=4<*;*7`=&=2&5=4+=7*(-*7(-*=&>=&3)= .98=*&71>=&'&143*= +.8-.3,= ,74:3)8= )*;*145*)= +742= 9&108= <.9-= *&71>= ).;*78= &3)= 9-*3= 8-4<3= 94= (:77*39= ).;*78=*;40*)=8:757.8*=&3)=)4:'9=:=+.7891>=8:757.8*=9-&9=9-*7*=<*7*=84=2&3>=7**+8=.3= 7*(-*7(-*`=&3)=8*(43)1>=)4:'9=9-&9=9-*>=<*7*=*;*7=<479-=+.8-.3,_= 184=.3=14(0=+-`=9-*=84:9-*73=*3)=4+=9-*=.,=(9&*43=.,-9=<&8=)*8(7.'*)='>=9-*=*&71>= ).;*78= &8= -&;.3,= )*38*= &'&143*= 545:1&9.438_= ?:77*391>`= &+9*7= -*&;>= +.8-.3,`= 545:1&9.438= '*(42*= ,7*&91>= )*51*9*)`= ':9= 2489= (:77*39= ).;*78= <-4= +.8-*)= &9= 9-*= (9&*438=<*7*=7*1:(9&39=94=).82.88=.9=&8=:3574):(9.;*_= 14(0= +.= <&8= &= 0*>= 5&79= 4+= 9-*= &'&143*= +.8-*7>= +742= .98= *&71.*89= 9.2*8`= 574):(.3,= '*9<**3=,**=9433*8=&3)=-**=9433*8=):7.3,=9-*=+31*8=&3)=+32*8_=14(0=+.=(438.898=4+= 9-*= 14<*7= 9+397*(&89*&:== ?-&33*1= .3(1:).3,= 479= +85*7&3(*`= ,4:9-5479= &3)= D7*&9= &>1478= &>`= 9-*= 84:9-*73= 8-47*8= 4+= 7:3>= 81&3)= *&89= 94= 47**1= *&)= .3(1:).3,= ?14:)>=&>`=9-*=7.&78=&3)=9-*=84:9-*73=8-47*=4+=9-*=O&'.11&7).*7*=*3.38:1&=&3)=9-*= 3479-*73=5&798=4+=9-*=(9&*438=7**+=8>89*28=.3(1:).3,=,4:9-5479=81&3)`=1&3(-*=&3)= D*47,*= = 74(08_= 9:7.3,= 9-*= *&71.*89= >*&78`= 2:(-= 4+= 9-*= (&9(-= <&8= (&:,-9= .3= 9-*= ?-&33*1`= 5&79.(:1&71>= 479= +85*7&3(*= 94;*7= 47= 3*&7'>_= 1&3.3,= -:118= <*7*= :3(42243=&3)=).;*78=<-4=)&>8+.8-*)=:8.3,=82&11=9.2'*7=).3,-.*8=<*7*=*++*(9.;*1>= 7*897.(9*)= 94= &= 7&3,*= 1*88= 9-&3= +*=3&:9.(&1= 2.1*8_= 9= <&8= 7*5479*)= 9-&9= .3= +30.`= )&.1>= (&9(-*8=4+=:5=94=0**=0.14,7&28=<*7*=9&0*3=+742=479=+85*7&3(*=45*=81&3)`=84:9-*73= 8-47*='*9<**3=&<0*78=&3)=O42&8=4.398`=1:''*7=*&)=3479-=94=74&7.3,=*&(-`=9-*= (4&89= 84:9-= 4+= 94;*7`= .3(1:).3,= ,(4998= 4.39`= 4<*7= &>`= O&)>= &>= &3)= ,.89*78= &>`= &3)=&797.),*=81&3)=&3)=9-*=.3*&551*8_=*3=>*&78=1&9*7`=&'&143*=545:1&9.438=.3=9-*= &7*&=-&)='*(42*=)*51*9*)=;.9-*785443`=+31/`=':9=<*7*=89.11=-*&;.1>=+.8-*)_=3=+31/`=&= 7*8.)*39= ).;*7= 8&.)= 9-&9= .9= <&8= (42243= 94= 8**= -&1+= &= )4?*3= ).;*78= +.8-.3,= 9-*= 479= +85*7&3(*= 84:9-*73= 8-47*= .3= 84:9-8<*89*71>= <*&9-*7`= <.9-= (&9(-*8= 9>5.(&11>= +**= 0.14,7&28= 5*7= )&>_= = +.8-= +&72= <&8= *89&'1.8-*)= .3= 479= +85*7&3(*= ):7.3,= 9-*= 1&9*= +32*8`=&+9*7=<-.(-=).;*78=8&.)=9-&9=9-*=0*15=&143,= 9-*= ,97.3,*78= ?7**0= 8-47*='*(&2*= (4;*7*)= .3= 8*).2*39`= 9-*= (1&7.9>= 4+= 9-*= <&9*7= )*(7*&8*)`= &3)= &'&143*= '*(&2*= ;*7>=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = -/ = =

)*51*9*)_=3=,**.`=842*=7*(4;*7>=4+=545:1&9.438=-&)=4((:77*)`=&3)=.841&9*)=(&9(-*8=4+= :5=94=,**=0.14,7&28=5*7=)&>=<*7*=1&3)*)=+742=9-*=84:9-*73=8-47*=&3)=45*=81&3)_= -*=84:9-*73=8-47*8=4+=7:3>=81&3)=&3)=9-*=3479-*73=5&798=4+=9-*=(9&*438=(439.3:*= 94=574;.)*=-.,-=1*;*18=4+=(&9(-=&3)=<*7*=349=(438.)*7*)=94=-&;*='**3=)*51*9*)='>=&3>= 4+= 9-*= ).;*78_= 3= (4397&89`= 2:(-= 4+= 9-*= 9+397*(&89*&:== ?-&33*1= <-.(-= <&8= 8&.)= 94= -&;*=(4397.':9*)=&5574=.2&9*1>=-&1+=9-*=14(0=+.=&33:&1=(&9(-=):7.3,=9-*=+31*8=&3)= +32*8= '*(&2*= 944= )*51*9*)= 94= <&77&39= +.8-.3,_= -*= &;*7&,*= &33:&1= (&9(-= '*9<**3= ,***=&3)=,**0=+47=9-*=<*89*73=8-47*='*9<**3=479=+85*7&3(*= &3)= ,4:9-5479= <&8= +/= 9433*8`= <-.1*= 43= 9-*= 7:3>= 81&3)= 8-47*= 9-*= (&9(-= -&)= )*(1.3*)= 94= 8*;*3= 9433*8= +47= 9-&9= 5*7.4)_= -*= 7:3>= 81&3)= 8-47*= .8= 34<= 8&.)= 94= '*= 24891>= )*51*9*)`= &19-4:,-= ).;*78=4((&8.43&11>=9&0*=,44)=(&9(-*8=+742=9-*=A:&77.*8_= >3=9-*=*&89=(4&89`=.3=14(0=,-`=9-*=+.789=7**+8=94='*=+.8-*)=<*7*=.3=O.991*=?-.3&2&38=&>`= 9-*=7**+=.22*).&9*1>=4:98.)*=9-*=<&774<8=&3)=&143,=9-*=84:9-*73=8-47*=4+=5&7.43=&>= 5&89=9-*=24:9-=4+=9-*=<&774<8_=-*8*=<*7*=+.8-*)='>=+7**=).;*78=.3=+30*`=43*=4+=<-42= *89.2&9*)= 9-&9= -:3)7*)8= 4+= 9433*8= 4+= &'&143*= <*7*= 9&0*3_= 4)&>`= 9-*= &7*&= 89.11= 8:554798= 1.2.9*)= (&9(-*8`= ':9= .8= *=9*38.;*1>= )*51*9*)`= 2&7,.3&11>= 574):(9.;*= &3)= .8= +.8-*)=431>=<-*3=).;*78=3**)=94=8:551>=&'&143*=&3)=9-*=<*&9-*7=.8=944='&)=94=<470= *18*<-*7*_= :79-*7= *&89= &9= ?&5*= &:1= O&2&343`= 9-*= O43,= 7**+= <&8= +.8-*)= :39.1= 9-*= *&71>= +32*8_= -*= 7**+= *=9*3)8= &5574=.2&9*1>= +_/= 0.142*97*8= 94= 9-*= 3479-8*&89= 4+= 9-*= (&5*`=&9=43*=54.39=7.8.3,=94=&'4:9=+.;*=2*97*8=+742=9-*=8:7+&(*`=&3)=*=9*3).3,=)4<3=94= -*=2*97*8_=?:77*391>=9-*=8-&114<=5&798=4+=9-*=7**+=7*2&.3=)*51*9*)`=<-.1*=9-*=89&9:8=4+= )**5*7=<&9*7=894(08=.8=:3034<3=':9=57*8:2*)=)*51*9*)_=:79-*7=3479-=.3=14(0=,-`=&3= *=9*38.;*=&7*&=4+=7**+=034<3=&8=+&,1*=7**+=<&8=.39*38.;*1>=+.8-*)='*9<**3=+30/=&3)= 9-*= *&71>= 1*8`=':9= -&8=&55&7*391>= 349= 574):(*)= (422*7(.&1= (&9(-*8= 4+= &'&143*= 8.3(*= 9-*3_= 3=14(0=,2`=9-*=*&71>=).;.3,=+30-=<&8=)43*=.3=9-*=.22*).&9*=;.(.3.9>=4+=9-*=D:1(-=&9= .(-*34`= &3)= *=9*3)*)= 84:9-= 94= 7.(*= *''1*= '*&(-= &3)= 3479-= .394= ;&:'8= &>= ._*_= <.9-.3=9-*=94<3='4:3)&7.*8_=-*=7**+8=.3=9-*8*=&7*&8=<*7*=7*5479*)=)*51*9*)=1&9*7=.3= +30.`=&3)=9-*=9<4=).;*78=<470.3,=9-*7*=1*+9=9-*=&7*&_=3=+30/`=247*=).;*78=&77.;*)=.3= .(-*34`=&3)=9-*>=<470*)=&143,=9-*=(4&89='49-=3479-=&3)=84:9-=4+=9-*=94<3_=-*=&7*&8= 4+= 7**+= (148*7= 94= .(-*34= '*(&2*= )*51*9*)`= +47(.3,= 9-*= ).;*78= +:79-*7= &+.*1)`= :39.1= *;*39:&11>= 9-48*= 7**+8= .3= 9:73= '*(&2*= )*51*9*)_= ,42*= 4+= 9-*= 7**+8= &9= .(-*34= -&;*= 7*(4;*7*)= &3)= 8:55479*)= 1.2.9*)= +.8-.3,= '*+47*= )*(1.3.3,= &,&.3_= 47= *=&251*`= 9-*7*= -&8= '**3= 1.2.9*)= 7*(4;*7>= &9= 9-*= 84:9-*73= *3)= 4+= 9-*= D:1(-`= &74:3)= 9-*= 14<-41*= 8-47*= &3)= 9-*= <*89*73= 8-47*= &9= 7.(*= *''1*= *&(-_= <43*= 4+= 9-*= .39*7;.*<*)= ).;*78= 7*2*2'*7*)= (&9(-.3,= &'&143*= +742= 9-*= &7*&= &74:3)= D4;*7347= 81&3)= 34<= .3(47547&9*)=.394=&=7*8*7;*`=84=.9=.8=1.0*1>=9-&9=9-.8= (4&89=<&8=&1<&>8=&=5447=&'&143*= -&'.9&9_=:91*78=4.39=94=9-*=84:9-=4+=.(-*34=<&8=2*39.43*)='>=9<4=).;*78=<-4=8&.)= 9-&9=9-*=&'&143*=9-*7*=<*7*=(438.89*391>=1&7,*7=9-&3=&3><-*7*=*18*=3*&7=.(-*34`=&3)= 9-&9=9-*>=<*7*=247*=51*39.+:1_=19-4:,-=,7&3.9*=.8=9-*=57*;&.1.3,=74(0=9>5*=43=2489=4+= 9-.8= (4&89`= &9= :91*78= 4.39= 9-*= 74(08= &7*= 8*).2*39&7>`= <.9-= +41)*)= '*)8= 4+= 6:&79?= <&(0*= 9.19*)= &12489= ;*79.(&11>_= -*= '740*3= '*)8= +472*)= 2&3>= 247*= 45*3= (7*;.(*8=

-0 = 74/*(9=34_=,**.2*+- = =

<-.(-= *=548*)= 9-*= &'&143*= 94= 9-*= ).;*7= &3)= 2&)*= 9-*2= *&8.*7= 94= +.3)= 9-&3= 43= 9-*= &)/&(*39=,7&3.9*=(4&89_= 3='14(08=,1`=,2`=&3)=,3=9-*7*=&7*=*=9*38.;*=5&9(-*8=4+=7**+=1>.3,=4++=143,='*&(-*8=*_,_= 7.*3)1>`=9*33.843`=94:,1&8`=&3)=*251*894<*='*&(-*8_=O&7,*=6:&39.9.*8=4+=&'&143*= <*7*= 9&0*3= +742= 9-*8*= '*&(-*8= '*9<**3= +301= &3)= 9-*= 2.)= +31*8_= 3= 9-*= +30*8`= 9-*>= <*7*=574):(9.;*=&9=)*59-8=)4<3=94=,*=2*97*8`=':9=.3=1&9*7=>*&78=<*7*=247*=574):(9.;*= &9= 8-&114<*7= )*59-8_= >= 9-*= 1&9*= +32*8`= 9-*= 7**+8= <*7*= 34= 143,*7= +.8-*)_= -*= 7**+8= &'&143*=545:1&9.438=89.11=4((&8.43&11>=2&0*=1.2.9*)=7*(4;*7.*8=<-.(-=8:55479=+.8-.3,= &9=-.,-=(&9(-=7&9*8=+47=&=8-479=5*7.4)`=':9=9-*>=&7*=7*5479*)=94=6:.(01>=)*(1.3*_= 3=9-*=3479-*73=5&79=4+=14(0=-*`=9-7**=&7*&8=4+=7**+=<*7*=.)*39.+.*)='>=9<4=).;*78=&8= '*.3,= 574):(9.;*= <-*3= 9-*>= +.789= 89&79*)`= ':9= )*(1.3*)= 842*= >*&78= 1&9*7= &3)= -&;*= 3*;*7=7*(4;*7*)_=-*8*=7**+8=<*7*=&9=*''1>=.,-9`=38438=&>=&3)=&9=9-*=7.3,=4+=E*15= &184=034<3=&8=7*)=74(08_=39*7*89.3,1>`=9-*=*&71>=,74:5=).;*78= <*7*=).82.88.;*=4+= 9-*8*= 7**+8`= &3)= 8&.)= 9-&9= 9-*>= -&)= 3*;*7= -*1)= <479-<-.1*= 6:&39.9.*8= 4+= &'&143*_= 4<*;*7`= '*9<**3= +32*= &3)= +320`= 9-*= 7**+8= 574):(*)= &'&143*= &9= 7&9*8= :5= 94= -**= 0.14,7&28=5*7=).;*7=)&>`=&3)=.9=<&8=74:,-1>=*89.2&9*)=9-&9='*9<**3=+*=9433*8=&3)=,*= 9433*8= 5*7= &33:2= <*7*= 9&0*3= +742= *&(-= 7**+= ):7.3,= 9-.8= 5*7.4)_= -*7*= &7*= '74&)= 8.2.1&7.9.*8='*9<**3=9-*=7**+=&9=:91*78=4.39=.3=14(0=,2=&3)=9-*=7**+='*9<**3=*''1>= .,-9=&3)=38438=&>a=9-*>=8-&7*=9-*=8&2*=(-&7&(9*7.89.(= 4+= :3):1&9.3,= 7.),*8= &3)= (-&33*18`=9-*>=&7*=8-&114<=-:3)7*)8=4+=2*97*8=4++8-47*=&3)=9-*>=-&;*=8.2.1&7='740*3= 6:&79?=<&(0*=897&9&_= :*89.43= +-a= .)= >4:= 349.(*= 9-&9= +.8-.3,= .2574;*)= &3>= &7*&8= ._*_= 89&79*)= '&)`= ':9= 9-*3= 574):(*)=+.8-
= ,*;*7&1=*&71>=,74:5=).;*78=8&.)=9-&9=5&798=4+=5&7.&=81&3)=&3)=9-*=&82&3=*3.38:1&= <*7*= .3.9.&11>= 349= ,44)= &'&143*= +.8-.3,= &7*&8_= -*>= ).;*)= &74:3)= 9-*= .81&3)= .3= 9-*= *&71>=+30*8=':9=&'&3)43*)=.9=+47=9-*=574;*3=+.8-.3,=455479:3.9.*8=&9=,9=*1*38_=5&7.&= 81&3)=<&8=2&)*=&=7*8*7;*`=&3)=(148*)=94=+.8-.3,=+742=+300=:39.1=+32*_=,.3(*=45*3.3,`= .9=-&8='**3=,*3*7&11>=574):(9.;*`=&3)=43*=4+=9-*=*&71>=).;*78=<-4=-&)=(439&(9=<.9-= 9-*= +.8-*7>= +47= 2&3>= >*&78= <&8= 8:757.8*)= 94= -*&7= 9-&9= 5&7.&= 81&3)= <&8= 574):(.3,= 6:&39.9.*8=4+=&'&143*_= <4=4+=9-*=*&71>=,74:5=).;*78=8&.)=9-&9=9-*=&82&3=*3.38:1&='*9<**3=&82&3=81&3)= &3)=+&,1*-&<0=<*(0=3*;*7=574):(*)=<479-<-.1*=(&9(-*8=):7.3,=9-*=+30*8_=>3*`=<-4= <&8=43*=4+=9-*=+.789=94=+.8-=9-*=&7*&`=8&.)=9-&9=-*=-&)=8>89*2&9.(&11>=<470*)=+742=43*= *3)=4+=9-.8=(4&89=94=9-*=49-*7=+47=14<=7*9:738`=&3)= *;*39:&11>= 1*+9= ).8&554.39*)_= *= 7*9:73*)=842*=>*&78=1&9*7=&+9*7=49-*78=-&)=+.8-*)=9-*7*=8:((*88+:11>=&3)=+4:3)=2:(-= -.,-*7=894(0=1*;*18_= -*8*=7*85438*8=.251>=*.9-*7=9-&9=9-*7*=<*7*=+1:(9:&9.3,=1*;*18=4+=&':3)&3(*=):*=94= 3&9:7&1=(&:8*8`=47=9-&9=9-*=).;*78=).)=349=8**=9-*=&'&143*_=4<*;*7`='49-=*=51&3&9.438= &7*=349=5&79.(:1&71>=51&:8.'1*`=&3)=7&.8*=247*=:3&38<*7&'1*=6:*89.438a=<->=<4:1)= ;.7,.3= &'&143*= 894(08= '*= 944= 14<= 94= <&77&39= +.8-.3,`= &3)= <->= <4:1)= *=5*7.*3(*)= ).;*78=2.88=9-*=&'&143*
=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = -1 = =

-*= 3479-*73= 7**+8= .3= 14(0= -*= *''1>`= 38438= &3)= 7.3,= 4+= E*15= &11= &55&7*391>= .2574;*)=+742=:3574):(9.;*=94=574):(9.;*_=-.8=4'8*7;&9.43=<&8=349='&8*)=:543=9-*= 7*85438*=4+=&=8.3,1*=).;*7`=':9=*89&'1.8-*)=&+9*7=9&10.3,=94=8*;*7&1=).;*78_== :*89.43=+.a=.)=+.8-.3,=2&0*=842*=&7*&8=<478*=.22*).&9*1>=:=>4:=+.8-*)=.9=43(*=&3)=.9=<&8= 3*;*7=&3>=,44)=&+9*7
= ,*;*7&1=).;*78=8&.)=9-&9=&'&143*=545:1&9.438=43=82&11=.841&9*)=5&9(-=&3)=+7.3,*=7**+8= :8:&11>= ).)= 349= 7*(4;*7= &+9*7= '*.3,= -*&;.1>= +.8-*)_= +=&251*8= ,.;*3= .3(1:)*)= 9*33.88 (4:79= 8.?*)= 5&9(-= 7**+8= .3= 14(0= -*`= 82&11= +7.3,*= 7**+8= .3= '14(08= ,-= &3)= ,.= &9= 9-*= 3479-*73=*3)=4+=9-*='*&(-=&9=5&7.43=&>=&3)=+7.3,*=7**+8=.3=,4:9-=?&5*=&>=8:(-=&8= O.43=74(0=14(0=+-_=-*>='*1.*;*)=9-&9=+.8-.3,=&9=9-*=+,1822=8.?*=1.2.9=-&)=1*+9=34= ;.&'1*= 85&<3.3,= 894(0`= &3)= 9-&9= 545:1&9.438= 43= 9-*= 7**+8= (411&58*)_= -.8= <&8= (43+.72*)= '>= 7*8*&7(-= 545:1&9.43= 8&251.3,= .3= *&89*73= &3)= 84:9-8*&89*73= &82&3.&= <-.(-=8-4<*)=9-&9=9-*=+,1=22=&3)=+-,=22=8.?*81.2.98=<*7*=.3&)*6:&9*=.3=9*728=4+= 2&3&,*2*39=51&3=,:.)*1.3*8=9-&9=8**0=94= &114<=&'&143*=94=,74<=94=&=8.?*=<-*7*=9-*>= -&;*= -&)= 9<4= '7**).3,= 8*&8438= 9-74:,-= 9-*= :8*= 4+= &557457.&9*= 8.?*= 1.2.98= 343>24:8`=+333_=9=<&8=&55&7*39=9-&9=-*&;.1>=+.8-*)=545:1&9.438=<*7*=.3(7*&8.3,1>= &9=7.80=<-*3=+.8-*)=&9=8.?*8=82&11*7=9-&3=+-2=22=&7'&9- =*9=&1 _`=,**+_= :*89.43=+/a=.)=>4:=349.(*=9-&9=9-*=&7*&=4+= 8(:3,>='49942=.3(7*&8*)
== -.8=6:*89.43=<&8=&184=7*5-7&8*)=&8= <*7*=9-*7*=-&'.9&9=(-&3,*8= 43=9-*=7**+8=<-*7*= >4:= (&:,-9= &'&143*
= &3)= &+9*7= 842*= ).8(:88.43`= 1*)=94=&= +:79-*7=6:*89.43= ).)=>4:= 349.(*8=-&'.9&9=(-&3,*8=9-&9=2.,-9='*=&884(.&9*)=<.9-=(-&3,*8=.3=&'&143*=&':3)&3(*
= -*=9*72= 8(:3,>='49942=<&8=*=51&.3*)=94=).;*78`=':9=2489=03*<=<-&9=<&8=2*&39= .22*).&9*1>= := 9-*>= &184= :8*)= 9-.8= 9*72`= '74<3= 74(0= 47= 8.2.1&7= 9*728_= 9= 7*+*78= 94= '*39-48=9-&9=.8=349=7*(4,3.8*)=&8=8:55479.3,=&'&143*=545:1&9.438_= ,(:3,>='49942=.8= &3=&118*3(425&88.3,=9*72=9-&9=.3(1:)*8=&=;&7.*9>=4+=*3(7:89.3,=7**+=(4;*7.3,8=8:(-=&8= 8543,*8= &3)= &8(.).&38`= &8= <*11= &8= 8*).2*39= 8&3)`= 8.19`= &3)= &1,&*= ,7**3`= 7*)= &3)= '74<3_= 11= ).;*78= <*7*= &<&7*= 4+= &3= &884(.&9.43= '*9<**3= (7:8948*= (477&11.3*= &1,&*= ??= (4;*7*)= 74(0=  5.30= 74(0= 47= 5:751*= 74(0= &3)= &'&143*`= &3)= 9-&9= 9-*7*= <&8= &= 2:(-= ,7*&9*7=1.0*1.-44)=4+=(&9(-.3,=&'&143*=43=??8(4;*7*)=74(0=9-&3=43=74(0=(4;*7*)='>= 49-*7=+4728_=,42*=).;*78=&184=*=51&.3*)=9-&9=*;*3=9-4:,-=7**+=2.,-9='*=*=9*38.;*1>= (4;*7*)=.3=??`=9-*7*=<&8=34=,:&7&39**=9-&9=.9=<&8=574):(9.;*=&'&143*=-&'.9&9_=>3*= ).;*7=,&;*=&3=*=&251*a=9-*=(4&89='*9<**3=>7+47)=&3)=,<&38*&=14(0=,/=-&8=&1<&>8= -&)= &3)= 89.11= -&8= *=9*38.;*= ??= (4;*7&,*= ':9= .98= &'&143*= 545:1&9.438= &55&7*391>= (411&58*)=.3=9-*=1&9*=+32*8=&+9*7=,/=>*&78=4+=.39*38.;*=+.8-.3,_=*=).)=349=9-.30=9-&9=9-*= )*51*9.43=4+=&'&143*=545:1&9.438=1*)=94=-&'.9&9=(-&3,*=9-*7*_= <49= &11= ).;*78= 7*5479*)= 8**.3,= -&'.9&9= (-&3,*_= +.,-9**3= ).;*78= 7*5479*)= 8**.3,= (-&3,*8= .3= 9-*= 7**+= -&'.9&9= <-*7*= 9-*>= +.8-*)= +47= &'&143*`= ':9= 2&3>= 6:&1.+.*)= 9-*.7= 7*2&708= '>= 89&9.3,= 9-&9= 9-&9= 9-*8*= (-&3,*8= <*7*= 349= 3*(*88&7.1>= &884(.&9*)= <.9-= &'&143*=+.8-.3,_=,42*=).;*78=8&.)=9-&9=9-*>=349.(*)=&=8*&843&1=(-&3,*=.3=9-*=&24:39=4+= 7**+=(4;*7*)=.3=7*)=&1,&*=&3)=9-*=0*15=(&345>=9-*7*=<&8=247*='*9<**3=2.)8857.3,=

-2 = 74/*(9=34_=,**.2*+- = =

&3)= 2.)8&:9:23`= &3)= .9= ).*)= '&(0= 4;*7= <.39*7_= 5489= 4+= 9-*= ).;*78= <*7*= :397&.3*)= 4'8*7;*78`= &3)=9-*.7= &'.1.9>= 94= )*8(7.'*= (-&3,*8= ;&7.*)= <.)*1>`= 5*7-&58='*(&:8*= .9= .8= 349= &= 80.11= .22*).&9*1>= 7*1*;&39= 94= (&9(-.3,= &'&143*_=,42*=4+=9-*.7=4'8*7;&9.438=&7*= )*9&.1*)='*14=<*7*=34=143,*7=+.8-*)=(4:1)=8:55479= &'&143*=+.8-.3,`=84=).++*7*39=<*7*=9-*>=+742=9-*=7**+8=9-&9=-*=(:77*391>=+.8-*)_=*= 8&.)=9-&9=.3=9-*=8-&114<8=9-*=(&345>=(4;*7=&3)=49-*7=&1,&1=,74<9-=<&8=)*38*7`= 9-&9=)**5*7=7**+=<&8=247*=*3(7:89*)`=5&79.(:1&71>='>=8543,*`=&3)=9-&9=43=2&3>= 14<=1>.3,=7**+8`=+.3*=8&3)=&3)=8.19=-&)=857*&)=&3)=34<=(4;*7*)=7**+=<-*7*=-.8= +&9-*7=:8*)=94=(411*(9=&'&143*_=*='*1.*;*)=9-&9=9-*7*=-&)='**3=&=-&'.9&9=(-&3,*=&9= 9-*=7**+8=<-*7*=-.8=+&9-*7=-&)=+.8-*)`=&3)=-*=9-4:,-9=9-&9=.9=<&8=&=(438*6:*3(*=4+= 9-*=7*24;&1=4+=&'&143*='>=+.8-.3,_= - >3*=*&71>8,74:5=).;*7=9-4:,-9=9-&9=&9=9-*=(9&*438=14(0=+-=:=+&89*73=I43*=9-*= ??=(4;*7=<&8=1*88=*=9*38.;*=.3=9-*=1&89=>*&78=9-&9=-*=).;*)_=*='*1.*;*)=9-&9= &'&143*=51&>*)=&=741*=.3=89&'.1.8.3,=9-*=-&'.9&9`=&3)=9-&9=9-*=(-&3,*=.3=??=(4;*7= (4:1)='*=&997.':9*)=94=14<=894(0=1*;*18=+4114<.3,=>*&78=4+=.39*38.;*=+.8-.3,_=*= 8&.)=9-&9=<-*3=-*=+.789=+.8-*)=&9=,4:9-=?&5*=&>=14(0=+-=:=;*89*73=I43*=.3=9-*= 2.)=+30*8`=9-*7*=<*7*=1&7,*=545:1&9.438=4+=&'&143*=43=7**+8=.3=9-*=8-&114<8`= <-.(-=<*7*=6:.(01>=)*51*9*)_=;-*3=-*=7*9:73*)=9-*=+4114<.3,=>*&7`=9-*=&'&143*= 545:1&9.438=-&)=349=7*(4;*7*)`=&3)=&=)*38*=(&345>=4+=':11=0*15=-&)=4;*7,74<3= 9-*=7**+8_=*=8&.)=9-&9=&11=;.8.'1*=&'&143*=<*7*=9&0*3='*(&:8*=9-*>=<*7*=&11=1&7,*7= 9-&3=9-*=+,1822=8.?*=1.2.9_=*='*1.*;*)=9-&9=9-*=,74<9-=4+=9-*=':11=0*15=(&345>= (4:1)='*=&997.':9*)=94=9-*=7*24;&1=4+=&'&143*_= - 349-*7=*&71>8,74:5=).;*7=2&)*=&=8.2.1&7=4'8*7;&9.43=&'4:9=&=8-&114<=9*33.8= (4:7988.?*)=5&9(-=7**+=.3=14(0=-*=+742=<-.(-=.3=+31*`=-*=7*24;*)=&11= &5574=.2&9*1>=43*=9433*=9-*=&'&143*_=4114<.3,=-.8=;.8.9`=9-*=7**+=-&'.9&9= (-&3,*)=+742=&3=45*3=(&345>=7**+=94=43*=)42.3&9*)='>=)*38*=':11=0*15_=-*= ).;*7=3*;*7=+4:3)=&'&143*=43=9-*=7**+=):7.3,=8:'8*6:*39=;.8.98_=;-*3=9-*=7**+= <&8=;.8.9*)='>==).;*78=.3=,**.`=431>=&=+*<=&'&143*=<*7*=8**3`=&19-4:,-= 8*&7(-.3,=<&8=2&)*=).++.(:19='>=9-*=)*38.9>=4+=9-*=(&345>_=-*=).;*7=4'8*7;*)= 8.2.1&7=(-&3,*8=43=8-&114<=+7.3,*=7**+8=+:79-*7=3479-=.3=14(0=-*_= - =2.))1*=,74:5=).;*7=7*5*&9*)=&3=4'8*7;&9.43=2&)*=94=-.2='>=&3=*&71>=).;*7_= *=8&.)=9-&9=9-*=*&71>=).;*7=-&)=941)=-.2=9-&9=4++=9-*=84:9-8<*89=8-47*=4+=O&,443= &>=14(0=,-`=,44)=(&9(-*8=4+=&'&143*=<*7*=9&0*3=):7.3,=9-*=+30*8_=;-*3=-*= 89&79*)=+.8-.3,=.3=+31.`=-*=+4:3)=9-*=7**+=94='*=;*7>=<**)>=<.9-=85&78*=??= (4;*7=&3)=+*<=&'&143*=.9=7*2&.38=84=94)&>_=-*=4'8*7;&9.43=5:??1*)=-.2= '*(&:8*=9-*=<**)>=7**+=<&8=349=43*=9-&9=-*=&884(.&9*)=<.9-=&'&143*=':9=.389*&)= <&8=9-*=9>5*=4+=-&'.9&9=9-&9=-*=&;4.)*)=.+=-*=<&39*)=94=(&9(-=&'&143*_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = -3 = =

- =).;*7=<-4=+.8-*)=*=9*38.;*1>=9-74:,-4:9=9-*=9+397*(&89*&:==?-&33*1='14(08= +.=&3)=+/=):7.3,=9-*=+32*8=&3)=+33*8=8&.)=9-&9=-*=-&)=349.(*)=.3(7*&8.3,= 9:7'.).9>=&3)=8*).2*39=(4.3(.).3,=<.9-=9-*=*89&'1.8-2*39=4+=8&1243=&6:&(:19:7*= +&728=.3=9-*=(-&33*1_=-*=8*).2*39=8*991*)=43=9-*=0*15=(&345>=&3)=9-*=7**+_=*= 8&.)=&'&143*=545:1&9.438=43=7**+8=.3=9-*=&++*(9*)=&7*&8=479=+85*7&3(*`=D7*&9= &>1478=&>`=7*)=?1.++8=&3)=,:7;*>478=&>=<*7*=;*7>=)*51*9*)=&3)=34=143,*7= <&77&39*)=+.8-.3,_= - =(:77*39=).;*7=<-4=89&79*)=&'&143*=+.8-.3,=.3=+32.=349.(*)=(-&3,*8=43=7**+8= 3479-=4+=9-*=D&7)*38=.3=14(0=-*=9-&9=(4.3(.)*)=<.9-=7*):(*)=(&9(-*8=&3)= *;*39:&11>=9-*=)*51*9.43=4+=&'&143*=545:1&9.438=94=85&78*1>=8(&99*7*)=.3).;.):&18_= 9=38438=&>`=9-*='49942=(-&3,*)=+742=??8(4;*7*)=74(0=94=,7**3=1*99:(*= <**)= *1;& _=9=9-*=7.3,=4+=E*15`=897.3,=0*15= 7&(74(>89.8 =).8&55*&7*)=&3)= 8543,*=&3)=)*38*=2&98=4+=9.3>=2:88*18=89&79*)=94=4;*7,74<=74(08_=9=*''1>= *&(-`=9-*=&1,&1=,74<9-=(&345>=&3)=:3)*78947>='*(&2*=)*38*7=&8=9-*=&'&143*= ).8&55*&7*)_=-*=).;*7=9-4:,-9=9-*8*=7**+8=-&)=&11=574;.)*)=,44)=(&9(-*8=4+= &'&143*=):7.3,=9-*=5*7.4)='*9<**3=+32.=&3)=+322=9-&9=-*=+.8-*)=9-*7*_=:79-*7= 84:9-=.3='14(08=,2=&3)=,1`=-*=349.(*)=9-&9=&8=9-*='*&(-=7**+8=5&(1*&3=&>=&3)= 7.*3)1>=*&(-*8='*(&2*=)*51*9*)`=&1,&1=,74<9-='*(&2*=247*=)*38*=&3)= 8543,*8=(4;*7*)=247*=74(0_= - =(:77*39=).;*7=<-4=89&79*)=.3=+332=349.(*)=9-&9=&+9*7=&'&143*=<*7*=7*24;*)= +742=9-*=*251*894<*=*&(-=7**+8=14(0=,3=.3=9-*=1&9*=+33*8=9-&9=9-*=7**+= &55*&7*)=94='*(42*=247*=8543,*=*3(7:89*)_=-.8=).;*7=+.8-*)=24891>=&74:3)= .(-*34=&3)=-&8=8<:2=&143,=2:(-=4+=9-*=(4&89=3*&7=9-*=94<3b=(4&89=9-&9=:8*)=94= 574):(*=&'&143*_=*=-&)=7*(*391>=8<:2='*9<**3=7*)'.11=4.39=&3)=?4)=74(0`= <-.(-=:8*)=94=574):(*=7*&843&'1*=(&9(-*8=.3=9-*=+32*8`=':9=-&)=8**3=;*7>=+*<= &'&143*_=*=(422*39*)=9-&9=9-*7*=<&8=,44)=(4;*7&,*=4+=??=&3)=9-&9=.9=1440*)= 1.0*=5*7+*(9=&'&143*=-&'.9&9=._*_=<&8=:3(-&3,*)`=&5&79=+742=9-*7*='*.3,=;*7>=+*<= &'&143*=57*8*39_= - 9.;*78=+742=&11=9-7**=(&9*,47.*8=8540*=&'4:9=8*&843&1=(-&3,*8=.3=1*;*18=4+=7*)= &1,&*=&3)=(&345>_=-*>=8&.)=9-&9=&1,&*=)*38.9>=.3(7*&8*)=+742=2.)8857.3,=&3)= <&8=5&79.&11>=7*85438.'1*=+47=7*):(*)=(&9(-=7&9*8=):7.3,=8:22*7`='*(&:8*=9-*= &1,&*=(4;*7*)=9-*=&'&143*_=9=1*&89=9<4=).;*78='*1.*;*)=9-&9=,.;*3=8:++.(.*39= 3:2'*78=4+=&'&143*`=9-*=:3)*78947>=&1,&1=(4;*7=(4:1)='*=7*):(*)=9-74:,-= +**).3,=&(9.;.9>_= - .3&11>`=9-7**=(:77*39=).;*78=8540*=&'4:9=(-&3,*8=9-&9=9-*>=-&)=8**3=&9=9-*= (9&*438=14(0=+-_=-*=+.789=8&.)=9-&9=-*=-&)=349.(*)=9-&9=&=)*38*='*)=4+= &:1*75& =,7**3=&1,&*=<&8=857*&).3,=&3)=*3(74&(-.3,=43=)**5=<&9*7=+/:,*=2= &'&143*=-&'.9&9=&9=.8-*78=4.39`=&3)=9-&9=34=&'&143*=1.;*)=&243,89=9-*= &:1*75& _= -*=8*(43)=8&.)=9-&9=-*=-&)=349.(*)=9-&9=9-*=8543,*=&3)=??=(4;*7`=&3)=&1,&1= :3)*78947>=(4;*7=+7*6:*391>=(-&3,*)=(4.3(.).3,=<.9-=(-&3,*8=.3=&'&143*= &':3)&3(*_=*=;.*<*)=9-*=-&'.9&9=(-&3,*=&8=&=)>3&2.(=7*85438*=94=(-&3,*8=.3= &'&143*=&':3)&3(*`=&3)=9-&9=(-&3,*8=.3=&':3)&3(*=&3)=).897.':9.43=4+=&'&143*=

.* = 74/*(9=34_=,**.2*+- = =

<*7*=349=3*(*88&7.1>=(&:8*)='>=+.8-.3,_=-*=9-.7)=).;*7=8&.)=9-&9=+4114<.3,=&= ;.41*39=89472=.3=+332`=2:(-=4+=9-*=8-&114<=7**+='*9<**3=.8-*78=4.39=&3)= 54:1)>=41*=<&8=897.55*)='&7*=&3)='4:1)*78=<*7*=4;*79:73*)='>=9-*=<&9*7= 24;*2*39_=*=8&.)=9-&9=.9=9440=/:89=9<4=>*&78=+47=9-*=(422:3.9.*8=94=7*8*89&'1.8-= 94=9-*=54.39=<-*7*=-*=(4:1)=34=143,*7=8**=&3>=).++*7*3(*='*9<**3=&++*(9*)=&3)= 3*&7'>=:3&++*(9*)=7**+_=.8=54.39=<&8=9-&9=<-&9*;*7=*++*(9=&'&143*=+.8-.3,=-&)=43= 9-*=*3;.7432*39`=.9=<&8=1.0*1>=94='*=.3(438*6:*39.&1=(425&7*)=<.9-=9-*= )*;&89&9.3,=*++*(9=4+=894728`=&3)=9-&9=9-*=-&'.9&9=<4:1)=*;*39:&11>=7*;*79=94=.98= +472*7=9>5*=,.;*3=9.2*_== ,.==).;*78=*25-&9.(&11>=7*/*(9*)=9-*=.)*&=9-&9=-&'.9&9=(-&3,*8=2.,-9='*=&884(.&9*)=<.9-= (-&3,*8= .3= &'&143*= &':3)&3(*`= *.9-*7= 4((:77.3,= 3&9:7&11>= 47= ):*= 94= +.8-.3,_= -*>= 2&.39&.3*)= 9-&9= &'&143*= +.8-.3,= <&8= *3;.7432*39&11>= '*3.,3_= <4= 49-*78= <*7*= 8(*59.(&1=4+=9-*=.)*&`=':9=&184=8&.)=9-&9=9-*>=-&)=3*;*7=(438.)*7*)=9-*=5488.'.1.9>=&3)= (4:1)=349=&38<*7=9-*=6:*89.43_= :*89.43=+0a=#-&9=8479=4+=)*59-=7&3,*=).)=>4:=(422431>=).;*=94
=.)=*&71>=).;*78=+.8-=)**5*7= -&'.9&9=9-&3=1&9*7=).;*78
=#*7*=>4:=&++*(9*)='>=)*(4257*88.43=8.(03*88
= 8=2.,-9='*=*=5*(9*)=,.;*3=9-*=5&:(.9>=4+=.3+472&9.43=&3)=1&(0=4+=&<&7*3*88=&'4:9= ).;.3,87*1&9*)= .3/:7.*8`= 2&3>= 4+= 9-*= *&71>= &3)= 2.))1*= ,74:5= ).;*78= 7*,:1&71>= ).;*)= )**5*7`=&3)=<470*)=&9=)*59-=+47=143,*7=9-&3=9-*=(:77*39=).;*78_=-*>=<*7*=349=<*11= .3+472*)=4+=9-*=(438*6:*3(*8=4+=)*(4257*88.43=8.(03*88=9?,`=&3)=7*,&7)*)=.9=&8=&3= 4((:5&9.43&1= -&?&7)= 7&9-*7= 9-&3= 842*9-.3,= 9-&9= 2:89='*=&;4.)*)_=5489=4+=9-*=*&71>= ,74:5=).)=349=).;*=897.(91>=94=)*(4257*88.43=9&'1*8`=':9=)*;.8*)=9-*.7=4<3=9.2*2)*59-= 8(-*):1*= 1448*1>= '&8*)= 43= 9-*= 9&'1*8`= 47= <-&9= 9-*>= -&)= -*&7)= +742= 49-*7= ).;*78`= 47= <-&9*;*7=9-*>=+*19=9-*>=(4:1)=,*9=&<&>=<.9-_=,42*=<*7*=247*=7.80=&;*78*=&3)=*.9-*7= 24891>= <470*)= .3= +*= 2*97*8= 47= 1*88`= 47= <470*)= &9= ,7*&9*7= )*59-8= +47= 431>= 8-479= 0+= -4:7=5*7.4)8='*+47*=85*3).3,=9-*=7*2&.3)*7=4+=9-*=)&>=.3=9-*=8-&114<8_=>9-*78=+4:3)= 9-&9=9-*=431>=<&>=9-&9=9-*>=(4:1)=*&73=8:++.(.*39=243*>=<&8=94=85*3)=9.2*=&9=)*59-`= &3)=9-*>=+7*6:*391>=<470*)=+47=+4:7=-4:78=&9=0*=+**9=5+2=2='*+47*=&8(*3).3,=94=9-*= 8:7+&(*`=:8:&11>=<.9-4:9=&=)*(4257*88.43=8945_== >3*= *&71>= ).;*7`= 8**0.3,= 94= &;4.)= 9?,`= )*;*145*)= &3= .3,*3.4:8= .38<&9*7= 4=>,*3 = )*(4257*88.43=9*(-3.6:*=9-&9=<&8=34;*1=&9=9-*=9.2*`=94=<-.(-=-*=&997.':9*)=-.8='*3)8 +7**=).;.3,=)*85.9*=-4:78=&9=)*59-_=*=(438.89*391>=+.8-*)=)**5*7=<&9*7=9-&3=9-*=49-*7= ).;*78`=*=51&.3.3,=9-&9=-*=57*+*77*)=94=+.8-=.3=0*=47=1*=+**9=+47=&=(4:51*=4+=-4:78`=9-*3= ,4=-42*`=(425&7*)=<.9-=9-*=49-*78=<-4=(&:,-9=9-*=8&2*=<*.,-9=&+9*7=<470.3,=.3=+*: .*= +**9= &11= )&>_= *= -&)= &= )*).(&9*)= 7*,:1&947= 43= &= 8-479= -48*= +.99*)= 94= &3= 4=>,*3= (>1.3)*7=43=-.8='4&9_=;-*3=-*=&8(*3)*)`=9-*=)*(0-&3)=<4:1)=14<*7=9-*=7*,:1&947=94= -.2`= &3)= -*= <4:1)= '7*&9-*= +742= .9= '*14<= 9-*= '4&9= &9= &= )*59-= 4+= &= +*<= 2*97*8= +47= &5574=.2&9*1>= +*= 2.3:9*8_= *= <&8= &<&7*= 9-&9= '7*&9-.3,= +**= 4=>,*3= <4:1)= &((*1*7&9*=9-*=7*24;&1=4+=3.974,*3=+742=-.8='4)>`=&3)=7*):(*=9-*=7.80=4+=9?,`=&3)=<&8= &184= &<&7*= 9-&9= '7*&9-.3,= 4=>,*3= &9= -.,-= 5&79.&1= 57*88:7*8= (4:1)= 2&0*= -.2= :3(438(.4:8_=*=8&.)=9-&9=-*=-&)=94='*=(&7*+:1=:=9-*=.3.9.&1=+14<=4+=4=>,*3=9-74:,-=9-*= 7*,:1&947=4((&8.43&11>=.,3.9*)=5&79.(1*8=4+=+1&22&'1*=2&9*7.&1=&3)=85&708=<4:1)=8-449=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = .+ = =

4:9_=3=-.8=).;.3,=(&7**7`=-*=3*;*7=-&)=8>259428=4+=9?,`=&3)=94)&>=7*2&.38=+7**=4+=.98= )*'.1.9&9.3,= *++*(98_= *(&:8*= 4+= 9-*= 7.80= &884(.&9*)= <.9-= '7*&9-.3,= 4=>,*3= :3)*7= 57*88:7*`=.9=.8=)4:'9+:1=<-*9-*7=&3>=.3+472*)=).;*7=<4:1)=:8*=9-.8=9*(-3.6:*=94)&>_= -.8=*=&251*=9>5.+.*8=9-*=7*&).3*88=4+=*&71>=).;*78=94=.2574;.8*=&3)=9&0*=7.808=<-*3= +&(*)=<.9-=9-*=:3034<3_= ?:77*39= ).;*78= <*7*= '*99*7= .3+472*)= &'4:9= 9-*= (438*6:*3(*8= 4+= :38&+*= ).;.3,= 57&(9.(*8=&3)=-&)=&((*88=94=).;*=(425:9*78=&3)=247*=(438*7;&9.;*=).;*=9&'1*8_=;-.1*= 8*;*3= 4+= 9-*= 9*3= <*7*= 57*5&7*)= 94= <470= &9=&3>= )*59-= 3*(*88&7>= 94= (&9(-= +.8-`= 9-*>= ,*3*7&11>= <470*)= 8-&114<*7= 9-&3= 9-*= *&71.*7= ,74:58`= &3)= 89&>*)=<.9-.3= 9-*= 1.2.98= 4+= 9-*.7= ).;*= (425:9*78`= <-.(-= ,7*&91>= 7*):(*)= 9-*= 9.2*= 9-*>= (4:1)= 85*3)= &9= )*59-= (425&7*)=<.9-=9-*=*&71.*7=).;*78_= 83+479:3&9*1>=349=&11=).;*78=<*7*=&8=8:((*88+:1=&9=&;4.).3,=9?,_=4:7=4+=9-*=+0=*&71>= ,74:5=).;*78=&3)=9-7**=4+=9-*=8*;*3=2.))1*=,74:5=).;*78=<*7*=&++*(9*)='>=9?,_=,42*= 4+=9-*8*=-&)='43*=)&2&,*=&884(.&9*)=<.9-=9?,_=>3*=4+=9-*=*&71>=,74:5=8:++*7*)=&3=&.7= *2'41.82`=':9=.9=<&8=349=(1*&7=9-&9=9-.8=<&8=):*=94=<470.3,=&9=,7*&9*7=)*59-8_=<43*=4+= 9-*=(:77*39=).;*78=-&)=8:++*7*)=+742=9?,_= -*=(438*6:*3(*=4+=(:77*39=).;*78=<470.3,=247*=8&+*1>=.8=9-&9=1*88=*++479=.8=85*39=43= )**5*7=7**+8_==2&/47=8-.+9=.3=*++479=94=8-&114<*7=<&9*7=<4:1)=.3).(&9*=&=7*):(9.43=.3= +.8-.3,=2479&1.9>=43=)**5=<&9*7=894(08=&9=9-*=*=5*38*= 4+= 8-&114<= <&9*7= 894(08`= &3)= 9-&9=&=549*39.&11>=8.,3.+.(&39=5&79=4+=9-*=+.8-*7>=.8=34=143,*7=*=514.9*)_=4<*;*7`=.9=-&8= 349='**3=5488.'1*=94=6:&39.+>=9-*=8-.+9=.3=*++479`=347=94=14(&9*=9-*=548.9.43=&3)=*=9*39=4+= )**5=7**+8=43=2&58`=347=94=*89.2&9*=9-*=(4397.':9.43=+742=9-*=)**5=7**+8=94=9-*=&33:&1= (&9(-`=+47=9-*=+4114<.3,=7*&8438a== +_ <4=*&71>=47=2.))1*=,74:5=).;*78=5488*88*)=).;*=(425:9*78`=&3)=+*<=4+=9-*= (:77*39=).;*78=7*9&.3*)=)*59-=14,8=+742=9-*.7=(425:9*78_=-*=)*59-=7*(47)*)= 43=+.8-=)4(0*98=14),*)=<.9-=9-*.7=(&9(-*8=<&8=9-*=2&=.2:2=)*59-=&3)=,&;*=34= .3).(&9.43=4+=9-*=9.2*=85*39=9-*7*_=?438*6:*391>`=&5&79=+742=&3*()49*8`=9-*7*=.8= 34=-.8947.(&1=.3+472&9.43=&'4:9=(-&3,*8=.3=9-*=).897.':9.43=4+=*++479='>=)*59-`= &3)=85&78*=7*(*39=.3+472&9.43_= ,_ 3=3*&71>=&11=(&8*8`=9-*=).;*78=<*7*=:3&'1*=94=14(&9*=9-*=7**+=<-*7*=9-*>=+.8-*)= +742=9-*==-&'.9&9=2&58_=*(&:8*=2&58=&7*=574):(*)=+742=84:3).3,8=9&0*3= :5=94=,**=2=&5&79`=9-*>=<*7*=4+=.38:++.(.*39=7*841:9.43=94=8-4<=0*>=+*&9:7*8=4+= 9-*=7**+=<-.(-=).;*78=(4:1)=:8*=94=3&;.,&9*_==+*<=).;*78=<*7*=&'1*=94=)7&<= *=9*38.;*= 2:)=2&58`=2&70.3,=)*9&.18=8:(-=&8='42'.*8`=,:99*78=&3)=8&3)= *),*8_=>3=9-*=7&7*=4((&8.438=<-*3=).;*78=2&3&,*)=94=14(&9*=574):(9.;*=7**+=43= 9-*=-&'.9&9=2&58`=9-*.7=5*7(*59.438=4+=9-*=7**+=<*7*=2:(-=).++*7*39=+742=9-48*= 8-4<3=43=9-*=2&58`=&3)=9-*>=9-4:,-9=9-&9=9-*=2&58=<*7*=.3(477*(9=.,:7*=1_= =

., = 74/*(9=34_=,**.2*+- = =

=

= *.,:7*=1= +425&7.843='*9<**3=&=%*7=-&'.9&9=2&5=&3)=&=2&5=)*;*145*)=+742=2*247>='>=&= ).;*7=<-4=+47=2&3>=>*&78=<470*)=43=9-*=7**+8=8-&)*)=.3='74<3=.3=9-*=-&'.9&9=2&5_= %19-4:,-=9-*=8(&1*=4+=+*&9:7*8=8:(-=&8=9-*=.81&3)8= .8= 4';.4:81>= <743,`= 9-*= ).;*78= 2&5= 8-4<8= 2:(-= ,7*&9*7= )*9&.1= 4+= 9-*= 7**+`= &3)= .11:897&9*8= 842*= 4+= 9-*= 574'1*28= +&(*)='>=).;*78=<-.1*=&99*259.3,=94=:3)*789&3)=9-*=-&'.9&9=2&58_= -_ -*=85&9.&1=7*5479.3,=4+=(&9(-*8=-&8=&1<&>8='**3=43=&=8(&1*=4+=2&3>=0.142*97*8_= 3=,***`=9-*=8(&1*=<&8=7*):(*)=<-*3=9-*=+472*7=7*5479.3,='14(08=<*7*= 8:').;.)*)`=':9=.9=.8=89.11=944=1&7,*=94=)*9*72.3*=.+=(&9(-*8=&7*=9&0*3=43=8-&114<= 7**+=47=)**5=7**+_=3=,**.`=).;*78=89&79*)=7*5479.3,=*++479=&(7488=9-7**=)*59-= 7&3,*8=*:+*=2`=+*:,*=2`=1,*=2`=<-.(-=-&8=2&)*=.9=5488.'1*=94=)*9*(9=(-&3,*8= 4+=45*7&9.43&1=)*59-_=47=*=&251*`=.9=.8=34<=5488.'1*=94=8**=&=8-.+9=.3=*++479=94= )**5*7=<&9*7=<-*3=).;*78=43=E.3,=81&3)=89&79*)=:8.3,=<.974=='7*&9-.3,= &55&7&9:8=.3=,**0=.,:7*=2_=-*=)**5*7=7**+8=-&)=349='**3=+.8-*)=8.3(*=9-*= 2.)8+32*8`=&3)=9-*7*=<*7*=2&3>=247*=&'&143*=&9=)*59-=9-&3=.3=9-*=)*51*9*)= 8-&114<8_=4<*;*7`=<-.1*=9-*=8-.+9=.3=*++479=.8=.3).(&9.;*`=.9=.8=89.11=349=5488.'1*= 94=57*(.8*1>=)*9*72.3*=-4<=2:(-=9-*=)**5*7=7**+8=(4397.':9*_=-*=*=&251*= +742=E.3,=81&3)=2&>='*=&3=*=(*59.43`=':9=.9=&55*&78=1.0*1>=9-&9=9-*=14(&9.43=4+= 9-*=+&89*73=I43*=)**5=<&9*7=894(08=-&8='**3=+47,499*3`=&3)=9-&9=:31*88=).;*78= &7*=<.11.3,=94=4:91&>=(438.)*7&'1*=*=5*38*=+47=<.974==*6:.52*39`=9-*8*=894(08= 2&>=3*;*7='*=+.8-*)=&9=8.,3.+.(&39=1*;*18=&,&.3_==

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = .- = =

80 0-10m 70 10-20m 60 >20m 50 % 40 30 20 10 0 2004 2005 2006 2007 = *.,:7*=2= *7(*39&,*=*++479=-4:78='>=)*59-=7&3,*=*:+*=2`=+*:,*=2`=1,*=2='*9<**3=0&3:&7>= ,**.=&3)=
&>=,**1`=..3,=781&3)='1&(01.5=+.8-*7>= :*89.43=+1a=8*&843&1=(-&3,*8=.3=(&9(-=7&9*8=:=<*7*=9&89=4&89=(&9(-*8=&1<&>8=;&7.&'1*
== :*89.43=+2a=#->=)4=9&89=4&89=(&9(-*8=;&7>`=':9=349=#*89=4&89
= '&143*=&7*=-&7)*7=94=(&9(-=.3=8:22*7=&3)=*&71>=&:9:23=43=9-*=*&89=(4&89=&3)=2489= 5&798= 4+= 84:9-8*&89= &82&3.&`= >*9= 9-*7*= &55*&78= 94= '*= 34= 8*&843&1= ;&7.&9.43= .3= (&9(-&'.1.9>= .3= 9-*= <*89= &3)= +&7= 84:9-= 4+= 9-*= 89&9*_= -*8*= 6:*89.438= <*7*= &80*)= 94= )*9*72.3*=.+=8*&843&1=;&7.&9.438=-&)=&1<&>8=4((:77*)=47=<*7*=&=7*(*39=5-*342*343`= &3)=94=*89&'1.8-=<->=9-*>=2.,-9=4((:7_= 11=9-7**=,74:58=4+=).;*78=8&.)=9-&9=&'&143*=<*7*=-&7)*7=94=(&9(-=.3=9-*=<&72*7=5&79=4+= 9-*= >*&7= 43= 9-*= *&89= (4&89_= ,42*= ).;*78= *=51&.3*)= 9-&9= 9-*= 0*15= (&345>= &3)= &1,&1= :3)*78947>=,7*<=9-.(0*7=&3)=-.)=9-*=&'&143*`=&3)=.9=<&8=349=:39.1=9-*=8-479*7=-4:78=4+= )&>1.,-9= &3)= .3(7*&8*)= <&9*7= 24;*2*39= ):7.3,= &:9:23= 9-&9= 9-*= <**)= ).*)= '&(0`= 2&0.3,=9-*=&'&143*=*&8.*7=94=+.3)_=-*>=8&.)=9-&9=43=9-*=<*89=&3)=84:9-=(4&898=<-.(-= &7*=247*=*=548*)=94=4(*&3=8<*11`=<**)=,74<9-=.8=7*897.(9*)='>=9-*=,7*&9*7=1*;*18=4+= <&9*7=24;*2*39`=&3)=9-*=&'&143*=&7*=247*=;.8.'1*_=-*= .3(7*&8*)= <&9*7= 24;*2*39= &184=+47(*8=9-*=&'&143*=.394=)**5*7=-&'.9&9=<-*7*=9-*=0*15=(&345>=.8=1*88=)*38*`=<-.(-= 2&0*8=9-*=&'&143*=247*=(4385.(:4:8_= -*=8*(43)=2489=(42243=7*85438*=<&8=9-&9=9-*=&'&143*='*(42*=(7>59.(=-.)*=:3)*7= 74(08= <-*3= 9-*= <&9*7= .8= <&72*7_= ;->= 9-.8= 8-4:1)= '*= 84= <&8= 349= (1*&7`= ':9= 9-*>= *=51&.3*)= 9-&9= 9-*= *&89= (4&89= <&9*7= ,*98= <&72*7= .3= 8:22*7= 9-&3= .3= 9-*= 84:9-= &3)= <*89`=<-.(-=.8=<->=9-.8='*-&;.4:7=.8=349=8**3=9-*7*_=>3=9-*=3479-*73=5&79=4+=9-*=*&89= (4&89=&3)=.3=&88=,97&.9=<-*7*=9-*=<&9*7=.8=,*3*7&11>=<&72*7`='1&(01.5=&'&143*=9*3)= 94='*=+4:3)=247*=4+9*3=.3=(7*;.(*8=&3)=:3)*7='4:1)*78=(425&7*)=<.9-=247*=84:9-*73=

.. = 74/*(9=34_=,**.2*+- = =

&'&143*`= &3)= 84:9-*73= ).;*78= 4+9*3= -&)= ).++.(:19>= +.3).3,= &'&143*= .3= 9-*= 3479-= :39.1= 9-*>=(&2*=94=9*728=<.9-=9-.8=(-&3,*=.3='*-&;.4:7_= -*.7=7*85438*8=.3).(&9*=9-&9=8*&843&1=;&7.&9.43=.3=(&9(-*8=-&8=&1<&>8=4((:77*)`=&3)= 9-&9=.9=.8=349=7*1&9*)=94=14<=1*;*18=4+=&':3)&3(*=347=2489=.25479&391>`=94=1488=4+=-&'.9&9= 47=143,89*72=(-&3,*8=.3=-&'.9&9_= +-&3,*8=.3=+.8-*)=(4&891.3*= 9:7.3,=9-*=.39*7;.*<8`=).;*78=<*7*=*3(4:7&,*)=94=2&70=43=2&58`=&3)=.3=842*=(&8*8= &*7.&1= 5-494,7&5-8`= 9-*= 548.9.43= 4+= 7**+8= &3)= (4&89= <-*7*= 9-*>= -&)= +.8-*)_= -.8= <&8= 6:.9*=.257*(.8*`='*(&:8*=9-*7*=<*7*=34=2&58=<.9-=<-.(-=9-*>=(4:1)=&((:7&9*1>=14(&9*= <-*7*=9-*>=-&)=+.8-*)_=-*='*89=7*57*8*39&9.43=4+=+.8-*)=(4&89=&3)=7**+=<&8=&(-.*;*)= '>=2&70.3,=1.3*8=&143,=9-*=(4&89_=<4=&99*259=<&8=2&)*=94=&((4:39=+47=;&7.&9.438=.3= <.)9-= 4+= +7.3,.3,= 7**+= &3)= ).++*7*3(*8= .3= +.8-.3,= &7*&`= '*(&:8*= 9-.8= .3+472&9.43= <&8= 24891>=:3&;&.1&'1*=47=:37*1.&'1*_=+=&251*8=4+=).;*78=2&58=&7*=8-4<3='*14<=.,:7*= 3_= =

= = =

*.,:7*=3= /*(-*7(-*=,&>`=,14(0=+-`=8-4<.3,=(-&3,*8=.3=574):(9.;*=&'&143*=+.8-.3,=7**+='1&(0= 1.3*8=):7.3,=9-*=(4:78*=4+=9-*=+.8-*7>_= -*=1*+98-&3)= 2&5= <&8= 574):(*)= '>= *&71>= ,74:5=).;*78`=9-*=49-*7=9<4=2&58='>=(:77*39=).;*78_=,&8*=2&58=7*574):(*)=<.9-=9-*= 5*72.88.43=4+=&82&5_= = -*=.3).;.):&1=2&58= <*7*=(42'.3*)`=9-*=1*3,9-=&3)=548.9.43=4+=9-*=1.3*8=(425&7*)= '*9<**3=,74:58`=&3)=9-*=1*3,9-=4+=+.8-*)=(4&891.3*=2*&8:7*)=<.9-=&=(:7;.2*97*=2&5= 2*&8:7*= E&79*32*88*7`= D*72&3>_= ?:77*391>= +.8-*)= (4&891.3*= <&8= *=57*88*)= &8= &= 5*7(*39&,*=4+=9-*=2&=.2:2=1*3,9-=4+=(4&891.3*=.)*39.+.*)=&8=574):(9.;*=&'1*=+_= = -*=2*9-4)=<&8=.3&((:7&9*=<-*7*=9-*7*=<*7*=*=9*38.;*=&7*&8=4+=4++8-47*=7**+=).89&39= +742=1&3)`='*(&:8*=9-*7*=<*7*=.38:++.(.*39=(148*=7*+*7*3(*=54.398=+47=).;*78=94=5149=9-*= 548.9.438= 4+= +.8-*)= 7**+= 43= 2&58_= 47= *=&251*`= 9-*7*= <*7*= ).++.(:19.*8= 14(&9.3,= &3)= )*8(7.'.3,= 4++8-47*= 7**+8= &9= 9-*= (9&*438= 14(0= +-_= 4<*;*7`= &11= ).;*78`= .3(1:).3,=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ./ = =

9-7**=<.9-=143,=1-*=>*&78=&3)=(439.3:4:8=*=5*7.*3(*=.3=9-*=&7*&=<*7*=:3&3.24:8=.3= 9-*.7=45.3.438=9-&9=431>=&=+*<=2.347=5&798=4+=9-*=7**+=.3(1:).3,=9-*=7*8*7;*=&9=D*47,*= =74(0=&7*=34<=:3+.8-*)=._*_=9-*=+.8-*)=&7*&=4+= 7**+= .8= *88*39.&11>= :3(-&3,*)_= 3= 14(0=-*`=9-*=548.9.43=4+=4++8-47*=+.8-.3,=&7*&8=9-*=D&7)*38`=,1445=74(0`=38438=7**+= &3)= 9-*= 7.3,= 4+= E*15= <*7*= .)*39.+.*)= <.9-= 9-*= :8*= 4+= &*7.&1= 5-494,7&5-8_= -.8= &7*&= <&8=;.8.9*)=<.9-=9<4=).;*78`=43*=+742=9-*=*&71>=,74:5=&3)=43*=(:77*39`=<-4=<*7*=&'1*= 94=14(&9*=9-*=548.9.43=4+=5&89=&3)=57*8*39=+.8-*)=7**+8_== = -*= 574'1*2= <.9-= 9-.8= 2*9-4)= 4+= &88*88.3,= (-&3,*8= .3= 7**+= 574):(9.;.9>= .8= 9-&9= .9= .8= 7*1.&39= 43= 9-*= 2*247.*8= &3)= 4'8*7;&9.438= 4+= &= 82&11= 5745479.43= 4+= 9-*= 5*451*= <-4= <470*)= 9-*7*`= &3)= &8= -&8= '**3= 57*;.4:81>= 349*)`= .3).;.):&18= ,*3*7&11>= -&)= &3= .3(4251*9*=034<1*),*=4+=9-*=+.8-*)=7**+8=.3=&=7*,.43_=)).9.43&11>`=2:(-=-.3,*8=43= 9-*= .39*757*9&9.43= 4+= <-&9= .3).;.):&18= (438.)*7*)= ,44)= 47= 574):(9.;*= '49942= '*(&:8*`=&8=-&8=&184='**3=8-4<3`=9-.8=/:),*2*39=;&7.*)=<.)*1>='*9<**3=.3).;.):&18_= = 3= .3)*5*3)*39= 2*&38= 4+= ;&1.)&9.3,= 9-*8*= (-&3,*8= .3= 574):(9.;*= (4&891.3*= <&8= )*;.8*)_=O488=4+=574):(9.;*=(4&891.3*=<&8=&88:2*)=94='*=(477*1&9*)=<.9-=+&11.3,=*++479= <.9-.3=&='14(0b=.3=49-*7=<47)8`=.+=(4&891.3*=-&8='**3=1489`=7*(*39=2*&3=1*;*18=4+=*++479= 8-4:1)= '*= &= 82&11*7= +7&(9.43= 4+= 5*&0= 1*;*18= 4+= *++479_= 9= <&8= &88:2*)= 9-&9= &= *++479= (4:1)='*=97&38+*77*)=4:9=4+=&='14(0=94=247*=574):(9.;*=&7*&8=.+=3*(*88&7>`=&3)='=9-&9= *++479=).)=349=(-&3,*=<.9-=.3(7*&8.3,=*++.(.*3(>_= ((47).3,1>`=+47=*&(-='14(0`=9-*=2*&3=4+=9-*=949&1=&33:&1=*++479=+47=9-*=57*;.4:8=+.;*= >*&78=,**,:*0=<&8=(425&7*)=<.9-=9-*=2*&3=4+=9-*=+.;*= -.,-*89= >*&78= 4+= 7*(47)*)= *++479=57.47=94=,**,=5*7(*39&,*=5*&0=2*&3=*++479`= &'1*= +_= 3= '14(08= +-`= ,2= &3)= -*`= 9-*7*=.8=,44)=(477*8543)*3(*='*9<**3=1*;*18=4+=2*&3=*++479=&3) =+.8-*)=(4&891.3*_=3= 14(0= +-`= 9<4= 4+= 9-*= >*&78= 4+= -.,-*89= *++479= &7*= (425&7&9.;*1>= 7*(*39= +333`= ,***`= .3).(&9.3,= 9-&9= 9-*= .)*39.+.(&9.43= 4+= +.8-*)= 7**+8= .8= 7*(*39= &3)= -*3(*= 2489= 574'&'1>= 7*1.&'1*_=3=14(0=-*`=9-*=>*&7=4+=-.,-*89=*++479=+32-=<&8=*=(1:)*)='*(&:8*=9-*=&33:&1= (&9(-=<&8=00=,7*&9*7=9-&3=9-*=3*=9=-.,-*89=(&9(-=&3)=7*,&7)*)=&8=&342&14:8_== = 3=14(0=+.=9-*=5*7(*39&,*=5*&0=2*&3=*++479=<&8=842*<-&9=1*88`=&3)=.3=14(0=,-=2:(-= 1*88=9-&3=+.8-*)= (4&891.3*`= .251>.3,=9-&9=9-*=1*3,9-=4+=(:77*391>=574):(9.;*=(4&891.3*= <&8=,7*&9*7=9-&3=2.,-9='*=*=5*(9*)_=49*39.&11>`=9-*=5*&0=2*&3=*++479=+742=14(0=,-= (4:1)=-&;*='**3=-.,-*7`='*(&:8*=.9=<&8=7*5479*)=94='*=247*=-*&;.1>=+.8-*)=.3=9-*=>*&78= 57.47=94=9-*=(411*(9.43=4+=85&9.&1=(&9(-=)&9&_=-*=*=9*39=4+=+.8-*)=8-47*1.3*=43=9-*=14(0= ,-=(4&89='*9<**3=543:2*39=&>=&3)=9-*=5&7.43=&>=<&774<8`=&3)=5&798=4+=9-*=14(0= +.=(4&89=&143,=9-*=84:9-*73=8-47*8=4+=7:3>=81&3)=;&7.*)='*9<**3=(:77*39=).;*78`=&3)= (4:1)='*=7*85438.'1*=+47=9-*=;&7.&9.43_= = -.8=(425&7.843=:8.3,=9-*=-.8947.(&1=).897.':9.43=4+=*++479=&88:2*8=9-&9=*++479=<4:1)= +14<=5745479.43&11>=94=9-*=2489=574):(9.;*=+.8-.3,=7**+8_=4<*;*7`=9-*7*=&7*=8*;*7&1= (7.9.(&1= +&(9478= <-.(-= .3;&1.)&9*= 9-.8= &88:259.43= &3)= &++*(9= 9-*= 7*1.&'.1.9>= 4+= 9-.8= 2*9-4)_= 3= 5&79.(:1&7`= .9= &88:2*8= 9-&9= +&(9478= .3+1:*3(.3,= 9-*= 85&9.&1= ).897.':9.43= 4+=

.0 = 74/*(9=34_=,**.2*+- = =

*++479=*_,_=':>*78=57*+*7*3(*8=+47=).++*7*39=8.?*8=4+=&'&143*`=7*1&9.;*=(4898=4+=+.8-.3,`= &3)=7*1&9.;*=(489=4+=1&'4:7=7*2&.3=:3(-&3,*)=4;*7=9-*=5*7.4)=4+=(425&7.843_=-*7*= &7*= 34= *++479= )&9&= 57.47= 94= +31/`= &3)= ,.;*3= -.,-= 1*;*18= 4+= (&9(-= 57.47= 94= 9-&9= >*&7`= 2&=.2:2=2*&3=*++479=2&>='*=:3)*7*89.2&9*)_=9=&184=)*5*3)8=:543=9-*=+.8-*7>='*.3,= :3(43897&.3*)='>=2&3&,*2*39=.39*7;*39.43_=47=*=&251*`=(43897&.398=43=1*;*1=4+=(&9(-= 2&>=2*&3=9-&9=.+=9-*7*=&7*=247*=&'&143*=94='*=(&:,-9=9-&3=&114<*)='>=&=?`=9-*3=9-*= ).897.':9.43=4+=*++479=2&>='*=.3+1:*3(*)='>=*(4342.(=+&(9478`=7&9-*7=9-&3=574):(9.;.9>= 4+=+.8-.3,=7**+8_=3=&)).9.43`=9-*7*=-&;*='**3=(-&3,*8=.3=(&9(-.3,=*++.(.*3(>=):7.3,=9-*= (4:78*= 4+= 9-*= +.8-*7>`= &3)= .9= (4:1)= '*= *=5*(9*)= 9-&9= 94= &(-.*;*= 9-*= 8&2*= &24:39= 4+= (&9(-`= 247*= -4:78= <4:1)= '*= *=5*3)*)= *&71.*7= .3= 9-*= +.8-*7>= 9-&3= .3= 1&9*7= >*&78= &77.843`= +32-b= &7'&9- = *9= &1 _`= ,**1_= 4<*;*7`= <.9-= 9-*8*= 7*8*7;&9.438`= 9-*= :8*= 4+= -.8947.(&1= ).897.':9.43= 4+= *++479= (43+.728= 9-*= )*(1.3*= .3= 574):(9.;*= 7**+= &7*&= <.9-.3= 9-*8*='14(08_= &'1*=+= +:77*391>= +.8-*)= (4&891.3*`= &8= &= 5*7(*39&,*= 4+= -.8947.(&11>= 574):(9.;*= (4&891.3*_= +:77*391>=+.8-*)=(4&891.3*=<&8=*89.2&9*)=+742=9-*=1*3,9-=4+=(4&89=51499*)=43=2&58= &3)=(425&7*)=<.9-=9-*=1*3,9-=4+=-.8947.(&11>=+.8-*)=(4&89_=*47=(425&7.843`=9-*=7*(*39= ,**,:*0= 2*&3= *++479= *=57*88*)= &8= &= 5*7(*39&,*= 4+= 9-*= 2*&3= 4+= 9-*= +.;*= >*&78= 4+= -.,-*89=*++479=.8=8-4<3_=++479=<&8=)*7.;*)=+742=).;*78=(&9(-=7*(47)8=(411*(9*)='>= &82&3.&3=,4;*732*39=+.8-*7.*8=&,*3(.*8=+742=+31/:,**0_=

14(0= =(:77*391>= )*39.+.*)=&7*&8=4+= =5*&0= U*&78=4+=-.,-*89=7*(47)*)=*++479= +.8-*)= 7*):(*)=*++479= 2*&3= (4&891.3*= *++479=

+-= 3*= 7*(-*7(-*=&>= 3*= +312`=+313`=+32,`=+333`=,***=

+.= /*= O4<*7=?-&33*1= -,= +32+`=+32-`=+32.`=+32/`=+322=

,-= 3*= +&,1*= 7**+`= O43,= ,,= +31/`=+310`=+311`=+312`=+32-= 7**+`= 5&7.43= &>= <&774<8=

,2= +*= 14(0=<.)*= +*= +310`=+311`=+32+`=+32,`=+32.=

-*= +*= 14(0=<.)*= 0= +32-=*=(1:)*)`=+32*`=+32+`=+32,`= +32.`=+320= +43(1:8.438= -*7*=&7*=9<4=(1*&7=(43(1:8.438=+742=9-.8=8*7.*8=4+=.39*7;.*<8a=+.789`=9-&9=).;*78=43(*= +.8-*)=&=2:(-=,7*&9*7=&7*&=4+=7**+=9-&3=9-&9=34<=8:55479.3,=9-*=(:77*39=+&89*73=I43*= ?`=&3)=8*(43)`=9-&9=1&7,*88(&1*=*(48>89*2=(-&3,*8=-&;*='**3=4'8*7;*)='>=).;*78_= :*):(9.43=4+=7**+=&7*&= -*=7*):(9.43=4+=+.8-*)=7**+=&7*&=.8=&=(438*6:*3(*=4+=9-7**=+&(9478a= &_ '.414,.(&1=)*51*9.43=4+=7**+= '_ *(4342.(=)*51*9.43=4+=7**+`=&3)= (_ 7*):(*)=*++479=.3=)**5=<&9*7_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = .1 = =

.414,.(&1= )*51*9.43= 4((:78= <-*3= 7&9*8= 4+= 7*(7:.92*39= &3)= ,74<9-= +&11= '*14<= 1488*8= (&:8*)='>=3&9:7&1=2479&1.9>=&3)=+.8-.3,_=?-&3,*8=.3='1&(01.5=&'&143*=&':3)&3(*=&3)= 9-*= *=9*39= 4+= '.414,.(&1= )*51*9.43= (&3= '*= 2*&8:7*)= 7*1&9.;*1>= *&8.1>= :8.3,= 8*;*7&1= 7*(4,3.8*)= 2*9-4)8= D47+.3* = *9= &1 _`= +330b= 5:3)> = *9= &1 _`= ,**0_= 83+479:3&9*1>`= &82&3.&= -&8= 3*;*7= -&)= &= +.8-*7>8.3)*5*3)*39= &':3)&3(*= 243.947.3,= 574,7&2`= 84= (-&3,*8=.3=&':3)&3(*=&3)=9-*=*=9*39=4+=)*51*9.43=-&;*=94='*=.3+*77*)=+742=&=;&7.*9>=4+= 84:7(*8`=&3)=57.3(.5&11>=+742=(-&3,*8=.3=(&9(-_=O43,89*72=(&9(-=7&9*8=&7*=4+=34=:8*=&8= &3=.3)*==4+=&':3)&3(*b=+.7891>='*(&:8*=8*&7(-=9.2*=.8=349=5745479.43&1=94=)*38.9>`=&3)= (438*6:*391>= (&9(-87&9*8= (&3= '*= ->5*7889&'1*= ,1:(?&34<80.`= +320b= 7.3(*`= +33,b= ,-*5-*7)=&3)=&79.3,943`=+33/b=&3)=8*(43)1>`='*(&:8*=.3=&82&3.&`=9-*7*=-&;*='**3= 2&3>= .2574;*2*398= .3= +.8-.3,= *++.(.*3(>= <-.(-= -&;*=7*):(*)= 9-*= *++479=7*6:.7*)= 94= (&9(-= &'&143*`= &3)= (43+4:3)= .39*757*9&9.43= 4+= (&9(-= 7&9*8= &8= &3= .3)*== 4+= &':3)&3(*= &77.843`=+32-b=&7'&9- =*9=&1 _`=,**1_= 3=5&798=4+=84:9-8*&89=&82&3.&`=&'&143*=894(08=<*7*=7*):(*)=+742=;.7,.3=1*;*18=94=&3= *=9*38.;*1>=)*51*9*)=89&9*=<.9-.3=9-*=+.789=+/=>*&78=4+=9-*=+.8-*7>=;.9-*785443`=+31/_= 3+472&9.43= +742= 9-*= ?,7>= (&9(-= 8&251.3,= 574,7&2= .,:7*= /= &3)= +742= 9-*= *&71>= ,74:5=).;*78=(43+.72=9-&9=)&.1>=1&3).3,8=+*11=):7.3,=9-.8=5*7.4)=94=&=+7&(9.43=4+=9-*.7= +472*7=1*;*18_=7*5479*)=&33:&1=(&9(-*8=<*7*=&8=-.,-=&8=-/**=9`=&12489=.*=-.,-*7=9-&3= &82&3.&8=(:77*39=?=.,:7*=-_=3=&)).9.43`=&'&143*=<*7*=(&:,-9=&9=&=82&11*7=8.?*= 1.2.9=9-&3=9-48*=4+=247*=7*(*39=>*&78`=&3)=.9=.8=574'&'1*=9-&9=*,,=574):(9.43=+742=9-*= 8:7;.;.3,=2&9:7*=&'&143*=<&8=.38:++.(.*39=94=574;.)*=&)*6:&9*=7*(7:.92*39=94=8:55479= 8:(-=-.,-=1*;*18=4+=+.8-.3,=2479&1.9>_== <4=2&/47=7**+8=<*7*=7*5479*)=<-*7*=&'&143*=<*7*=+.8-*)=94=14(&1.8*)=*=9.3(9.43_=+;*3= 43= 9-*= 7**+8= &'4:9= <-.(-= ).;*78= *=57*88*)= 9-*= 2489=(43(*73= *_,_= 9-*= 14(0= -*= 7**+8= '*9<**3= +))>8943*= 4.39= &3)= 9-*= D&7)*38`= 47= 9-*= 7**+8= 4++8-47*= 4+= 9-*= '*&(-*8= .3= 5(O*&3= &>`= 47= +&,1*= &3)= O43,= 7**+8= .3= 5&7.43= &>`= &'&143*= <*7*= 57*8*39= &1'*.9= 24891>=&8=8(&99*7*)=.3).;.):&18=&3)=9-*8*=7**+8=89.11=8:89&.3=1.2.9*)=545:1&9.438_== -*= 7*5479*)= 574):(9.;.9>= 4+= .3).;.):&1= 7**+8= ;&7.*)= ,7*&91>_= ,42*= 7**+8= -&;*= (438.89*391>=8:551.*)=,44)=(&9(-*8=8.3(*=9-*=89&79=4+=9-*=+.8-*7>_=+=&251*8=.3(1:)*=9-*= 4++8-47*=7**+8=.3=14(0=+-`=9-*=D4&9=.118=.3=14(0=,-=&3)=O43,=,*>24:7=4.39=&9=9-*= 3479-*73=*3)=4+=14(0=,2_=>5.(&11>=9-*8*=7**+8=+*&9:7*=(4251*==(7>59.(=-&'.9&9=<-.(-= 2&0*8=&'&143*=).++.(:19=94=+.3)`=574;.).3,=5749*(9.43=+47=&):198=+742=+.8-.3,_== >9-*78=7**+8= 8:551.*)= ,44)= (&9(-*8= +47= 2&3>= >*&78`=':9= 9-*3= )*(1.3*)`= &3)= 34<= &7*= +.8-*)=431>=&+9*7=5*7.4)8=4+=7*(4;*7>`=<-.(-=2&>=9&0*=2&3>=>*&78_=+=&251*8=.3(1:)*= 9-*=+7.3,*=7**+8=4+=9-*=9+397*(&89*&:==?-&33*1=14(0=+.`=+&,1*=7**+=&3)=5&7.43=&>= 14(0=,-`=5&798=4+=9-*=,7&3.9*=(4&891.3*=&9=.(-*34=14(0=,2=&3)=9-*=(4&89='*9<**3= .3&143,= &>= &3)= 9-*= D&7)*38= 14(0= -*_= ,42*= 4+= 9-*8*= 7**+8= &7*= .841&9*)= '>= 143,= 897*9(-*8= 4+= '*&(-`= 47= &7*= 4++8-47*`= 47= 5&79.(:1&71>= .3= 9-*= ,7&3.9*= &7*&8`= 2&>= 1&(0= 8:++.(.*39= 8:.9&'1*= (7>59.(= -&'.9&9_= 9= 9-*= 82&11*7= 8.?*= 1.2.98= 45*7&9.3,= :39.1= 7*(*391>`= 2&3>= &'&143*= <4:1)= -&;*= '**3= 9&0*3= '*+47*= 9-*>= '*(&2*= 8*=:&11>= 2&9:7*`= ,7*&91>= 7*):(.3,=9-*=8.?*=4+=9-*=85&<3.3,=894(0=<&8-`=+33,b=&7'&9- =*9=&1 _`=,**+_=-*=.841&9*)= 3&9:7*= 4+= 842*= 4+= 9-*8*= 7**+8= &3)= 9>5.(&11>= 1.2.9*)= ).85*78&1= 4+= 9-*= &'&143*= 1&7;&*=

.2 = 74/*(9=34_=,**.2*+- = =

7.3(* =*9=&1 _`=+321b=5(,-&3* =*9=&1 _`=+322=2*&39=9-&9=2.3.2&1=7*(7:.92*39=<&8=1.0*1>= +4114<.3,= *=9*38.;*= 7*):(9.43= 4+= 894(08= '>= +.8-.3,`= &3)= &3>= 8:'8*6:*39= 7*(4;*7>= <4:1)='*=814<_= -*= 9<4= '14(08= <.9-= 9-*= ,7*&9*89= )*(1.3*= .3= 574):(9.;.9>= '14(08= ,2= &3)= -*= &7*= ,*414,.(&11>= ).89.3(9= +742= 9-*= 49-*7= 9-7**_= 14(08= ,2= &3)= -*= &7*= 43= 9-*= ,7&3.9*= '*19= <-.(-=(4;*78=2:(-=4+=9-*=3479-*73=-&1+=4+=9-*=*&89=(4&89`=<-*7*&8=9-*=49-*7=9-7**=&7*= 43= )41*7.9*= 478>9- = *9= &1 _`= ,**/'b= 478>9- = *9= &1 _`= ,**/&_= -*= 897:(9:7*= 4+= 9-*= ,7&3.9*= '*)8`= 5&79.(:1&71>= 43= 9-*= (4&89= 8:774:3).3,= .(-*34= &3)= .3&143,= &>`= .8= 897.0.3,`= 9>5.(&11>=(4257.8.3,=2&88.;*=81&'8=&3)='4:1)*78_=-*=8.?*=4+=9-*='4:1)*78=.8=9>5.(&11>= 2:(-=,7*&9*7=9-&3=9-48*=+742=9-*=)41*7.9*=(4&89`=&3)=9-*=(7>59.(=-&'.9&9=&55*&78=94='*= 247*= 45*3= &3)= 1*88= &'1*= 94= (43(*&1= &'&143*_= -.8= 2&>= '*= &= 1.2.9.3,= +&(947= .3= 9-*= 7*8.1.*3(*=4+=9-*=,7&3.9*=7**+8=94=<.9-89&3)=-*&;>=+.8-.3,=57*88:7*_= 742=9-*=5*785*(9.;*=4+=+.8-*72*3`=7**+=574):(9.;.9>= .8= .3+1:*3(*)='>=9-*=57.(*=5&.)= +47=9-*=(&9(-`=&3)=<-*3=57.(*8=&7*=8:++.(.*391>=-.,-`=7**+8=<.9-=14<=894(0=1*;*18=2&>= '*(42*=574):(9.;*_=?43;*78*1>`=<-*3=57.(*8=&7*=14<`=894(0=1*;*18=3**)=94=7*&(-=1*;*18= <-*7*=9-*>=(&3='*=*(4342.(&11>=-&7;*89*)='*+47*=9-*>=&7*=(1&88*)= &8=574):(9.;*= ._*_= 9-*>=2&>='*=*(4342.(&11>=)*51*9*)_= +(4342.(=)*51*9.43=.8=)*9*72.3*)=247*='>=+.3&3(.&1=(438.)*7&9.438=*_,_=574+.9&'.1.9>= 9-&3='>=7*):(9.43=.3=894(0=1*;*18_=74+.9&'.1.9>=)*5*3)8=:543=9-*=1*;*1=4+=7*9:73=94=9-*= ).;*7`= <-.(-= .98*1+= .8= )*9*72.3*)= '>= &= ;&7.*9>= 4+= +&(9478= 8:(-= &8= +.3&3(.&1= (489= 4+= +.8-.3,`=9-*=5->8.(&1=).++.(:19>=4+=+.8-.3,`=9-*=57.(*=7*(*.;*)=+47=(&9(-.3,=&'&143*=&3)= 9-*= ).;*78= *=5*(9&9.438= 4+= 7*<&7)_= 9.;*78= :8:&11>= 97>= 94= 2&=.2.8*= 9-*.7= +.3&3(.&1= 7*9:738`=&3)=2489=-&;*=&=9-7*8-41)=1*;*1=4+=*=5*(9&9.43=4+=(&9(-a=.+=9-*.7=*=5*(9&9.438= 4+=(&9(-=43=&=7**+=&7*=14<`=9-*>=<.11=&99*259=94=+.3)=842*<-*7*=247*=574):(9.;*_= 4=.11:897&9*=9-*=*++*(98=4+=*(4342.(=)*51*9.43`=(4397&89=9-*=).;*78=<-4=89455*)=+.8-.3,= ;.7,.3=894(08=&9=.(-*34=.3=+30.='*(&:8*=9-*>=-&)=(&:,-9=9-*=*&8.1>=&((*88.'1*=+.8-=&3)= 9-*= 57.(*= <&8= 944= 14<= 94= <&77&39= 24;.3,= +:79-*7= &+.*1)`= <.9-= 9-*= ).;*78= +.8-.3,= )*51*9*)=894(08=&9=94;*7=.3=+31/=&9=;*7>=14<=(&9(-=7&9*8=+**=0,2)&>=':9=<-4=7*(*.;*)= +*=9.2*8=9-*='*&(-=57.(*=4+=9-*=*&71>=.(-*34=).;*78_=-*8*=&7*=*=97*2*=*=&251*8`=&3)= 9-*=89&9*=4+=9-*=(:77*39=+.8-*7>=1.*8= 842*<-*7*='*9<**3=9-*2b=-4<*;*7`=9-*=54.39=.8= (1*&7a= 9-*= *=9*39= 4+= 7**+= +.8-*)= 43= 9-*= (4&89= 34<= (4;*7*)= '>= 9-*= +&89*73= I43*= .8= )*9*72.3*)=&8=2:(-='>=*(4342.(8=&8='>='.414,>_= 9= .8= 4:98.)*= 9-*= 8(45*= 4+= 9-.8= 574/*(9= 94= 57*8*39= &= )*9&.1*)= 7*;.*<= 4+= 9-*= *(4342.(= &85*(98=4+=(&9(-.3,=&'&143*='49-=5&89=&3)=57*8*39`=':9=9-*=(:77*39=).;*78=<-4=<470=43= (4397&(98= 89&9*= 9-&9= 9-*= 1*;*1= 4+= 5&>2*398= 9-*>= 7*(*.;*= +47= (&9(-.3,= &'&143*= 1.2.9*)= 9-*2=94=-.,-*78>.*1).3,=8*(9.438=4+=7**+_=-*>='*1.*;*)=9-&9=9-*=+.3&3(.&1=7*<&7)8=94= 9-*=*&71.*7=).;*78=<-48*=7.,-9=94=9&0*=&3=:31.2.9*)=&24:39=4+=+.8-=6:49&=<&8='4:3)= 94= 9-*.7= +.8-.3,= 1.(*38*= <*7*= ,7*&9*7`= &3)= *3&'1*)= 9-*2= 94= 574+.9&'1>= +.8-= &9= 14<*7= 1*;*18=4+=&':3)&3(*_= 3=7*(*39=>*&78=9-*=7*5479*)=&33:&1=(&9(-=+742=9-*=&7*&=34<=(4;*7*)='>=9-*=+&89*73= I43*=-&8='**3=&9=9-*=14<*89=1*;*18=8.3(*=(&9(-*8=-&;*='**3=85&9.&11>=7*(47)*)=+31/`=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = .3 = =

&3)=+742=*89.2&9*8=574;.)*)='>=9-*=*&71>=,74:5=).;*78`=574'&'1>=8.3(*=+30/_=?:77*39= ).;*78=7*5479=9-&9='*(&:8*=4+=9-*=7*1&9.;*1>=14<=1*;*18=4+=+.8-.3,=2479&1.9>`=894(0=1*;*18= -&;*=.3(7*&8*)`=&3)=9-*.7=(&9(-=7&9*8=-&;*=7.8*3=(477*8543).3,1>_=-*>=-&;*=(43(*738= 9-&9=.+=&3>=+:9:7*=.3(7*&8*8=.3=?=&7*=944=1&7,*`=894(0=1*;*18=43=9-*=(:77*39=574):(9.;*= 7**+8=<.11=*;*39:&11>=+&11`=+47(.3,=9-*2=94=9-*=1*88=574):(9.;*=&3)=(:77*391>=:3+.8-*)= 7**+8`=7&.8.3,=9-*=(489=4+=+.8-.3,_=;-.1*=9-.8=<4:1)=+47(*=9-*2=94=<470=4;*7=&=,7*&9*7= &7*&=4+=7**+`=9-*>=(4:1)=431>=&++47)=94=)4=84=.+=9-*= .3(7*&8*)= (4898= <*7*= 2*9= '>= 9-*= 6:49&=4<3*78_=,.2.1&7=8.9:&9.438=-&;*=&7.8*3=+4114<.3,=9-*=.251*2*39&9.43=4+=?43*8=.3= 9-*=&'&143*=+.8-*7>`=<-.(-=-&8=+47(*)=).;*78=94=<470=.3=7*249*=&7*&8=9-&9=-&)=349='**3= +.8-*)= +47= 2&3>= >*&78_= ;-.1*= .3.9.&11>= 842*= 4+= 9-*8*= 7**+8= -&)= -.,-= 894(0= 1*;*18`= .39*38.;*= +.8-.3,= -&8= '**3= 2*9= '>= +&11.3,= (&9(-= 7&9*8= &3)= 6:49&= 4<3*78= -&;*= '**3= (425*11*)=94=4++*7=-.,-*7=7&9*8=94=).;*78=94=.3):(*=9-*2=94=+.8-=9-*7*_= O488=4+=7**+=(&:8*)='>=7*):(*)=*++479=.3=)**5=<&9*7=2&>='*=4+=1*88=(438*6:*3(*=9-&3= .3).(&9*)='>=9-*=7*;*78*=8.9:&9.43=&9=E.3,=81&3)=.,:7*=2_=3=9-*=*&89=&3)=84:9-=*&89`= ).;*78=+742=&11=,74:58='*1.*;*)=9-&9=9-*=8-&114<8=<*7*=247*=574):(9.;*=9-&3=9-*=)**5= <&9*7=-&'.9&9`=&3)=&19-4:,-=9-*=)**5=<&9*7=7**+8=2&>=-&;*=.3.9.&11>=8:55479*)=,44)= (&9(-*8`= 9-*>= <*7*= ;*7>= 814<= 94= 7*(4;*7_= ,*;*7&1= *&71>= ,74:5= ).;*78= *89.2&9*)= 9-&9= 431>=/:+*=4+=9-*.7=*&89*73=(&9(-=<&8=9&0*3=+742=<&9*7=)**5*7=9-&3=.*=+**9=5+,=2`= &3)=9-.8=4((:77*)=24891>=.3=9-*=247*=*=548*)=(4&89=4+=9-*=84:9-_= 3=8:22&7>`=9-*=*=9*39=4+=+.8-*)=7**+=&7*&=.8=)>3&2.(`=&3)=.8=&++*(9*)='>=&=(4251*== 7*1&9.438-.5='*9<**3=&'&143*=&':3)&3(*`=9-*=&24:39=4+=(&9(-=94='*=9&0*3=?=&3)= 9-*= +.3&3(.&1= 7*<&7)8= 94= 9-*= ).;*78_= ;-.1*= 9-*= &':3)&3(*= 4+= &'&143*= 43= .3).;.):&1= 7**+8=-&8=3*;*7='**3=).7*(91>=243.947*)`=.9=&55*&78=9-&9=.3=9-*=84:9-=&3)=84:9-8*&89`= 545:1&9.438=8**2='*99*7=&'1*=94=7*(4;*7=+4114<.3,=+.8-.3,=9-&3=.3=9-*=3479-8*&89`=&3)= (438*6:*391>= 9-*= *=9*39= 4+= &7*&= 4+= +.8-*)= 7**+= +1:(9:&9*8_= 3= 9-*= 3479-8*&89`= <-*7*= 545:1&9.438=&55*&7=94='*=1*88=7*8.1.*39=94=+.8-.3,`=1&7,*=&7*&8=4+=+472*71>=574):(9.;*= 7**+8= <*7*= .)*39.+.*)= <-.(-= -&;*= '**3= 7*):(*)= 94= '*(42.3,= &9= '*89= 2&7,.3&11>= 574):(9.;*`=&3)=9-*=1488=4+=574):(9.;*=7**+=&7*&=.8=2:(-=,7*&9*7=&3)=1*88=)>3&2.(_= -*= *++*(9= 4+= .39*78&33:&1= (-&3,*8= 94= 574):(9.;*= 7**+= &7*&= 43= 9-*= 894(0= &88*882*39= 574(*88=3**)8=94='*=(438.)*7*)_=+=9-*=&7*&=4+=3438574):(.3,=7**+=(439.3:*8=94=.3(7*&8*= '*(&:8*= 4+= *.9-*7= '.414,.(&1= 47= *(4342.(= )*51*9.43`= 9-*3= :31*88= 9-*= 4;*7&11= (&9(-= .8= 7*):(*)`=894(08=43=7*2&.3.3,=7**+8=<.11='*=/*45&7).8*)='>=.3(7*&8.3,=1*;*18=4+=+.8-.3,= 2479&1.9>= E**8.3,= &3)= &0*7`= +332_= 4<*;*7`= 9-*= (43;*78*= &184= &551.*8`= &3)= '49-= *&71>= &3)= 2.))1*= ,74:5= ).;*78= 8&.)= 9-&9= '*(&:8*= 9-*=+&89*73=I43*=?=.8=14<=&3)= (:77*39= ).;*78= &7*= (439*39= 94= +.8-= 43= *89&'1.8-*)= 574):(9.;*= 7**+8`= 9-*7*= .8= 1489= 574):(9.43= +742= :3+.8-*)= 7**+8= <-.(-= -&;*= *.9-*7= '**3= +47,499*3= 47= <-*7*= 545:1&9.438=-&;*=7*(4;*7*)=:34'8*7;*)_=E34<1*),*=4+=(-&3,*8=.3=+.8-*)=7**+=&3)=.98= &++*(9= 43= 7*2&.3.3,= 545:1&9.438= <4:1)= 9-*7*+47*= -*15= 94= 2&3&,*= 9-*= +.8-*7>= 8:89&.3&'1>=&3)=574):(9.;*1>_= ,94(0= &88*882*39= 4+= 9-*= &82&3.&3= &'&143*= +.8-*7>= .8= 24891>= )*5*3)*39= 43= +.8-*7>= )*7.;*)= .3+472&9.43_= 9= -&8= &1<&>8= '**3= &88:2*)= 9-&9= *++479= +14<8= 94= 9-*= 2489= 574):(9.;*= 7**+8= ._*_= +.8-*72*3= &99*259= 94= 2&=.2.8*= 9-*.7= 7*9:738`= &3)= 9-&9=

/* = 74/*(9=34_=,**.2*+- = =

243.947.3,=(-&3,*8=.3=(&9(-=&3)=4;*7=8-479=5*7.4)8=4+=9.2*=*++479='*9<**3=7*5479.3,= '14(08=8-4:1)='*=.3).(&9.;*=4+=,748888(&1*=(-&3,*8=.3=7**+=574):(9.43_=83+479:3&9*1>`= 9-*= 7*1&9.438-.5= '*9<**3= ?= &3)= 9-*= 8.?*= 4+= 9-*= 894(0= .8= 7&7*1>= 459.2.8*)= 94= 9-*= *=9*39=9-&9=.9=*3+47(*8=57*).(9&'1*=+14<8=.3=*++479=&3)=(438*6:*391>=9-*=)*(.8.43=&'4:9= <-*7*= 94= +.8-= .8= 4+9*3= '&8*)= 43= 247*= (4251*== 7*&8438= 9-&3= &':3)&3(*_= -.8= 2*&38= 9-&9=).;*78=(&3=)*51*9*=8:((*88.;*=7**+8=<.9-.3=&=7*5479.3,='14(0=<.9-4:9=3*(*88&7.1>= 97.,,*7.3,= (-&3,*8= .3= &33:&1= (&9(-= .3).(&9.;*= 4+= 894(0= (411&58*_= 831*88= &= 2*&38= 4+= )*9*(9.3,= 82&1188(&1*= (-&3,*8= .3= *++479= *_,_= 9-*= (:77*39= 79?= +:3)*)= D,= ).;*7= 97&(0.3,=574/*(9=47=+.8-*7>8.3)*5*3)*39=243.947.3,=4+=&'&143*=&':3)&3(*=.8=:8*)`=9-*= (:77*39= 894(0= &88*882*39= 574(*88= <.11= (439.3:*= 94= +&.1= 94= )*9*(9= 894(0= )*(1.3*8= &3)= (-&3,*8=.3=9-*=&7*&=4+=+.8-*)=7**+_= 9(48>89*2=(-&3,*8= =<.)*=7&3,*=4+=*(48>89*2=(-&3,*8=<*7*=4'8*7;*)='>=).;*78`=&19-4:,-=9-*>=).)=349= 3*(*88&7.1>=&884(.&9*=9-*2=<.9-=(-&3,*8=.3=&'&143*=&':3)&3(*_=7.47=94=9-.8=574/*(9`=.9= -&)= '**3= 349*)= 9-&9= ).;*78= (&9(-= 2489= 4+= 9-*.7= &'&143*= 43= ??8*3(7:89*)= 7**+= 5.3025:751*= 74(0`= &3)= 1*&89= &'&143*= 43= 7**+= *3(7:89*)= <.9-= 8543,*8`= &8(.).&38= 47= 49-*7= *3(7:89.3,= '.49&= .3(1:).3,= )*38*= :3)*78947>= &3)= (&345>= &1,&*= '74<3= 74(0_= ,42*= ).;*78= -&)= 8&.)= 9-&9= +4114<.3,= 5&79.(:1&71>= .39*38.;*= +.8-.3,= 8:(-= &8= 4((:77*)= ):7.3,=9-*=&88=,97&.9=5:18*=+.8-*7.*8=&3)=.3=-*&;.1>=+.8-*)=&7*&8=8:774:3).3,=.(-*34= &3)=9-*=D&7)*38=<-.(-=1*)=94=*=9*38.;*=)*51*9.43`=9-*=-&'.9&9=(-&3,*)_=-*>='*1.*;*)= 9-&9=9-*=(4;*7&,*=4+=??=43=9-*=7**+=<-*7*=9-*>=:8*)=94=(&9(-=&'&143*=-&)='*(42*= 1*88= *=9*38.;*`= 9-&9= 9-*= 5.30= 74(0= -&)= (-&3,*)= 94= '74<3= 74(0= &3)= 9-&9= 9-*7*= <*7*= 2:(-= 1*88= &'&143*= 43= 9-*= 7**+_= -*= 5488.'1*= (438*6:*3(*8= 4+= 9-.8= -&'.9&9= (-&3,*= .3(1:)*=7*):(*)=7**+=&7*&=+47=8*991*2*39=4+=;*1.,*78`=7*):(*)=*,,=574):(9.43=+742=9-*= )*51*9*)= 545:1&9.438= &3)= (438*6:*39= )*89&'.1.8&9.43= 4+= 9-*= 57.2&7>= &'&143*= -&'.9&9= 1*&).3,= 94= +:79-*7= 545:1&9.43= )*(1.3*8_= -.8= -&'.9&9=(-&3,*=2&>= '*=9-*=7*&843=<->= &'&143*=545:1&9.438=43=842*=4+=9-*=)*51*9*)=7**+8=.3='14(08=,2=&3)=-*=-&;*=+&.1*)=94= 7*(4;*7=94=+472*7=1*;*18`=)*85.9*=14<=1*;*18=4+=(&9(-='*.3,=9&0*3_= <49=&11=).;*78=349.(*)=(-&3,*8=94=9-*=-&'.9&9=.3=<-.(-=9-*>=<470*)_=5489=&,7**)=9-&9= &1,&1=,74<9-=.3(7*&8*)=):7.3,=9-*=<&72*7=2439-8`=':9='>=&3)=1&7,*`=9-*>=<*7*=1*88= .39*7*89*)= .3= 9-*.7= 8:774:3).3,8= &3)= 247*= (43(*73*)= <.9-= (&9(-.3,= &'&143*_= >+= 9-*= (-&3,*8= 9-&9= <*7*= 349.(*)`= 2489= <*7*= 97&38.*39= &3)= .3(438*6:*39.&1`= 8:(-= &8= +1:(9:&9.438=.3=&1,&1=,74<9-=47=9-*=(438*6:*3(*8=4+=89472=)&2&,*_= >31>= &= +*<= ).;*78= 349.(*)= 8.,3.+.(&39= -&'.9&9= (-&3,*8_= -7**= ).;*78= 349.(*)= (-&3,*8= 9-&9= 9-*>= &884(.&9*)= <.9-= ,748888(&1*= )*51*9.43= 4+= &'&143*_= 3= &11= 9-7**= (&8*8`= 9-*= (-&3,*)= -&'.9&9= 89&9*8= &3)= 7*):(9.43= .3= &'&143*= 3:2'*78= -&;*= 5*78.89*)= +47= 2&3>= >*&78_= -*>= -&)= &88:2*)= 9-&9= 9-*= 7*24;&1= 4+= 9-*= &'&143*= <&8= 7*85438.'1*= +47= 9-*= -&'.9&9= (-&3,*`= &19-4:,-= 9-*>= (43(*)*)= 9-&9= 49-*7= +&(9478`= 8:(-= &8= 8&3)= 8(4:7= 47= )&2&,*=(&:8*)='>=894728=(4:1)=&184=-&;*=(4397.':9*)=94=9-*=(-&3,*8_= -7**= ).++*7*39= ).;*78= 8540*= &'4:9= 7**+8= .3= 49-*7= &7*&8`= <-*7*= &'&143*= 545:1&9.438= -&)= &184= '**3= ,74881>= )*51*9*)_= -*8*= 51&(*8= .3(1:)*)= 7**+8= &9= .(-*34`= .3= 14(0= ,/=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = /+ = =

'*9<**3=,<&38*&=&3)=>7+47)=&3)=43=&=82&11=&7*&=4+=7**+=43=9-*=<*89=(4&89=84:9-=4+= ?&5*=,47*11=14(0=3_=3=(4397&89=94=9-*=7**+8=<-*7*=-&'.9&9=(-&3,*8=-&)=4((:77*)`=9-*>= 8&.)= 9-&9= 9-*8*= 7**+8= 7*2&.3*)= 57.89.3*= &'&143*= -&'.9&9`= <.9-= 8:'89&39.&1= &7*&8= 4+= ??8(4;*7*)=74(0_= 3=.25479&39=)*9&.1=9-&9=*2*7,*)=+742=9-*=9&108=<&8=9-&9=9-*8*=8.==).;*78=<*7*=&<&7*= 9-&9= 9-*= *=9*39= &3)= 8.?*= 4+= 9-*= &'&143*= 545:1&9.438= 9-&9= 9-*>= <*7*= +.8-.3,= -&)='**3= 8*;*7*1>= ).2.3.8-*)`= &3)= 9-*>= -&)= &= ,44)= 034<1*),*= 4+= 9-*= &'&143*= -&'.9&9= '*+47*= &3)=&+9*7=9-*=7*24;&1=4+=&'&143*_=-.8=(4397&898=<.9-=2&3>=4+=9-*=49-*78`=<-4=43(*= &<&7*=9-&9=)*51*9.43=-&)=9&0*3=51&(*`=1489=.39*7*89=.3=&3=&7*&=43(*=9-*>=03*<=.9=<&8= 349=<479-=+.8-.3,`=&3)=(438*6:*391>=).)=349=4'8*7;*=-&'.9&9=(-&3,*_= -*=431>=7*&843&'1*=(43(1:8.43=9-&9=(&3='*=)*;*145*)=+742=9-*8*=4'8*7;&9.438=.8=9-&9= &'&143*=-&'.9&9=2&>=:3)*7,4=*=97*2*=(-&3,*8`=&3)=9-*7*=2&>='*=2:19.51*=(&:8*8`=43*= 4+=<-.(-=.8=9-*=)*51*9.43=4+=&'&143*_=

/, = 74/*(9=34_=,**.2*+- = =

,_,= ,.414,.(&1=&3)=*3;.7432*39&1=(477*1&9*8=4+=7**+8= <.9-=(4397&89.3,=&'&143*=)*38.9.*8= = 73974):(9.43== .8-.3,= .8= 9-*= 2489= <.)*857*&)= -:2&3= *=514.9&9.;*= &(9.;.9>= .3= 9-*= 2&7.3*= *3;.7432*39=B*33.3,8=]=E&.8*7`=+332=&3)=.9=.8=34<=<*11=7*(4,3.8*)=9-&9=*(414,.(&11>= 8:89&.3&'1*=)*;*1452*39=4+=2&7.3*=7*84:7(*8=7*6:.7*8=&3=*(48>89*28'&8*)=&5574&(-= 94= 51&33.3,= &3)= 2&3&,*2*39= ):*= 94= 9-*= *=9*38.;*= .39*7&(9.438= 9-&9= 4((:7= '*9<**3= 9&7,*9=85*(.*8=&3)=49-*7=47,&3.828=B*33.3,8=]=E&.8*7=+332_=88*88.3,=9-*=*(414,.(&1= 741*= 4+= &= +.8-*)= 85*(.*8= 7*57*8*398= &= +:3)&2*39&1= 89&,*= .3= &3= *(48>89*28'&8*)= 2&3&,*2*39=&5574&(-_== = 1&(01.5= &'&143*=  &1.49.8= 7:'7& = .8= 9-*= )42.3&39= -*7'.;47*= .3= 8:'9.)&1= -&'.9&98= 43= *=548*)= (4&891.3*8= 4+= &82&3.&= &3)= 9-*= +4(:8= 4+= 9-*= <471)8= 1&7,*89= &'&143*= <.1)= +.8-*7>=1,/**=9433*8=5*7=&33:2_=;-.1*=349=(43+.72*)`=.9=.8=<.)*1>=-*1)=9-&9=&'&143*= &(9.;.9>=(4397.':9*8=94=9-*=)42.3&3(*=4+=(7:8948*=(47&11.3*=&1,&*=??=.3=:3)*78947*>= (422:3.9.*8= ?_= 5:3)>`= 5*78_= (422__= 3*()49&1= *;.)*3(*= +742= 842*= (422*7(.&1= &'&143*=).;*78=.3).(&9*8=9-&9=&=8-.+9=+742=??=)42.3&3(*=84=(&11*)= 5.30=74(0=94=&= (422:3.9>= )42.3&9*)= '>= 8*88.1*= .3;*79*'7&9*8= &3)= +41.48*= &1,&*=  '74<3= 74(0= .8= &884(.&9*)= <.9-= )*51*9.43= 4+= &'&143*= +742= 7**+8= ?-&59*7= ,_+_= >3= 842*= &82&3.&3= 7**+8=9-*7*=.8=*;.)*3(*=9-&9=&'&143*=3:2'*78=-&;*='**3=-*&;.1>=)*51*9*)`=<.9-=&33:&1= (&9(-*8=7*57*8*39.3,=431>=.=4+=9-*=143,89*72=&;*7&,*=(&9(-=&7'&9-=*9=&1_=,**._=+= &'&143*= 51&>= &= 0*>= 741*= .3= 9-*= 2&.39*3&3(*= 4+= ??`= 9-*3= 8:'89&39.&1= 7*):(9.438= .3= '.42&88=&3)=3:2'*78=4+=&'&143*=9-74:,-=+.8-.3,=2&>=1*&)=94=(-&3,*8=.3=*(48>89*2= 897:(9:7*= &3)= +:3(9.43_= )).9.43&1= .25*9:8= +47= :3)*789&3).3,= &'&143*:*(48>89*2= .39*7&(9.438=.8=9-*=+&(9=9-&9=9-*=2&/47.9>=4+=&'&143*= &1.49.8= 855 _=+.8-*7.*8=&74:3)=9-*= <471)= -&;*= (411&58*)= 47= &7*= .3= 8*7.4:8= )*(1.3*= ,-*5-*7)= *9= &1_= ,***`= 7&.8.3,= 9-*= 5488.'.1.9>=9-&9=&19*7*)=*(48>89*2=+:3(9.43=2&>=-&;*=4((:77*)=):*=94=7*24;&1=4+=9-.8= 0*>=-*7'.;47*_== = 7*):(*)=(4;*7=4+=??=-&8=.251.(&9.438='49-=+47=3&9:7&1=574(*88*8=&3)=+47=9-*=143,8 9*72= *=.89*3(*= 4+= &'&143*= 545:1&9.438`= &8= 49-*7= 1.+*= -.8947>= 89&,*8= 4+= &'&143*= &3)= .3;*79*'7&9*8= &184= 7*1>= 8.,3.+.(&391>= 43= ??_= 47= *=&251*`= 9-*= 7*(*39= 7*(7:.92*39= +&.1:7*=4+='1&(0=&'&143*=.3=?&1.+473.&=-&8='**3=1.30*)=<.9-=(-&3,*8=.3=??=&':3)&3(*= +4114<.3,= 2&8882479&1.9>= 4+= '1&(0= &'&143*= 545:1&9.438= 5.3*7= *9= &1_= ,**0_= O&7;&1= &'&143*=&7*=034<3=94=57*+*7*39.&11>=2*9&2475-48*=&3)=8:'8*6:*391>=+**)=43=??=47= &884(.&9*)= '&(9*7.&= &3)= ).&9428= :39.1= 9-*>= 7*&(-= &5574=.2&9*1>= +/= 22= .3= 1*3,9-= ,-*5-*7)=+31-'b=,&.94=+32+b=,-*5-*7)=]=:73*7=+32/b=&77=*9=&1_=+330b=9&:2*=*9=&1_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = /- = =

+333_=,-*11=5.,2*39&9.43=5.30=(414:7&9.43=&884(.&9*)=<.9-=9-.8=+**).3,=&(9.;.9>=&184= &.)8=(&24:+1&,*=&3)=574;.)*8=5749*(9.43=+742=57*)&9478=):7.3,=9-.8=(7.9.(&1=*&71>=1.+*= -.8947>=5-&8*_== = ;-.1*= &3= *=5*7.2*39&1= &5574&(-= .8= 7*6:.7*)= 94= :19.2&9*1>= )*9*72.3*= 9-*= *++*(9= 4+= &'&143*= 7*24;&1= 43= 9-*= 7**+= *(48>89*2`= &= 3*(*88&7>= 57*7*6:.8.9*= 94= *=5*7.2*39&1= 2&3.5:1&9.438= .8= 9-*= :8*= 4+= &= (477*1&9.;*= 89:).*8= 94= .)*39.+>= 9&=&= 9-&9= (4:1)= '*= 549*39.&11>=.3+1:*3(*)='>=&'&143*=&':3)&3(*=B*30.38=,**._=-*=57.2&7>=4'/*(9.;*=4+= 9-.8= 89:)>= <&8= 94= *=&2.3*= '*39-.(= (422:3.9.*8= 43= 7**+8= <.9-= (4397&89.3,= +.8-.3,= -.8947.*8`=(425&7.3,='.414,.(&1=&3)=*3;.7432*39&1=(477*1&9*8=4+=7**+8=9-&9=(439.3:*=94= 8:89&.3=(422*7(.&1=&'&143*=+.8-.3,=<.9-=7**+8=9-&9=34=143,*7=8:55479=&=;.&'1*=+.8-*7>_= -*= 47.,.3&1= 89:)>= 4'/*(9.;*= 7*6:.7*)= 24).+.(&9.43= '*(&:8*= 4+= 9-*= (4251*=.9.*8= &884(.&9*)= <.9-= &88.,3.3,= 574):(9.;.9>= 89&9:8= 94= .3).;.):&1= 7**+8= 8**= ?-&59*7= ,_+_= ?438*6:*391>`= 9-*= 57.2&7>= 4'/*(9.;*= <&8= &)/:89*)`= +4(:8.3,= 43= '.414,.(&1= &3)= *3;.7432*39&1= (477*1&9*8= 4+= 7**+8= <.9-= (4397&89.3,= &'&143*= )*38.9.*8`= 7*+1*(9.3,= 9-*= 3**)=94=6:&39.+>=&'&143*=&':3)&3(*=43=8:7;*>=7**+8_== =
*9-4)8= 9:)>=8.9*8= ,:7;*>8= +4(:8*)= 43= +4:7= &7*&8= 4+= 9-*= &82&3.&3= +&89*73= I43*= +.8-*7>= .3(1:).3,= ,9= *1*38='14(08=-*`=-+`=.(-*34='14(08=,2`=,3=&3)=9:3&11*>='14(08=,-`=,.=43=9-*=*&89= (4&89=&3)=9-*= (9&*438='14(08=+-`=+.=7*,.43=43=9-*=84:9-8*&89=(4&89_=-*=*&89=(4&89= 7*,.438=<*7*=(-48*3='*(&:8*=.9=.8=<*11=)4(:2*39*)=9-&9=3:2*74:8=7**+8=.3=9-*=7*,.43= -&;*= *=5*7.*3(*)= 8.,3.+.(&39= )*(1.3*8= .3= &'&143*= &':3)&3(*`= 7*+1*(9*)= '>= )*(1.3.3,= (&9(-=&3)=*++479=.3=7*(*39=>*&78=*_,_=.,:7*=+*_=3=(4397&89=9-*=(9&*438=&7*&=-&8=2&3>= 7**+8=9-&9=-&;*=7*2&.3*)=574):(9.;*=9-74:,-4:9=9-*=-.8947>=4+=9-*=+.8-*7>=.,:7*=+*_= -*= +4(:8= 4+= 9-*= 89:)>= <&8= :3)*78947*>= (422:3.9.*8= .3=9-*=0:2= 2=)*59-=7&3,*=43= *=548*)= (4&891.3*8`= 8.3(*= 9-.8= .8= 9>5.(&11>= <-*7*= 2489= &'&143*= +.8-.3,= &(9.;.9>= 9&0*8= 51&(*_=-*=.3+1:*3(*=4+=)*59-=43=&'&143*=&':3)&3(*=&3)='*39-.(=(422:3.9>=897:(9:7*= <&8=.3;*89.,&9*)=+47=9-*=9:3&11*>=7*,.43`=<-*7*=&=8-&114<*7=)*59-=7&3,*=,:-=2=<&8= &184=.3(1:)*)=&9=&=7*897.(9*)=3:2'*7=4+=8.9*8_= =

/. = 74/*(9=34_=,**.2*+- = =

700 St Helens 16000 600 12000 500 400 8000 300

200 4000 100 0 0

700 16000 Bicheno 600 12000 500 400 8000 ) 300 s e E n 200 4000 f n f o o

t 100 r ( t ( h 0 0 h c t o a 700 16000 u r C

Dunalley s

600 ) 12000 500 400 8000 300

200 4000 100 0 0

700 16000 Actaeons 600 12000 500 400 8000 300

200 4000 100 0 0 76 78 80 82 84 86 88 90 92 94 96 98 00 02 04 06 = = *.,:7*=+*= +425&7.843=4+= &1.49.8=7:'7&= (&9(-= =&3)=*++479= =+47=9-*=9=1*1*38=,14(08=-*`= -+`= ,.(-*34=,14(08= ,2`=,3`= -:3&11*>=,14(08= ,-`= ,.= &3)= %(9&*438=,14(08= +-`= +.= 7*,.438_= 49*39.&1= 8:7;*>= 7**+8= .3= *&(-= 7*,.43= <*7*= 8*1*(9*)= '&8*)= 43= &3*()49&1= *;.)*3(*`= .3+472&9.43= ,&.3*)= 9-74:,-= ).;*7= .39*7;.*<8= ,*(9.43= ,_+= &3)= 034<1*),*= 4+= *=5*7.*3(*)= &'&143*= 7*8*&7(-= 8(.*39.898= &9= 9-*= 83.;*78.9>= 4+= &82&3.&_= 7**+8= <*7*= (&9*,47.8*)=&8= +&.1*)=.+=9-*>=<*7*=+472*71>=574):(9.;*=':9=34<=(438.)*7*)=)*51*9*)= <.9-= 7*85*(9= 94= &'&143*= &3)= 574):(9.;*= .+= 9-*>= <*7*= (438.)*7*)= 94= -&;*= '**3= 574):(9.;*=8.3(*=9-*=.3(*59.43=4+=9-*=+.8-*7>=&3)=(:77*391>=7*2&.3=574):(9.;*_=;-*7*= 5488.'1*`= 2&7.3*= 5749*(9*)= &7*&8= <*7*= &184= .3(1:)*)= .3= 9-*= 8:7;*>_= 9= <&8= 47.,.3&11>=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = // = =

&39.(.5&9*)= 9-&9= &9= 1*&89= +*= 7**+8= <4:1)= '*= 8&251*)= .3= *&(-= 7*,.43`= .3(1:).3,= *6:&1= 3:2'*78=4+= 574):(9.;*=&3)= +&.1*)=7**+8_=-*=14(&9.43=4+=8:7;*>=8.9*8=&7*=8-4<3=.3= .,:7*=++_= = = 574'1*2= <.9-= 9-*= 47.,.3&1= 8:7;*>= )*8.,3= <&8= 9-&9= +47= 9-*= *&89= (4&89= 7*,.438= ,9= *1*38`= .(-*34`= 9:3&11*>= 9-*= 3:2'*7= 4+= 574):(9.;*= 7**+8= &;&.1&'1*= <&8= 8*;*7*1>= 1.2.9*)`='*(&:8*= 2489= 7**+8= .3=9-*=&7*&=&7*=34=143,*7=(438.)*7*)=574):(9.;*_=>3=9-*= 49-*7=-&3)`=&=82&11=3:2'*7=4+= +&.1*)=7**+8=<*7*=&;&.1&'1*=.3=9-*=(9&*438=7*,.43_=9:*= 94= 9-*8*= 7*897.(9.438`= *6:&1= 3:2'*78= 4+= +&.1*)= &3)= 574):(9.;*= 8.9*8= (4:1)= 349= '*= 8&251*)=&3)=9-*=)&9&=(4:1)=349='*=&3&1>8*)=:8.3,=&=(43;*39.43&1=479-4,43&1=)*8.,3_= 8= &= (438*6:*3(*`= &3= &19*73&9.;*= 7*,7*88.438'&8*)= &5574&(-= <&8= .251*2*39*)`= 84= 7**+8=<.9-=(4397&89.3,=&'&143*=)*38.9.*8=(4:1)='*=(425&7*)_=-.8=&5574&(-=<&8=&184= 247*= &557457.&9*='*(&:8*= 9-*7*= <*7*= 842*9.2*8= ).8(7*5&3(.*8='*9<**3= ).;*78= &8= 94= 9-*= 574):(9.;.9>= 89&9:8= 4+= 7**+8= 8**= ,*(9.43= ,_+_= :79-*7247*`= 7**+= 89&9:8= <&8= 349= &1<&>8=&=7*1.&'1*=.3).(&947=4+=&'&143*=&':3)&3(*_= = :7;*>=57494(41= += .414,.(&1=(477*1&9*8=4+=7**+8=<.9-=(4397&89.3,=&'&143*=)*38.9.*8= 9=*&(-=8:7;*>=8.9*=&= +**=2=97&38*(9=<&8=)*514>*)=+742= 9-*= '4&9= &143,= 9-*= 0:2= 2= )*59-= (4394:7_= .;*= ,*= 2 ,= 6:&)7&98= <*7*= 548.9.43*)= &9= ,*= 2= .39*7;&18= &143,= 9-*= 97&38*(9= &3)= .3= *&(-= 6:&)7&9= 9-*= 3:2'*7= 4+= &'&143*= &3)= 49-*7= ,7&?*78= *_,_= 8*&= :7(-.38=<&8=7*(47)*)_=49&1=&'&143*=&':3)&3(*=<&8=851.9=.394=9<4=8*5&7&9*=(&9*,47.*8= 4+= (7>59.(= &3)= *2*7,*39= '&8*)= :543= 9-*= 14(&9.43= 4+= .3).;.):&1= &3.2&18_= ?7>59.(= &'&143*=<*7*=)*+.3*)=&8=9-48*=-.))*3=.3=(7&(08=&3)=(7*;.(*8`=<-.1*=*2*7,*39=&'&143*= 4((:5.*)=*=548*)=7**+=8:7+&(*8_=':3)&3(*=4+=(&345>8+472.3,=&1,&*=.3=*&(-=6:&)7&9= <&8=&184=*89.2&9*)='>=(1&88.+>.3,=(4;*7=4+=).++*7*39=85*(.*8=&((47).3,=94=9-*=+4114<.3,= (&9*,47.*8a=+=-=*:+*b=,=-=++:-*b=-=-=-+:/*b=.=-=/+:1/b=/=-=10:+**_= = ':3)&3(*=4+=:3)*78947*>=47,&3.828=.3(1:).3,=&1,&*=&3)=8*88.1*=.3;*79*'7&9*8=<&8= &88*88*)=.3=9*728=4+=5*7(*39&,*=(4;*7_=*7(*39&,*=(4;*7=<&8=*89.2&9*)=<.9-=&=*_,/=2 ,= 8:'86:&)7&9= :8.3,= &= 54.39= .39*7(*59= 2*9-4)_= -*= 8:'86:&)7&9= <&8= ).;.)*)= <.9-= &= ,7.)= 4+= .3= *;*31>= 85&(*)= .39*78*(9.438= &3)= <&8= 1&.)= +1&9= 43= 9-*= 7**+= ):7.3,= &1,&1= &88*882*39_=1,&*=4((:77.3,=:3)*7=*&(-=.39*7(*59=&3)=43*=(473*7=4+=9-*=8:'86:&)7&9= <*7*= 7*(47)*)`= 94= ,.;*= &= 949&1= 4+= /*= .39*78*(9.438= 5*7= 8:'86:&)7&9_= .;*= 7&3)421>= 548.9.43*)=8:'86:&)7&98=<*7*=&88*88*)=.3=9-.8=<&>=+47=*&(-=,*=2 ,=6:&)7&9_=>7,&3.828= <*7*=.)*39.+.*) =.3=8.9:= 94=9-*=-.,-*89=9&=4342.(=7*841:9.43=5488.'1*_=47=(&345>=&1,&*`= .)*39.+.(&9.43=94=85*(.*8=1*;*1=<&8=5488.'1*b=-4<*;*7`=.9=<&8=3*(*88&7>=94=&114(&9*=49-*7= 85*(.*8=94=85*(.*8=(4251*=*8=47=,:.1)8=*_,_=(7:8948*=(47&11.3*=&1,&*`=+41.48*=7*)=&1,&*`= 8*88.1*=.3;*79*'7&9*8_= = = = =

/0 = 74/*(9=34_=,**.2*+- = =

= = 1. St Helens = = = = = 145 oE 146 oE 147 oE 148 oE = 5 km = o 40 S 2. Bicheno = = 41 oS = = = 42 oS = 5 km = 43 oS 3. Dunalley = = = = = 4. Actaeons

= 5 km ======5 km = = *.,:7*=++= =
&5=8-4<.3,=14(&9.43=4+=+4:7=89:)>=7*,.438=&3)=8:7;*>=8.9*8=


= = ,= 3;.7432*39&1=(477*1&9*8=4+=7**+8=<.9-=(4397&89.3,=&'&143*=)*38.9.*8= 4= .3;*89.,&9*= *3;.7432*39&1= (477*1&9*8= 4+= 7**+8= <.9-= (4397&89.3,= &'&143*= )*38.9.*8`= &)).9.43&1= 8.9*= 1*;*1= ;&7.&'1*8= <*7*= 7*(47)*)`= .3(1:).3,= 897:(9:7&1= (4251*=.9>= &3)= 7*1&9.;*= <&;*= *=548:7*_= 7*1&9.;*= <&;*= *=548:7*= <&8= (&1(:1&9*)= &((47).3,= 94= 9-*= 2*9-4)8=4+=7.(*=]=E*3(-.3,943=+33*_=-.8=<&;*=*=548:7*=.3)*==.8='&8*)=:543=9-*= 3:2'*7=4+=3 °=8*(9478=7&).&9.3,=+742=9-*=8.9*=9-&9=&7*=+:11>=45*3=94=8*&<&7)=+47=1_/=02= 47= +:79-*7= &3)= )4*8= 349= &((4:39= +47= 57*;&.1.3,= <.3)8`= (:77*398= 47= 4(*&3= ,*3*7&9*)= 8<*11_= ,97:(9:7&1= (4251*=.9>= <&8= (&1(:1&9*)= :8.3,= 9<4= 2*9-4)8a= &= 745*= &3)= (-&.3= 2*9-4)= O:(0-:789= ]= O:(0-:789= +312= &3)= &= (&9*,47.(&1= (1&88.+.(&9.43_= 47= 9-*= 745*= &3)=(-&.3=2*9-4)=&=+*=2=(-&.3=9&5*=<&8=24:1)*)=4;*7=9-*=8:'897&9:2=9-74:,-=9-*= (*397*=4+=*&(-=6:&)7&9=&3)=&=2*&8:7.3,=9&5*=<&8=9-*3=5:11*)=897&.,-9=94=)*9*72.3*=9-*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = /1 = =

1.3*&7= ).89&3(*= 9-&9= 9-*= +*= 2= (-&.3= 5&88*)= 4;*7_= -*= (&9*,47.(&1= (1&88.+.(&9.43= 4+= 8:'897&9:2= 9>5*8= <&8= '&8*)= 43= 9-*= &;*7&,*= ).&2*9*7= 4+= 9-*= )42.3&39= 8:'897&9:2= 9>5*a= += -= +1&9= 74(02'4:1)*78= 1/= 2= ).&2*9*7b= ,= -= '4:1)*78= ,_/= := /= 2= ).&2*9*7b= -= -= '4:1)*78=+=:=,_/=2b=.=-=74(08=*_,=:=+=2b=/=-=(4''1*=*_+=:=*_,=2b=0=-=5*''1*=*_*+=:=*_+=2b=1= -=8&3)_== = 9= 8-4:1)= '*= *25-&8.8*)= 9-&9= '*(&:8*= 9-*= 57.2&7>= +4(:8= 4+= 9-*= 89:)>= <&8= 94= :3)*789&3)= 9-*= .3+1:*3(*= 4+= &'&143*= 43= :3)*78947*>= (422:3.9.*8`= 9-*= 7&3,*= 4+= *3;.7432*39&1= (-&7&(9*7.89.(8= <&8= 7*897.(9*)= ._*_= 0:2= 2= )*59-= 7&3,*b= *=548*)= (4&89= 7**+8_= -*8*= (43897&.398= <*7*= 3*(*88&7>= '*(&:8*= 8&251.3,= ).++*7*39= )*59-8= &3)= &= ,7*&9*7=7&3,*=4+=*=548:7*8=<4:1)=-&;*=7*):(*)=9-*=54<*7=94=)*9*(9=9-*=.3+1:*3(*=4+= &'&143*= 43= '*39-.(= (422:3.9>= 897:(9:7*_= = 8:7;*>= )*8.,3= <.9-= &= ,7*&9*7= 7&3,*= 4+= )*59-8=&3)=<&;*=*=548:7*8=<4:1)=-&;*=549*39.&11>=,.;*3=,7*&9*7=.38.,-98=.394=+&(9478= .3+1:*3(.3,=&'&143*=&':3)&3(*b=-4<*;*7`=9-.8=<4:1)=-&;*='**3=&9=9-*=*=5*38*=4+=9-*= &)*6:&9*=)*8(7.59.43=4+= &'&143*8*(48>89*2=5&99*738_== = %3&1>8.8= 7*1&9.438-.58='*9<**3=&'&143*=(&9*,47.*8=949&1`=*2*7,*39`=(7>59.(=&3)=9-*=)42.3&39= '*39-.(=,74:58=<*7*=*=5147*)=:8.3,=8(&99*751498=&3)=1.3*&7=7*,7*88.43_=47=.3).;.):&1= 9&=&`= ,5*&72&3= 7&30= (477*1&9.438= <*7*= &184= :8*)= 94= .)*39.+>= 9&=&= 9-&9= <*7*= 2489= 89743,1>= (477*1&9*)= <.9-= 949&1= &'&143*= &':3)&3(*= &9= 9-*= 7*,.43&1= 1*;*1_= ;-.1*= &':3)&3(*=4+=49-*7=,7&?*78=8*&=:7(-.38`=,&897454)8=<&8=;*7>=14<`=&9=+4:7=8.9*8=.3=9-*= ,9= *1*38= 7*,.43= 9-*= 8*&= :7(-.3= *397489*5-&3:8= 74),*78.. = <&8= &':3)&39= .3= 842*= 6:&)7&98_= *(&:8*= 9-.8= ,7&?*7= (&3= -&;*= &= 2&/47= .3+1:*3(*= 43= &1,&1= (422:3.9>= 897:(9:7*= 1*9(-*7= +321`= 6:&)7&98= <-*7*= _ = 74),*78.. = <&8= &':3)&39= <*7*= *=(1:)*)= +742=7*,7*88.43=&3&1>8*8_== = 3&1>8.8=4+=;&7.&3(*=<>C=<&8=:8*)=94=(425&7*=&'&143*=&':3)&3(*=&3)=(4;*7=4+= )42.3&39= :3)*78947*>=,74:58=.3=7*1&9.43=94= )*59-=+47=9-*=9:3&11*>=7*,.43_='&143*= &':3)&3(*=<&8=&3&1>8*)='>=&=9<48<&>=54)*1==<>C`=<-.1*=&=9-7**8+&(947=54)*1= = 3*89*)= <>C= <&8= :8*)= +47= (4;*7= )&9&_= 49-= &3&1>8*8= .3(1:)*)= )*59-= +.=*)= +&(947`=9<4=1*;*18=&3)=8.9*=7&3)42=+&(947`=+.;*=1*;*18_=-*=3*89*)=<>C=.3(1:)*)= 9-*=*++*(9=4+=8*,2*39=3*89*)=<.9-.3=&11=(42'.3&9.438=4+=9*59-$,.9*=&8=&=7&3)42=+&(947_== = 5:19.;&7.&9*= 5&99*738= .3= :3)*78947*>= (422:3.9>= 897:(9:7*= &243,= 8.9*8= <*7*= *=&2.3*)= :8.3,= 34382*97.(= 2:19.).2*38.43&1= 8(&1.3,= 59,`= &3= :3(43897&.3*)= 47).3&9.43= 2*9-4)= 9-&9= &114<8= 4;*7&11= 5&99*738= &3)= 549*39.&1= ).++*7*3(*8= .3= 7*1&9.;*= <.9-.38,74:5=).85*78.438=94='*=;.8:&1.8*)_=-*=359,=74:9.3*=.3=7.2*7=?1&70*=+33-= <&8= :8*)= +47= 9-*8*= &3&1>8*8_= = (43897&.3*)= 47).3&9.43= 2*9-4)= <&8= &184= :8*)= 94= ;.8:&1.8*= 2:19.;&7.&9*= 5&99*738= <.9-= 7*85*(9= 94= 5&79.(:1&7= ->549-*8*8_= ?43897&.3*)= 47).3&9.438=<*7*=(43):(9*)=:8.3,=9-*= ?=2*9-4)=?&343.(&1=&3&1>8.8=4+=57.3(.5&1= (4847).3&9*8= .3= &((47)&3(*= <.9-= 3)*7843= ]= ;.11.8= ,**-_= -.8= 2*9-4)= .8= &= 97&).9.43&1= (&343.(&1= ).8(7.2.3&39= 47= (&343.(&1= (477*1&9.43= &3&1>8.8= )*5*3).3,= 43=

/2 = 74/*(9=34_=,**.2*+- = =

<-*9-*7= 9-*= ->549-*8.8= .3;41;*8= ,74:5= ).++*7*3(*8= 47= (439.3:4:8= 57*).(9478= 43= &= 8:'8*9=4+=(447).3&9*=&=*8=+742=&=2*97.(=2:19.).2*38.43&1=8(&1.3,=3)*7843=]=;.11.8= ,**-b=;.11.8=]=3)*7843=,**-_=,*5&7&9*=?=&3&1>8*8=<*7*=(43):(9*)=94=;.8:&1.8*=9-*= 7*1&9.438-.5='*9<**3=2:19.;&7.&9*=;&7.&9.43=.3=:3)*78947*>=(422:3.9>=897:(9:7*=&3)= .= &'&143*= )*38.9>= &3)= ..= 85&9.&1= ;&7.&'.1.9>= &9= 9-*= 7*,.43&1= 1*;*1_= -*= (&343.(&1= (477*1&9.438= .3= *&(-= (&8*= <*7*= 9*89*)= :8.3,= &= 5*72:9&9.43= 2*9-4)`= .3;41;.3,= .333= 5*72:9&9.438= 4+= 9-*= 7&<= )&9&_= 11= 2:19.;&7.&9*= &3&1>8*8= <*7*= '&8*)= 43= 7&>8?:79.8= 8.2.1&7.9>=2&97.(*8=)*7.;*)=+742=&;*7&,*=5*7(*39&,*=(4;*7=)&9&=&9=*&(-=8.9*_=9&9&=<*7*= +4:79-=7449=97&38+472*)=94=7*):(*=9-*=.3+1:*3(*=4+=)42.3&39=85*(.*8_= = ,9&3)&7)= 2:19.51*= 7*,7*88.43= <&8= :8*)= 94= )*9*72.3*= 9-*= *3;.7432*39&1= 5&7&2*9*78= 9-&9=-&)=9-*=,7*&9*89=.3+1:*3(*=43=&'&143*=*2*7,*39`=(7>59.(`=949&1=&':3)&3(*_=-*8*= 5&7&2*9*78= <*7*= 7*1&9.;*= *=548:7*`= 7**+= (4251*=.9>= (-&.3`= 7**+= (4251*=.9>= (&9*,47.(&1`=&3)=&=85&9.&1=(42543*39= 7*,.43_=-*=.3)*5*3)*3(*=4+=9-*8*=2*&8:7*8= <&8=*=&2.3*)='>=8(7**3.3,=5&.78<.8*=(477*1&9.438=4+=.3)*5*3)*39=;&7.&'1*8_=-*=9<4= 7:,48.9>=2*9-4)8=<*7*=-.,-1>=(477*1&9*)`=84=431>=43*=2*9-4)= 745*=&3)=(-&.3=<&8= .3(1:)*)= .3= 9-*= 2:19.51*= 7*,7*88.43= 24)*1= 94= 7*):(*= 574'1*28= &884(.&9*)= <.9-= (411.3*&7.9>= 7&4= +332_= -*= 7*8:19.3,= 86:&7*)= 2:19.51*= (477*1&9.43=  :2= .8= &3= *=57*88.43=4+=9-*=5745479.43=4+=9-*=949&1=;&7.&'.1.9>=.3=9-*=)*5*3)*39=;&7.&'1*=&'&143*= &':3)&3(*= 9-&9= .8= 57*).(9&'1*= +742= 9-*= '*89= 1.3*&7= (42'.3&9.43= 4+= 9-*= .3)*5*3)*39= ;&7.&'1*8= &'&(-3.(0= ]= .)*11= +323_= ,*2.5&79.&1= (477*1&9.43= (4*++.(.*398= <*7*= &184= :8*)= 94= *=57*88= 9-*= :3.6:*= (4397.':9.43= 4+= *&(-= .3)*5*3)*39= ;&7.&'1*= 94= 9-*= 949&1= ;&7.&9.43= .3= &'&143*= &':3)&3(*= &'&(-3.(0= ]= .))*11= +323_= 5:19.51*= 7*,7*88.43= &3&1>8*8=<*7*=5*7+472*)=:8.3,=9-*=B5&=84+9<&7*=574,7&2_== = /*8:198= = ,.414,.(&1=(477*1&9*8=4+=7**+8=<.9-=(4397&89.3,=&'&143*=)*38.9.*8= *,.43&1=1*;*1=(425&7.843=4+= +&.1*)`= 574):(9.;*=&3)= 2&7.3*=7*8*7;*=7**+8= 74&)88(&1*=(425&7.8438=4+=+&.1*)`=574):(9.;*=&3)=2&7.3*=7*8*7;*=7**+8=&9=9-*=7*,.43&1= 1*;*1=&7*=8-4<3=.3=.,:7*=+,_=;-.189=).++*7*3(*8=(4:1)=349='*=89&9.89.(&11>=9*89*)=):*=94= 9-*= 1&(0= 4+= '&1&3(*= .3= 9-*= )&9&8*9`= .9= 343*9-*1*88= 8-4<8= 842*= .25479&39= 5&99*738_= ?4;*7=4+=??=<&8=(438.89*391>=-.,-*7=43=574):(9.;*=7**+8=(425&7*)=94=+&.1*)=7**+8`= &19-4:,-=9-*=2&,3.9:)*=4+=9-*=).++*7*3(*=<&8=349=)7&2&9.(=(438.)*7.3,=9-*=7&3,*=4+= &'&143*=)*38.9.*8=4'8*7;*)_='&143*=)*38.9>=<&8=247*=9-&3=8*;*3=9.2*8=-.,-*7=43=9-*= (9&*438= 574):(9.;*= 7**+8= *_01= &'&143*= 2 -2 = (425&7*)= 94= +&.1*)= 7**+8= &9= .(-*34= *_*3=&'&143*=2 -2 _=?425&7.843=4+=9-*=(477*8543).3,=??=(4;*7=43=9-*8*=7**+8=7*;*&18= &=2:(-=82&11*7=).++*7*3(*`=<.9-=??=(4;*7=43=9-*=(9&*438= 574):(9.;*=7**+8=/+_*= -.,-*7= 9-&3= .(-*348= +&.1*)= 7**+8= -*_-='>= &= +&(947=4+=431>=+_1_=47=9-*=7*2&.3.3,= '*39-.(= ,74:58`= 5&99*738= .3= 7*1&9.43= 94= +.8-.3,= -.8947>= <*7*= ,*3*7&11>= <*&0= &3)= .3(438.89*39_=,*88.1*=.3;*79*'7&9*=(4;*7=<&8=,*3*7&11>=81.,-91>=-.,-*7=43= +&.1*)=7**+8`= <.9-= 9-*= *=(*59.43= 4+= ,9= *1*38`= <-*7*= 574):(9.;*= 7**+8= -&)= -.,-*7= 8*88.1*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = /3 = =

.3;*79*'7&9*= (4;*7_= 47= :3)*78947*>= &1,&*= &3)= (&345>8+472.3,= &1,&1= 7*(7:.98`= 89743,= 5&99*738=.3=7*1&9.43=94=+.8-.3,=-.8947>=<*7*=349=*;.)*39_= = 477*1&9.438='*9<**3=&'&143*=&3)=:3)*78947*>=47,&3.828== ,.,3.+.(&39=(477*1&9.438='*9<**3=949&1=&'&143*=&':3)&3(*=&3)=:3)*78947*>=47,&3.828= <*7*=4'8*7;*)=+47=)&9&=(411*(9*)=&9=9-*= 6:&)7&9=1*;*1`=&19-4:,-=+47=842*=:3)*78947*>= ,74:58`= 9-*= 3&9:7*= 4+= 9-*= 7*1&9.438-.5= ;&7.*)= '*9<**3= 7*,.438= .,_= ._= 19-4:,-= 8.,3.+.(&39= .3= &= 3:2'*7= 4+= (&8*8`= (477*1&9.438= <*7*= 9>5.(&11>= ;*7>= <*&0= +47= &11= :3)*78947*>= ,74:58_= -*= 89743,*89= (477*1&9.43= 4'8*7;*)= <&8= '*9<**3= 949&1= &'&143*= &':3)&3(*=&3)=??=&9=.(-*34`=<.9-=&3= :2=;&1:*=4+=/:89=*_-*_=,.,3.+.(&39=&884(.&9.438= '*9<**3=949&1=&'&143*=&':3)&3(*=&3)=5&79.(:1&7='*39-.(=,74:58=&55*&7=94='*=)7.;*3= 1&7,*1>= '>= 9-*= &':3)&3(*= 4+= *2*7,*39= &'&143*`= 8.3(*=2489=4+=9-*= 5&99*738=4'8*7;*)= <*7*=(438.89*39='*9<**3=9-*= 949&1=&':3)&3(*=&3)= *2*7,*39=(&9*,47.*8=.,_=.`=.,_= /_= 7*1&9.438-.58= '*9<**3= (7>59.(= &'&143*= &':3)&3(*= &3)= (4;*7= 4+= :3)*78947*>= 47,&3.828= <*7*= <*&0= 47= 3438*=.89*39= .,_= 0_= >+= 9-*= 9-7**= 8.,3.+.(&39= (477*1&9.438= 4'8*7;*)`=9<4=.(-*34=??`=9:3&11*>=(&345>8+472.3,=7*(7:.98=<*7*=.3+1:*3(*)='>=&= 8.3,1*= 89743,= 1*;*7&,*= 54.39`= <-.(-= <-*3= 7*24;*)= 2&)*= 9-*= 7*1&9.438-.58= 3438 8.,3.+.(&39_= =

0* = 74/*(9=34_=,**.2*+- = =

Failed Productive MPA 0.8 Abalone 2 m

r 0.6 e p e

n 0.4 o l a b 0.2 A # 0 80 Crustose corallines

60

40 %cover 20

0

40 Sessile invertebrates 30

%cover 20

10

0

40 Understorey algae

30

20 %cover

10

0

10 Brown algal 8 recruits 6

% cover 4 2

0 n (8)(2)(0) (9) (2) (1) (10)(3)(0) (4) (6) (1) St Helens Bicheno Dunalley Actaeons = = *.,:7*=+,= =%':3)&3(*=4+=&'&143*=&3)=2&/47=:3)*78947*>=,74:58=.3=7*1&9.43=94=+.8-.3,=-.8947>_= %'&143*=&':3)&3(*=7*57*8*398=2*&3=949&1=&':3)&3(*=(7>59.(=&3)=*2*7,*39=&(7488= 8.9*8`=)*9*72.3*)=+742=+.;*=7&3)421>=548.9.43*)=,*=22=6:&)7&98=&9=*&(-=8.9*_=+4;*7=4+= :3)*78947*>=47,&3.828=<&8=)*9*72.3*)=+742=+.;*=7&3)421>=548.9.43*)=*_,/=2 2=8:'8 6:&)7&98=.3=*&(-=6:&)7&9_=!49*=9-&9=7*51.(&9.43=;&7.*)='*9<**3=7*,.438b=9-*=3:2'*7= 4+= 7*51.(&9*= 8.9*= ;&7.&9.438= +47= *&(-= (&9*,47>87*,.43= (42'.3&9.43= .8= 8-4<3= .3= 5&7*39-*8*8_==

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 0+ = =

= ??= (4;*7= <&8= 548.9.;*1>= (477*1&9*)= <.9-= 949&1= &'&143*= &':3)&3(*= +47= &11= 8:7;*>= 7*,.438_= = +*&9:7*= 4+= &11= (477*1&9.438= <&8= 9-*= -.,-= 1*;*1= 4+= ;&7.&'.1.9>= &3)= (477*8543).3,=14<= :2=;&1:*8_=;-.1*=9-*7*=<&8=&=,*3*7&1=97*3)=4+=-.,-*7=??=(4;*7= &884(.&9*)= <.9-= &'&143*= )*38.9>`= 9-*7*= <*7*= 2&3>= .389&3(*8= <-*7*= -.,-= ??= (4;*7= <&8=4'8*7;*)=&9=14<=&'&143*=)*38.9.*8_== = ,*88.1*= .3;*79*'7&9*8= <*7*= 3*,&9.;*1>= (477*1&9*)= <.9-= 949&1= &'&143*= &':3)&3(*= <-*3= )&9&=<*7*=5441*)=&(7488=&11=7*,.438= :2=-=*_*-`=':9=<-*3=7*,.438=<*7*=(438.)*7*)=.3= .841&9.43=34=8.,3.+.(&39=7*1&9.438-.58=<*7*=*;.)*39=.,:7*=+-_=3=(4397&89`=8.,3.+.(&39= 3*,&9.;*= (477*1&9.438= <*7*= *;.)*39= .3= &11= 7*,.438= +47= :3)*78947*>= &1,&*_= ;-.1*= 8.,3.+.(&39`= 9-*8*= (477*1&9.438= <*7*= &,&.3= ;*7>= <*&0_= -*= 97.&3,:1&7= 3&9:7*= 4+= 9-.8= 7*1&9.438-.5=8:,,*898=9-&9=<-.1*=49-*7=+&(9478=.3+1:*3(*=:3)*78947*>=&1,&1=&':3)&3(*`= &'&143*=&':3)&3(*=8*98=&3= :55*7=1.2.9=94=9-*.7=&':3)&3(*=&=84=(&11*)= +&(947=(*.1.3,= ).897.':9.43=-425843= *9=&1 _=+330_=?4;*7=4+=:3)*78947*>=&1,&*=;&7.*)=8:'89&39.&11>= <-*3=&'&143*=)*38.9>=<&8=14<`=':9=-.,-=;&1:*8=<*7*=431>=4'8*7;*)=.3=9-*=57*8*3(*=4+= 14<=&'&143*=)*38.9.*8_=;-*3=&'&143*=)*38.9>=<&8=-.,-`=431>=14<=(4;*7=4+=:3)*78947*>= &1,&*=<&8=4'8*7;*)=.,:7*=+-_== = ,5*&72&3=7&30=(477*1&9.438=(43+.72*)=9-*=548.9.;*=(477*1&9.43=)*9*(9*)=.3=9-*=1.3*&7= 7*,7*88.43=&3&1>8*8`=<.9-=&=8.,3.+.(&39=548.9.;*=(477*1&9.43='*9<**3=&'&143*=&3)=??= &(7488= &11= 7*,.438= &'1*= ,_= ,.,3.+.(&39= (477*1&9.438= <*7*= 7&7*1>= (438.89*39= '*9<**3= 7*,.438= +47= .3).;.):&1= 9&=&`= <.9-= 9-*= *=(*59.43= 4+= +41.48*= 7*)= &1,&*= <-.(-= <&8= 3*,&9.;*1>= (477*1&9*)= <.9-= &'&143*= &':3)&3(*= +47= 9-7**= 4+= 9-*= +4:7= 8:7;*>= 7*,.438_= >9-*7= 8.,3.+.(&39= (477*1&9.438= <*7*= *;.)*39= ':9= <*7*= 431>= .3= 5&79.(:1&7= 7*,.438= *_,_= ;43&7.& =855_=<&8=548.9.;*1>=(477*1&9*)=<.9-=&'&143*=&9=.3&143,=&>=&3)=.(-*34_= = = 477*1&9.438='*9<**3=&'&143*=&3)=(&345>8+472.3,=&1,&*= C*7>= +*<= 8.,3.+.(&39= &884(.&9.438= <*7*= .)*39.+.*)= '*9<**3= &'&143*= &3)= 9-*= ;&7.4:8= (&345>8+472.3,= &1,&1= 85*(.*8= *3(4:39*7*)= .3= 9-*= 89:)>= .,:7*= +0_= -*= &884(.&9.438= 9-&9=<*7*=4'8*7;*)=<*7*=*=97*2*1>=<*&0=&3)=349=(438.89*39='*9<**3=7*,.438_== =

0, = 74/*(9=34_=,**.2*+- = =

a. Crustose 100 All regions St Helens Bicheno Dunalley Actaeons coralline algae 80 (CCA) 60 % 40 20 R2= 0.13 R2= 0.14 R2= 0.30 R2= 0.05 R2= 0.09 0

b. Sessile 100 Invertebrates 80 60 % 40

20 R2= 0.03 0 c. Understorey 100 algae 80 60 % 40

20 R2= 0.07 R2= 0.09 R2= 0.15 R2= 0.09 R2= 0.20 0

d. Canopy-forming 100 algal recruits 80 60 % 40

20 †R2= 0.09 0 0 1 2 3 4 0 0.5 1 1.5 0 0.5 1 1.5 0 0.5 1 1.5 2 0 1 2 3 4 Total Haliotis rubra density (individuals m-2 ) = *.,:7*=+-= =/*1&9.438-.5='*9<**3=949&1=&'&143*=&':3)&3(*=&3)=:3)*78947*>=47,&3.828_=.,3.+.(&39=7*,7*88.43=1.3*8=
=-=*_*/=&3)=(477*8543).3,= 2= ;&1:*8=&7*=8-4<3_=!49*=).++*7*39=8(&1*8=43=9-*==8&=*8_= †/*1&9.438-.5=89743,1>=.3+1:*3(*)='>=4:91.*7=<.9-=89743,=1*;*7&,* .

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 0- = =

a. Crustose 100 All regions St Helens Bicheno Dunalley Actaeons coralline algae 80 (CCA) 60 % 40 20 R2= 0.12 R2= 0.25 R2= 0.14 0

b. Sessile 100 Invertebrates 80 60 % 40

20 R2= 0.02 0 c. Understorey 100 algae 80 60 % 40

20 2 R2= 0.09 R = 0.10 R2= 0.14 R2= 0.09 R2= 0.23 0

d. Canopy-forming 100 algal recruits 80 60 % 40 20 0 0 1 2 3 0 0.5 1 1.5 0 0.5 1 1.5 0 0.5 1 1.5 2 0 1 2 3 Emergent Haliotis rubra density (individuals m-2 ) = *.,:7*=+.= =/*1&9.438-.5='*9<**3=*2*7,*39=&'&143*=&':3)&3(*=&3)=:3)*78947*>=47,&3.828_=.,3.+.(&39=7*,7*88.43=1.3*8=
=-=*_*/=&3)=(477*8543).3,= 2=;&1:*8=&7*=8-4<3_=!49*=).++*7*39=8(&1*8=43=9-*==8&=*8_==

0. = 74/*(9=34_=,**.2*+- = =

a. Crustose 100 All regions St Helens Bicheno Dunalley Actaeons coralline algae 80 (CCA) 60 % 40

20 R2= 0.03 †R2= 0.11 0

b. Sessile 100 Invertebrates 80 60 % 40 20 0 c. Understorey 100 algae 80 60 % 40 20 0

d. Canopy-forming 100 algal recruits 80 60 % 40 20 †R2= 0.11 0 0 0.5 1 1.5 2 0 0.25 0.5 0.75 1 0 0.25 0.5 0.75 1 0 0.25 0.5 0.75 1 0 0.3 0.6 0.9 1.2 1.5 Cryptic Haliotis rubra density (individuals m-2 ) = *.,:7*=+/= =/*1&9.438-.5='*9<**3=(7>59.(=&'&143*=&':3)&3(*=&3)=:3)*78947*>=47,&3.828_=.,3.+.(&39=7*,7*88.43=1.3*8=
=-=*_*/=&3)=(477*8543).3,= 2= ;&1:*8=&7*=8-4<3_=!49*=).++*7*39=8(&1*8=43=9-*==8&=*8_= †/*1&9.438-.5=89743,1>=.3+1:*3(*)='>=4:91.*7=<.9-=89743,=1*;*7&,* .=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 0/ = =

a. Total 10 All regions St Helens Bicheno Dunalley Actaeons Canopy 8 6 4 2 canopy index canopy R2= 0.10 0

b. Phyllospora 5 comosa 4 3 2

canopy index canopy 1 R2= 0.02 0

c. Ecklonia 5 radiata 4 3 2

canopy index canopy 1 R2= 0.07 R2= 0.13 0 5 d. Lessonia 4 corrugata 3 2

canopy index canopy 1 0 5 e. Durvillea 4 potatorum 3 2

canopy index canopy 1 R2= 0.02 0 0 1 2 3 4 0 0.5 1 1.5 2 0 0.5 1 1.5 2 0 0.5 1 1.5 2 0 1 2 3 4 Haliotis rubra density (individuals m -2 ) = *.,:7*=+0= =/*1&9.438-.5='*9<**3=949&1=&'&143*=&':3)&3(*=&3)=(&345>8+472.3,=&1,&*_=.,3.+.(&39=7*,7*88.43=1.3*8=
=-=*_*/=&3)=(477*8543).3,= 2= ;&1:*8=&7*=8-4<3_=!49*=).++*7*39=8(&1*8=43=9-*==8&=*8_=

00 = 74/*(9=34_=,**.2*+- = =

&'1*=,= 5*&72&3=7&30=(477*1&9.438=4+=&1,&1=&3)=.3;*79*'7&9*=,74:58`=)*7.;*)=+742=7*,.43&1= 1*;*1= )&9&_= %''7*;.&9.438= .3(1:)*= !+/%= -= 3438(47&11.3*= *3(7:89.3,= 7*)= &1,&*= .3(1:)*8= 9-*= &1,&1= ,*3*7&= "*>88433*1.& = &3)= .1)*3'7&3).& `= &3)= ++%= -= (7:8948*= (47&11.3*= &1,&*_= E-*7*= 9&=&= <*7*= 349= 7*(47)*)= .3= &= 5&79.(:1&7= 7*,.43`= 9-*= 349&9.43= !%=&551.*8_=.,3.+.(&39=58;&1:*8=
=-=*_*/=&7*=8-4<3=.3='41)+&(*_= = =C&7.&'1*= ,9=*1*38= .(-*34= 9:3&11*>= (9&*438= 8= 5= 8=:&30= 5= 8=:&30= 5= 8=:&30= 5= :&30= +3(7:89.3,=&1,&*= = *_+** ======&1,&*= &754,1488:2 = *_.+* 8*_++23= <= <= 8*_,.1/= *_*.02= 8*_*+32= *_220+= (43+1:*38 = 2= *_-*0 &7542.97&=(489&9& = 8*_+.1/= *_+.*+= *_,2/2= *_+,*0= *_--2.= 8*_+-1.= *_-+1= 1= *_,3. &:1*75&=+1*=.1.8 = 8*_+/+,= 8*_,21= *_*,0,= 8*_+*.1= *_.*00= 8*_./03= *_***/= 1= &:1*75&= 7-.?42* = <= <= 8*_+,.+= *_-./= <= <= 8*_*/./= *_03,0= *_*/2 41542*3.&= 855_= 8*_,03= <= <= <= <= <= <= 3= *_-** .1&2*394:8=7*)== 8*_+.3.= 8*_*,-,= *_20*.= *_,.++= *_*/-= 8*_*+*.= *_3.*+= .= *_++/ 0*_*** 41.48*=7*)=&1,&*= 8*_,,/.= 8*_.,3/= *_***0= 8*_,3,3= *_*+13= 8*_0+22= 0= += .1&2*394:8= <= <= 8*_,+00= *_*30.= 8*_+-.0= *_,2.3= *_,10= *_*.+.= ,7**3= *_++2 &1459*7.8 =855_= *_,,-2= *_-*,,= *_*+3= 8*_-31/= *_**+= <= <= -= *_/2- 7*)=7*(7:.98= 8*_*13.= 8*_*1,,= *_/2-2= *_,+*/= *_*3,.= 8*_*,3= *_2--2= 0= *_.12 843)*7&5*19& =855_= *_+*,0= *_*2-/= *_/,0= 8*_-23,= *_**+.= 8*_,0-,= *_*/,,= ,= =.5-45-47& = <= <= 8*_*0-.= *_0-*+= *_+./+= *_,.22= 8*_,330= *_*,0-= ,1&).&9& = *_*-+ ;43&7.& =855_= *_-*.2= *_-+0,= *_*+-2= 8*_+*01= *_-312= *_,,11= *_*3./= .= ?&345>8+472.3,======&1,&1=7*(7:.98= *_,.1 9(0143.&=7&).&9& = 8*_+000= 8*_+,20= *_-,1/= 8*_+//2= *_,+/+= 8*_+-03= *_-+3= /=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 01 = =

>8945-47& = <= <= <= <= 8*_,-03= *_*/1.= <= <= =243.1.+472.8= >8945-47& = <= <= <= <= 8*_+-.+= *_,21= *_+*-+= *_./-3= =7*974+1*=&=
->1148547& = *_,01 8*_+0= *_,3,,= *_*,-/= 8*_+31.= *_++/= *_+*2= *_.-,0= (4248&= += 8&7,&88:2= = <= <= <= <= 8*_+*+-= *_.,+3= <= <= )*(.5.*38= 8&7,&88:2 =855_== *_+33 8*_+2.1= *_*...= *_1-0,= 8*_*+.2= *_3*1+= *_*32,= *_.1//= 7*(7:.9= += 3;*79*'7&9*8======*_/+3 &73&(1*8= 8*_*3-,= 8*_+,.+= *_-./= *_+-+,= *_,310= <= <= 1= >:,:1&7.& = *_-1/ 8*_+,2= 8*_*.-.= *_1.,= 8*_-.*.= *_**//= 8*_,/1= *_*/2,= ).88.2.1.8= 3= =C&7.&'1*= ,9=*1*38= .(-*34= 9:3&11*>= (9&*438= 8=:&30= 5= 8=:&30= 5= 8=:&30= 5= 8=:&30= 5= ?4143.&1=8(.).&3 = <= <= 8*_*+0= *_3*-,= <= <= *_+201= *_+1,.= +3(7:89.3,= *_-*. *_+.2= 8*_*/20= *_0/0-= *_*011= *_/3,,= *_-0*0= *_**02= '7>4?4&= 3= *_*/* +7*(9=8543,*= 8*_,12/= *_*.0/= *_1,.= 8*_+-.0= *_,2.3= 8*_*0..= *_0.*-= ,= +3(7:89.3,= <= <= 8*_*020= *_0*,.= <= <= <= <= 2:88*18= +3(7:89.3,= *_/,0 *_*3+1= 8*_*-+,= *_2+,1= 8*_*,1/= *_2,13= 8*_*3/-= *_.222= 8543,*= .= ?79-48(:9.(*11& = *_++, 8*_,,1+= 8*_*/32= *_0/= 8*_-*+,= *_*+.2= 8*_*1+-= *_0*/+= 5-4*3.(*:2 = 1= *_*,3 ,41.9&7>=8(.).&3= *_-*2-= 8*_**+3= *_322.= *_***/= *_3303= *_,0/= *_*/*/= .= = #3+1:*3(*=4+=)*59-=43=&':3)&3(*=4+=&'&143*=&3)=:3)*78947*>=47,&3.828= 25479&39=.38.,-98=.394=9-*=.3+1:*3(*=4+=)*59-=43=5&99*738=4+=&'&143*=&':3)&3(*=&3)= :3)*78947*>=(422:3.9>=897:(9:7*=<*7*=574;.)*)='>=9-*=9:3&11*>=8:7;*>8=.,:7*=+1_= 9*59-87*1&9*)= 5&99*738= <*7*= 8.9*= 85*(.+.(`= <.9-= 9-*= *=(*59.43= 4+= 9-*= (&345>8+472.3,= &1,&1=7*(7:.9=(&9*,47>`=.3).(&9*)='>=&=8.,3.+.(&39=9*59-$,.9*=.39*7&(9.43=.3=9-*=<>C= 24)*18= &'1*= -_= 47= 842*= 4+= 9-*= :3)*78947*>= ,74:58`= ).++*7*3(*8= &997.':9&'1*= 94= )*59-=<*7*=*;.)*39=&9=9-*=8&2*=8.9*8=<-*7*=).++*7*3(*8= .3= &'&143*= &':3)&3(*= <*7*= +4:3)_=47=*=&251*`=??=(4;*7=<&8=8.,3.+.(&391>=-.,-*7=.3=9-*=8-&114<=)*59-=?43*=&9= 8.9*8=8+`=8-=&3)=8/_='&143*=&':3)&3(*=<&8=&184=-.,-*7=+47=9-*8*=8&2*=8.9*8`=&19-4:,-= 89&9.89.(&11>= 8.,3.+.(&39= ).++*7*3(*8= <*7*= 431>= *;.)*39= +47= 8.9*8= 8+= &3)= 8/_= ,.2.1&7= 5&99*738=<*7*=*;.)*39=+47=:3)*78947*>=&1,&*_=47= 8*88.1*= .3;*79*'7&9*8=&3)= (&345>8 +472.3,= &1,&1= 7*(7:.98= 89743,= )*59-= 7*1&9*)= 5&99*738= <*7*= 349= &55&7*39_= -*8*= 5&99*738= -.,-1.,-9= 9-*= 549*39.&1= +47= (43+4:3).3,= <-*3= *=&2.3.3,= (477*1&9.438=

02 = 74/*(9=34_=,**.2*+- = =

'*9<**3= &'&143*= &3)= '*39-.(= (422:3.9>= 897:(9:7*_= 3= 9-.8= 5&79.(:1&7= *=&251*`= ).++*7*3(*8= .3= ??= &':3)&3(*= '*9<**3= )*59-8= (4:1)= '*= 7*1&9*)= 94= &'&143*= &':3)&3(*b= -4<*;*7`= 9-*8*= ).++*7*3(*8= &7*= (1*&71>= (43+4:3)*)= '>= )*59-= &3)= (4:1)= &184='*=*=51&.3*)='>=(-&3,*8=.3=9-*=5->8.(&1=*3;.7432*39=9-&9=&184=;&7>=<.9-=)*59-= *_,_=<&;*=*3*7,>`=1.,-9`=8*).2*39&9.43_== = 422:3.9>=1*;*1=5&99*738= 59,=&3&1>8.8=7*+1*(9*)=7*,.43&1=).++*7*3(*8=.3=:3)*78947*>=(422:3.9>=897:(9:7*`=<.9-= (9&*438=8.9*8=,*3*7&11>=).89.3(9=+742=9-*=9-7**=*&89=(4&89=7*,.438=.,:7*=+2&_=-*= ':''1*=5149=.,:7*=+2'=&184=9*3)*)=94=8-4<=8.9*8=<.9-=-.,-=&'&143*=)*38.9>=+472.3,= &=).89.3(9=,74:5`=':9=9-.8=,74:5.3,=(4:1)=&184='*=&997.':9&'1*=94=7*,.43&1=).++*7*3(*8=.3= :3)*78947*>= (422:3.9>= 897:(9:7*_= ?= &3&1>8*8= )*243897&9*)= &= 8.,3.+.(&39= (477*1&9.43= '*9<**3= :3)*78947*>= &88*2'1&,*= (42548.9.43= &3)= '49-= 7*,.43= &3)= &'&143*b=-4<*;*7`=7*,.43&1=(477*1&9.438=<*7*=2:(-=89743,*7=9-&3=9-48*=&997.':9&'1*= 94=&'&143*=)*38.9>=&'1*=._=-*=+4:7=7*,.438=8*5&7&9*=(1*&71>=.3=9-*=(&343.(&1=&=.8=+47= 7*,.43= .,:7*= +3&`= )*243897&9*)= '>= 9-*= -.,-= 86:&7*)= (&343.(&1= (4*++.(.*39_= -*= (&343.(&1= &=.8= +47= &'&143*= )*38.9>= 8-4<8= 842*= (1:89*7.3,= 4+= 8.9*8= (438.89*39= <.9-= &'&143*=)*38.9>=&8=&=897:(9:7.3,=.3+1:*3(*`=&19-4:,-=9-*7*=&7*=&=3:2'*7=4+=.389&3(*8=4+= 4;*71&5='*9<**3=8.9*8=<.9-=(4397&89.3,=)*38.9.*8=.,:7*=+3'_= = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 03 = =

30 (i) Abalone shallow (2 - 3m) ) y t i -2 s

n deep (6 - 8m) e 20 d e n o l a

b 10 A (individuals m

0 100 (ii) CCA cover 80

60

cover (%) 40

20

0 40 (iii) Sessile invertebrates

30

20 cover (%)

10

0 60 (iv) Understorey algae

40 cover (%) 20

0 20 (v) Brown algal recruits 16

12

cover (%) 8

4

0 s1 s2s3 s4 s5 site = *.,:7*=+1= =73+1:*3(*=4+=)*59-=43=5&99*738=4+=.=&'&143*=&':3)&3(*=&3)=..8;=:3)*78947*>=(4;*7= +47= 9-*= -:3&11*>= 7*,.43_= %'&143*= &':3)&3(*= 7*57*8*398= 2*&3= (= &':3)&3(*= &(7488= +.;*= 7&3)421>= 548.9.43*)= ,*= 2 2=6:&)7&98=&9=*&(-=8.9*_=+4;*7=4+=:3)*78947*>= 47,&3.828=7*57*8*398=2*&3=(=5*7(*39&,*=(4;*7=&(7488=6:&)7&98=3=-=/=)*9*72.3*)= +742= +.;*= 7&3)421>= 548.9.43*)= *_,/= 2 2= 8:'86:&)7&98= <.9-.3= *&(-= ,*= 2 2= 6:&)7&9_= >2'41= =.3).(&9*8=8.9*=<-*7*=&=8.,3.+.(&39=).++*7*3(*='*9<**3=)*59-8=<&8=*;.)*39= 
=-=*_*/_== =

1* = 74/*(9=34_=,**.2*+- = =

&'1*=-= 73+1:*3(*=4+=)*59-=43=&=&':3)&3(*=4+=:3)*78947*>= 47,&3.828= &3)= '= &'&143*_= /*8:198=)*8(7.'*=9-*=4;*7&11=%!42%=*=&2.3.3,=9-*=*++*(9=4+=).++*7*39=)*59-8=,:-=2= ;8=0:2=2=43=:3)*78947*>=&3)=&'&143*=&':3)&3(*_=.,3.+.(&39=58;&1:*8=
=-=*_*/=&7*= 8-4<3= .3= '41)+&(*_= 7&38+472&9.438= &7*= *=57*88*)= .3= 9*728= 4+= 9-*= :397&38+472*)= ;&7.&'1*`= M_= !7&38+472&9.43= .2574;*)= )&9&= 897:(9:7*= (438.)*7&'1>= ':9= ).)= 349= &(-.*;*=3472&1.9>=&3)=-4248(*)&89.(.9>= = = =

= = ,4:7(*=4+=C&7.&9.43= ,*,2*39=9*59-= &_=*39-.(=,74:58= = 9*59-= ,.9*= 9*59-$,.9*= $,.9*= = = )= 5= )= 5= )= 5= )= 5= = = )+=-=+`=.= )+=-.`=.*= )+=-.`.*= )+=-.*`=,**= ?7:8948*= (47&11.3*= &1,&*= +*_-+= *_*--= 3_3.= 0*_**+ = -_13= *_*++= ,_+*= 0*_**+= 34=97&38+472&9.43= = = ,*88.1*=.3;*79*'7&9*8= = *_*+= *_3+1= +,_-,= 0*_**+= ._.-= *_**.1= +_+2= *_,--+=  Y = 83)*78947*>=&1,&*= = +-_3-= *_*,*= ._*2= *_**1= ,_0.= *_*.2= ,_,,= 0*_**+ = 13 @(*_+ = ?&345>8 +472.3,= &1,&1= = † 7*(7:.98 = = *_1*= *_.*1= -_+-= *_+.2= ,_,0= *_*13= +_3+= *_**,= 13 @(*_+ ======

= = ,4:7(*=4+=C&7.&9.43 =

'_='&143* = = 9*59-== ,.9*= 9*59-$,.9*= = = )= 5= )= 5= )= 5= = = )+=-=+`=.= )+=-=.`=.*= )+=-=.`=.*= '&143*= = /_32= *_*1+= /_*0= *_**,= -_3-= *_**3= 13 @(*_+ =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 1+ = =

(a) D

SH SH D SH DSH D D SH D B SH D B D SH A B SH B SH B A B B B B A A D A B B SH A A B D A A D A D D A

(b) D

SH SH D SH DSH D D SH D B SH D B D SH A B SH B SH B A B BB B A A D A B B SH A A B D A A D A D D A

= *.,:7*=+2=
-=51498='&8*)=43=2*&3=:3)*78947*>=(422:3.9>=(42548.9.43=&9=*&(-=8.9*=+4:79-= 7449= 97&38+472&9.43`= ,7&>= +:79.8= 8.2.1&7.9>b= 897*88= -= *_,_= &=
-= .3).(&9.3,= .3).;.):&1=8.9*8b=1=-=9=1*1*38`=,=-=,.(-*34`=-=-=-:3&11*>`=%=-=%(9&*438b='=
-= .3).(&9.3,=.3).;.):&1=8.9*8=&8=&'4;*=8:5*7.2548*)=<.9-=&=':''1*=5149=7*57*8*39.3,= &;*7&,*=&'&143*=)*38.9>=&9=*&(-=8.9*_=

1, = 74/*(9=34_=,**.2*+- = =

0.3 (a)

0.2 SH BSH SH SH SH SH B BSH B SH B SH B 0.1 D B B BB B D D 0 D D D D

D D D DD -0.1 D A A Canonicalaxis for 'Region' A A A A A -0.2 A A A A -0.3

-0.4 -0.3 -0.2 -0.1 0 0.1 0.2 0.3

Canonical axis for abalone density

0.3 (b)

0.2 SH BSH SH SH SH SH B BSH B SH B 0.1 B D B B BB B 0 D D D D D D

D D D D -0.1 D D A A A Canonicalaxis for 'Region' A -0.2 A A A A A A -0.3 A

-0.4 -0.3 -0.2 -0.1 0 0.1 0.2 0.3

Canonical axis for abalone density = = *.,:7*=+3= &= <48).2*38.43&1= 8(&99*75149= 4+= 9-*= (&343.(&1= &=*8= +47= &'&143*= )*38.9>= &3)= 7*,.43`= '&8*)= 43= :3)*78947*>= (422:3.9>= (42548.9.43= &9= *&(-= 8.9*= +4:79-= 7449= 97&38+472&9.43`=,7&>=+:79.8=8.2.1&7.9>b=1=-=9=1*1*38`=,=-=,.(-*34`=-=-=-:3&11*>`=%= -=%(9&*438_='=+&343.(&1=&=*8=5149=8:5*7.2548*)=<.9-=&=':''1*=5149=7*57*8*39.3,= &;*7&,*=&'&143*=)*38.9>=&9=*&(-=8.9*_= =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 1- = =

&'1*=.= /*8:198= 4+= (&343.(&1= &3&1>8.8= 4+= 57.3(.5&1= (447).3&9*8= *=&2.3.3,= 9-*= *++*(98= 4+= 7*,.43= &3)= &'&143*= )*38.9>= 43= :3)*78947*>= &88*2'1&,*8_= 2&7= -= 5*7(*39&,*= ;&7.&9.43= *=51&.3*)= '>= 9-*= +.789= 2= 57.3(.5&1= (447).3&9*= &=*8b= &114(&9.43= 8:((*88= -= 5*7(*39&,*= 4+= 54.398= (477*(91>= &114(&9*)= .394= *&(-= ,74:5b=  2= -= 86:&7*)= (&343.(&1= (477*1&9.43_= C = &(947= 2= 114(&9.43=8:((*88== 2= 5= &7= 49 = = = D74:5=+= D74:5=,= D74:5=-= D74:5=.= = = &1= 3*_3= 0+_/= 2-_-= +**_*= 2,_ *_3 *_*** 7*,.43= 3= 2/_-= (9&*438= 9:3&11*>= .(-*34= ,9=*1*38 = 0= *= ,=

+'&143* = = = *_/ +,= 3/_+= = = = *_**-= )*38.9> = /======3;.7432*39&1=(-&7&(9*7.89.(8=4+=7**+8=<.9-=(4397&89.3,=&'&143*=)*38.9.*8= 47=*&(-=&'&143*=&':3)&3(*=(&9*,47>`=9-*=*3;.7432*39&1=+&(9478=9-&9=<*7*=(438.)*7*)= .3=9-*=57*8*39=89:)>=*=51&.3*)=431>=&=;*7>=82&11=5745479.43=4+=9-*=949&1=;&7.&9.43=.3= &':3)&3(*= &'1*= /_= ,6:&7*)= 2:19.51*= (477*1&9.43= :2= ;&1:*8= 7&3,*)= +742= *_+/= +47= (7>59.(=&'&143*=94=*_,/=+47=9-*=*2*7,*39=&'&143*=545:1&9.43_=-*=*3;.7432*39&1=+&(947= 9-&9=&((4:39*)=+47=9-*=2&/47.9>=4+=9-*=;&7.&9.43=+47=*&(-=&'&143*=&':3)&3(*=(&9*,47>= <&8= 7*,.43`=<.9-=&= 2&=.2:2= :2=4+=*_,*=4'8*7;*)=+47=9-*= *2*7,*39=(42543*39=4+= 9-*=545:1&9.43_=-*=:3.6:*=(4397.':9.43=4+=7:,48.9>=&3)=7*1&9.;*=<&;*=*=548:7*=94=9-*= 949&1= ;&7.&9.43= .3= &'&143*= &':3)&3(*= <&8= *=97*2*1>= 14<`= -.,-1.,-9*)= '>= 9-*= 14<= 86:&7*)=8*2.5&79.&1=(477*1&9.43= 87 2=;&1:*8=+47=&11=&':3)&3(*=(&9*,47.*8=&'1*=/_= &'1*=/= 9&3)&7)= 2:19.51*= 7*,7*88.43= &3&1>8.8= *=&2.3.3,= 9-*= .3+1:*3(*= 4+= *3;.7432*39&1= +&(9478=43=9-*=&':3)&3(*=4+=*2*7,*39`=(7>59.(=&3)=949&1=&'&143*=&':3)&3(*_=6:&7*)= 8*2.85&79.&1=(477*1&9.43= 87 ,=*=57*88*8=9-*=:3.6:*=(4397.':9.43=4+=*&(-=.3)*5*3)*39= ;&7.&'1*=94=9-*=949&1=;&7.&3(*_

Abalone Regression Squared semi-partial correlation (sr 2) Relative Rugosity Region F df p R2 exposure

Emergent 15.33 5, 224 < 0.001 0.25 0.051 0.006 0.203

Cryptic 7.60 5, 224 < 0.001 0.15 0.002 0.003 0.128

Total 13.73 5, 224 < 0.001 0.23 0.041 0.008 0.187

=

1. = 74/*(9=34_=,**.2*+- = =

-.8(:88.43= ;.)*3(*=+47=&'&143*=&8=&=897:(9:7.3,=.3+1:*3(*=43=8:'9.)&1=7**+=(422:3.9.*8= -*=(477*1&9.;*=*;.)*3(*=&7.8.3,=+742=9-*=57*8*39=<470=574;.)*8=1.2.9*)=*;.)*3(*=+47= )7&2&9.(= *(48>89*2= (-&3,*= &884(.&9*)= <.9-= &'&143*= )*51*9.43_= -*= 2489= (438.89*39= 5&99*73=&(7488=7*,.438=<&8=9-*=*=.89*3(*=4+=&=<*&0=548.9.;*=(477*1&9.43='*9<**3=949&1= &'&143*=&':3)&3(*=&3)=??`=&3)=&=<*&0=3*,&9.;*=(477*1&9.43='*9<**3=949&1=&'&143*= &':3)&3(*= &3)= :3)*78947*>= &1,&*_= -*= 7&7*= &3)= .3(438.89*39= 5&99*738= 4'8*7;*)= '*9<**3=&'&143*=&':3)&3(*`=49-*7=:3)*78947*>=,74:58=8*88.1*=.3;*79*'7&9*8`=(&345>8 +472.3,=&1,&1=7*(7:.98=&3)=(&345>8+472.3,=&1,&*=574;.)*=+:79-*7=*;.)*3(*=4+=&=<*&0= 897:(9:7.3,= 741*_= 19-4:,-= 2:19.;&7.&9*= &3&1>8*8= )*243897&9*)= &= 8.,3.+.(&39= (477*1&9.43= <.9-= &'&143*= )*38.9>`= 89743,*7= (477*1&9.438= <*7*= 4'8*7;*)= '&8*)= 43= 7*,.43&1=).++*7*3(*8=.3=:3)*78947*>=(422:3.9>=897:(9:7*_== = -*7*= &7*= &= 7&3,*= 4+= 5488.'1*= 7*&8438= 9-&9= 2&>= &((4:39= +47= 9-*= 4'8*7;*)= <*&0= (477*1&9.438= '*9<**3= &'&143*= &3)= :3)*78947*>= 47,&3.828_= '&143*= &(9.;.9>= 2&>= .3)**)=-&;*=431>=&=2.347=.3+1:*3(*=43=:3)*78947*>=(422:3.9>=897:(9:7*_=-.8=<4:1)= '*= *=5*(9*)= .+= &'&143*= +**)= 43= )7.+9= &1,&*= &3)= ).851&>= 1.2.9*)= 24;*2*39= 5&99*738= &74:3)= &= -42*8.9*= 47= 8(&7_= ;-.1*= 9-.8= 24)*= 4+= '*-&;.4:7= *=51&.38= 9-*= 1.2.9*)= 897:(9:7.3,=.3+1:*3(*=4+= _=74*. =43=&1,&1=(422:3.9.*8=.3=;*89*73=:897&1.&=,(-*.'1.3,= +33.`=8.2.1&7=*;.)*3(*=+47='1&(01.5=&'&143*=.8=1&(0.3,_=19-4:,-='1&(01.5=&'&143*=&7*= 9-4:,-9=94='*=,*3*7&1.89=-*7'.;47*8`=+**).3,=2&.31>=43=)7.+9=&1,&*=,-*5-*7)=+31-&`= )*9&.1*)=89:).*8=.3(47547&9.3,=24;*2*39=&3)=+**).3,='*-&;.4:7=&(7488='74&)=85&9.&1= &3)= 9*2547&1= 8(&1*8= &7*= ;.9&1= 94= '*99*7= :3)*789&3)= *(414,.(&1= .39*7&(9.438= '*9<**3= &'&143*=&3)='*39-.(=(422:3.9.*8_=7*(*39=<470=(43):(9*)=.3=&=8-*19*7*)='&>=43=9-*= *&89= (4&89= 4+= &82&3.&= -&8= 8-4<3= 1.2.9*)= 24;*2*39= '>= '1&(01.5= &'&143*= O&38)*11= ,**0`=<.9-=12*=4+=&3.2&18=24;.3,=1*88=9-&3=-*=(2=5*7=)&>_=-*=,*3*7&1.9>=4+=9-.8= 7*(*39=<470=7*6:.7*8=+:79-*7=.3;*89.,&9.43_== = 9=7*2&.38=5488.'1*=9-&9=&'&143*=&(9.;.9>=.3+1:*3(*8=(422:3.9>=897:(9:7*=4:98.)*=9-*= .22*).&9*=-42*8.9*b=-4<*;*7`=9-*=&'.1.9>=94=)*9*(9=9-*8*=549*39.&1=*++*(98=<.11=)*5*3)= 43= 9-*= )*38.9>= &3)= ).897.':9.43= 4+= &'&143*= &3)= 9-*= 8(&1*= 4+= .3+1:*3(*= 4+= .3).;.):&1= &3.2&18_= *(&:8*= 4+= 9-*= .3-*7*39= 5&9(->= 3&9:7*= 4+= 8:'9.)&1= 7**+8= &9= 82&11= 8(&1*8= *_,_= E*33*11>= +321b= 4<1*78;&10*7= &3)= ?433*11= ,**,`= 8:(-= 7*1&9.;*1>= 82&1188(&1*= *++*(98= <4:1)= -&;*= '**3= ).++.(:19= 94= )*9*(9= .3= 9-*= 57*8*39= 8:7;*>`= <-.(-= <&8= )*8.,3*)= 94= )*9*(9= 7**+88(&1*= ).++*7*3(*8= .3= (422:3.9>= 897:(9:7*_= ?1*&71>= 9-*= 8(&1*= 4+= &3>= 549*39.&1= .3+1:*3(*= 4+= .3).;.):&1= &'&143*= .8= &= 6:*89.43= 9-&9= 2:89= '*= &))7*88*)= .3= +:9:7*= 7*8*&7(-_= += &'&143*= &(9.;.9>= (&3= '*= )*243897&9*)= 94= 897:(9:7*= :3)*78947*>= (422:3.9.*8`=9-*=:3)*71>.3,=2*(-&3.828=7*6:.7*=+:79-*7=.3;*89.,&9.43_= = ;-.189= 9-*= (477*1&9.438= 4'8*7;*)= .3= 9-*= 57*8*39= 89:)>= &7*= (438.89*39= <.9-= ,7&?.3,= *++*(98=._*_=548.9.;*=(477*1&9.438='*9<**3=&'&143*=&3)=??`=3*,&9.;*=(477*1&9.43=<.9-= :3)*78947*>=&1,&*`=897:(9:7.3,=2*(-&3.828=&7*=349=3*(*88&7.1>=7*897.(9*)=94=,7&?.3,`= 8.3(*=2:(:8=574):(9.43=B4-3843=]=,97&9-2&33=+323b=,*&7(>8*73&1=*9=&1_=+33,=&3)=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 1/ = =

':11)4?.3,=9&>943=+31+b=&<0.38=+32-='>=,7&?.3,=2411:8(8=&184=-&;*=9-*=549*39.&1= 94=24).+>='*39-.(=(422:3.9.*8_== = +3;.7432*39&1= &3)= -&'.9&9= (43).9.438= &7*= &184= &= 2&/47= (438.)*7&9.43= <-*3= .39*757*9.3,= 9-*= 7*8:198= 4+= 9-*= (:77*39= 89:)>_= -*= (:77*39= 8:7;*>= +4(:8*)= 43= 9-*= 0:2= 2*97*8= )*59-= 7&3,*= 43= *=548*)= (4&891.3*8= '*(&:8*= 4+= .98= 7*1*;&3(*= 94= 9-*= &'&143*= +.8-*7>_=-*=5488.'.1.9>=*=.898=9-&9=&'&143*=2&>=51&>=&=247*=.25479&39=897:(9:7.3,=741*= .3= -&'.9&98= 9-&9= <*7*= 349= (438.)*7*)= .3= 9-*= 57*8*39= 89:)>_= 47= *=&251*`= 89743,*7= (477*1&9.438=2.,-9=*=.89=+47=)**5*7=<&9*7=&'&143*=545:1&9.438`=+47=8-*19*7*)=8.9*8`=47=.3= 49-*7='.4,*4,7&5-.(=7*,.438_= = 9.++*7*3(*8=.3=9-*=*++*(98=4+=&'&143*=)*51*9.43=.3=7*1&9.43=94=*3;.7432*39&1=&3)=-&'.9&9= (43).9.438=2&>=.3=+&(9=*=51&.3=<->=9-*7*=&7*=).++*7.3,=45.3.438=&243,=).;*78=&8=94=9-*= *++*(98=4+=&'&143*=7*24;&1=43='*39-.(=(422:3.9>=897:(9:7*=,*(9.43=,_+`=8.3(*=).;*78= 5*7(*59.438= 2&>= '*= 89743,1>= .3+1:*3(*)= '>= 9-*= 7*,.43= &3)= )*59-= 7&3,*= 9-*>= 2489= 7*,:1&71>= +.8-_= ;-*9-*7= 47= 349= &'&143*= &(9.;.9>= .3+1:*3(*8= :3)*78947*>= (422:3.9>= 897:(9:7*`= 9-*= 57*8*39= 89:)>= (1*&71>= 8-4<8= 9-&9= +&(9478= 49-*7= 9-&3= &'&143*= ,7&?.3,= (4397.':9*=94=;&7.&9.43=.3='*39-.(=(422:3.9>=897:(9:7*_== = $&(9478=&++*(9.3,=&':3)&3(*=4+=:3)*78947*>=47,&3.828= =7&3,*=4+=+&(9478=-&;*='**3=7*5479*)=94=.3+1:*3(*=9-*=).897.':9.43=&3)=&':3)&3(*=4+= :3)*78947*>= 47,&3.828_= *7'.;47>= .8= 2489= (422431>= .)*39.+.*)= &8= 9-*= 84:7(*= 4+= ).89:7'&3(*= 9-&9= 2&.39&.38= )42.3&3(*= 4+= *3(7:89.3,= &1,&1= (422:3.9.*8`= 57*;*39.3,= +4:1.3,='>=9:7+8+472.3,=&1,&*=,9*3*(0=+320_=3='*39-.(=2&7.3*=8>89*28`=2489=89:).*8= 4+=51&39:-*7'.;47*=.39*7&(9.438=-&;*=+4(:8*)=43=9-*=,7&?.3,=.3+1:*3(*=4+=8*&=:7(-.38`= <-.(-= (&3= -&;*= &= )7&2&9.(= .25&(9= 43= '*39-.(= (422:3.9>= 897:(9:7*= *_,_= ?-&52&3= +32+b=B4-3843=]=5&33=+33-b=,(-*.'1.3,=*9=&1_=+333b=:11*7.=*9=&1_=,**,b=:>&=*9=&1_=,**._= 3= 9-*= 57*8*39= 89:)>= )*38.9>= 4+= ,7&?*78= 49-*7= 9-&3= &'&143*= <*7*= ,*3*7&11>= ;*7>= 14<= &3)=(4:1)=349=&((4:39=+47=9-*=-.,-=(4;*7=4+=??=9-&9=<&8=+7*6:*391>=4'8*7;*)=.3=9-*= &'8*3(*=4+=-.,-=&'&143*=)*38.9.*8_== = ?&345>8+472.3,=&1,&1=(&345.*8=(&3=&184= .3+1:*3(*=:3)*78947*>=(422:3.9>=897:(9:7*= 9-74:,-= 8*;*7&1= 5->8.(&1= 2*(-&3.828= .3(1:).3,= 8-&).3,`= 57*;*39.43= 4+= 8*).2*39= &((:2:1&9.43= &3)= 9-*= 8(4:78*++*(9= &884(.&9*)= <.9-= &1,&1= +743)8= &'7&).3,= 9-*= 8:'897&9:2=E*33*11>=+321b=5*1;.11*=]=?433*11=,**+_=+&(-=4+=9-*8*=2*(-&3.828=(&3= 2&.39&.3= )42.3&3(*= 4+= ??= '>= .3-.'.9.3,= 9-*= *89&'1.8-2*39= 4+= +41.48*= &1,&*= &3)= .3;*79*'7&9*8_= 49-= 9-*= (&345>= 85*(.*8= (42548.9.43= 7;.3,= *9= &1_= ,**.b= 7;.3,= ]= ?433*11= ,**0= &3)= 51&39= )*38.9>= E*3)7.(0= *9= &1_= +333= -&;*= &184= '**3= 8-4<3= 94= .3+1:*3(*= :3)*78947*>= (422:3.9>= 897:(9:7*_= 3= 9-*= &'8*3(*= 4+= &= 2&(74&1,&1= (&345>= &3)= ,7&?*78`= 842*= &:9-478= -&;*= 8-4<3= 9-&9= ??= &7*= (&5&'1*= 4+= 2&.39&.3.3,= )42.3&3(*= '>= 814:,-.3,= &3)= 8-*)).3,= *5.9-&11.&1= (*118= 7*.9':7,= +32.b= B4-3843= ]= 5&33=+320`=47=9-74:,-=574):(9.43=4+=&11*145&9-.(=8:'89&3(*8=E.2=*9=&1_=,**._== =

10 = 74/*(9=34_=,**.2*+- = =

7*(*39=&);&3(*8=.3=:3)*789&3).3,=:3)*78947*>=(422:3.9>=897:(9:7*=&(7488=9*25*7&9*= :897&1.&=-&;*=.3;41;*)=:3)*78947*>=(422:3.9.*8=4((:77.3,='*3*&9-=&=(&345>=4+=9-*= (42243=0*15= 9(0143.&=7&).&9&= 4<1*78;&10*7=]=?433*11=,**,b=?433*11=,**-b=7;.3,=*9= &1_= ,**._= -.8= <470= -&8= 8-4<3= 9-&9= .38.)*= 0*15= +47*898`= 9-*= 57*8*3(*= 4+= 9-*= (&345>= 2&>='*=247*=.25479&39=9-&3=,7&?*78=.3=+&(.1.9&9.3,=2&.39*3&3(*=4+=??=)42.3&3(*_= 47= *=&251*`= '*3*&9-= 0*15= (&345.*8= (4;*7= 4+= ??= <&8=+4:3)=94='*=-.,-=11/=43= ;*89*73=:897&1.&3=&3)=,4:9-=:897&1.&3=7**+8`=)*85.9*=9-*=;.79:&1=&'8*3(*=4+=,7&?*78`= <-.1*= ??= (4;*7= 7*2&.3*)= 14<= 0+*= 4:98.)*= 0*15= (&345.*8= 4<1*78;&10*7= ]= ?433*11=,**,_=-*=57*8*39=89:)>=<&8=349=)*8.,3*)=94=(4397&89=(422:3.9>=897:(9:7*= .38.)*= &3)= 4:98.)*= (&345.*8= 84= .9= .8= ).++.(:19= 94= 2&0*= ).7*(9= (425&7.8438= <.9-= 9-*= &+47*2*39.43*)=89:).*8_=<43*9-*1*88`=(&345>8+472.3,=&1,&1=(4;*7=<&8=,*3*7&11>=;*7>= -.,-=&(7488=&11=8.9*8=.3=9-*=57*8*39=8:7;*>=2*&3=(4;*7=11/`=84=.+=9-*=8&2*=574(*88*8= -41)= .3= &82&3.&3= <&9*78`= 9-*= &55&7*39= <*&0= .3+1:*3(*= 4+= &'&143*= 43= :3)*78947*>= (422:3.9.*8=8-4:1)=349='*=&3=:3*=5*(9*)=7*8:19_=9=<4:1)='*=4+=,7*&9='*3*+.9=94=9*89= <-*9-*7= 9-*= 8-&)*= &3)= 8<**5.3,= *++*(98= 4+= )42.3&39= (&345>8+472.3,= 85*(.*8= .3= &82&3.&3= <&9*78= *_,_=
->1148547&= (4248& `= :7;.11*&= 549&947:2 = +&(.1.9&9*= 9-*= 2434541.8&9.43= 4+= ??8)42.3&9*)= -&'.9&98= .3= 9-*= 8&2*=<&>=9-&9= 9_= 7&).&9& = )4*8= 43= ;*89*73=&3)=,4:9-=:897&1.&3=(4&891.3*8=?433*11=,**/_=+=(&345>82*).&9*)=5->8.(&1= 574(*88*8= &7*= 9-*= 2&.3= )7.;.3,= +47(*= .3+1:*3(.3,= ??= &':3)&3(*`= -&'.9&9= &19*7&9.43= (&:8*)= '>= &'&143*= 7*24;&1= .8= :31.0*1>_= 83)*7= 9-*8*= (.7(:289&3(*8`= .2574;*)= :3)*789&3).3,= 4+= 9-*= +&(9478= .3+1:*3(.3,= 9-*= ).897.':9.43= &3)= &':3)&3(*= 4+= (&345>8 +472.3,=&1,&*=8-4:1)='*=&=+4(:8=4+=+:9:7*=7*8*&7(-`=1*&).3,=94=&='*99*7=:3)*789&3).3,= 4+=9-*=*3;.7432*39&1=&3)='.414,.(&1=+&(9478=9-&9=:3)*75.3=7*8.1.*3(*=4+=7**+8=94=+.8-.3,_= = %.2.9&9.438=4+=(477*1&9.;*=&5574&(-=94=.3+*7=*++*(98=4+=&'&143*=)*51*9.43= -*7*=&7*=8.,3.+.(&39=1.2.9&9.438=<-*3=:8.3,=(477*1&9.;*=89:).*8=94=.3+*7=9-*=.25&(9=4+= &'&143*=7*24;&1=43=*(48>89*2=897:(9:7*=&3)=+:3(9.43_=?43+4:3).3,=+&(9478=7*57*8*39= &=8*7.4:8=.88:*`=8.3(*=).++*7*3(*8=.3=:3)*78947*>=(422:3.9.*8=&997.':9*)=94=).++*7*3(*8= .3=&'&143*=)*38.9>=(4:1)=&184='*=(&:8*)='>=49-*7=+&(9478=*_,_=)*59-`=*=548:7*`=7*,.43&1= '.4,*4,7&5->_= 47= *=&251*`= -*= (9&*438= 7*,.43= -&)= &= ).89.3(9= :3)*78947*>= (422:3.9>= ':9= &184= 9-*= -.,-*89= &'&143*= )*38.9>= 84= 9-*= .3+1:*3(*= 4+= &'&143*= .8= (43+4:3)*)= '>= 7*,.43= .3= 9-.8= 5&79.(:1&7= 8.9:&9.43_= ,.2.1&71>`= *++*(98= 4+= &'&143*= 43= :3)*78947*>=(422:3.9.*8=<*7*=(1*&71>=(43+4:3)*)='>=)*59-=+47=9-*=9:3&11*>=7*,.43_== = -*=(477*1&9.;*=&5574&(-=&184=(&3349=.)*39.+>=9-*=+&(9478=)7.;.3,=&884(.&9.438='*9<**3= &'&143*=&3)=:3)*78947*>=(422:3.9.*8_=;-.1*=9-.8=).8(:88.43=+4(:8*8=43=9-*=549*39.&1= .3+1:*3(*= 4+= &'&143*= 43= :3)*78947*>= (422:3.9.*8`= .9= .8= &184= 51&:8.'1*= 9-&9= '*39-.(= (422:3.9.*8= 2&>= .3+1:*3(*= &'&143*= &':3)&3(*`= &8= 45548*)= 94= &'&143*= &(9.;.9>= 897:(9:7.3,= :3)*78947*>= (422:3.9.*8_= 83)*789&3).3,= 9-*= 2*(-&3.828= :3)*71>.3,= &'&143*::3)*78947*>= &884(.&9.438= .8= &3= .25479&39= 6:*89.43= <.9-= 7*1*;&3(*= 94= 9-*= 574):(9.;.9>= 4+= &'&143*= 545:1&9.438_= -*= &55&7*39= 7*8.1.*3(*= 4+= 9-*= (9&*438= 7*,.43= (4:1)= '*= &997.':9&'1*= 94= 9-*= 57*8*3(*= 4+= &= (422:3.9>= 9-&9= .8= 247*= +&;4:7&'1*= 94= &'&143*=545:1&9.438`=549*39.&11>=574;.).3,=8:5*7.47=(43).9.438=+47=43=&'&143*=,74<9-`=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 11 = =

7*574):(9.43= &3)= 7*(7:.92*39= .3= (425&7.843= <.9-= 9-*= 1*88= 7*8.1.*39= 3479-*&89= (4&89= 7**+8_== = ?1*&71>= 9-*= 431>= <&>= 94= )*243897&9*= (&:8&1.9>= .8= 9-74:,-= 2&3.5:1&9.43= 4+= &'&143*= )*38.9.*8_= ?438.)*7&9.438= +47= &3= *=5*7.2*39&1= &5574&(-= 94= :3)*789&3).3,= *++*(98= 4+= &'&143*=+.8-.3,=*_,_=5149=8.?*`=9&7,*9=)*38.9.*8`=89&9.89.(&1=54<*7=-&;*='**3=).8(:88*)= 57*;.4:81>=8**=B*30.38=,**.b=-4<*;*7`=9-*7*=7*2&.38=34=5:'1.8-*)=<470=*=&2.3.3,= 2&3.5:1&9.43= 4+= &'&143*= )*38.9.*8_= +=5*7.2*39&1= 89:).*8= .3;41;.3,= 2&3.5:1&9.43= 4+= &'&143*= )*38.9.*8= &7*= (:77*391>= :3)*7<&>= .3= &82&3.&= &3)= C.(947.&= &3)= 9-*8*= <.11= *3&'1*= &= 2:(-= ,7*&9*7= :3)*789&3).3,= 4+= *(48>89*2= *++*(98= 43= '*39-.(= (422:3.9>= 897:(9:7*_= -*= &'.1.9>= 94= ,*3*7&1.8*= +742= 9-*8*= 89:).*8= <.11= '*= &= 8.,3.+.(&39= .88:*`= -4<*;*7`= 8.3(*= 9-*= 85&9.&1= ).897.':9.43= 4+= &'&143*= 43= 9-*= 7**+= 574;.)*8= *=(*59.43&1= (-&11*3,*8=.3=9-.8=7*,&7)_=47=*=&251*`=&):19=&'&143*=545:1&9.438=&143,=9-*=C.(947.&3= (4&89=&7*=9>5.(&11>=&884(.&9*)=<.9-=(7*;.(*8=&3)=(&;*8=5(,-&3*=+333`=<-*7*&8=&):19= &'&143*= 545:1&9.438= 43= 9-*= *&89= (4&89= 4+= &82&3.&= &7*= ,*3*7&11>= &884(.&9*)= <.9-= *=548*)=7**+=8:7+&(*8=*_,_=*=548*)=8:7+&(*=4+='4:1)*78_=,.2.1&7=).++*7*3(*8=.3=&'&143*= ).897.':9.43=(&3='*=*;.)*39=4;*7=2:(-=82&11*7=8(&1*8=B__=C&1*39.3*`=5*78_=4'8__=-*= .3-*7*39=;&7.&9.43=.3=&'&143*=&':3)&3(*=9-&9=4((:78=&9=2:19.51*=85&9.&1=8(&1*8=57*8*398= 2&/47= (-&11*3,*8= <-*3= 6:&39.+>.3,= &'&143*= &':3)&3(*= *_,_= >++.(*7= *9= &1_= ,**+b= 5(,-&3*=+33.b=9-*8*=8&2*=(-&11*3,*8=&184=3**)=94='*=(438.)*7*)=<-*3=*=&2.3.3,=9-*= *++*(98=4+=&'&143*=)*51*9.43=.3=+:9:7*=<470_= = $&(9478=.3+1:*3(.3,=7*8.1.*3(*=4+=7**+8=94=&'&143*=+.8-.3,= ?438.)*7&9.43=4+=549*39.&1=*3;.7432*39&1=+&(9478=.3+1:*3(.3,=&'&143*=&':3)&3(*=.8=&3= .25479&39=(42543*39=4+=:3)*789&3).3,=<->=7**+8=).++*7=<.9-=7*85*(9=94=7*8.1.*3(*=94= +.8-.3,=&(9.;.9.*8_=83+479:3&9*1>=9-*=57*8*39=89:)>=574;.)*)=1.2.9*)=.38.,-98= .394=9-*= .25479&3(*= 4+= *3;.7432*39&1= +&(9478= .3= 7*1&9.43= 94= &'&143*= &':3)&3(*b= 9-*= *3;.7432*39&1=+&(9478=9-&9=<*7*=(438.)*7*)=&((4:39*)=+47=&=;*7>=82&11=5745479.43=4+= 9-*= 4'8*7;*)= ;&7.&9.43= .3= &':3)&3(*_= 39*7*89.3,1>`= 7*,.43= *=51&.3*)= 9-*= -.,-*89= 5745479.43=4+=;&7.&9.43=.3=&'&143*=&':3)&3(*_=;-.1*=349=&3=*3;.7432*39&1=+&(947=.3= .98= 4<3= 7.,-9`= 7*,.43= .3(47547&9*8= &= 3:2'*7= 4+= +&(9478= 9-&9= <*7*= 349= 6:&39.+.*)= ).7*(91>=&3)=&7*=1.0*1>=94=(4397.':9*=94=;&7.&9.43=.3=&'&143*=&':3)&3(*_=47=*=&251*`= 7*,.43&1= ).++*7*3(*8= .3= .= 9-*= 85&9.&1= 897:(9:7.3,= 4+= 7**+= -&'.9&9= *_,_= B47)&3= *9= &1_= ,**/'`= ..= 4(*&3= ,*3*7&9*)= 8<*11`= ...= 2&(74&1,&1= 574):(9.;.9>= &3)= .;= ->)74)>3&2.(8=(4:1)=&11=(4397.':9*=94=).++*7*3(*8=.3=&'&143*=&':3)&3(*_== = -*= 1.2.9*)= .3+1:*3(*= 4+= 7**+= 897:(9:7*= 43= &'&143*= &':3)&3(*= <&8= &= 842*<-&9= :3*=5*(9*)= 7*8:19`= 8.3(*= 7**+= (4251*=.9>= .8= 4+9*3= 9-4:,-9= 94= .3+1:*3(*= &'&143*= &':3)&3(*_=-*=&24:39=4+= (7>59.(=-&'.9&9=(7&(08=&3)=(7*;.(*8=<.9-.3=9-*=7**+`=+47= *=&251*`=.8=,*3*7&11>=9-4:,-9=94='*=&=,44)=.3).(&947=4+=&'&143*=&':3)&3(*_=19-4:,-= 9-*=7*8:198=+742=9-*=57*8*39=8:7;*>=574;.)*=<*&0=*;.)*3(*=+47=7**+=(4251*=.9>=&8=&3= .25479&39=897:(9:7.3,=+&(947`=9-*=(4251*=.9>=2*&8:7*8=:8*)=.3=9-*=57*8*39=89:)>=2&>= 349=-&;*='**3=8:++.(.*39=94=.)*39.+>=9-*=+.3*88(&1*=-&'.9&9=897:(9:7*=9-&9=.8=1.0*1>=94='*=4+=

12 = 74/*(9=34_=,**.2*+- = =

.25479&3(*=94=&'&143*=545:1&9.438_=:9:7*=<470=8-4:1)=(438.)*7=&)).9.43&1=2*9-4)8= 94=6:&39.+>=7**+=(4251*=.9>=4;*7=&=7&3,*=4+=85&9.&1=8(&1*8_ = == -*= 1&(0= 4+= .38.,-9= +742= 9-*= 57*8*39= 8:7;*>= .394= *3;.7432*39&1= +&(9478= .3+1:*3(.3,= &'&143*= &':3)&3(*= 2&>= '*= 5&791>= ):*= 94= 9-*= 3*(*88.9>= 94= &19*7= 9-*= 47.,.3&1= 574/*(9= 4'/*(9.;*8_=+=7**+8=(4:1)=-&;*='**3=4'/*(9.;*1>=&88.,3*)=94=&=5&79.(:1&7= 574):(9.;.9>= 89&9:8`= *3;.7432*39&1= +&(9478= .3+1:*3(.3,= 7*8.1.*3(*= 7&9-*7= 9-&3= &'&143*= &':3)&3(*= (4:1)=-&;*='**3=&))7*88*)_==(4251*=.9>=<.9-=9-*=&5574&(-=:8*)=.3=9-*=57*8*39=<470= .8=9-&9=&'&143*=&':3)&3(*=.8=349=3*(*88&7.1>=&=,44)=.3).(&947=4+=7**+=574):(9.;.9>=&3)= ;.(*=;*78&_=,:7;*>8=<*7*=(43):(9*)=):7.3,=&=5*7.4)=4+=&55&7*39=7*(4;*7>=4+=&'&143*= 894(08= 43= 9-*= *&89= (4&89= &7'&9-= *9= &1_= 894(0= &88*882*39= 7*+*7*3(*`= .3= <-.(-= (&8*= +472*71>= )*51*9*)= 7**+8= 2&>= -&;*= 7*(47)*)= -.,-= &'&143*= )*38.9.*8_= -.8= &55&7*39= 7*(4;*7>=(4:1)=-&;*=4'8(:7*)=&3>=*(48>89*2=(-&3,*8`=&19-4:,-=9-*=+&(9=9-&9=&'&143*= 545:1&9.438=7*(4;*7=4;*7=7*1&9.;*1>=82&11=9*2547&1=8(&1*8=574;.)*8=.3).7*(9=*;.)*3(*= 9-&9=&3>=*(48>89*2=(-&3,*=)4*8=349=-&;*=143,89*72=*++*(98=43=9-*=574(*88=4+=&'&143*= 545:1&9.43=7*(4;*7>_= = 4= &)*6:&9*1>= &))7*88= 9-*= 6:*89.43= 4+= 7**+= 7*8.1.*3(*`= 6:&39.9&9.;*= )&9&= 43= +.8-.3,= '*-&;.4:7= &9= 9-*= 8(&1*= 4+= .3).;.):&1= 7**+8= .8= *88*39.&1_= -*= )*;*1452*39= 4+= D,= 9*(-3414,>= *_,_= 79?= ,**02*,3= 574;.)*8= 9-*= 94418= 94= ,&9-*7= 9-.8= .3+472&9.43`= 574;.).3,= 6:&39.9&9.;*= )&9&= 43= &'&143*= (&9(-= &3)= *++479= &9= +.3*= 85&9.&1= 8(&1*8_= -.8= .3+472&9.43= <.11= &114<= 7**+8= <.9-= ).++*7.3,= 7*8.1.*3(*= 94= +.8-.3,= &(9.;.9.*8= 94= '*= .)*39.+.*)`= *3&'1.3,= &= 247*= )*9&.1*)= &88*882*39= 4+=9-*= *3;.7432*39&1= &3)='.414,.(&1= +&(9478=9-&9=2&>=.3+1:*3(*=7**+=7*8.1.*3(*_=7*;.4:8=<470=(43):(9*)=4;*7=1&7,*=85&9.&1= 8(&1*8= -&8= .)*39.+.*)= 85&9.&1= 897:(9:7.3,= &8= &3= .25479&39= +&(947= .3+1:*3(.3,= 9-*= 7*8.1.*3(*=4+=7**+8=94=&'&143*=+.8-.3,=B47)&3=*9=&1_=,**/'b=-4<*;*7`=&=7&3,*=4+=+&(9478= 8-4:1)= '*= (438.)*7*)= .3= +:9:7*= <470_= &(9478= 9-&9= 2:89= '*= (438.)*7*)= .3(1:)*= 9-*= .25479&3(*= 4+= 4(*&3= ,*3*7&9*)= 8<*11`= 14(&1= ->)74)>3&2.(8`= 3:97.*39= 1*;*18`= &1,&1= 574):(9.;.9>= &3)= )7.+9= &1,&1= &':3)&3(*_= 5&3>= 4+= 9-*8*= +&(9478= (&3349= '*= *=&2.3*)= :8.3,= &= 83&5= 8-49= 8:7;*>= &5574&(-= &3)= <.11= 3**)= 94='*= 6:&39.+.*)= 4;*7= &= 7&3,*= 4+= 85&9.&1=&3)=9*2547&1=8(&1*8_== = +43(1:8.438= -*=1&(0=4+=&=89743,=(438.89*39=5&99*73='*9<**3=(422:3.9.*8=<.9-=(4397&89.3,=&'&143*= )*38.9.*8=8:,,*898=9-&9=)7&2&9.(=7**+88(&1*=8-.+98=.3='*39-.(=(422:3.9>=897:(9:7*=&7*= :31.0*1>= +4114<.3,= )*51*9.43= 4+= &'&143*= 894(08_= ;-.1*= 9-.8= 2&>= '*= 4+= 842*= 7*1.*+= 94= 2&3&,*78=4+=8:'9.)&1= 7**+8`=&=3:2'*7=4+=6:*89.438=2:89='*=&))7*88*)=94=&)*6:&9*1>= &))7*88= .25&(98= 4+= &'&143*= )*51*9.43_= +=5*7.2*39&1= 89:).*8= &7*= (1*&71>= 7*6:.7*)= .3= -&'.9&98=<.9-=;&7>.3,=5->8.(&1=(-&7&(9*7.89.(8=&3)=9-*=8(&1*=4+=.3+1:*3(*=4+=.3).;.):&1= &'&143*=2:89=&184='*=(7.9.(&11>=*=&2.3*)_=-*=7*1&9.;*=.3+1:*3(*=4+=&'&143*=7*24;&1=.8= 1.0*1>=94=)*5*3)=43=9-*=5->8.(&1=(-&7&(9*7.89.(8=4+=5&79.(:1&7=7**+8`=84=&=2&/47=6:*89.43= <.11= '*= 94= .)*39.+>= 9-*8*= (-&7&(9*7.89.(8= 84= 7**+8= 9-&9= &7*= &9= 2489= 7.80= 4+= *(48>89*2= (-&3,*=+4114<.3,=)*51*9.43=4+=&'&143*=894(08=(&3='*=.)*39.+.*)_=-*=7.80=4+=*(48>89*2=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 13 = =

(-&3,*= <.11= &184= )*5*3)= 43= 9-*= 7*8.1.*3(*= 4+= 7**+8= 94= &'&143*= +.8-.3,_= -.8= .8= &= 5&79.(:1&71>= (-&11*3,.3,= &7*&= 4+= 7*8*&7(-= 9-&9= 8-4:1)= '*= *3-&3(*)= <.9-= .2574;*)= :3)*789&3).3,= 4+= &'&143*= +.8-.3,= '*-&;.4:7`= &(-.*;&'1*= <.9-= 9-*= 438,4.3,= )*;*1452*39=4+=D,=97&(0.3,=9*(-3414,>=79?=,**02*,3_==

2* = 74/*(9=34_=,**.2*+- = =

=-= -*9*72.3.3,=9-*=).*9=4+=74(0= 14'89*78=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 2+ = =

-_+= ;&1:&9.43=4+=2*9-4)8=+47=)*9*72.3.3,=74(0= 14'89*7=).*9`=<.9-=5&79.(:1&7=*25-&8.8=43=3438 )*897:(9.;*=8&251.3,= = 73974):(9.43= 7*)&947857*>= .39*7&(9.438= &7*= +:3)&2*39&1= 94= :3)*789&3).3,= 9-*= )>3&2.(8= 4+= *(48>89*28_= -*=).*9=4+=14'89*78`=9-*=)42.3&39=2&(748.3;*79*'7&9*=43=84:9-*73=9*25*7&9*=7**+8=.8=54471>= :3)*78944)_= &79= 4+= 9-.8= 7*&843= .8= 9-*= ).++.(:19>= .3= .)*39.+>.3,= 57*>= .9*28= 43(*= 9-*>= 5&88= 9-74:,-= 9-*= ,7.3).3,= 2&3).'1*8= &3)= .394= 9-*= +47*,:9_= +9*7= 9-*= +47*,:9= 9-*>= '*(42*= 1*88= ).89.3,:.8-&'1*= &8= 9-*= ,&897.(= 2.11= ,7.3)8= 9-*2= +:79-*7_= ;-.1*= (*79&.3= 57*>= .9*28= &7*= ).89.3,:.8-&'1*= +742= +7&,2*398= 4+= 8-*118`= 85.(:1*8`= '43*8= *9(_`= 49-*7= +1*8-.*7= 57*>= .9*28= *,_= &'&143*`= (9*345-47*8= (&3= 349= '*= ).89.3,:.8-*)_= )).9.43&11>`= 94= &((4:39= +47= ).++*7*3(*8= .3= 7*,.438`=)*59-8`=8.?*=4+=14'89*78=&3)=8*&843=;&7.&9.438=.3=).*9=&=1&7,*=3:2'*7=4+=14'89*7=<4:1)= 3**)=94='*=8&251*)_=;*=574548*=94=*=5147*=2*9-4)8=9-&9=&7*=3438)*897:(9.;*=8:(-=&8=+&*(&1= *=&2.3&9.43_=-.8=<4:1)=*3&'1*=8&251.3,=4+=14'89*78=.3=7*8*7;*=545:1&9.438=<-*7*=)*897:(9.;*= 8&251.3,=<4:1)='*=574-.'.9*)_=,.2.1&71>=<-.1*=8&251.3,=+742=+.8-*78=;*88*18=<4:1)=7*):(*= 8&251.3,=(4898`=5:7(-&8.3,=4+=14'89*78=+47=)*897:(9.;*=8&251.3,=<4:1)='*=574-.'.9.;*_ = -*= +.789= &.2= 4+= 9-.8= 8*(9.43= <&8= 94= )*;*145= &= 3438)*897:(9.;*= 8&251.3,= 9*(-3.6:*= +47= 4'9&.3.3,=).*9&7>=.3+472&9.43=+742=14'89*78_== =
*9-4)8=&3)=7*8:198= .789= <*= )*;*145*)= &= 6:.(0= &3)= 3438)*1*9*7.4:8= 2*9-4)= 4+= (411*(9.3,= 74(0= 14'89*7= +&*(&1=2&9*7.&1=94=574;.)*=8&251*8=+47=9<=).*9&7>=&3&1>8.8_== = = (7&)1*= )*;.(*= .,:7*= ,*= <&8= )*8.,3*)= &3)= ':.19= +47= 9-*= 5:7548*= 4+= 7*897&.3.3,= 14'89*78=<-.1*=8&251*8=(4:1)='*=9&0*3=+742=9-*=-.3),:9=7*,.43_=O4'89*78=&7*=51&(*)=.3= 9-*= (7&)1*`=<-.(-=-41)8=9-*=&3.2&1=:58.)*8)4<3=&3)=.224'.1.?*8=9-*=5489*7.47=+4:7= 5&.78=4+=<&10.3,=1*,8_=-*=&39*7.47=9*1843=.8=-*1)=+.721>='>=9-*=7*8*&7(-*7=94=89&'.1.?*= 9-*=&')42.3&1=7*,.432=9&.1=<-.1*=(411*(9.3,=+&*(*8_= = O4'89*7=+&*(*8=&7*=(411*(9*)=:8.3,=&=.5*99*2&3 =+**8+***= µO=5.5*99*=<.9-=).8548&'1*= 9.58_=47=*&(-=+&*(&1=8&251*=&=3*<=89*7.1*=9.5=.8=:8*)=94=57*;*39=(439&2.3&9.43='*9<**3= 8&251*8_=-*=9.5=.8=.38*79*)=).7*(91>=.394=9-*=&3&1=547*=4+=9-*=14'89*7=94=7*24;*=+&*(*8= +742= 9-*= -.3),:9= 7*,.43= .,:7*= ,+_= -*= (411*(9*)= +&*(&1= 2&9*7.&1= .8= .22*).&9*1>= 5.5*99*)= .394= &= +_/= 2O= 2.(74= (*397.+:,*= 9:'*= (439&.3.3,= /**= µO= 4+= 1*= *9-&341_= +9-&341=-&8='**3=8-4<3=94='*=&3=*++*(9.;*=57*8*7;&9.;*=+47=+.*1)=8&251*8=&3)=)4*8=349= 7*6:.7*=+7**?.3,=47=&3>=85*(.&1=-&3)1.3,_=-*=;41:2*=4+=(411*(9*)=+&*(*8=;&7.*8=+742= &5574=.2&9*1>= +*= µO= 94= 4;*7= += 21= )*5*3).3,= 43= 9-*= 8.?*= 4+= 14'89*7= &3)= +:113*88= 4+= -.3),:9=&9=9-*=9.2*=4+=8&251.3,_=

2, = 74/*(9=34_=,**.2*+- = =

= = *.,:7*=,*a= -*= (7&)1*=)*;.(*=)*8.,3*)=&3)=':.19=+47=7*897&.3.3,=14'89*78=<-.1*=8&251*8=(&3='*= 9&0*3=+742=9-*=-.3),:9=7*,.43_==

=

= = *.,:7*=,+a= *&*(&1=(411*(9.43=9*(-3.6:*=:8.3,=&=.5*99*2&3 =+**8+***= µµµ8=5.5*99*=<.9-=).8548&'1*= 9.5=.38*79*)=).7*(91>=.394=9-*=&3&1=547*=4+=&=74(0=14'89*7_= ,*(43)= <*= )*9*72.3*)= .+= +&*(&1= 2&9*7.&1= (4:1)= '*= :8*)= 94= .)*39.+>= 57*>= :8.3,= 241*(:1&7=2*9-4)8_=7*8:198=<*7*=*=97*2*1>=548.9.;*=&3)=&7*=7*5479*)=.3=7*))=*9=&1_= ,**2=8**=55*3).==0_= = -.7)1>`= <*= 3**)*)= 94= )*9*72.3*= 4;*7= <-&9= 9.2*= 5*7.4)= &= 57*>= 85*(.*8= 9<= 8.,3&1= <4:1)='*=)*9*(9*)=.3=14'89*7=+&*(&1=2&9*7.&1_==0*>=)7.;*7=+47=9-.8=<&8=94=)*9*72.3*=.+= 9-*= 57*>= 9<= 8.,3&1= (4:1)= '*= 4'9&.3*)= +742= 14'89*78= 84:7(*)= +742= 97&58= ):7.3,= 74:9.3*=+.8-.3,=45*7&9.438_=7*8:198=+742=9-.8=89:)>=&7*=7*5479*)=.3=7*))=*9=&1_=,**2= 8**=55*3).==0_=3=8:22&7>=9-*8*=7*8:198=)*243897&9*)=9-&9=9-*=57*>=9<=8.,3&1=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 2- = =

<&8=.3.9.&11>=)*9*(9*)=.3=&11=8&251*8=&9=1=-=&+9*7=+**).3,=&3)=<&8=(438.89*391>=)*9*(9*)= .3=&11=8&251*8=:39.1=0*=-=&+9*7=9-*=+**).3,=*5.84)*_=-*7*=<*7*=34=)*9*(9.438=.3=&3>=4+= 9-*=8&251*8=9&0*3=&9=-=&3)=/=-=47=+47=9-*=8.==8&251.3,=9.2*8=+742=00=-=94=30=-=&+9*7= (422*3(*2*39=4+=+**).3,_= = .3&11>`= <*= *=&2.3*)= 9-*= ).*9= 4+= <.1)= 74(0= 14'89*78= :8.3,= &= ,*3*9.(= (143*= 1.'7&7>= &5574&(-= 94= 8(7**3= 57*>= ).;*78.9>= .3= 9-*= (411*(9*)= +&*(&1= 8&251*8_= -.8= &5574&(-= .8= (422431>=:8*)=.3=2.(74'.&1=*(414,>=94=)*9*72.3*='&(9*7.&1=(422:3.9>=(42548.9.43= +742= *3;.7432*39&1= .841&9*8_= ;*= :9.1.?*)= 9-.8= 34;*1= &5574&(-= 94= 57*>= )*9*(9.43= '>= 9&7,*9.3,=9-*=2.94(-43)7.&1=+08=79<=7*,.43`=034<3=94='*=57*8*39=.3=2:19.51*=(45.*8= .3=*;*7>=57*>=(*11=&3)=&184=<.)*1>=:8*)=+47=5->14,*3*9.(=&3&1>8.8_=;*=+.789=&251.+.*)= 9-.8=9<=7*,.43='>=?7=:8.3,=:3.;*78&1=57.2*78=&3)=9-*3=(143*)=9-*=9<=+7&,2*398= .394= '&(9*7.&1= 51&82.)8_= ;*= ,7*<= 9-*= '&(9*7.&= 43= &,&7= 51&9*8= &3)= 9-*3= .841&9*)= &3)= 8*6:*3(*)= 9-*= 51&82.)8_= ;*= :8*= 9-*= <&9.43&1= ?*39*7=+47= .49*(-3414,>=3+472&9.43= = 4:7= 8*6:*3(*8= &,&.389= &11= 5:'1.8-*)= 9<=8*6:*3(*8=:8.3,=9-*=O,=8:.9*=4+=&1,47.9-28_== = >= :8.3,= 9-.8= 8*6:*3(*= &3&1>8.8= <*= <*7*= &'1*= 94= .)*39.+>= 8*;*7&1= 57*>= 85*(.*8= 4+= .39*7*89=.3=<.1)=14'89*7=+&*(&1=8&251*8=(411*(9*)=&74:3)=&82&3=81&3)=.-J=+.=,`=+.2J= +=.3=&3=&7*&=+7*6:*391>=;.8.9*)='>=(422*7(.&1=74(0=14'89*7=+.8-.3,=;*88*18=&'1*=0_== &'1*=0a= -*=+4114<.3,=85*(.*8=-&;*='**3=)*9*(9*)=.3= +4:7= 74(0= 14'89*7= +&*(&1= 8&251*8= '>= :8.3,= ,*3*9.(= (143*= 1.'7&7>= 9*(-3.6:*8= 94= 8(7**3= 57*>= ).;*78.9>_= 73(1:)*)= &7*b= 9-*= 7*1&9.;*= 8.2.1&7.9>`= &8= 5*7(*39= 2&9(-`= '*9<**3= 4:7= 8&251*8= &3)= 9-*= 3*3,&30= !:(1*49.)*= -&9&'&8*`= 9-*= (42243= 3&2*= 4+= 9-*= 57*>= 85*(.*8= )*9*(9*)`= 9-*= -.,-*89= 9&=4342.(= ,74:5= 94= <-.(-= 9-*= -!%= (4:1)= '*= 2&9(-*)= &((:7&9*1>= &3)= &= (422*39= &'4:9=9-*=57*>_=

5*(.*8 = *7(*39=2&9(- = +42243=3&2* =
&9(-=4= +422*39 = .3=3*3,&30 = -.,-*89=1*;*1 = ?(945:8=2&47:2 = 32 = 5&47.=>(945:8 = ,5*(.*8 = 25479&39=85*(.*8 =
1&,:8.& =&3)= 742.& = 3, = 7*)= &.9= ?7&'= &3)= 3+7&47)*7 = D74:5= .3(1:)*8= 2&3>= ,543,*=?7&' = (7&'8 = &8:8=*)<&7)8.. = +** = ,4:9-*73=74(0=O4'89*7 = ,5*(.*8 = ?&33.'&1.82= 47= 57*)&947= 9< = )14742*97&=8*77&9.88.2& = 3+ = *25*7&9*= ;&9*7= ,:'(1&88 = 4471>= 8*6:*3(*)= ,74:5`= ?7.34.)*& = 349= <*11= )4(:2*39*)= .3= D*3&30`=34=85*(.*8=+742= &82&3.&=.3=)&9&'&8* = = -.8(:88.43= 3=9-*=47.,.3&1=574/*(9=)*8(7.59.43=<*=51&33*)=94=*;&1:&9*=8*7414,>=&8=&3=&19*73&9.;*= 9*(-3.6:*= 94= *;&1:&9*= ).*9= .3= 14'89*78_= D.;*3= 9-*= 8:((*88= 4+= 9-*= 9<= 97.&18= 9-*= 8*7414,.(&1= <470= <&8= 349= 5:78:*)_= O.0*= 9-*= 9<= 2*9-4)`= 9-*= 8*7414,.(&1= 2*9-4)= 7*6:.7*8= 9-*= )*;*1452*39= 4+= 85*(.+.(= &39.'4).*8= 94= 1.30= 94= 85*(.+.(= +44)= .9*28_= 4<*;*7`=:31.0*=9-*=9<=2*9-4)`=9-*=8*7414,.(&1=2*9-4)=7*6:.7*8=9-*=:8*=4+=7&''.98= <-.(-= 3**)= 94= '*= 8&(7.+.(*)= .3= )*;*1452*39= 4+= 9-*= &39.'4).*8_= -.8= 7*6:.7*8= *9-.(8= &5574;&1= &3)= .8= (438.)*7&'1*= 247*= *=5*38.;*_= 8= 9-*= 9<= 2*9-4)= <*= -&;*= )*;*145*)= .8= 3438)*897:(9.;*`= )4*839= 7*6:.7*= *9-.(8= &5574;&1= &3)= .8= 8.251*7= &3)=

2. = 74/*(9=34_=,**.2*+- = =

(-*&5*7`= +:9:7*= )*;*1452*398= .3= ).*9&7>= 89:).*8= +47= 14'89*78= &7*= *=5*(9*)= 94= 5:78:*= 9-*=9<=&5574&(-=)*8(7.'*)=&3)=)*;*145*)=.3=9-.8=7*5479_= = -*= 97.&1= 94= :8*= 9-*= (143*= 1.'7&7>= 2*9-4)= 94= )*9*72.3*= 9-*= 7&3,*=4+= 57*)&947>= .9*28= (438:2*)='>=14'89*78=<&8=*=(.9.3,=':9=<*=(438.)*7*)=.9=94='*=944=9.2*=(438:2.3,=&3)= (4891>= &8= &= 1&7,*= (42543*39= 4+= 9-*= 8&251*8= <*7*= 549*39.&11>= 8*1+= 8&251*8= 4+= 9-*= 57*)&947=._*_=(*118=814:,-*)=4++=+742=9-*=).,*89.;*=97&(0_=-*=+4(:8=4+=+:9:7*=89:).*8= 8-4:1)=+4(:8=43=9-*=)*;*1452*39=4+=85*(.+.(=9<=2&70*78=&3)`=&8=9-*8*=&,,7*,&9*=.3= ,*3*9.(=)&9&'&8*8`=&='74&)*7=7&3,*=4+=549*39.&1=57*>=.9*28=(&3='*=8(7**3*)_== = -*7*=.8=&=3*<=2*9-4)='*.3,=)*;*145*)=9-&9=*=(1:)*8=57*)&947=9<=&3)=9-.8=-41)8= 5742.8*=+47=2&=.2.8.3,=9-*=7*9:73=+742=9-*=(143*=1.'7&7>=89>1*=&5574&(-_=-.8=(4:1)= -41)=5742.8*=+47=+:9:7*=).*9&7>=89:).*8_==

-!%=57.2*7=)*;*1452*39= -*=*1*2*39=94=)*9*72.3*=9-*=).*9=4+=74(0=14'89*78=-&8=+4(:8*)=57.2&7.1>=43=34381*9-&1= 57*>=)*9*(9.43=&88&>8_=>+=5&79.(:1&7=.39*7*89=.8=9-*=:8*=4+=9-*=541>2*7&8*=(-&.3=7*&(9.43= ?7`=&=54<*7+:1=241*(:1&7=9*(-3.6:*=94=&251.+>=9<=+742=*3;.7432*39&1=8&251*8_= ;*=.)*39.+.*)=&=3**)=94=)*9*(9=9-*=9<=+742=&=<.)*=7&3,*=4+=7**+=85*(.*8='>=?7=&3)= -&;*=)*;*145*)=&=8:.9*=4+=&88&>8=94=5*7+472=9-.8=+:3(9.43_== = 9*8.,3=4+=?7=57.2*78=+47=)*9*(9.43=4+=85*(.*8=57*8*39=43=&82&3.&3=74(0>=7**+8=-&8= '**3=(4251*9*)_=-*=?7=57.2*78=&7*=)*8.,3*)=94='.3)=8*1*(9.;*1>=94=7*,.438=.3=9-*= +08=7.'4842&1=7<=8*6:*3(*_=-.8=7*,.43=-&8='49-=-.,-1>=(438*7;*)=7*,.438=&8=<*11= &8=7*,.438=<-.(-=&7*=:3.6:*=94=.3).;.):&1=85*(.*8_=;*=-&;*=:8*)=85*(.*8=;&7.&9.43=&3)= &=84+9<&7*='&8*)=(425:9*7=51&9+472`=251.(43=B&72&3=,**.`=94=)*8.,3=?7=57.2*78= '&8*)=:543=&1.,3*)=57*>=8*6:*3(*=)&9&_=3.9.&11>=57*>=9<=8*6:*3(*8=+47=<*7*=+4:3)= .3=9-*==85*(.*8=+47=<-.(-=34= 57*;.4:8=8*6:*3(*=)&9&=<*7*=&;&.1&'1*=<*7*=(411*(9*)=&8=7*+*7*3(*=85*(.2*38_=,*;*7&1= .25479&39=.3;*79*'7&9*8=43=84:9-*73=9*25*7&9*=7**+8=-&;*='**3=8*6:*3(*)=&8=&=5&79=4+= 9-.8= 8*6:*3(*= &3&1>8.8= 574(*88= .3(1:).3,b= Centrostephanus rodgersii, *1.4(.)&7.8= *7>9-74,7&22&`= &3)= *(94(&7(.3:8=9:'*7(:148:8 _= = -*=?7=57.2*78=)*8.,3*)=7&3,*=.3=85*(.+.(.9>=+742=9-*=5->1:2=1*;*1=)4<3=94=9-*= 1*;*1=4+=.3).;.):&1=85*(.*8_=D*3*7&1=57.2*78=-&;*=&17*&)>='**3=5:'1.8-*)=.3=)*9&.1= B&72&3=*9=&1_=,**0_=&'1*=1=)*8(7.'*8=7*(*391>=)*;*145*)=57.2*78=1.89.3,=9-*=8*6:*3(*= 4+=*&(-=57.2*7=&3)=85*(.+.(.9>=4+=*&(-=8*9_ = = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 2/ = =

= &'1*=1a= +/=7.2*78=)*8.,3*)=+47=)*9*(9.43=4+=84:9-*73= 9*25*7&9*= 7**+= 85*(.*8_= !&2*= 4+= *&(-=57.2*7=.8=1.89*)=&8=.8=9-*=57.2*7=8*6:*3(*`=85*(.+.(.9>= &3)= 9&7,*9= 47,&3.82= 43= <-.(-=*&(-=57.2*7=<4708_==

Primer Name Sequence (5'-3') Specificity Target

Hali16sF GGGGTGACTGGGGAACAATAGT Genus Haliotis sp. Hali16sR CTACACCCTCAGGACACCTTAATCC Genus Haliotis sp Plag16sF GACGTGCAAAGGTAGCATA Genus Plagusia sp.

Plag16sR TAATTCAACATCGAGGTCGCA Genus Plagusia sp.

Pallidus16sF CTCGGTGAGATATAA Species Octopus pallidus

Pallidus16sR GTCCCTTTAA Species Octopus pallidus

Maorum16sF GCTCGGTGAGAATAAAAT Species Octopus maorum

Maorum16sR GTCCCTTTAAA Species Octopus maorum

Jas16sF TCAAATATCCTGGGGGACGATAAGACCCTATA Species Jasus edwardsii

Jas16sR CCTTGCCTTCGATAAGGACTCTC Species Jasus edwardsii

Centro16sF TTATTCTCCCCCTGAAATTCACATC Species Centrostephanus rodgersii

Centro16sR CCCTTAAAAGCTTCTGCACT Species Centrostephanus rodgersii

Helio16sF AGCTTACAGCAAAAGT Species *1.4(.)&7.8=*7>9-74,7&22&=

Helio16sR GGTAACTTGTTCCTTTG Species *1.4(.)&7.8=*7>9-74,7&22&= = )).9.43&1=*++479=-&8='**3=).7*(9*)=&9=)*;*145.3,=&=34;*1=3:(1*.(=&(.)=->'7.).?&9.43= &5574&(-=+47=57*>=)*9*(9.43_=>'7.).?&9.43=7*1.*8=:543=*=&(9=2&9(-*8=4+=574'*= 8*6:*3(*8=94=9-*=9<=.3=*3;.7432*39&1=8&251*8_=-*8*=9*(-3.6:*8=-&;*=57.2&7.1>= '**3=&551.*)=94=2.(74'.&1=8>89*28=':9=-&;*=549*39.&1=94='*=:8*)=.3=&3>=+472=4+= 241*(:1&7=)*9*(9.43=&88&>=5*.=*9=&1_=,**-_=;*=-&;*=*=&2.3*)=9-*=:9.1.9>=4+= ->'7.).?&9.43=9*(-3.6:*8=+47=+44)=<*'=&3&1>8.8=.3=9-*=84:9-*73=9*25*7&9*=7**+= *(48>89*2=&3)=&7*=(:77*391>=5:78:.3,=&=8:.9*=4+=&88&>8=<-.(-=(&3='*=&551.*)=94=&3>= ).*9&7>=8&251*=(411*(9*)_=&'1*=2=)*8(7.'*8=9-*=41.,43:(1*49.)*=574'*8=)*8.,3*)=+47= 9<=->'7.).8&9.43=&88&>8_= = =

20 = 74/*(9=34_=,**.2*+- = =

= &'1*=2a=
41*(:1&7= 574'*8= )*8.,3*)= +47= )*9*(9.43= 4+= 84:9-*73= 9*25*7&9*= 7**+= 85*(.*8= '>= ->'7.).?&9.43= &88&>_= !&2*= 4+= *&(-= 574'*= .8= 1.89*)= &8= .8= 9-*= 574'*= 8*6:*3(*`= 85*(.+.(.9>=&3)=9&7,*9=47,&3.82=94=<-.(-=*&(-=574'*='.3)8_== = = =

Probe Name Sequence (5'-3') Specificity Target

Abalone CTACACCCTCAGGACACCTTAATCC Genus Haliotis sp. Lobster CCTTGCCTTCGATAAGGACTCTC Species Jasus edwardsii Mussel CCTACCCTTAGAGGCTTCTACACCTCT Species Mytilus edulis

Shore Crab AATTACCGCGGCCTTTAAATTTTTA Species Plagusia chabrus

Octopus1 GATGCGGCCTCGATGTTGGATTAAAAATAAC Species Octopus maorum

Octopus2 AGATTGCGACCTCGATGTTGGATTAAAAATAAC Species Octopus pallidus =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 21 = =

-_,=;&1:&9.43=4+=89&'1*=.84945*8=&3)=+&99>= &(.)=8.,3&9:7*=2*9-4)414,>= = 73974):(9.43= 3= &)).9.43= 94= 9-*= 9<= 2*9-4)= <*= &184= *=5147*)= 9-*= :8*= 4+= 49-*7= 241*(:1&7= 9*(-3.6:*8`=85*(.+.(&11>=89&'1*=.84945*8=&3)=+&99>=&(.)=8.,3&9:7*8_== -*=9<=2*9-4)=)*9*(98=<-&9=-&8='**3=*&9*3=.3=9-*=1&89=43*=47=9<4=2*&18=)*5*3).3,= 43=,:9=&3)=.39*89.3&1=*;&(:&9.43=7&9*8_=3=(4397&89`=9-*=97&(*7=9*(-3.6:*8=1440=&9=<-&9= -&8='**3=.3(47547&9*)=.394=9-*='4)>=9.88:*=&3)=9-:8=574;.)*=&3=.3).(&9.43=4+=143,*7= 9*72=2439-8=+**).3,=57*+*7*3(*8=)*5*3).3,=43=9.88:*=9:734;*7=7&9*_= 19-4:,-= 9-*= 89&'1*= .84945*= &3)= +&99>= &(.)= 97&(*78= &7*= 1*88= 85*(.*8= 85*(.+.(`= <*= *3;.8&,*)= 9-&9= &= (42'.3&9.43= 4+= 9-*= 9<= &3)= 9-*= 97&(*78= <.11= 574;.)*= 9-*= '*89= 7*841:9.43=4+=).*9&7>=.39&0*='>=14'89*78=.3=9-*=+:9:7*_= = 4= )*243897&9*= 9-*= &551.(&'.1.9>= 4+= 9-*= (42'.3*)= 89&'1*= .84945*= &3)= +&99>= &(.)= 8.,3&9:7*=&5574&(-=<*=*=&2.3*)=&=8:'88*9=4+=9-*=)&9&='&8*)=43=&=57.2&7>=574):(*7= '*39-.(= 2&(74= &1,&*= &3)= 57.2&7>= (438:2*7= &'&143*= D:*89= *9= &1_= ,**2b= 8**= 55*3).==1_=;*=9-*3=*=5&3)*)=9-.8=<470=94=1440=&9=).++*7*3(*8=.3=9-*8*=9<4=+4728=4+= 2*97.(8= +47= 74(0= 14'89*78= '*9<**3= +.8-*)= &3)= 3438+.8-*)= 14(&9.438= D:*89= *9= &1_= .3= 7*;.*<b=8**=55*3).==2_= =
&9*7.&18=&3)=2*9-4)8= ,**=&55*3).(*8=1=&3)=2=+47=)*9&.18_= = /*8:198=&3)=).8(:88.43= ?4397&).(947>=94=(42243='*1.*+`=9-*=89&'1*=.84945*=&3)=+&99>=&(.)=8.,3&9:7*=&3&1>8*8= )*243897&9*)= 9-&9= &'&143*`= +742= 9-*= 8.9*8= 8&251*)= 43= 9-*= +&89= ?4&89= 4+= &82&3.&`= 57*+*77*)=94=(438:2*='74<3=7&9-*7=9-&3=7*)=&1,&*_=-.8=<&8=9-*=+.789=.3).(&9.43=4+=9-*= 57*+*7*3(*=+47='74<3=&1,&*=+47=84:9-*73=9*25*7&9*=7**+=&'&143*_=:9:7*=89:).*8=3**)= 94=)*9*72.3*=.+=9-.8=57*+*7*3(*=.8=(438.89*39=&(7488=&11=9*25*7&9*=7**+=85*(.*8_= = 83+479:3&9*1>=9-*=8.,3&9:7*8=+47= -*&19->='74<3=&1,&*=&3)=)*(&>.3,='74<3=&1,&*=9-&9= (4:1)= *39*7= 9-*= ).*9= 9-74:,-= 9-*= )*97.9&1= 5&9-<&>= (4:1)= 349= '*= 8*5&7&9*)_= :9:7*= 89:).*8=9-&9=&99*259=94=*1:(.)&9*=9-*8*=5&9-<&>8=8-4:1)='*=.3;*89.,&9*)_= = ,4:9-*73= :897&1.&= -&8= &= 7.(-= &3)= ).;*78*= 2&(74&1,&1= (422:3.9>= &3)= )*9*72.3.3,= <-.(-=85*(.*8=(4397.':9*=94=9-*=&'&143*=).*9=7*6:.7*8=+:79-*7=<470_=-*=)*;*1452*39= 4+=9<=85*(.+.(=2&70*78=+47=*&(-=4+=9-*=549*39.&1='74<3=2&(74&1,&*=85*(.*8=<4:1)='*= &3=&557457.&9*=+:9:7*=459.43_=

22 = 74/*(9=34_=,**.2*+- = =

-*= (425&7.843= 4+= 74(0= 14'89*7= ).*9= <&8= '&8*)= 43= &= 7*1&9.;*= (425&7.843= 4+= :7(-.3`= 2411:8(=&'&143*=&3)=9:7'4`=&8(.).&38`='74<3=&3)=7*)=&1,&*=(42543*398=4+=9-*=).*9_= -*= 89&'1*= .84945*= &3&1>8.8= ).)= 574;.)*= *;.)*3(*= 4+= ).++*7*3(*8= .3= 9-*= ).*98= 4+= 74(0= 14'89*78= <.9-.3= 2&7.3*= 7*8*7;*8= (425&7*)= 94= &)/&(*39= +.8-*)= 8.9*8_= &99>= &(.)= 8.,3&9:7*8=).)=349=+.3)=8.,3.+.(&39=).++*7*3(*8='*9<**3=7*8*7;*=&3)=+.8-*)=8.9*8=':9=).)= 574;.)*=.38.,-98=.394=9-*=).*9=57*+*7*3(*=+47=14'89*78_= = = 8:757.8.3,= 7*8:19= <&8= 9-*= 57*+*7*3(*= +47= &8(.).&38= .3= 9-*= +.8-*)= 8.9*8= &3)= :7'4= ,&897454)= 2411:8(= .3= 9-*= 7*8*7;*= 8.9*_= ;-.1*= ).;*78= -&)= 7*5479*)= 4'8*7;&9.438= 4+= 14'89*78= *&9.3,= &8(.).&38= .3= 9-*= +.*1)`= 9-*>= -&;*= 8*1)42= '**3= 7*5479*)= .3= 57*;.4:8= 89:).*8=4+=14'89*7=).*98_=19-4:,-=34=6:&39.9&9.;*=&88*882*39=4+=&8(.).&3=&':3)&3(*8= .3=9-*=7*8*7;*=&3)=+.8-*)=8.9*8=.8=&;&.1&'1*`=&8(.).&38`=):*=94=9-*.7=8*88.1*=3&9:7*=&3)= 7*6:.7*2*39= 94= +.19*7= +**)= <4:1)= '*= 14(&9*)= 43= 7*1&9.;*1>= *=548*)= -&'.9&9= (+_= 57*8 *2*7,*39=/:;*3.1*=&'&143*=47=:7(-.38_=3=.3(7*&8*=.3=9-*=)*38.9>=&3)=&':3)&3(*=4+= 14'89*78=.3=&=7*8*7;*=<4:1)='*=*=5*(9*)=94=7*):(*=&=3472&11>=&':3)&39=+44)=84:7(*= &3)=9-:8=7*6:.7*=&=8-.+9=94=&3=&19*73&9.;*=85*(.*8_=-*=8<.9(-=94=:7'4=.3=9-*=7*8*7;*)= 8.9*8=2&>=7*+1*(9=9-*=)*(1.3*=.3=&8(.).&38=):*=94=.3(7*&8*)=57*)&9.43=57*88:7*=&3)=9-*= 8<.9(-= 94= &3= &19*73&9.;*= +44)= 84:7(*_= -.8= .8= +:79-*7= 7*+1*(9*)= .3= 9-*= .3(7*&8*= .3= 9-*= 5745479.43&1=(4397.':9.438=4+=49-*7=85*(.*8=.3(1:).3,=&'&143*=&3)=:7(-.38_= = *7+472&3(*=.3).(&9478= )*39.+.(&9.43=4+=9-*=2489=&557457.&9*=2*9-4)=+47=:3)*79&0.3,=57*)&947=57*>=&3&1>8*8_= +=8:((*88+:1`='49-=9-*=8*7414,.(&1=&3)=9<=2&70*78=<4:1)='*=:8*)=43=49-*7=85*(.*8= 034<3=94=.39*7&(9=47=(425*9*=<.9-=14'89*78_=+=9-*=9<=2*9-4)=<*7*=8:((*88+:1=9-*3= 9-*8*= 2&70*78= <4:1)= (422*3(*= &= )&9&'&8*= 4+= 84:9-*73= 9*25*7&9*= 7**+= 85*(.*8_= -*= 2489=*=5*38.;*=(42543*39=4+=9-*=9<=<470=.8=9-*=)*;*1452*39=4+=9-*=2&70*7_=>3(*= )*;*145*)`= 9-*= 2&70*7= <4:1)= '*= &;&.1&'1*= +47= 49-*7= 7*8*&7(-*78= &9= &= 8:'89&39.&11>= (-*&5*7=(489_=8=247*=2&70*78=&7*=&))*)=94=9-*=)&9&'&8*`=&3.2&18=<.11='*=&'1*=94='*= 8(7**3*)=+47=&=7&3,*=4+=549*39.&1=57*>=.9*28_ = -*=574/*(9=+4:3)=9-&9=9<=2&70*78=<*7*=&=57*+*77*)= 2*9-4)= 4+= 4'9&.3.3,= ).*9&7>= .3+472&9.43= +742= 14'89*78= .3= (4397&89= 94= ,:9= &3&1>8.8= 9-&9= 7*6:.7*8= 8&(7.+.(.3,= 9-*= &3.2&1_= -*= 1.2.9&9.43= 4+= 9-*= 9<= <470= .8= 9-&9= .9= .8= 431>= 8:.9&'1*= 94= )*9*(9= 9-*= 57*8*3(*= 4+= 57*>= .9*28= 9-&9= &17*&)>= -&;*= 57.2*78= 2&70*78= )*;*145*)_= -.8= 574/*(9= -&8=)*;*145*)=&=3:2'*7=4+=2&70*78=+47=84:9-*73=9*25*7&9*=7**+8=9-&9=<.11='*=14),*)= 43= ,*3*9.(= )&9&'&8*8= +47= +:9:7*= 7*8*&7(-*78_= <*<= 574/*(98= &7*= &17*&)>= :8.3,= 9-*8*= 2&70*78= *_,_= 79?= *397489*5-&3:8 = 574/*(9= &3)= .9= .8= &39.(.5&9*)= 9-&9= 9-.8= )&9&'&8*= <.11=.3(7*&8*=&8=+:9:7*=574/*(98=+4(:8=43=3*<=85*(.*8_= -*=574/*(9=&184=)*;*145*)=&=34381*9-&1=2*9-4)=+47=(411*(9.3,=14'89*7=+&*(&1=2&9*7.&1= 9-&9=&114<8=8&251*8=94='*=(411*(9*)=+742=2&7.3*=7*8*7;*8=&3)=(422*7(.&1=;*88*18_= =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 23 = = .= +425&7.843=4+=9-*=+47&,.3,=7&3,*= &3)=-&'.9&9=:8&,*='>=14'89*78=.3= +.8-*)=&3)=:3+.8-*)=7*,.438=

73974):(9.43= 19-4:,-=9-*=.25&(98=4+=*=514.9&9.43=43=&':3)&3(*=&3)=8.?*=(42548.9.43=-&;*='**3= <.)*1>=7*5479*)=+47=*=514.9&'1*=+.8-=894(08`=9-*7*=7*2&.38=&=1&(0=4+=034<1*),*=43=9-*= 1.0*1>=&19*7&9.43=4+=9-*='*-&;.4:7=4+=*=514.9*)=894(08=&8=&=7*8:19=4+=9-*8*=.25&(98_=-*= ;&89=2&/47.9>=4+=89:).*8=*=&2.3.3,=&3.2&1='*-&;.4:7=.3=9-*=2&7.3*=*3;.7432*39=-&;*= '**3=:3)*79&0*3=43=545:1&9.438=<-*7*=8.?*8=&3)=)*38.9>8)*5*3)*39=*++*(98=(&3349='*= *=&2.3*)= ):*= 94= 9-*= .25&(98= 4+= *=514.9&9.43= 43= 545:1&9.43= 897:(9:7*_= -*= ,14'&1= .251*2*39&9.43=4+=2&7.3*=5749*(9*)=&7*&8=58=574;.)*8=&=;&1:&'1*=455479:3.9>=94= *=&2.3*=9-*='*-&;.4:7=4+=9&7,*9*)=85*(.*8=.3=8.9:&9.438=<-*7*=(422:3.9>=)>3&2.(8= &3)=85*(.*8=.39*7&(9.438=247*=(148*1>=7*8*2'1*=9-48*=57*8)&9.3,=+.8-.3,_=25479&391>= 9-*= 5= 574;.)*8= &= '&8*1.3*= &,&.389= <-.(-= (425&7.8438= (&3= '*= 2&)*= 94= +.8-*)= 14(&9.438=94=*=5147*=9-*=*++*(98=4+=+.8-.3,_

-*= 84:9-*73= 74(0= 14'89*7= &8:8= *)<&7)8.. = .8= &= )42.3&39= 57*)&947= 4+= '*39-.(= .3;*79*'7&9*8=.3=*&89*73=&82&3.&=*)*7843=]=B4-3843=,**0`=&3)=8:554798=+.8-*7.*8= <479-=.3=*=(*88=4+=8N1*=2.11.43=5*7=&33:2=7+`=,**1_=4<*;*7`=(422*7(.&1= &3)= 7*(7*&9.43&1= *=514.9&9.43= -&8= 8.,3.+.(&391>= 7*):(*)= 9-*= &':3)&3(*= &3)= &;*7&,*= 8.?*=4+=14'89*78= &8:8=*)<&7)8.. =.3=*&89*73=&82&3.&=94='*9<**3=9<4=&3)=*.,-9=5*7=(*39= 4+= 9-*= ;.7,.3= 1*,&188.?*)= '.42&88= 7:8-*7`= +331_= ,.3(*= 9-*= )*(1&7&9.43= 4+= 2&7.3*= 5749*(9*)= &7*&8= .3= *&89*73= &82&3.&= .3= +33+`= 9-*= &':3)&3(*= &3)= &;*7&,*= 8.?*= 4+= _= *)<&7)8.. =.38.)*=9-*=5749*(9*)=&7*&8=-&8=8.,3.+.(&391>=.3(7*&8*)=(425&7*)=94=&)/&(*39= +.8-*)=-&'.9&98=+),&7=]=&77*99`=+333b=:=943=*9=&1_`=,**0b=&77*99=*9=&1_`=,**1_=5489= 349&'1>`= 14'89*7= '.42&88= .38.)*= 9-*= 1&7,*89= 5= &9= 5&7.&= 81&3)= 55= .8= 34<= *89.2&9*)=94='*=,*=9.2*8=9-&9=4+=&)/&(*39=+.8-*)=&7*&8=&3)=2&>=34<=7*8*2'1*=14'89*7= 545:1&9.438= 57*8)&9.3,= 9-*= +.8-*7>= <_= &77*99_= 5*78_= (422__= ?4.3(.).3,= <.9-= 9-*= .3(7*&8*8=.3=&;*7&,*=8.?*=&3)=&':3)&3(*=4+=74(0=14'89*78=.38.)*=9-*=55=-&;*='**3= &3*()49&1= 7*54798= 9-&9= 9-*= '*-&;.4:7= 4+= .3).;.):&18= 2&>= '*= )*38.9>= &3)= 8.?*= )*5*3)*39= &3)= 24)*7&9*)= '>= .397&885*(.+.(= (425*9.9.;*= .39*7&(9.438_= O&7,*= 14'89*78= 1+-*= 22= ?O= +*2&1*8= &3)= 1+.*= 22= ?O= .3= 2&1*8`= <-.(-=&7*=7&7*=.3=&)/&(*39=&7*&8= 45*3=94=+.8-.3,`=&7*=4+9*3=4'8*7;*)='>=).;*78=+47&,.3,= ):7.3,= '49-= 9-*= )&>= &3)= 9-*= 3.,-9`=<-.1*=9-*=&(9.;.9>=4+=82&11=14'89*78`='49-=2&1*8=&3)=+*2&1*8=.8=1&7,*1>=:3034<3_======-*= )*;*1452*39= 4+= :197&843.(= &(4:89.(= 97&382.99*78= 4;*7= 9-*= 5&89= 9<4= )*(&)*8= -&8= 7*;41:9.43.8*)= 9-*= <&>= .3= <-.(-= 9-*= 24;*2*39`= &(9.;.9>= &3)= '*-&;.4:7= 4+= 2&7.3*= 85*(.*8`=.3(1:).3,=14'89*78`=&7*='*.3,=7*(47)*)=90.3843=*9=&1_`=,**/b=D41*9=*9=&1_`=,**0_=

3* = 74/*(9=34_=,**.2*+- = =

;-*3= :8*)= .3= (43/:3(9.43= <.9-= &:942&9*)= 9*1*2*97>= 8>89*28= 9-*= 14(&9.43= 4+= .3).;.):&1= 97&382.99*78= (&3= '*= 97.&3,:1&9*)= .3= 3*&7= 7*&189.2*= <.9-= &= 548.9.43&1= &((:7&(>= 4+= +:,= 2*97*8= &3)= 4;*7= *=9*3)*)= 5*7.4)8= C7= 8>89*28`= C+5?>= O9)`= &1.+&=`= ?&3&)&_= ;.9-= 9-*= &);*39= 4+= 9-.8= 9*(-3414,>`= 9-*= .251*2*39&9.43= 4+= 58`= &3)= 9-*= *=5&3).3,= &((*59&3(*= 4+= ,*4,7&5-.(&1= .3+472&9.43= 8>89*28= .3= +.8-*7.*8= 8(.*3(*`= 9-*= '*-&;.4:7= 4+= 2&3>= 2&7.3*= 85*(.*8= (&3= '*= .3;*89.,&9*)= .3= 2:(-= ,7*&9*7= )*9&.1= 9-&3= 57*;.4:81>= 5488.'1*_= ;*= *89&'1.8-*)= &= 3*9<470= 4+= 7*249*= :197&843.(= &(4:89.(= 7*(*.;*78= 94= 7*(47)= 9-*= +.3*88(&1*= 24;*2*39= 5&99*738= 4+= 74(0= 14'89*78= .3= &= +.8-*)=&3)=3438+.8-*)=5=8.9*=.3=*&89*73=&82&3.&=94=)*9*72.3*=.+=*=514.9&9.43=&3)= 9-*=7*24;&1=4+=1&7,*=14'89*78=-&8=&19*7*)=9-*='*-&;.4:7=4+=9-.8=85*(.*8=&3)=9-:8=.98=741*= .3=9*25*7&9*=7**+=*(48>89*28_= =
*9-4)8= .9*=8*1*(9.43= -*= 24;*2*39= &3)= '*-&;.4:7= 4+= 14'89*78=  &8:8= *)<&7)8.. = <&8= )4(:2*39*)= &9= 9<4= 8.9*8= .3=*&89*73=&82&3.&3='*9<**3=5&>=,**0=&3)=<4;*2'*7=,**1=94=)*9*72.3*=9-*= 5488.'1*=.25&(98=4+=*=514.9&9.43=94=:3+.8-*)=894(08_=4=*=&2.3*=8.?*885*(.+.(=*++*(98=<*= 243.947*)=9-*=24;*2*39=&(9.;.9>=4+=14'89*78=.38.)*=&=2&7.3*=5749*(9*)=&7*&=&3)=&9=&= 8.9*)=<-*7*=+.8-.3,=-&8=7*):(*)=9-*=&;*7&,*=14'89*7=8.?*=&3)=&':3)&3(*_=54;*2*39= &3)='*-&;.4:7=4+=14'89*78=<&8=)*7.;*)=+742=)&9&=(411*(9*)=:8.3,=&3=:197&843.(=&(4:89.(= 9*1*2*97>=8>89*2=94=)*9*72.3*=9-*=57*(.8*=14(&9.43=4+=9&,,*)=.3).;.):&18=8**='*14<= +47=5*7.4)8=:5=94=*.,-9=<**08=.3=):7&9.43_== = 4114<.3,=+2=>*&78=4+=5749*(9.43=+742=+.8-.3,=&(9.;.9>`=7**+8=<.9-.3=9-*=5&7.&=81&3)= 5&7.3*= 749*(9*)= 7*&= 55= 43= 9-*= *&89= (4&89= 4+= &82&3.&= 8:55479= ).;*78*= 2&(74&1,&1`=)*2*78&1=+.8-=&3)=.3;*79*'7&9*=(422:3.9.*8=).89.3(91>=).++*7*39=94=9-48*=.3= 8:774:3)=-&'.9&98=45*3=94=+.8-.3,=+),&7=]=&77*99`=+333b=:=943=*9=&1_`=,**0b=&77*99=*9= &1_`=,**1_=O4'89*7=545:1&9.438=<.9-.3=9-*=5=&7*=2&)*=:5=4+=&='74&)=7&3,*=4+=8.?*= (1&88*8= ':9= &7*= )42.3&9*)= '>= 1&7,*= 2&9:7*= .3).;.):&18`= &3)= (438.)*7*)= 94= 7*8*2'1*= 545:1&9.438=57.47=94=9-*=*89&'1.8-2*39=4+='49-=(422*7(.&1=&3)=7*(7*&9.43&1=+.8-*7.*8_= 3=(4397&89`=14'89*7=545:1&9.438=&9=8.9*8=*=548*)=94=+.8-.3,=&(9.;.9>=.3=*&89*73=&82&3.&= -&;*=+*<*7=8.?*=(1&88*8=&3)=&7*=)42.3&9*)='>=82&11=.3).;.):&18='*14<=9-*=2.3.2:2= 1*,&11>= *=514.9&'1*= 8.?*= 4+= +*/= &3)= ++*= 22= ?O= +47= 2&1*= &3)= +*2&1*= 14'89*78= 7*85*(9.;*1>_== = -*=89:)>=8.9*=.38.)*=9-*=5=<&8=14(&9*)=&5574=.2&9*1>=/**=2*97*8=+742=8-47*=43= &3= .841&9*)= 5&9(-= 4+= 2*).:28574+.1*= 74(0>= 7**+`= .39*785*78*)= <.9-= 8*&,7&88= '*)8= ;489*7&= 9&82&3.(& `= 8&3)= +1&98= &3)= 5&9(-= 7**+= (1:258= 4+= '4:1)*78= .39*785*78*)= '>= 8&3)_=-*=&;*7&,*=)*59-=&9=9-*=8.9*=<&8=+,=2*97*8=&3)=8.9:&9*)=43=9-*=)**5*89=&3)= 2489=*=9*38.;*=8*(9.43=4+=(439.3:4:8=7**+=.38.)*=9-*=5_=-*=8.9*=*=548*)=94=+.8-.3,= &(9.;.9>=7*+*77*)=94=-*7*&+9*7=&8=9-*=+.8-*)=8.9*=<&8=8.9:&9*)=/*=0.142*97*8=&<&>=43= 9-*=&82&3=*3.38:1&=&3)=45*3=94='49-=7*(7*&9.43&1=&3)=(422*7(.&1=+.8-.3,=&(9.;.9>_= -*=-&'.9&9=&9=9-*=+.8-*)=8.9*=<&8=)42.3&9*)='>=1&7,*=&7*&8=4+=(439.,:4:8=14<8574+.1*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 3+ = =

7**+= &3)= 8:55479*)= 8.2.1&7= (422:3.9.*8= 4+= 2&(74&1,&*=&8=9-*=55_=4<*;*7`=.9= <&8= 247*= *=548*)= 94= 4(*&3= 8<*11= &3)= -&)= &3= &;*7&,*= )*59-= 4+= ,0= 2*97*8_= ;-.1*= 8:.9&'1*=8.9*8`=8.2.1&7=.3=*=548:7*=&3)=)*59-=7&3,*`=2&>=-&;*='**3=8*1*(9*)=(148*7=94= 9-*= 55= &3)= <.9-.3= 5*7(:7>= &88&,*`= 9-*= 8.9*= 43= &82&3= *3.38:1&= <&8= (438.)*7*)= 7*57*8*39&9.;*= 4+= &7*&8= 9&7,*9*)= '>= '49-= 7*(7*&9.43&1= &3)= (422*7(.&1= +.8-*7.*8=&3)='*99*7=8:.9*)=94=9-*=)*514>2*39=4+=9-*=9*1*2*97>=8>89*2`=<-.(-=7*6:.7*8= 1&3)8'&8*)=+&(.1.9.*8=94=45*7&9*=9-*=7&).4='&8*889&9.43_== = 1&'.9&9=(1&88.+.(&9.43=&3)=+*&9:7*=.)*39.+.(&9.43= = )*9&.1*)= 8:7;*>= 4+= 9-*= '*39-.(= -&'.9&98= <&8= (43):(9*)= .3= 57.1= ,**0= 57.47= 94=9-*= *89&'1.8-2*39= 4+= 9-*= &(4:89.(= 9*1*2*97>= 8>89*2= +4114<.3,= 9-*= 2*9-4)8= )*9&.1*)= '>= B47)&3=*9=&1_=,**/&_=4:7=2&.3=-&'.9&9=(&9*,47.*8=(439.,:4:8=7**+`=5&9(-=7**+`=8&3)`= &3)=8*&,7&88=<*7*=*&8.1>=)*+.3*)=9-74:,-=;&7.&9.438=.3=9-*=+.789=&3)=8*(43)=*(-4*8=.3= 9-*= *(-4,7&2= (411*(9*)= '>= &= 8.3,1*8'*&2= 8(.*39.+.(= 84:3)*7= ,.27&)= +E0*_= &'.9&9= '4:3)&7.*8= <*7*= .)*39.+.*)= +742= 8947*)= *(-4,7&28= &3)= ,74:3)897:9-*)= :8.3,= ;.)*4= +449&,*= &3)= &997.':9*)= .394= 9-*= ;*88*1= 97&(0= 14,= :8.3,= 7(&)= ;0_*= +3;.7432*39&1= ,>89*28=7*8*&7(-=389.9:9*`=+,7=<.9-=9-*=7*8:19.3,=-&'.9&9=2&5=,*3*7&9*)=.3=7(D,= .,:7*=,,_= =

= *.,:7*=,,= =&251*=4+=-&'.9&9=2&5=<.9-=14'89*7=24;*2*398= 7*)= &3)= >*114<= 1.3*8= &3)= 3/= )&70='1:*=&3)=/*=1.,-9='1:*=574'&'.1.9>=0*73*18=94=)*+.3*=-42*=7&3,*8_= = 4=)*9*72.3*=-4<=14'89*78=.39*7&(9=<.9-=9-*=+.3*88(&1*=945414,.(&1=+*&9:7*8`=&='*39-.(= (4251*=.9>=24)*1`=<-.(-=(&3=.)*39.+>=+.3*88(&1*=2475-42*97.(=+*&9:7*8=.3=7**+=-&'.9&9`=

3, = 74/*(9=34_=,**.2*+- = =

<&8= ,*3*7&9*)= +47= 9-*= 8.9*= +4114<.3,= 9-*= 2*9-4)8= )*8(7.'*)= '>= O:(.**7= ]= *)*7843= ,**2`=.,:7*=,-_=7.*+1>`='&9->2*97.(=)&9&=<&8=574(*88*)=94=(7*&9*=&=:3.+472=,7.)=&9=&= 57*8)*+.3*)=7*841:9.43=/=2===/=2=,7.)=(*118=.3=9-.8=(&8*`=&3)=9-*=7*1&9.438-.5='*9<**3= 9-*= *1*;&9.43= 4+= *&(-= (*11= <.9-= 9-*= *.,-9= 3*.,-'4:7.3,= (*118= <&8= )*9*72.3*)_= -*= 574(*88= <&8= .9*7&9*)= :39.1= 9-*= ,7.)= (*11= 8.?*= 7*&(-*)= ,/= 2= == ,/= 2= &3)= ,/= 3*.,-'4:7-44)= *1*;&9.43= 7*1&9.438-.58= -&)= '**3= (1&88.+.*)= +47= *&(-= ,7.)= (*11_= -*= 3*.,-'4:7-44)=*1*;&9.43=7*1&9.438-.58=<*7*=(425.1*)`=<.9-=*&(-=(*11='*.3,=&88.,3*)= 94= 43*= 4+= 8.== +*&9:7*= (1&88*8= +47= *&(-= 4+= 9-*= .9*7&9.438_= -*= ,7*&9*7= 9-*= 3:2'*7= 4+= (1&88.+.(&9.438= 94= 9-*= 8&2*= (1&88`= 9-*= -.,-*7= 9-*= 574'&'.1.9>= 9-&9= &=(*11= <&8= .)*39.+.*)= (477*(91>=&9=2:19.51*= 85&9.&1= 8(&1*8_=-*=7*8:19.3,=24)*1=51&(*)=(*118= .394=8.==).89.3(9= 2475-42*97.(=+*&9:7*8a=7.),*8`=51&3*8`=5*&08`=5.98`=5&88*8=47=(-&33*18=8**=O:(.**7=]= *)*7843= ,**2= +47= )*9&.18_= -.8= 574(*):7*= <&8= 5*7+472*)= 43= '&9->2*97.(= )&9&= (411*(9*)= &9= *&(-= 8.9*= 94= 574):(*= .3).;.):&1= -&'.9&9= (4251*=.9>= 2&58= 94= &114<= 8.9*8 85*(.+.(=-&'.9&9=&884(.&9.438=94='*=)*9*72.3*)_= = = =

= = *.,:7*=,-= *742= '&9->2*97.(= ).,.9&1= *1*;&9.43= 24)*18`= ).89.3(9= 7**+= 2475-42*97.(= +*&9:7*8= (4:1)= '*= (1&88.+.*)= &3)= 6:&39.+.*)= '&8*)= :543= 9-*.7= 9-7**8).2*38.43&1= 8-&5*_= .== +*&9:7*8`=.3(1:).3,=5*&08`=5&88*8`=5.98`=51&.38`=(-&33*18=&3)=7.),*8`=(4:1)='*=7*&).1>= .)*39.+.*)=&9=&82&3=*3.38:1&=&3)=
&7.&=781&3)=8.9*8=+.,:7*=24).+.*)=+742=E44)= +330_== =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 3- = =

&'1*=3= (-*):1*=4+=&(4:89.(=9&,,.3,=*;*398_= 2006 2007 Jul Jul Jul Apr Apr Oct Oct Oct Jun Jun Jan Jun Feb Feb Mar Aug Aug Sep Nov Dec Aug Sep Nov May May May

Unfished (MPA) 35 36 21 16 Fished 8 18 18 12

Life history

Peak Activity

Mating

Moulting

Egg release = O4'89*78=<*7*=9&,,*)=):7.3,=+4:7=).89.3(9=8*&8438=4;*7=&=+,82439-=5*7.4)=94=(&59:7*= 24;*2*39=&(9.;.9>=):7.3,=9-*=5*&0=4+=&(9.;.9>=&3*()49&1=7*54798`=2&9.3,`=24:19.3,= &3)=*,,=7*1*&8*=&'1*=3_=9:*=94=9-*=14<=&':3)&3(*=&3)=(4251*9*=&'8*3(*=4+=1&7,*= 14'89*78`=&=949&1=4+=/0=82&11=14'89*78=<*7*=9&,,*)=&9=9-*=+.8-*)=8.9*_=;.9-.3=9-*=55`= +*2=14'89*78=<*7*=9&,,*)=4;*7=9-*=+4:7=8*&8438_== = 84'89*7=9&,,.3,=&3)=9*1*2*97>= O4'89*78=<*7*=(411*(9*)=+742=9-*=7**+=-&'.9&98=<.9-.3=*&(-=89:)>=8.9*='>=*=5*7.*3(*)= ,?8=).;*78=94=*38:7*=.3).;.):&18=<*7*=349=5->8.(&11>=)&2&,*)=':9=<*7*=-&3)1*)= (&7*+:11>=94=7*):(*=9&,,.3,8&884(.&9*)='.&8*8_=O4'89*78`=.3(1:).3,=2&1*8=&3)=+*2&1*8`= 7&3,.3,=.3=8.?*=+742=3,:,**=22=?O=+742=9-*=55`=&3)=2/:++/=22=?O=+742=9-*= +.8-*)= 8.9*= <*7*= 9&,,*)= :8.3,= 9<4= 89>1*8= (4)*)= &3)= (439.3:4:8= 4+= &(4:89.(= 97&382.99*78= 2.7.== ,>89*28`= C*2(4= 9.;.8.43_= 7.47= 94= 9-*= &99&(-2*39= 4+= &(4:89.(= 97&382.99*78`= 14'89*78= <*7*= '74:,-9= 94= 9-*= 8:7+&(*`= 9-*= 1*3,9-= 4+= 9-*= (&7&5&(*= <&8= 2*&8:7*)= :8.3,= 03.+*8*),*= (&11.5*78`= &3)= 9-*= 14'89*78= <*7*= 8*5&7&9*)= .394= 9<4= 8.?*= (1&88*8_= O4'89*78= 0+*/= 22= +47= +*2&1*8= &3)= 0++*= 22= +47= 2&1*8= 7*57*8*39.3,= 9-*= 2.3.2:2=1*,&1=(&9(-=8.?*=.3=9-*=&)/&(*39=+.8-*7>=<*7*=(1&88*)=&8=82&11=&3)=14'89*78= 1+-*=22=+47=+*2&1*8=&3)=1+.*=22=+47=2&1*8=<*7*=(438.)*7*)=1&7,*_=4=*38:7*=*&(-= 9&,,*)=14'89*7=<4:1)=(&77>=&=8.2.1&7=<*.,-9=5745479.43&1=94=9-*.7=2&88`=9-*=(&7&5&(*= 1*3,9-= 4+= *&(-= .3).;.):&1= <&8= :8*)= 94= )*7.;*= &= <*9= <*.,-9= +742= &= 57*)*9*72.3*)= 7*1&9.438-.5=&3)=&88.,3*)=&=97&382.99*7=<-48*=.38<&9*7=<*.,-9=<&8=34=247*=9-&3=/= 4+= 9-*= 14'89*78= '4)>= <*.,-9= 94= 7*):(*= &3>= .25*).2*39= 94= 3472&1= 24;*2*39= ?&((&2.8*=]=*).3`= +32/_=7&382.99*78=<*7*=.38*79*)=.394=&=8*(9.43=4+=8.1.(43=9:'*= &5574=.2&9*1>=+*=2.11.2*97*8=143,*7=9-&3=9-*=97&382.99*7=94=+&(.1.9&9*=*&8>=&99&(-2*39= 94=9-*=14'89*78_=-*=(&7&5&(*=4+=*&(-=14'89*7=<&8=9-*3=)7.*)=:8.3,=(4257*88*)=&.7=94= *38:7*=84:3)=&99&(-2*39=4+=9-*=97&382.99*7=:8.3,=&=9<485&79=+&89=8*99.3,=*=45>=7*8.3= &551.*)=94='49-=9-*=8.1.(43=9:'.3,=&3)=9-*=)7.*)=(&7&5&(*_== = &,,*)= 14'89*78= <*7*= 97&(0*)= &9= *&(-= 8.9*= :8.3,= &= 7&).4= &(4:89.(= 548.9.43.3,= 8>89*2= C7`=2.7.==8>89*28=:=C*2(4=9.;.8.43b=8**=>947=*9=&1_=+332=&3)=E1.21*>=*9=&1_=

3. = 74/*(9=34_=,**.2*+- = =

,**+=+47=)*9&.18=&3)=57457.*9&7>=84+9<&7*=C7=/_+`=C*2(4_=-7**=C7=7*(*.;*78= <*7*=2447*)=94=9-*=8*&=+1447=94=+472=&3=*6:.1&9*7&1=97.&3,:1&7=&77&>=<.9-=&=8*5&7&9.43= 4+=+/*=2*97*8='*9<**3=7*(*.;*78=<.9-.3=9-*=55=&3)=-**=2*97*8=&9=9-*=+.8-*)=8.9*=&9= 9-*=&82&3=*3.38:1&_=D74:3)897:9-.3,=4+=9-*=&77&>=.3).(&9*)=548.9.43&1=57*(.8.43=4+= (&_= ±,= 2*97*8= .38.)*= 9-*= 97.&3,1*= &3)= (&_= ±.= 2*97*8= :5= 94= ,**= 2*97*8= +742= 9-*= &77&>= <.9-.3= 9-*= 55`= &3)= ±/=2*97*8= .38.)*=9-*=97.&3,1*=&3)=(&_= ±+/=2*97*8=:5=94=/**= 2*97*8=+742=9-*=&77&>=&9=9-*=+.8-*)=8.9*_=-*=85&(.3,=4+=9-*=9*1*2*97>=&77&>=<&8=;&7.*)= '*9<**3= 9-*= 8.9*8`= 94= *38:7*= 2&=.2:2= 5*7+472&3(*= &9= *&(-= 8.9*`= ':9= <&8= 7*51.(&9*)= 57*(.8*1>= ):7.3,= *&(-= )*514>2*39= &9= *&(-= 8.9*= 94= 2&.39&.3= (438.89*3(>= '*9<**3= 8*&8438_= 9:*= 94= 9-*= &;&.1&'.1.9>= 4+= 431>= 43*= C7= 8>89*2`= 89:).*8= <*7*= 7:3= (438*(:9.;*1>= 94= *38:7*= 9-&9= &9= 1*&89= +4:7= (439.3:4:8= <**08= 4+= .3+472&9.43= <&8= 7*(47)*)=<.9-.3=*&(-=4+=+4:7=8*5&7&9*=8*&8438=&9=*&(-=8.9*_==

*1*2*97>=)&9&=574(*88.3,=&3)=&3&1>8.8= 88*88.3,=9-*=.25&(9=4+=574(*):7&1=&79*+&(98=43=9-*='*-&;.4:7=4+=9*89=8:'/*(98=.8=4+9*3= 4;*71440*)= .3= &3.2&1= 24;*2*39= &3)= '*-&;.4:7&1= 89:).*8_= 47= &8:8= *)<&7)8..= = 9-*= .25&(9= 43= 3472&1= '*-&;.4:7= &8= &= 7*8:19= 4+= (&77>.3,= &= 97&382.99*7= .8= 9-4:,-9= 94= '*= 3*,1.,.'1*=90.3843=*9=&1_`=,**/b=5&(79-:7=*9=&1_`=,**2_=4<*;*7`==&19*7&9.43=94=54898 7*1*&8*= '*-&;.4:7= 4+= 14'89*78= &8= &= 7*8:19= 4+= '*.3,= '74:,-9= 94= 9-*= 8:7+&(*= <&8= 1.0*1>= B*73&04++`= +321b= B*73&04++= *9= &1_`= +321= &8= 9-*= 2&/47.9>= 4+= .3).;.):&18= 85*39= 8*;*7&1= -4:78=74&2.3,=4;*7=9-*=-&'.9&9`=&3)= :5=94= .2=-4:78=94=7*14(&9*=94=9-*=8-*19*7=<-*7*= 9-*>=<*7*=(&59:7*)_=-*7*+47*`=548.9.43&1=*89.2&9*8=4+=9&,,*)=14'89*78=7*(47)*)=.3=9-*= .2= -4:78= +4114<.3,= 7*1*&8*= <-*7*= ).8(&7)*)= +742= &11= &3&1>8*8_= 48.9.43&1= )&9&= <&8= *=5479*)=+742=9-*=C7=84+9<&7*=;/_+='*+47*='*.3,=574(*88*)=&3)=;.8:&1.8*)=:8.3,= +43+:8.43= ;+_,= 5>7.&== 84+9<&7*_= = 48.9.43&1= )&9&= <&8= 574/*(9*)= :8.3,= 9-*= D9= 8>89*2=+33.=D9=5D=+33.=I43*=//=+47=&((:7&9*=).89&3(*=&3)=&7*&=:3.9=(&1(:1&9.43_= = ;-.1*= 9-*= &((:7&(>= &3)= 57*(.8.43= 4+= 9-*= C7= 8>89*2= <&8= )*9*72.3*)= 57.47= 94= 9-*= 89:)>`=7&3)42=*7747=.3=548.9.43&1=*89.2&9*8=89.11=4((:77*)_=+7747=.3=548.9.43&1=*89.2&9*8= (&3=4((:7=+47=&=3:2'*7=4+=7*&8438=D41*9=*9=&1_`=,**0=':9=<*7*=*&8.1>=7*24;*)=:8.3,=&= 89*58<.8*= )&9&= +.19*7.3,= &5574&(-`= 8.2.1&7= 94= 9-&9= )*8(7.'*)= '>= D41*9= *9= &1_`= ,**0_= 48.9.43= *89.2&9*8= <*7*= (&1(:1&9*)= '>= 9-*= 548.9.43=&;*7&,*=&1,47.9-2=.3=9-*=C7= 84+9<&7*= ;/_+= :8.3,= 9-*= '*89= 2*= 4+= 8.,3&18= +742= *&(-= 97&382.99*7= .3= *&(-= +.;*8 2.3:9*=8&251.3,=5*7.4)_== = +7743*4:8=)&9&=54.398=<*7*=.)*39.+.*)=:8.3,=&=9-7**889*5=574(*88=:8.3,=9-*=+43+:8.43= 84+9<&7*= 5&(0&,*_= .789`= &= 5745479.43= 4+= 9-*= *7743*4:8= )&9&= 54.398= <*7*= *&8.1>= .)*39.+.*)=<-*3=9-*=5&9-=1*3,9-8=<*7*=*=97*2*=8*;*7&1=-:3)7*)=2*97*8`=9-*=548.9.43= *89.2&9*= <&8= 43= 1&3)`= 47= 9-*= 8*(43)= )&9&= 54.39= .3= &= 8*6:*3(*= 4+= 9-7**= (438*(:9.;*= 54.398=<&8=(438.)*7*)=94='*=&= +1>*7_=1>*7=548.9.438=<*7*=*&8.1>=.)*39.+.*)=&8=9-*=+.789= &3)= 9-.7)= 548.9.438= .3= 9-*= 8*7.*8= <*7*= 4+9*3= (148*= 94,*9-*7= ,:/= 2*97*8`= <.9-= 9-*= 8*(43)=548.9.43=.841&9*)=842*=).89&3(*=+742=9-*=49-*7=9<4_=88.3,=9-*=-*&).3,=4+=*&(-= .3).;.):&1=5&9-=8*,2*39`=9-*=&(:9*=&3,1*='*9<**3=9-*=9<4=-*&).3,8`=9*72*)=9-*=7*9:73=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 3/ = =

&3,1*`=(&3='*=(&1(:1&9*)=&3)=<&8=9-*3=:8*)=94=&:942&9.(&11>=.)*39.+>=&3)=7*24;*=+1>*7= 54.398= +742= 548.9.43&1= )&9&= :8.3,= &3= &((*59&3(*= 9-7*8-41)= 4+= ,*= )*,7**8_= -*= +.3&1= 89&,*= 4+= *7747= 7*24;&1= <&8= 94= .)*39.+>= 5&9-= 8*,2*398= <-*3= 9-*= &;*7&,*= 85**)= 4+= 24;*2*39= '*9<**3= 9<4= (438*(:9.;*= )&9&= 54.398= *=(**)*)= &= 57*8)*9*72.3*)= 2&=.2:2=4+=9-7**=2*97*8=5*7=2.3:9*_=,*,2*398=.)*39.+.*)=&8=*=(**).3,=9-*=2&=.2:2= &;*7&,*=85**)=<*7*=2&3:&11>=.3;*89.,&9*)=+47=;&1.).9>_=-*=+.19*7.3,=574(*88=7*8:19*)= .3=&=7*):(9.43=4+=548.9.43=*89.2&9*8=&3)=549*39.&1=(438*7;&9.;*=*89.2&9*8=4+=9-*=949&1= ).89&3(*=97&;*11*)_= = &,,*)= &3.2&18= 2:89= ).851&>= &= 1*;*1= 4+= 8.9*= +.)*1.9>= '*+47*= 9-*= *=9*39= 4+= 9-*.7= -42*= 7&3,*=(&3='*=(&1(:1&9*)=,5*3(*7=*9=&1_`=+33*_=-*=2489=:8*+:1=2*9-4)=4+=&88*88.3,=8.9*= +.)*1.9>= <&8= 94= (425&7*= 9-*= &(9:&1= 8*6:*3(*= 4+= 5&9-8= 97&;*11*)= <.9-= &= 7&3)42= &77&3,*2*39=4+=9-*=5&9-8=44,*=*9=&1_`=,**+_=>3(*=8.9*=+.)*1.9>=+47=*&(-=9&,,*)=14'89*7= <&8=*89&'1.8-*)`=-42*=7&3,*=&3)=&(9.;.9>=(*397*=&7*&8=<*7*=(&1(:1&9*)=:8.3,=9-*=0*73*1= 574'&'.1.89.(= 2*9-4)= ;47943`= +323= <-.(-= &551.*8= 1*&89886:&7*8= (74888;&1.)&9.43= ,*&2&3=]=4<*11`=+330`=.3=9-*= 3.2&1=54;*2*39=*=9*38.43=44,*=*9=&1_`=,**+=.3= 7(C.*<= -_,= +,7_= 42*= 7&3,*= &7*&8= <*7*= )*+.3*)= '>= 9-*= 574'&'.1.9>= (4394:78= *3(425&88.3,=3/=4+=&11=548.9.43&1=*89.2&9*8=4+=*&(-=14'89*7=&3)=<*7*=(438.)*7*)=94= '*=9-*=&7*&=:9.1.8*)=):7.3,=+47&,.3,=&3)=7*8.)*3(>_=(9.;.9>=(*397*8=<*7*=)*+.3*)='>= 9-*=574'&'.1.9>=(4394:7=*3(425&88.3,=/*=4+=&11=548.9.43&1=*89.2&9*8=4+=*&(-=14'89*7= &3)=9>5.(&11>=.)*39.+>=9-*=&7*&=4+=7*8.)*3(>=44,*=*9=&1_`=,**+=.,:7*=,._== =

= = *.,:7*=,.= 142*=7&3,*8=4+=9&,,*)=2&1*='1:*=&3)=+*2&1*= 7*)= 14'89*78= .38.)*= 9-*=
7
%= ):7.3,=
&>=,**0_=-*=&7*&=)*1.3*&9*)='>=)&70=8-&).3,=7*57*8*398=9-*=&7*&=:9.1.8*)= 3/=4+=9-*=9.2*='>=&3=.3).;.):&1=14'89*7=<.9-=9-*=&7*&=)*1.3*&9*)='>=1.,-9*7=8-&).3,= 9-*=&(9.;.9>=(*397*=4+=.3).;.):&1=14'89*78_==

30 = 74/*(9=34_=,**.2*+- = =

= &99*738= 4+= -&'.9&9= :9.1.8&9.43= <*7*= .)*39.+.*)= '>= 6:&39.+>.3,= 9-*= &7*&= 4+= 85&9.&1= 4;*71&5= 4+= &(9.;.9>= (*397*= &3)= -42*= 7&3,*= &7*&8= <.9-= 9-*= '*39-.(= -&'.9&9= 2&5= &3)= -&'.9&9=(4251*=.9>=24)*1_=9&9&=<*7*=574(*88*)=:8.3,=7(C.*<=D,=;-_,`=+,7=&3)= ).++*7*3(*8= .3= 9-*= 5&99*738= 4+= -&'.9&9= :9.1.8&9.43= '*9<**3= .3).;.):&18= &3&1>8*)= :8.3,= <>,5=7.2*7=;0_*`=1>24:9-=5&7.3*=O&'47&947.*8_= = -*= 9.2.3,= 4+= 14'89*7= &(9.;.9>= <&8= )*9*72.3*)= '>= (&1(:1&9.3,= 9-*= ).89&3(*= '*9<**3= (438*(:9.;*=548.9.43&1=*89.2&9*8`=7*24;.3,=).89&3(*8=4+=0/=2*97*8=.3=1*3,9-=&;*7&,*= &((*59&'1*=548.9.43&1=*7747=4+=9-*=C7=8>89*2=&3)=&997.':9.3,=9-*=5745479.43=4+=)&>= 1*3,9-= .3= <-.(-= *&(-= 24;*2*39= *;*39= 4((:77*)_= 54;*2*39= *;*398= +47= *&(-= &3.2&1= <-*7*= 9-*3= 8:22*)='>= 5745479.43= 4+= )&>=1*3,9-= &3)= 9-*= +7*6:*3(.*8= 4+= 4((:77*3(*= (43;*79*)=94=5745479.438=4+=9-*=949&1=24;*2*39=(4:398=94=7*):(*='.&8*8='>=.3).;.):&18= 24;.3,=247*=+7*6:*391>=9-&3=8*)*39&7>=.3).;.):&18_= = -*=)*,7**=4+=89&9.(=&3)=)>3&2.(= .39*7&(9.43='*9<**3=74(0=14'89*78=<&8=)*9*72.3*)= :8.3,=9-*=7=(4394:78=47=&(9.;.9>=(*397*=&7*&8=/*=0*73*1=574'&'.1.9>=(4394:78= 4;*71&55*)= :8.3,= 9-*= >C+7O= 74:9.3*_= ;-.1*= 89&9.(= .39*7&(9.438= &7*= :8*+:1= .3= .)*39.+>.3,=9-*=&24:39=4+=4;*71&55.3,=9*77.947>`=9-*>=2&>=(43(*&1=9-*=97:*=3&9:7*=4+= 9-*=7*1&9.438-.5='*9<**3=.3).;.):&18=.3=9.2*_=9>3&2.(=.39*7&(9.438`=.3=<-.(-=B&(4'8= .3)*==B&(4'8`=+31.=.8=:8*)=94=*=&2.3*=9-*=9.2*=8*7.*8=4+=24;*2*398`=<*7*=(&1(:1&9*)= 94= .)*39.+>= (4-*8.43= &3)= &;4.)&3(*= '*9<**3= 5&.78= 4+= 74(0= 14'89*78= :8.3,= 9-*= <+7?><=74:9.3*_=,.,3.+.(&39=).++*7*3(*8='*9<**3=,74:58=4+=74(0=14'89*78=8.?*= &3)=8*==<*7*=)*9*72.3*)=:8.3,=&=;.1(4=43=8.,3*)=7&30=9*89=.3=9-*=89&9.89.(&1=5&(0&,*= 7_== = /*8:198= .2.3,=4+=24;*2*39=&(9.;.9>= -*=9.2.3,=4+=24;*2*39=&3)=&(9.;.9>=<&8=.3+1:*3(*)='>='49-=9-*=8.?*=&3)=9-*=8*==4+= 14'89*78_=3=9-*=&'8*3(*=4+=1&7,*=14'89*78=&9=9-*=+.8-*)=8.9*`=&3)=&((*88=94=&=2:(-=<.)*7= 7&3,*=4+=14'89*7=8.?*8=<.9-.3=9-*=55`=9-*=.3+1:*3(*=4+=8.?*=<&8=*=&2.3*)=.3.9.&11>= <.9-.3= 9-*= 55= :8.3,= 9-*= 2489= *=9*38.;*= )&9&= 8*9= (411*(9*)= ):7.3,= 9-*= 2&9.3,= 5*7.4)= 4+= ,**0_= ;-*3= &(9.;.9>= )&9&= <*7*= 5441*)= &(7488= 8.?*8= <.9-.3= *&(-= 8*=`= ).++*7*3(*8='*9<**3= 2&1*= &3)= +*2&1*= 14'89*78= <*7*= 4'8*7;*)= .,:7*= ,/_= 49-= 2&1*= &3)= +*2&1*= 14'89*78`= 7*,&7)1*88= 4+= 8.?*`= <*7*= &(9.;*= 9-74:,-4:9= 9-*= 2473.3,b= 2&1*= &(9.;.9>=)*(7*&8*)=.3=9-*=*&71>=&+9*73443=<-*7*&8=+*2&1*=14'89*78=7*2&.3*)=&(9.;*=+47= 8*;*7&1=-4:78='*+47*='*(42.3,=247*=8*)*39&7>=+4114<.3,=8:38*9_== = ;-*3=8*5&7&9*)='>=8*=`=).++*7*3(*8=.3=9-*=&(9.;.9>=4+=2&1*=14'89*78='&8*)=43=(&7&5&(*= 8.?*= <*7*= &184= *;.)*39= .,:7*= ,0_= O&7,*= 2&1*= 14'89*78= 1+.*= 22= ?O= <-*7*= 57*)42.3&9*1>= 247*= &(9.;*= ):7.3,= 9-*= )&>1.,-9= -4:78= &3)= 8*)*39&7>= &9= 3.,-9= <-*3=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 31 = =

82&11=2&1*8=0+.*=22=?O=<*7*=2489=&(9.;*_=-*=.3(7*&8*8=&3)=)*(7*&8*8=.3=&(9.;.9>= 5&99*738= 4+= 2&1*= 14'89*78= &9= *.9-*7= *3)= 4+= 9-*= )&>= (4.3(.)*)= <.9-= '49-= 8:37.8*= &3)= 8:38*9_= *2&1*= 14'89*78`= <-.(-= <*7*= 8&251*)= .3= 14<*7= 3:2'*78= 9-&3= 2&1*8`= &184= 8-4<*)= ).++*7*3(*8= '*9<**3= 8.?*8= .3= 9-*= 9.2.3,= 4+= &(9.;.9>= .,:7*= ,1_= -*= 2489= 5742.3*39= ).++*7*3(*= <&8= 4'8*7;*)= .3= 9-*= 1&9*= &+9*73443= <-*3= 9-*= &(9.;.9>= 4+= 1&7,*= +*2&1*8= 1+-*= 22= ?O= <&8= ,7*&9*7= 9-&3= 9-&9= 4+= 82&11*7= +*2&1*8_= ,.2.1&7= 94= 2&1*= 14'89*78`=(-&3,*8=.3=+*2&1*=14'89*7=&(9.;.9>=5&99*738=(4.3(.)*)=<.9-='49-=8:37.8*=&3)= 8:38*9_== = 9:*=94=9-*=5&:(.9>=4+=1&7,*=14'89*7=&3)=2&1*8=4+=&3>=8.?*=&9=9-*=+.8-*)=8.9*`=(425&7.843= 4+=9*2547&1=97*3)8=.3=9-*=&(9.;.9>=4+=14'89*78='*9<**3=&3)=<.9-.3=9-*=+.8-*)=&3)=5= 8.9*8= <&8= 7*897.(9*)= 94= 82&11= 0+-*= 22= ?O= +*2&1*= 14'89*78_= *2&1*= 14'89*78= &9= 9-*= +.8-*)= 8.9*= 43= 9-*= &82&3= *3.38:1&= ).851&>*)= 8.2.1&7= 5&99*738= 4+= &(9.;.9>= ):7.3,= 85&<3.3,=>(9:<4;=&3)=5*&0=(&9(-&'.1.9>=B&3:*'`=<.9-=24;*2*39=7*897.(9*)=94=9-*= -4:78='*9<**3=8:38*9=&3)=8:37.8*=.,:7*=,2_=-*=&(9.;.9>=4+=+*2&1*=14'89*78=):7.3,= 9-*= 2&9.3,= 8*&843= <&8= ).++.(:19= 94= .39*757*9= ):*= 94= 9-*= *=97*2*1>= 14<= 3:2'*78= 4+= 548.9.43&1= *89.2&9*8= 4'9&.3*)= +742= 9-*= C7= 8>89*2_= 4<*;*7`= *=&2.3&9.43= 4+= 9-*= :37*841;*)= 548.9.43&1= *89.2&9*8= .3).(&9*8= 9-&9= 9-*= 97&382.99*78= <*7*= +:3(9.43&1= &3)= 9-*7*+47*= +*2&1*= 14'89*78= <*7*= 2489= 1.0*1>= 8*)*39&7>_= (9.;.9>= ):7.3,= 9-*= 85&<3.3,= 8*&843=<&8=(438.89*39='*9<**3=9-*=9<48>*&7=8&251.3,=5*7.4)8=4+=,**0=&3)=,**1_=9:*= 94=9-*=14<=3:2'*78=4+=2&1*=14'89*78=+4:3)=&9=9-*=+.8-*)=8.9*`=.9=<&8=349=5488.'1*=94=9&,= 8:++.(.*39=3:2'*78=94=)*9*72.3*=5&99*738=4+=&(9.;.9>_= = -*=&(9.;.9>=5&99*738=4+=82&11=0+-*=22=?O=+*2&1*=14'89*78=.38.)*=9-*=55=<*7*= 8.2.1&7=):7.3,=2&9.3,=,**0`=5*&0=(&9(-&'.1.9>=,**1=&3)=85&<3.3,=.3=,**1=.,:7*= ,3_=3=(4397&89`=9-*=&(9.;.9>=4+=+*2&1*=14'89*78=7*(47)*)=.3=9-*=2&9.3,=8*&843=4+=,**1= <&8=8:'89&39.&11>=).++*7*39=94=9-&9=&9=9-*=8&2*=9.2*=.3=,**0`=.3).(&9.3,=&=1&7,*=&24:39= 4+= .39*78&33:&1= ;&7.&'.1.9>= .3= '*-&;.4:7= ):7.3,= 2&9.3,_= -*= 14<= 1*;*18= 4+= +*2&1*= &(9.;.9>=.3=9-*=2&9.3,=8*&843=4+=,**1=7*+1*(9=&=8.2.1&7=5&99*73=4+=.3&(9.;.9>=+47=+*2&1*8= &9=9-*=+.8-*)=8.9*=):7.3,=9-*=8&2*=8*&843_=;.9-=9-*=*=(*59.43=4+=9-*=2&9.3,=8*&843=.3= ,**1`=9-*=&(9.;.9>=4+=+*2&1*=14'89*78=.38.)*=9-*=55=<&8=57*)42.3&391>=):7.3,=9-*= )&>= &8= 45548*)= 94= 9-*= +.8-*)= 8.9*= <-*7*= 9-*= 2&/47.9>= 4+= &(9.;.9>= <&8= ):7.3,= 9-*= *;*3.3,_=-.8=<&8=5&79.(:1&71>=*;.)*39=):7.3,=9-*=8*&8438=4+=5*&0=(&9(-&'.1.9>=.,:7*= -*= &3)= 85&<3.3,= .,:7*= -+= .3= ,**1= <-*3= +*2&1*8= .38.)*= 9-*= 7*8*7;*= <*7*= &(9.;*= ):7.3,= 9-*= )&>= &3)= 8*)*39&7>= ):7.3,= 9-*= 3.,-9b= 9-*= 45548.9*= 4((:77*)= &9= 9-*= +.8-*)= 8.9*_= = 5&1*=14'89*7=&(9.;.9>=<&8=7*1&9.;*1>=(438.89*39='*9<**3=5*&0=(&9(-&'.1.9>`=2&9.3,=&3)= 24:19.3,=):7.3,=9-*=3.,-9`=':9=8-4<*)=.3(7*&8*)=&3)=-.,-1>=;&7.&'1*=&(9.;.9>=):7.3,= 9-*=)&>=.,:7*=-,_= =

32 = 74/*(9=34_=,**.2*+- = =

0.16

Females Males

0.12 y c n e u q e r f l

a 0.08 n o i t r o p o r P

0.04

0 0:00:00 6:00:00 12:00:00 18:00:00 0:00:00

Time of day = *.,:7*=,/= %(9.;.9>=5&99*738=4+=2&1*=&3)=+*2&1*=14'89*78= <.9-.3= 9-*=
%= 2&9.3,= ,**0= <.9-= )&9&= 5441*)= &(7488= (&7&5&(*= 8.?*= <.9-.3= *&(-= 8*=_= 8.3*8= 7*57*8*39= 9-*= 2*&3= 5745479.43&1=&(9.;.9>=7*(47)*)=.3=*&(-=43*=-4:7='14(0=9-74:,-4:9=9-*=)&>=)=8_*__= = = = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = 33 = =

0.12

Large males (>140mm CL) Small males (<140mm CL)

y 0.08 c n e u q e r f l a n o i t r o p o r 0.04 P

0 0:00:00 6:00:00 12:00:00 18:00:00 0:00:00

Time of day = *.,:7*=,0= +425&7.843=4+=82&11=0+.*22=&3)=1&7,*=1+.*22=2&1*=14'89*7=&(9.;.9>=<.9-.3=9-*=
%=2&9.3,=,**0_==8.3*8=7*57*8*39=9-*=2*&3=5745479.43&1=&(9.;.9>=7*(47)*)=.3=*&(-= 43*=-4:7='14(0=9-74:,-4:9=9-*=)&>=)=8_*__=

+** = 74/*(9=34_=,**.2*+- = =

0.25

Large females (>130mm CL) Small females (<130mm CL)

0.2 y c n e

u 0.15 q e r f l a n o i t r

o 0.1 p o r P

0.05

0 0:00:00 6:00:00 12:00:00 18:00:00 0:00:00

Time of day = *.,:7*=,1= +425&7.843=4+=82&11=0+-*22=&3)=1&7,*=1+-*22= +*2&1*= 14'89*7= &(9.;.9>= <.9-.3= 9-*=
%=,**0_==8.3*8=7*57*8*39=9-*=2*&3=5745479.43&1=&(9.;.9>=7*(47)*)=.3=*&(-=43*= -4:7='14(0=9-74:,-4:9=9-*=)&>=)=8_*__======

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +*+ = =

Female lobster activity 0.25

0.2

y 0.15 c n e u q e r f l

a 0.1 n o i t r o p o r 0.05 P

0

-0.05

0:00 6:00 12:00 18:00 0:00

Time of day

Spawning / Male moult (2006) Peak catchability (2007) Mating / Female moult (2007) Spawning / Male moult (2007) = *.,:7*=,2= %(9.;.9>=5&99*738=4+=82&11=+*2&1*=14'89*78=0+-*22=+8=&9=9-*=+.8-*)=8.9*='>=8*&843_= 8.3*8= 7*57*8*39= 9-*= 2*&3= 5745479.43&1= &(9.;.9>= 7*(47)*)= .3= *&(-= 43*= -4:7= '14(0= 9-74:,-4:9=9-*=)&>=)=8_*__= =

+*, = 74/*(9=34_=,**.2*+- = =

Female lobster activity 0.25

0.2 y c n e

u 0.15 q e r f l a n o i t r

o 0.1 p o r P

0.05

0

0:00 6:00 12:00 18:00 0:00

Time of day

Mating / female moult (2006) Peak catchability (2007) Mating - female moult (2007) Spawning / male moult (2007) = *.,:7*=,3= %(9.;.9>=5&99*738=4+=82&11=+*2&1*=14'89*78=0+-*22=+8=.38.)*=9-*=
%='>=8*&843_= 8.3*8= 7*57*8*39= 9-*= 2*&3= 5745479.43&1= &(9.;.9>= 7*(47)*)= .3= *&(-= 43*= -4:7= '14(0= 9-74:,-4:9=9-*=)&>=)=8_*__= = ==

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +*- = =

Female lobster activity during peak catchability 0.25

0.2

y 0.15 c n e u q e r f l

a 0.1 n o i t r o p o r 0.05 P

0

-0.05

0:00 6:00 12:00 18:00 0:00

Time of day

MPA Fished habitat = *.,:7*=-*= %(9.;.9>=5&99*738=4+=+*2&1*=14'89*78=.3=+.8-*)=&3)=:3+.8-*)=-&'.9&98=):7.3,=9.2*8=4+= 5*&0= (&9(-&'.1.9>_= 8.3*8= 7*57*8*39= 9-*= 2*&3= 5745479.43&1= &(9.;.9>= 7*(47)*)= .3= *&(-= 43*=-4:7='14(0=9-74:,-4:9=9-*=)&>=)=8_*__=

+*. = 74/*(9=34_=,**.2*+- = =

Female lobster activity during spawning 0.16

0.12 y c n e u q e r f l

a 0.08 n o i t r o p o r P

0.04

0

0:00 6:00 12:00 18:00 0:00

Time of day

MPA Fished habitat = = *.,:7*=-+= %(9.;.9>=5&99*738=4+=+*2&1*=14'89*78=.3=+.8-*)=&3)=:3+.8-*)=-&'.9&98=):7.3,=85&<3.3,= ,**1_= 8.3*8= 7*57*8*39= 9-*= 2*&3= 5745479.43&1= &(9.;.9>= 7*(47)*)= .3= *&(-= 43*= -4:7= '14(0=9-74:,-4:9=9-*=)&>=)=8_*__=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +*/ = =

142*=7&3,*=&7*&= 88.3,= 9-*= 548.9.43&1= .3+472&9.43&1= 4'9&.3*)= +742= 9-*= C7= 8>89*2`= *89.2&9*8= 4+= 14'89*7= -42*= 7&3,*8= <*7*= (&1(:1&9*)= :8.3,= &= 0*73*1= )*38.9>= 574'&'.1.9>= &1,47.9-2_= 9:7.3,= 9-*= 2&9.3,= 8*&843= .3= ,**0`= 14'89*78= .38.)*= 9-*= 55= 8-4<*)= 34= ).89.3(9= 7*1&9.438-.5= 94= (&7&5&(*= 1*3,9-= +47= *.9-*7= 2&1*= 47= +*2&1*= 14'89*7= .,:7*= --_= 39*72*).&9*88.?*)=2&1*=14'89*78=<.9-.3=9-*=7*8*7;*=).851&>*)=9-*=,7*&9*89=;&7.&'.1.9>= .3=-42*=7&3,*=&7*&_== = -*= 8.?*= 4+= 9-*= +*2&1*= 14'89*7= -42*= 7&3,*= 7*2&.3*)= 7*1&9.;*1>= (438.89*39= '*9<**3= 8*&8438=<.9-.3=9-*=55=':9=8-4<*)=8:'89&39.&1=;&7.&9.43=+47=2&1*=14'89*78=4;*7=&= 8.2.1&7=9.2*=5*7.4)=.,:7*=-._=-*=&;*7&,*=-42*=7&3,*=&7*&=+47=2&1*=14'89*78=):7.3,= 2&9.3,= .3= ,**0= <&8= 1*88= 9-&3= 43*= 9-.7)= 4+= 9-&9= 4+= 2&1*= 14'89*78= ):7.3,= 9-*= 2&9.3,= 8*&843=.3=,**1_== = -*7*=<&8=&3=.3(7*&8*=.3=9-*=-42*=7&3,*=4+=14'89*78=+4:3)=):7.3,=9-*=,**0=&3)=,**1= 2&9.3,=5*7.4)8=(425&7*)=94=*.9-*7=9-*=85&<3.3,=47=2&1*=24:19.3,=5*7.4)=47=9-*=5*&0= (&9(-&'.1.9>=5*7.4)=.38.)*=9-*=55=.,:7*=-/_= = -*=-42*=7&3,*=8.?*=4+=+*2&1*=14'89*78=&9=9-*=+.8-*)=8.9*=8-4<*)=8.,3.+.(&39=;&7.&9.43= '*9<**3= 8*&8438`= <.9-= 1&7,*7= &;*7&,*= -42*= 7&3,*8= .3= 9-*= 85&<3.3,= 8*&843= 4+= ,**0= (425&7*)=94=9-*=49-*7=8&251.3,=5*7.4)8=.,:7*=-0_== = 8= )*243897&9*)= '>= 9-*= &(9.;.9>= 5&99*738`= -42*= 7&3,*= (4:1)= 349= '*= 4'9&.3*)= +47= +*2&1*=14'89*78=&9=9-*=+.8-*)=8.9*=&8=+*2&1*8= ).)=349=24;*='*>43)=9-*.7=)*38=):7.3,= 9-*= 8:7;*>_= 9:7.3,= 85&<3.3,= ,**0= 9-*7*= <&8= &= (438.)*7&'1*= .3(7*&8*= .3= 9-*= -42*= 7&3,*=&7*&=9-&9=<&8=349=7*+1*(9*)=.3=9-*=,**1=85&<3.3,=5*7.4)`=<-.(-=8-4<*)=8.2.1&7= -42*=7&3,*=8.?*8=94=9-*=5*7.4)=4+=5*&0=(&9(-&'.1.9>=.,:7*=-1_= =

+*0 = 74/*(9=34_=,**.2*+- = =

Male lobster activity 0.16

0.12 y c n e u q e r f l

a 0.08 n o i t r o p o r P

0.04

0

0:00 6:00 12:00 18:00 0:00

Time of day

Mating / female moult (2006) Peak catchability Mating / female moult (2007) Spawning / Male moulting (2007) = *.,:7*=-,= +425&7.843= 4+= 2&1*= 14'89*7= &(9.;.9>= .38.)*= 9-*=
%= 4;*7= +4:7= 8*&8438_= 8.3*8= 7*57*8*39=9-*=2*&3=5745479.43&1=&(9.;.9>=7*(47)*)=.3=*&(-=43*=-4:7='14(0=9-74:,-4:9= 9-*=)&>=)=8_*__= = = = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +*1 = =

8000 ) y t i l i 6000 b a b o r p l e n r e k % 5 9 - 4000 0 ( 2 m a e r a e g n a r e

m 2000 o H

0 0.4 0.6 0.8 1 Rock lobster size - proportion of maximum size (carapace length mm) = = = *.,:7*=--= /*1&9.438-.5='*9<**3=74(0=14'89*7=(&7&5&(*=1*3,9-=&3)=-42*=7&3,*=&7*&=7*57*8*39*)= '>= 0*73*1= 574'&'.1.9>= (4394:78= *:3/= +47= 2&1*=  '''= &3)= +*2&1*=  = 74(0= 14'89*78= ):7.3,=9-*=2&9.3,=8*&843=,**0=.38.)*=9-*=
7
%_= =

+*2 = 74/*(9=34_=,**.2*+- = =

 

:CV  VI:CV

 



 0V`:$V
QIV
:J$V
:`V:
^I_

 : 1J$
 : H.:G1C 17 : 1J$
 ]:1J1J$


= *.,:7*=-.= *&843&1=97*3)8=.3=-42*=7&3,*=&7*&=+47=2&1*=&3)=+*2&1*=14'89*78=.38.)*=9-*=
7
/= 7*8*7;*=):7.3,=2&9.3,`=5*&0=(&9(-&'.1.9>=&3)=85&<3.3,=.3=,**0=&3)=,**1_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +*3 = =

40000

Mating 2006 Peak catchability Mating 2007 Spawning 2007

30000 ) 2

20000 Home range area (m area range Home

10000

0

80 120 160 200 Lobster size (CL mm) = = *.,:7*=-/= *&843&1=97*3)8=.3=-42*=7&3,*=&7*&=&8=&=+:3(9.43=4+=(&7&5&(*=1*3,9-=+47=&11=14'89*78= 9&,,*)=.38.)*=9-*=
%=):7.3,=2&9.3,`=5*&0=(&9(-&'.1.9>=&3)=85&<3.3,=.3=,**0=&3)= ,**1_======

++* = 74/*(9=34_=,**.2*+- = =

 











 0V`:$V
QIV
:J$V
:`V:
^I_ 

 ]:1J1J$
 : H.:G1C1 7
 : 1J$
 ]:1J1J$


= = *.,:7*=-0= *&843&1=97*3)8=.3=&;*7&,*=-42*=7&3,*=&7*&=)=8*=+47=+*2&1*=14'89*78=&9=9-*=+.8-*)= 8.9*=):7.3,=85&<3.3,`=5*&0=(&9(-&'.1.9>=&3)=2&9.3,=.3=,**0=&3)=,**1_== =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +++ = =

400000 Spawning 2006 Peak catchability 2007 Mating 2007 Spawning 2007 300000 ) 2 200000

100000 Home range area (m area range Home

5000

4000

3000

2000

1000

0

80 90 100 110 120 130 Lobster size (CL mm) = *.,:7*=-1= *&843&1=97*3)8=.3=-42*=7&3,*=&7*&=+47=+*2&1*= 14'89*78= &8= &= +:3(9.43= 4+= (&7&5&(*= 1*3,9-=&9=9-*=+.8-*)=8.9*=):7.3,=85&<3.3,`=5*&0=(&9(-&'.1.9>=&3)=2&9.3,=.3=,**0=&3)= ,**1_== = -.89&3(*=97&;*11*)= ;.9-= 9-*= *=(*59.43= 4+= 9-*= 2&9.3,= 5*7.4)8= <-*3= 2&1*= &3)= +*2&1*= 14'89*78= 97&;*11*)= 8.2.1&7= ).89&3(*8`= 2&1*= 14'89*78= 97&;*11*)`= 43= &;*7&,*`= ,7*&9*7= ).89&3(*8= 9-&3= +*2&1*= 14'89*78=.38.)*=9-*=55=.,:7*=-2_= = >:98.)*= 9-*= 55`= 9-*= 949&1= ).89&3(*= 97&;*11*)='>= +*2&1*= 14'89*78= <&8= ).++*7*39= 94= 9-&9= <-.(-= 4((:77*)= .38.)*= 9-*= 55`= <.9-= .3(7*&8*)= 949&1= ).89&3(*= 97&;*11*)= 4((:77.3,=.3=9-*=85&<3.3,=8*&843=.,:7*=-3_ = = =

++, = 74/*(9=34_=,**.2*+- = =

=

 VI:CV :CV 











0V`:$V
Q :C
IQ0VIVJ
R1 :JHV
^I5
ULR _  : 1J$
 : H.:G1C 17 : 1J$
 ]:1J1J$
 = *.,:7*=-2= *&843&1=5&99*738=.3=9-*=949&1=).89&3(*=97&;*11*)='>=2&1*=&3)=+*2&1*=14'89*78=.38.)*= 9-*=
%='*9<**3=2&9.3,=,**0=&3)=85&<3.3,=,**1_=

8

8

8

8

8

8

0V`:$V
Q :C
IQ0VIVJ
R1 :JHV
^I5
ULR _ 8 ]:1J1J$
 : H.:G1C1 7
 : 1J$
 ]:1J1J$
 = = = = *.,:7*=-3= *&843&1=5&99*738=.3=9-*=949&1=).89&3(*=97&;*11*)='>=+*2&1*=14'89*78=&9=9-*=+.8-*)=8.9*= '*9<**3=85&<3.3,=,**0=&3)=,**1_= = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ++- = =

1&'.9&9=:9.1.8&9.43= E*73*1= 574'&'.1.9>= -42*= 7&3,*8= <*7*= (&1(:1&9*)= :8.3,= +.19*7*)= 548.9.43&1= *89.2&9*8= &3)= 9-*= 7*8:19.3,= 8-&5*+.1*8= <*7*= :8*)= 94= )*9*72.3*= 9-*= 6:&39.9>= 4+= *&(-= -&'.9&9= :9.1.8*)='>=*&(-=9&,,*)=14'89*7_=*(&:8*=9-*=(43+.,:7&9.43=&3)=6:&39.9>=4+=-&'.9&98=<&8= 349= (438.89*39= '*9<**3= 9-*= 9<4= 8.9*8`= 5&99*738= .3= -&'.9&9= :9.1.8&9.43= <*7*= &3&1>8*)= '*9<**3=8*&8438=<.9-.3=*&(-=8.9*=94=*=&2.3*=9*2547&1=(-&3,*8_== =

= *.,:7*=.*= !4382*97.(=
-= 5149= 7*57*8*39.3,= 8*&843&1= 97*3)8= .3= 9-*= :9.1.8&9.43= <.9-.3= 9-*=
7
%=4+=-&'.9&9=2475-42*97.(=+*&9:7*8=.)*39.+.*)=:8.3,=9-*=(1&88.+.(&9.43=24)*1_=== = 88.3,= &3&1>8.8= 4+= 8.2.1&7.9>= 9-*= 5&99*73= 4+= -&'.9&9= :9.1.8&9.43= <&8= 349= 8.,3.+.(&391>= ).++*7*39= '*9<**3= 8*&8438= <.9-.3= 9-*= 55= 
= -= *_//`= .,:7*= .*_= 3= (425&7.843`= -&'.9&9=:9.1.8&9.43=&9=9-*=+.8-*)=8.9*=<&8=8.,3.+.(&391>=).++*7*39='*9<**3=8*&8438`=<.9-= 9-*= 85&<3.3,= 8*&843= 4+= ,**0= 8.,3.+.(&391>= ).++*7*39= +742= &11= 49-*7= 9.2*= 5*7.4)8= 8&251*)=
=0=*_*+`=.,:7*=.+_=-*=,5+7=74:9.3*=.3=9-*=75+7=84+9<&7*=5&(0&,*= .)*39.+.*)= 9-*= -.,-*7= (4397.':9.43= 4+= (-&33*18= <.9-.3= 9-*= 7**+= (4397.':9.3,= 94= 9-*= ).++*7*3(*8_= +=&251*8= 4+= -&'.9&9= (1&88.+.(&9.438= &3)= 14'89*7= 24;*2*398= &9= 9-*= +.8-*)= 8.9*=&7*=57*8*39*)=.3== .,:7*=.,=&3)=.,:7*=.-_= = = =

++. = 74/*(9=34_=,**.2*+- = =

=

= = *.,:7*=.+= !4382*97.(=
-=5149=7*57*8*39.3,=8*&843&1=97*3)8= .3= 9-*= :9.1.8&9.43= &9= 9-*= +.8-*)= 8.9*= 4+= -&'.9&9= 2475-42*97.(= +*&9:7*8= .)*39.+.*)= :8.3,= 9-*= (1&88.+.(&9.43= 24)*1_= %19-4:,-= -&'.9&9= :9.1.8&9.43= +47= 9-*= 5*7.4)= 4+= 2&9.3,= .3= ,**1= <&8= &88*88*)= &3)= 7*57*8*39*)=.3=9-*=%!47
=9-*=)&9&=-&8='**3=*=(1:)*=+742=9-*=
-=5149=94=).851&>= 9-*= &77&3,*2*39= 4+= 9-*= 49-*7= 9-7**= 8*&8438= <.9-4:9= 9-*= '.&8= 4+= 9-*= 8&251*= 9&0*3= ):7.3,=9-*=2&9.3,=8*&843_=738:++.(.*39=8&251*=8.?*= 4+= 9-*= 548.9.43&1= )&9&= (411*(9*)= ):7.3,=9-*=2&9.3,=8*&843=).)=349=&114<=&((:7&9*=-42*=7&3,*=&3)=-&'.9&9=:9.1.8&9.43= 5&7&2*9*78=94='*=(&1(:1&9*)_== = = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ++/ = =

= = =

= = *.,:7*=.,= 1&'.9&9=2&58=&3)=(1&88.+.(&9.43=24)*18=+47=9-*=*=5*7.2*39&1=8.9*=14(&9*)=43=&82&3= *3.38:1&_= = =

++0 = 74/*(9=34_=,**.2*+- = = =

=

= = *.,:7*=.-=
4;*2*39=5&9-8=4+=9<4=14'89*78=(&77>.3,=&(4:89.(=9&,8=5.30=1.3*=-=+*2&1*=14'89*7`= '1:*= 1.3*= -= 2&1*= 43= 9-*= &82&3= *3.38:1&= 4;*71&>*)= 43= -&'.9&9= (1&88.+.(&9.43= 24)*18_= -.8(:88.43= -*7*= &7*= 8:'89&39.&1= ).++*7*3(*8= '*9<**3= 9-*= '*-&;.4:7= 4+= 14'89*78= .3= +.8-*)= &3)= :3+.8-*)= 8.9*8= .3= *&89*73= &82&3.&= &8= <*11= &8= ).++*7*3(*8= .3= 8*&843&1= &(9.;.9>= <.9-.3= 9-*8*=8.9*8_==2&/47=8:757.8*=<&8=9-*=.3(7*&8*)=&(9.;.9>=4+=+*2&1*=14'89*78=):7.3,=9-*= )&>= .3= 9-*= 55_= ,&251.3,= +742= 97&58= 8*9= .3= 9-*= 7*8*7;*= ):7.3,= )&>= &3)= 3.,-9= 7:8-*7`= 5*7= 4'8= (&59:7*)= ;.79:&11>= 34= +*2&1*= 14'89*78= ):7.3,= 9-*= )&>_= -:8 `= 9-*= .3(7*&8*)=&(9.;.9>=4+=9-*8*=14'89*78= .8=349=&= 7*+1*(9.43=4+=+**).3,=&(9.;.9>_=3=(4397&89`= 9-*=) 42.3&3(*=4+=1&7,*=2&1*8=(&:,-9=.3=14'89*7=97&58=8*9=):7.3,=9-*=)&>=.3= 9-*=55= .8=7*+1*(9*)=.3=9-*=&(9.;.9>=5&99*738=4+=1&7,*=2&1*8_=,.2.1&71>`=82&11*7=2&1*8=<*7*=431>= (&:,-9=.3=97&58=8*9=) :7.3,=9-*=3.,-9=<-*3=82&11=2&1* =14'89*7=&(9.;.9>=.8=-.,-*89_=-.8= 5&99*73=4+=2&1*=14'89*7=&(9.;.9>=.8=&184=7*+1*(9*)=.3=+.8-.3,=&(9.;.9>=&8=+.8-*78=431>=8*9= 9-*.7=97&58=4;*73.,-9=.3=8-&114<=<&9*7=7*,.438_=9=9-*=+.8-*)=8.9*=9-*=&(9.;.9>=5&99*73=4+= +*2&1*8= <&8= (4251*9*1>= ).++*7*39 `= <.9-= &(9.;.9>= 5 7.2&7.1>= &884(.&9*)= <.9-= 3.,-989.2*= &(9.;.9>_== = ;-.1*=4'8*7;&9.438=+742=97&5=(&9(-*8=<4:1)=8:,,*89=9-&9=9-*7*= &7* =34=).++*7*3(*8=.3= 9-*='*-&;.4:7=4+=14'89*78='*9<**3=)&>=&3)=3.,-9=.3='49-=+.8-*)=&3)=:3+.8-*)=7*,.438`= 9-.8=574/*(9=-&8=)*243897&9*)=9-&9=9-*7*=&7*=8:'89&39.&1=).++*7* 3(*8=.3=&(9.;.9>=5&99*738_= -*=2&.3=).++*7*3(*='*9<**3=9-*=55=&3)=9-*=+.8-*)=8.9*=.8=9-*=4;*7&11=&':3)&3(*=

:19.8 85*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ++1 = =

4+=14'89*78=&3)=9-*=.3(7*&8*=.3=9-*=3:2'*7=4+=1&7,*=14'89*78_=-:8`=9-*8*=7*8:198=.3+*7= 9-&9=+.8-.3,=-&8=.3+1:*3(*)=9-*='*-&;.4:7=4+=14'89*78_= = 19-4:,-= 9-*7*= <*7*= ).++*7*3(*8= .3= 4;*7&11= &(9.;.9>= 5&99*738= '*9<**3= +.8-*)= &3)= :3+.8-*)= 8.9*8= +47= +*2&1*8`= 9-*7*= <*7*= (438.89*39= 5&99*738= '*9<**3= 8*&8438`= <.9-= +*2&1*= 14'89*78= 8-4<.3,= 1.2.9*)= &(9.;.9>= ):7.3,= 9-*= 2&9.3,= 8*&843_= -.8= .8= 349= 8:757.8.3,= ,.;*3= 9-&9= +*2&1*8= 24:19= '*+47*= 2&9.3,= &3)= &7*= 4+9*3= ,:&7)*)= '>= 2&1*8= ):7.3,=9-*=2&9.3,=8*&843=5&(9.&72.)`=+33+_=47=2&1*8=9-*7*=<&8=.3(7*&8*)=&(9.;.9>= ):7.3,= 9-*= 85&<3.3,= 5*7.4)= <-.(-= (4.3(.)*8= <.9-= 9-*= 57*824:19= 5*7.4)= +47= 2&1*8_= 3(7*&8*)=&(9.;.9>=):7.3,=9-.8=5*7.4)=.8=&184=7*+1*(9*)=.3=9-*=2&1*=(422*7(.&1=(&9(-=&3)= .8= (438.)*7*)= 94= '*= &884(.&9*)= <.9-= 14'89*78= .3(7*&8.3,= 9-*.7= 2*9&'41.(= 7*8*7;*8= +**).3,=57.47=94=9-*=*3*7,>=)7&.3.3,=574(*88=4+=24:19.3,_= = 19-4:,-= 9-*7*= <&8= 5745479.43&9*1>= ,7*&9*7= &(9.;.9>= ):7.3,= 9-*= 2&1*= 24:19= 5*7.4)= .38.)*=9-*=55`=9-*=431>=(-&3,*=94=9-*=&;*7&,*=-42*=7&3,*=<&8=4'8*7;*)=):7.3,= 9-*= 2&9.3,= 8*&843_= ,&.3`= 9-.8= 7*+1*(98= 9-*= 2&1*= '*-&;.4:7= 4+= 8**0.3,= 4:9= +*2&1*= 14'89*78= ):7.3,= 9-.8= 5*7.4)= 5&(9.&72.)`= +33+_= ;-.1*= 9-*7*= <*7*= ).++*7*3(*8= .3= 9-*= 8*&843&1= &(9.;.9>= 5&99*738= 4+= +*2&1*= 14'89*78`= 9-.8= &(9.;.9>= &55*&78= 94= '*= 57.2&7.1>= 7*897.(9*)=94=9-*.7=-42*=7&3,*=7*,.438=.3=9-*=55_=3=(4397&89=94=9-*=55`=9-*7*= <&8=&=8:'89&39.&1=.3(7*&8*=.3=-42*=7&3,*=):7.3,=85&<3.3,=.3=,**0=&9=9-*=+.8-*)=8.9*_= 4<*;*7`= 9-.8= .3(7*&8*= .3= -42*= 7&3,*= <&8= 349= 7*+1*(9*)= .3= 9-*= 85&<3.3,= 5*7.4)= 4+= ,**1_=9*85.9*=&=1&7,*=-42*=7&3,*=+47=85&<3.3,=.3=,**0`=9-*=&;*7&,*=).89&3(*=24;*)= '>=+*2&1*=14'89*78=&9=9-*=+.8-*)=8.9*=<&8=1*88=.3=,**0=(425&7*)=94=,**1`=8:,,*89.3,=9-&9= &= ,7*&9*7= 3:2'*7= 4+= +*2&1*= 14'89*78= 24;*)= (438.)*7&'1*= ).89&3(*8= ._*= 4:98.)*= 9-*.7= -42*=7&3,*=):7.3,=,**1_=-*8*=1&7,*7=24;*2*398=&7*='*1.*;*)=94='*=&884(.&9*)=<.9-= *,,= 7*1*&8*= <-*3= +*2&1*= 14'89*78= 24;*= 94= 4++8-47*= 7*,.438= 94= 7*1*&8*= 9-*= 3*<1>= -&9(-*)=5->114842&8=.394=9-*=89743,*7=4++8-47*=(:77*398=&884(.&9*)=<.9-=9-*8*=7*,.438= 8**=.,:7*=..=+47=&3=*=&251*=4+=9-.8=24;*2*39_== = 9.89&3(*=97&;*11*)='>=2&1*=14'89*78=.8=&184=349=7*+1*(9*)=.3=9-*=5&99*73=4+=-42*=7&3,*= ;&7.&9.43`= .3).(&9.3,= 9-&9= ):7.3,= (&9(-&'.1.9>= &3)= 57*824:19= 85&<3.3,= +47= +*2&1*8= 9-*7*=<*7*=&=3:2'*7=4+=143,8).89&3(*=*=(:78.438='>=14'89*78='*>43)=9-*=-42*=7&3,*_= 3= (43897&89`= ):7.3,= 2&9.3,= 9-*= 24;*2*39= 4+= 14'89*78= <&8= 247*= 7*+1*(9*)= '>= 247*= +7*6:*39= ':9= 82&11*7= 24;*2*398= <.9-.3= 9-*= &)/&(*39= 7**+= 7*,.43`= 7*8:19.3,= .3= &3= .3(7*&8*)= -42*= 7&3,*= 8**= .,:7*= ./= +47= &3= *=&251*= 4+= 2*).:28= &3)= 143,87&3,*= 24;*2*398= 4+= 2&1*= 14'89*78= <.9-.3= 9-*= 55_= -.8= &(9.;.9>= 5&99*73= 8:554798= 9-*= 9-*47>= 9-&9= 2&1*= 14'89*78= &7*= ;.8.9.3,= +*2&1*= 14'89*78= <.9-.3= 9-*.7= &5574=.2&9*= )*3`= 7&9-*7=9-&3=:3)*79&0.3,=1&7,*7=+**).3,=+47&>8_= = -*= 1&7,*7= &':3)&3(*= 4+= 14'89*78= <.9-.3= 9-*= 55= -&8= 7*8:19*)= .3= ;.79:&11>= &11= 7*,.438=4+=9-*=7**+='*.3,=:8*)`=8:,,*89.3,=9-&9=(&77>.3,=(&5&(.9>=.8=2489=1.0*1>=94='*= &884(.&9*)= <.9-= +44)= &;&.1&'.1.9>= .,:7*= .0_= 3= (4397&89`= <-*3= 9-*= &':3)&3(*= .8= 7*):(*)`= 8:(-= &8= .3= 9-*= +.8-*)= 8.9*`= 8*&843&1= ).++*7*3(*8= .3= -&'.9&9= :9.1.8&9.43= <*7*=

++2 = 74/*(9=34_=,**.2*+- = =

7*;*&1*)_=*2&1*=14'89*78=:8*)=(-&33*18=.3=9-*=7**+=897:(9:7*=94=24;*=94=4++8-47*=&7*&8= ):7.3,=85&<3.3,_= = -.8=89:)>=-&8='**3=9-*=+.789=94=7*;*&1=).++*7*3(*8=.3=9-*='*-&;.4:7=4+=14'89*78=.3=5= &3)= +.8-*)= 8.9*8= &3)= &8= 9-*= 2&/47= ).++*7*3(*= '*9<**3= 9-*8*= 8.9*8= .8= 9-*= 7*):(9.43= .3= 14'89*7= &':3)&3(*= &3)= &;*7&,*= 8.?*= ):*= 94= +.8-.3,`= 9-.8= .3).(&9*8= 9-&9= +.8-.3,= -&8= .25&(9*)=43=9-*='*-&;.4:7=4+=14'89*78_=-*8*='*-&;.4:7=97*3)8=<.11=-&;*=,43*=1&7,*1>= :3349.(*)=&8=<*=-&;*=.)*39.+.*)=&(9.;.9>=5&99*738=9-&9=&7*=.3)*5*3)*39=4+=(&9(-=7&9*8= 47=(&9(-=(42548.9.43_== =

= = *.,:7*=..=
4;*2*39=5&9-8=1.3*8=4+=*,,81&)*3=+*2&1*=14'89*78=4;*7=&=9<4=<**0=5*7.4)=&9=9-*= +.8-*)=8.9*_=+414:7*)=)498=7*57*8*39=14(&9.438=)*9*72.3*)='>=2/%=8>89*2_=6:&7*= 7*57*8*398=1&89=14(&9.43=4'8*7;*)='>=).;*78_== =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ++3 = =

= = *.,:7*=./= =&251*8=4+=82&11=24;*2*398=<.9-.3=9-*=-42*=7&3,*='49942`=2*).:2=24;*2*398= 4:98.)*= 9-*= -42*= 7&3,*= 7*,.43= 2.))1*= &3)= 1&7,*7= 24;*2*398= <-.(-= 7*8:19= .3= (-&3,*8=.3=-42*=7&3,*8=):7.3,=9-*=8:7;*>=:55*7=&9=9-*=
7
%_= = =

+,* = 74/*(9=34_=,**.2*+- = =

= = = *.,:7*=.0= =&251*=4+=4;*71&55.3,=-42*=7&3,*8=4+=2&1*='1:*=&3)=+*2&1*=7*)=14'89*78=&9=9-*=
7
%_=

= =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +,+ = =

,*3*+.98= .8-*7.*8=2&3&,*78`=8(.*39.898`=.3):897>=&3)=9-*=(422:3.9>=<.11=&11='*3*+.9=+742=9-.8= 574/*(9_=.8-*7.*8=2&3&,*78=-&;*=&3=*=&251*=4+=).7*(9=&3)=.3).7*(9=.25&(98=4+=+.8-.3,= &3)=<.11='*=&'1*=94=(439*=9:&1.8*=9-*=3**)=+47=2:19.885*(.*8=2&3&,*2*39_=47=&'&143*= &3)= 74(0= 14'89*7= +.8-*7.*8= 2&3&,*2*39`= 9-.8= 574/*(9= 574;.)*8= ).7*(9= *;.)*3(*= 4+= 9-*= 7*1&9.438-.5= '*9<**3= 9-*8*= 9<4= ;&1:&'1*= (422*7(.&1= 85*(.*8_= -.8= .3+472&9.43= (&3= 9-*3= '*= :8*)= &3)= .8= '*.3,= :8*)= '>= 2&3&,*78= .3= ,4:9-= :897&1.&= &3)= &82&3.&= 94= &))7*88=+?=(9=(43(*738_== = ,(.*39.898=<.11='*3*+.9=+742=9-.8=574/*(9=&8=.9=574;.)*8=&=+7&2*<470=+47=9&(01.3,=2:19.8 85*(.*8=2&3&,*2*39=.88:*8=&3)=.)*39.+.*8=3*<=&3)=.334;&9.;*=<&>8=4+=:3)*789&3).3,= 9-*=).7*(9=&3)=.3).7*(9=*++*(98=4+=+.8-.3,_=,*;*7&1=4+=9-*8*=2*9-4)8=-&;*=&17*&)>='**3= &)459*)= '>= 49-*7= 574/*(98= .3(1:).3,= 9-*= 9<= ).*9&7>= 9*(-3.6:*= 94= .)*39.+>= *397489*5-&3:8 =.3=9-*=).*9=4+=14'89*7=97&3814(&9*)=.394= *397489*5-&3:8 ='&77*38=79?= ,**12*./= &3)= 9-*= :8*= 4+= +.3*88(&1*= &(4:89.(= 9*1*2*97>= 94= )*1.3*&9*= 9-*= 24;*2*39= 5&99*738=&3)=-42*=7&3,*8=4+=14'89*78=97&3814(&9*)=.394='&77*38=79?=,**12*./_=-*= +.3*88(&1*= &(4:89.(= 9*1*2*97>= .8= &184= '**3= :8*)= 94= :3)*789&3)= 9-*= '*-&;.4:7= 4+= :3)*78.?*)= 14'89*78= 97&3814(&9*)= 94= .2574;*= >.*1)= .3= 84:9-*73= 74(0= 14'89*7= +.8-*7.*8= ,**02,,*_= = -.8= 574/*(9= -&8= )*243897&9*)= 94= 9-*= +.8-.3,= .3):897>= 9-&9= 9-*= 1&7,*= &3)= 4+9*3= &2475-4:8=89&9*2*398=&'4:9=*(48>89*2=2&3&,*2*39=&7*`=.3=7*&1.9>`=&(-.*;&'1*=,4&18_== -*=.3):897>=34<=-&8=&3=*=&251*=4+=9-*=-4<=&3=.88:*=(&3='*=&))7*88*)=&3)=9-&9=9-*7*= .8= 9-*= &557457.&9*= 9*(-3414,>= &3)= 8(.*39.+.(= 80.118= 94= :3)*789&3)= 0*>= .88:*8='*9<**3= 85*(.*8_=

*:79-*7=)*;*1452*39= -.8=574/*(9=-&8=9&(01*)=&=(4:51*=4+=0*>=*(48>89*2=.88:*8=43=8-&114<=9*25*7&9*=74(0= 7**+8_=9*;*145.3,=8*;*7&1=4+=9-*=2*9-4)8=94=&))7*88=5*1&,.(=&3)=)**5=<&9*7='*39-.(= (422:3.9.*8=<.11='*=7*6:.7*)_=5&3.5:1&9.;*=*=5*7.2*398=&3)=&(4:89.(=9*1*2*97>=<.11= '*= (-&11*3,*78= +47= 9-*8*= *(48>89*28_= 3= (4397&89`= 9-*= 9745-.(= 1.30&,*= 2*9-4)414,.*8= 9-&9= .3;41;*)= 89&'1*= .84945*8`= +&99>= &(.)= 8.,3&9:7*8= &3)= 9<= ).*9&7>= &3&1>8.8= &7*= '74&)1>= &551.(&'1*= 94= +.8-*7.*8= .3= &3>= *(48>89*2_= :79-*7= )*;*1452*39= 4+= 9-*8*= 2*9-4)8= -41)8= (438.)*7&'1*= 5742.8*= +47= &= (4898*++*(9.;*= 2*&38= 4+= (43897:(9.3,= &557457.&9*=+44)=<*'8=47=;&1.)&9.3,=*=.89.3,=9-*47*9.(&1=+44)=<*'=1.30&,*8_=-*=9<= 9*(-3414,>= .8= &184= &);&3(.3,= 7&5.)1>= &3)= 9-*= 6:&39.+.(&9.43= 4+= ).*9&7>= .39&0*= .8= (:77*391>=.3=)*;*1452*39_=)).9.43&11>`=&=3*<=9<=9*(-3.6:*=(&11*)= 5>748*6:*3(.3, = -41)8=5742.8*=+47=)*8(7.'.3,=&11=57*>=.9*28=.3=&=+&*(&1=8&251*_=49-=9-*8*=9*(-3.6:*8= 8-4:1)= '*= *=5147*)= +47= :8*= .3= :3)*789&3).3,= *(48>89*2= .39*7&(9.438= '*9<**3= 9-*= ).++*7*39=1.;.3,=(42543*398=4+=2&7.3*=*(48>89*28_=

+,, = 74/*(9=34_=,**.2*+- = =

-*=:8*=4+=+.8-*78=034<1*),*=94=.3+472=8(.*39.+.(=.3;*89.,&9.438=-&8=349='**3=7*&).1>= 8:55479*)= .3= :897&1.&3= +.8-*7.*8_= :9:7*= )*;*1452*398= 8-4:1)= *;&1:&9*= <&>8= 4+= .3(47547&9.3,=+.8-*7=034<1*),*=.394=&=8(.*39.+.(=+7&2*<470_= -*=)*;*1452*39=4+=&=(42'.3*)=*(48>89*2=&5574&(-='&8*)=43=&=(42'.3*)=24)*1=+47= 9-*8*=9<4=.25479&39=+.8-*7.*8=.8=89.11=7*6:.7*)=&3)='*>43)=9-*=8(45*=4+=&=8.3,1*=574/*(9_= ;*=&7*=2&0.3,=8.,3.+.(&39=.374&)8=94=&))7*88.3,=9-.8=.88:*=9-74:,-=-9=574/*(98=&3)= )*;*145.3,= (42543*398= .3= &884(.&9*)= 574/*(98= <-*7*= 9-*= 4:9(42*8= &7*= 2:9:&11>= '*3*+.(.&1_=?:77*391>=9-*=74(0=14'89*7=24)*1=.8='*.3,=:5,7&)*)=&3)=9-*=&'&143*=24)*1= .8=89.11='*.3,=&)&59*)=&3)=97.&11*)_=

1&33*)=4:9(42*8= A4=.3(47547&9*=9-.8=034<1*),*=.394=9-*=9+=&88*882*398= 4+= '49-= 9-*= 74(0= 14'89*7= &3)= &'&143*= +.8-*7.*8`=9-:8=&))7*88.3,=9-*=3**)8=.)*39.+.*)=.3=9-*=.3.9.&1=&88*882*398=4+='49-=+.8-*7.*8=+47=&= ,7*&9*7=:3)*789&3).3,=4+=*(48>89*2=*++*(98=4+=+.8-.3,_= -*=.3+472&9.43=4'9&.3*)=+742=9-.8=7*5479=-&8='**3=8:551.*)=94=,4:9-=:897&1.&=&3)= &82&3.&=+47=.3(47547&9.43=.394=9-*.7=+=&88*882*398_=

*59&0*=4+=9-*8*=7*8:198=<.11=1*&)=94=&=3*<=.39*,7&9*)=&5574&(-=94=894(0=&88*882*39=.3='49-=9-*= 74(0=14'89*7=&3)=&'&143*=+.8-*7.*8=9-&9=<.11=459.2.8*=9-*=*(414,.(&1`=84(.&1=&3)=*(4342.(='*3*+.98= 4+='49-=+.8-*7.*8_= -*= 4:9(42*8= 4+= 9-.8= 89:)>= .3).(&9*)= 9-&9= 9-*= .39*7&(9.43= '*9<**3= 74(0= 14'89*7= &3)= &'&143*= <&8= 57.2&7.1>= '*-&;.4:7&1= (-&3,*8= .3= 8.?*= &9= *2*7,*3(*= <.9-= 57*)&9.43= '*.3,=7*1&9.;*1>=2.347_= = >:9(42*8= 4+= 9-*= 574/*(9= -&;*= )*243897&9*)= 94= .3):897>= &3)= (422:3.9>= 7*57*8*39&9.;*8=9-&9=9-*7*=&7*=.39*7&(9.438='*9<**3= 85*(.*8= 9-&9= (&3= '*= &88*88*)= &3)= 6:&39.+.*)_=>=+4(:8.3,=43=85*(.+.(=.88:*8=.)*39.+.*)='>=4:7=89&0*-41)*78`=9-.8=574/*(9= -&8=)*243897&9*)=9-&9=9-*7*=.8=&=3**)=+47=2:19.885*(.*8=2&3&,*2*39=.3=9<4=4+=84:9-8 *&89=:897&1.&8=2489=;&1:&'1*=+.8-*7.*8`=&3)=9-*=3**)=+47=9-.8=&5574&(-=94='*=&)459*)= &8=9-*=+:9:7*=2&3&,*2*39=+7&2*<470_=;-.1*=<*=)4=349=*=5*(9=2&3&,*78=&3)=.3):897>= 94=24;*=94=&3=+5=&5574&(-=.22*).&9*1>`=9-*8*=7*8:198=-&;*=574,7*88*)=9-*=)*'&9*= &3)= 34<= &<&.9= 9-*= 3*<= ,*3*7&9.43= 4+= 2:19.885*(.*8= 24)*18= 9-&9= (&3= '*= 1.30*)= 94= &88*882*39=24)*18_=;*=&7*=(:77*391>=574,7*88.3,=9-.8=(43(*59=9-74:,-=&=-9=89:)*39= 8**='*14<_====

3=&=3*<=574/*(9=79?=,**12*./=9-&9=.8=*;&1:&9.3,=<&>8=4+=2&3&,.3,=9-*=.3(7*&8*=.3= :7(-.3= '&77*38= '>= *397489*5-&3:8= 74),*78.. `= &3= 459.43= .8= 94= .3(7*&8*= 9-*= 3:2'*7= 4+= 1&7,*7=8.?*)=14'89*78=:7(-.3=57*)&9478=43=.38-47*=7**+8_=-*=&82&3.&3=74(0=14'89*7= &88*882*39=24)*1=-&8='**3=&19*7*)=94=574;.)*=&3=4:95:9=4+=1&7,*=14'89*7='.42&88_=3= &)).9.43`=9-*=&'&143*=).*9&7>=9<=2&70*7=<.11='*=:8*)=94=)*9*72.3*=9-*=(438:259.43= 4+=9-*8*=1&7,*7=14'89*78=4+=&'&143*_==-.8=<.11=*3&'1*=9-*=74(0=14'89*7=&88*882*39=24)*1= 94= &184= *89.2&9*= &'&143*= 2479&1.9>= <-.(-= (&3= '*= .3(47547&9*)= .394= &'&143*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +,- = =

&88*882*398_=4<*;*7`=9-*=)*;*1452*39=4+=&3=&'&143*=24)*1=.8=(:77*391>=:3)*7<&>_= <*;*79-*1*88`= 4:95:98= <.11= 7&.8*= 9-*= &<&7*3*88= 4+= '49-= 2&3&,*78= &3)= .3):897>= 4+= &)).9.43&1= 84:7(*8= 4+= &'&143*= 2479&1.9>= 9-&9= 3**)= 94='*= (438.)*7*)= .3= &88*882*39= 4+= 9-*= +.8-*7>_= -.8= &88:2*8= 9-&9= 9-*7*= .8= &= (-&3,*= .3= &'&143*= 2479&1.9>= <.9-= .3(7*&8*)= 8.?*=4+=74(0=14'89*7=&8=.)*39.+.*)=.3=9-.8=574/*(9== = B+=9-*=3*,&9.;*=.39*7&(9.43='*9<**3=14'89*78=&3)=&'&143*=&3)=&'&143*=&3)=-&'.9&9=&7*=(43+.72*)= '>=9-.8=574/*(9`=9-*>=<.11=)*243897&9*=9-*=3**)=+47='49-=.3):897>=&3)=2&3&,*2*39=94=&)459=9-*= 98=&,*3)&_= -*=2*9-4)414,.*8=)*243897&9*)=.3=9-.8=574/*(9=-&;*='**3=)*243897&9*)=94=.3):897>= <-.(-=.8='*(42.3,=.3(7*&8.3,1>=&<&7*=4+=9-*=3**)=94=9&0*=&3=*(48>89*2=&5574&(-=94= +.8-*7.*8_=+;.)*3(*=4+= 9-.8= .8=9-*= 8:55479=+47=&3)=5:8-=+47=841:9.438=94=9-*=.3(7*&8*)= 57*;&1*3(*=4+=9-*='&77*388+472.3,=:7(-.3= *397489*5-&3:8 _=8=-.,-1.,-9*)=&'4;*`=9-*= 79?= 574/*(9= 9-&9= .3):897>= &3)= 2&3&,*2*39= 8:55479*)= -&8= &)459*)= 9-*= 2*9-4)8= )*;*145*)= .3= 9-.8= 574/*(9_= 3):897>= &3)= 2&3&,*2*39= &7*= &<&7*= 4+= 9-*= +4:78<&>= .39*7&(9.43= '*9<**3= 0*15`= :7(-.38`= &'&143*= &3)= 74(0= 14'89*7= &3)= &7*= 574&(9.;*= .3= 8**0.3,=&=(42'.3*)=841:9.43_=

A-*=:8*=4+=.3).;.):&18'&8*)=24)*18=94=)*8(7.'*=*(48>89*2=574(*88*8=.3=894(0=&88*882*398_ 3).;.):&18'&8*)=24)*18=<*7*=349=*=5147*)=.3=9-.8=574/*(9`=&19-4:,-=9-*=)*;*1452*39= 4+=2*9-4)8=94=&88*88=14'89*7='*-&;.4:7`=24;*2*39=&3)=).*9=&9=9-*=.3).;.):&1=1*;*1=<&8= )*243897&9*)= .3= 9-*= 574/*(9_= ;*= -&;*= &554.39*)= &= -9= 89:)*39= 94= )*;*145= '49-= 6:&1.9&9.;*=&3)=6:&39.9&9.;*=24)*18=94=*;&1:&9*=9-*=)>3&2.(8=4+=9-*=(42'.3*)=&1,&*`= 74(0= 14'89*7`= &'&143*= &3)= :7(-.3= *(48>89*2= )>3&2.(8_= ;*= 51&3= 94= :8*= &,*398'&8*)= 24)*11.3,= 8.2.1&7= 94= .3).;.):&18'&8*)= 24)*11.3,= <.9-= &,*398= '*.3,= .3).;.):&18= 47= (411*(9.438=4+=.3).;.):&18=47=8.2.1&7=*39.9.*8=94=':.1)=9-*='.414,.(&1=24)*1_=-.8=24)*1= <.11=9-*3=.39*7+&(*=<.9-=9-*=+.8-*7.*8=&88*882*39=24)*18=94=574;.)*='.414,.(&1=+.8-*7.*8= 5&7&2*9*78= *=514.9&9&'1*= '.42&88= *9(_= -*= 74(0= 14'89*7= 24)*1= .8= (:77*391>= '*.3,= &)/:89*)= 94= .3(47547&9*= *(4342.(= )&9&= 79?= ,**02,,*= &3)= '.48*(4342.(= )&9&= 43= +1**9=)>3&2.(8=-9=574/*(9_== =

+,. = 74/*(9=34_=,**.2*+- = =

%55*3).(*8=

%55*3).==+= -*=*++*(9=4+=57*)&947857*>=&3)=(425*9.9.;*= .39*7&(9.438=43=8.?*=&9=*2*7,*3(*=.3='1&(08 1.5=&'&143*= &.149.8=7:'7& =.3=&=&82&3.&3=
%= = = :9-478=&3)=&))7*88*8a=*)*7843=_=D_ $`=&77*99=<_`=7:8-*7=,_9_`=:=943=?_=9_= = &82&3.&3= 6:&(:19:7*= &3)= .8-*7.*8= 389.9:9*`= 5&7.3*= 7*8*&7(-= O&'47&947.*8`= 83.;*78.9>=4+=&82&3.&`=7.;&9*=&>=.3`=4'&79`=&82&3.&`=:897&1.&`=1**+= = ?477*8543).3,=&:9-47=$+2&.1a:,-_*)*7843 :9&8_*):_&:= = &=a=0+=-=0,,1=2*-/= = %'897&(9= 4114<.3,= 247*= 9-&3= &= )*(&)*= 4+= 5749*(9.43= +742= +.8-.3,= &(9.;.9>= 9-*= ).7*(9= &3)= .3).7*(9= *++*(98= 4+= +.8-.3,= 43= '*39-.(= (422:3.9>= 897:(9:7*= &7*= '*(42.3,= &55&7*39= .38.)*= 3489&0*= 2&7.3*= 5749*(9*)= &7*&8= 58= 43= &82&3.&8= *&89= (4&89_= D7&):&1= .3(7*&8*8=.3=9-*=&':3)&3(*=&3)=&;*7&,*=8.?*=4+=5:9&9.;*=&'&143*=57*)&9478=.38.)*=9-*= 3489&0*= 5&7.&= 81&3)= 5&7.3*= 7*8*7;*= 557= -&;*= (4.3(.)*)= <.9-= .3(7*&8*8= .3= 9-*= 2.3.2:2= 8.?*= 4+= *2*7,*39= &'&143*=  &1.49.8= 7:'7& _= -.8= 8:,,*898= 9-&9= 9-*= 9-7*&9= 4+= 57*)&9.43= 2&>= .3+1:*3(*= 9-*= 897:(9:7.3,= 4+= &'&143*= 545:1&9.438_= -*= &':3)&3(*= 4+= *2*7,*39=&'&143*=<&8=3*,&9.;*1>=&884(.&9*)=<.9-=57*)&947=&':3)&3(*`=*85*(.&11>=74(0= 14'89*78= &8:8=*)<&7)8.. `=.38.)*=9-*=5=&3)=.3=&)/&(*39=+.8-*)=&7*&8_='&143*=1*&;*= (7>59.(=-&'.9&9=&9=82&11*7=8.?*8=.3=+.8-*)=&7*&8=(425&7*)=94=&'&143*=.38.)*=9-*=5_= 19-4:,-=9-*=5&99*738=.3=&'&143*=8.?*=&9=*2*7,*3(*=<*7*=89743,1>=(477*1&9*)=<.9-=74(0= 14'89*7= &':3)&3(*= &3)= &;*7&,*= 8.?*`= 9-*= &':3)&3(*= 4+= 49-*7= 57*)&9478= )*2*78&1= 57*)&947>=+.8-=&3)=(7&'8=47=(425*9.9478=8*&=:7(-.38=).)=349=.3+1:*3(*=9-*=5&99*738=.3= &'&143*= 8.?*= &9= *2*7,*3(*_= 4<*;*7`= 57*)&9.43= 2479&1.9>= .3= .841&9.43= (4:1)= 349= &((4:39= +47= 9-*= ).++*7*3(*8= <*= 4'8*7;*)= .3= &'&143*= 8.?*= +7*6:*3(>= ).897.':9.438= '*9<**3=5=&3)=&)/&(*39=+.8-*)=14(&9.438_=;*=8:,,*89=9-&9=&=(42'.3&9.43=4+=+&(9478=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +,/ = =

.3(1:).3,= 57*)&9.43`= .397&= &3)= .39*785*(.+.(= (425*9.9.;*= .39*7&(9.438= &7*= 7*85438.'1*= +47=5&99*738=.3=&'&143*=8.?*=&9=*2*7,*3(*_== = .*><47)8 a='&143*`=8.?*=&9=*2*7,*3(*`=57*)&947857*>=.39*7&(9.438`='*-&;.4:7`=58`= &1.49.8=7:'7&= = 73974):(9.43= .8947.(&11>`= 7*8*&7(-= 43= 9-*= *++*(98= 4+= +.8-.3,= -&8= '**3= +4(:8*)= 43= )*9*72.3.3,= 9-*= .25&(9=4+=7*24;.3,=9&7,*9=85*(.*8=+742=2&7.3*=*(48>89*28`=<.9-=2489=89:).*8=1.2.9*)= 94=*=&2.3.3,=(-&3,*8=.3='.42&88=&3)=8.?*=897:(9:7*_=4<*;*7`=&+9*7=8*;*7&1=)*(&)*8=4+= *=514.9&9.43= 9-*= .3).7*(9= *++*(98= 4+= +.8-.3,= 94= 34389&7,*9= 85*(.*8= &3)= *(48>89*28= &7*= '*.3,=4'8*7;*)=.3=&=7&3,*=4+=9*25*7&9*=*(48>89*28=&'(4(0=*9=&1_=+333b=5&>+.*1)=]= 7&3(-=,***b=*,3*7=]=9&>943=,***b=E&754;=*9=&1_=,**+b=74,*788*33*99=]=*&78*=,**+b= ,-*&78= ]= &'(4(0= ,**-b= 7*;.*<*)= '>= *,3*7= ]= 9&>943= ,***_= 243,= 9-*= 2489= 5742.3*39=.3).7*(9=*++*(98=4+=+.8-.3,=&7*=(-&3,*8=94=57*)&947857*>=7*1&9.438-.58=+89*8= ]=&12.8&34=+31.b=,.2*389&)=*9=&1_=+312b=*,3*7=]=9&>943=+32+b=?4<*3=+32-b=*,3*7= ]= O*;.3= +32-b= C&)&8= ]= ,9*3*(0= +33/b= *,3*7= ]= 9&>943= ,***= &3)= (425*9.9.;*= .39*7&(9.438= '*9<**3= 85*(.*8= &77= *9= &1_= +330b= E&754;= *9= &1= ,**+_= 3= 2&3>= (&8*8`= &88*88.3,='49-=9-*=).7*(9=&3)=.3).7*(9=*++*(98=4+=+.8-.3,=-&8=431>='**3=5488.'1*=;.&=9-*= &);*39=4+=2&7.3*=5749*(9*)=&7*&8=.3=<-.(-=+.8-.3,=.8=574-.'.9*)=3489&0*=58_=-*= *++*(9.;*3*88= 4+= 58= 94= .3(7*&8*= 9-*= &':3)&3(*`= &;*7&,*= 8.?*= &3)= '.42&88= 4+= *=514.9*)=85*(.*8=+),&7=]=&77*99=+333b=5(?1&3&-&3=]=79-:7=,**+b=7:88=]=1(&1&= ,**-b=;.11.8=*9=&1_=,**-`=7*;*78*=9745-.(=(&8(&)*8=&3)=7*8947*=*(48>89*28=94<&7)8=57*8 +.8-.3,=89&9*8=.8=34<=<*11=7*(4,3.8*)=,-*&78=]=&'(4(0=,**-_== = 4114<.3,= &= )*(&)*= 4+= 5749*(9.43= +742= *=514.9&9.43`= (-&3,*8= .3= 9-*= &':3)&3(*`= &;*7&,*= 8.?*= &3)= ).;*78.9>= 4+= 85*(.*8= -&;*= '**3= 4'8*7;*)= .3= 3489&0*= 58= &143,= &82&3.&8= *&89= (4&89= +),&7= ]= &77*99= +333`= :=943= *9= &1_= ,**0_= -*= 2489= 349&'1*= (-&3,*8= -&;*= 4((:77*)= .3= 9-*= 1&7,*89= 3489&0*= 7*8*7;*= &9= 5&7.&= 81&3)`= <-*7*= 545:1&9.438=4+=9-*=9<4=(422*7(.&11>=.25479&39=85*(.*8`=74(0=14'89*7= &8:8=*)<&7)8.. = &3)='1&(081.5=&'&143*= &1.49.8=7:'7& ` =-&;*=:3)*7,43*=8.,3.+.(&39=(-&3,*=(425&7*)=94= &)/&(*39=+.8-*)=14(&9.438=+),&7=]=&77*99=+333b=:=943=*9=&1_=,**0_=3=9-*=&'8*3(*=4+= +.8-.3,`= 9-*= &;*7&,*= 8.?*= &3)= 7*1&9.;*= &':3)&3(*= 4+= 74(0= 14'89*78= .3(7*&8*)= 8.,3.+.(&391>= .38.)*= 9-*= 5_= 3= (4397&89`= *2*7,*39= &'&143*= 545:1&9.438= -&;*= :3)*7,43*=&3=:3*=5*(9*)=)*(1.3*=.3=7*1&9.;*=&':3)&3(*=.38.)*=9-*=5`=&997.':9&'1*= 94= &= )*(1.3*= .3= 82&11*7= 8.?*= (1&88*8= :=943= *9= &1_= ,**0_= -.8= 4'8*7;*)= )*(1.3*= <&8= &997.':9*)= 94= 43*= 4+= 8*;*7&1= ).++*7*39= +&(9478a= &3= .3(7*&8*= .3= 57*)&9.43= 2479&1.9>= 4+= 82&11= .3).;.):&18= &8= 57*)&947= &':3)&3(*8= .3(7*&8*)= .3= 9-*= &'8*3(*= 4+= +.8-.3,b= 9-*= *2*7,*3(*= '*-&;.4:7= 4+= /:;*3.1*= &'&143*= .38.)*= 9-*= 5= 2&>= -&;*= (-&3,*)= .3= 7*85438*= 94= 34381*9-&1= .39*7&(9.43= <.9-= 9-*= .3(7*&8*)= 3:2'*7= &3)= 8.?*= 4+= 57*)&9478= .38.)*= 9-*= 5b= .397&85*(.+.(= (425*9.9.43= +47= 7*84:7(*8= +44)= &3)= 85&(*= &8= 9-*= &;*7&,*=8.?*=4+=&):19=*2*7,*39=&'&143*=.3(7*&8*)b=47=+742=.39*7885*(.+.(=(425*9.9.43= <.9-=8*&=:7(-.38_==

+,0 = 74/*(9=34_=,**.2*+- = =

= 19-4:,-= +&(9478= 8:(-= &8= (425*9.9.;*= .39*7&(9.438= '*9<**3= &'&143*= &3)= 8*&= :7(-.38= ,-*5-*7)=+31-&b=3)7*<=]=83)*7<44)=+33,b=E&754;=*9= &1= ,**+= &3)= 57*)&9.43= 4+= /:;*3.1*=&'&143*=74,*788*33*99=]=*&78*=,**+b=,-*5-*7)=+332b=,-*5-*7)=]=?1&70843= ,**+b=5&>+.*1)=]=7&3(-=,***b=9&>=]=7&3(-=,**,=-&;*='**3=*=&2.3*)`=;*7>=1.991*= .3+472&9.43= *=.898= 43= 9-*= 2*(-&3.828= (4397.':9.3,= 94= *2*7,*3(*= '*-&;.4:7_= 88.3,= 7*8:198= +742= &= 8:7;*>= 4+= &'&143*= 545:1&9.438= &9= 8*;*7&1= 8.9*8= .38.)*= 9-*= 5= &3)= &)/&(*39=+.8-*)=14(&9.438`=<*=(425&7*=5&99*738=4+=&'&143*=8.?*=&9=*2*7,*3(*=<.9-=9-*= &':3)&3(*= 4+= 57*)&9478= &3)= (425*9.9478= 94= )*9*72.3*= 9-*= 5488.'1*= 2*(-&3.828= 1*&).3,=94=9-*=4'8*7;*)=(-&3,*8=.3=*2*7,*39=&'&143*=545:1&9.438_== =
*9-4)8= .9*=8*1*(9.43= -*= 545:1&9.43= 897:(9:7*8= 4+= '*39-.(= .3;*79*'7&9*8= &3)= )*2*78&1= +.8-= 85*(.*8= <*7*= 8:7;*>*)=&9=+*=8.9*8=.3=5*7(:7>=&88&,*=43=&82&3.&8=*&89=(4&89='*9<**3=5&>=&3)= B:1>= ,**/_= -*= 8.9*8= 8:7;*>*)= <*7*= 7*57*8*39&9.;*= 4+= 9-48*= :8*)= .3= 9-*= 143,89*72= 243.947.3,= 4+= 9-*= *++*(9.;*3*88= 4+= 9-*= 3489&0*= 5&7.&=81&3)=5&7.3*=7*8*7;*=557= *89&'1.8-*)=.3=+33+=+),&7=]=&77*99=+331_=,9:)>=8.9*8=<*7*=14(&9*)=43=2*).:2=574+.1*= 74(0>= 7**+8= &9= &= )*59-= 4+= /=2`= <*7*= 8.2.1&7= .3= *=548:7*= 94= 57*;&.1.3,= <*&9-*7= (43).9.438`=&3)=8:55479*)=(422:3.9.*8=4+=1&7,*='74<3=2&(74&1,&*=&3)=:3)*78947*>= &1,&1= 85*(.*8= 9>5.(&1= 4+= 24)*7&9*1>= *=548*)= (4&891.3*8= .3= 84:9-8*&89*73= &82&3.&= +),&7= +32._= .;*= 4+= 9-*= 8.9*8= <*7*= 14(&9*)= .38.)*= 9-*= 5`= <.9-= &= 2.3.2:2= 8*5&7&9.43=4+=*_2=02='*9<**3=8.9*8`=<-.(-=.8=,7*&9*7=9-&3=9-*=.39*78&33:&1=24;*2*39= 4+=74(0=14'89*78=.38.)*=9-*=5=:=943=*9=&1=,**0=94=*38:7*=*89.2&9*8=4+=74(0=14'89*7= &':3)&3(*= <*7*= .3)*5*3)*39= 4+= *&(-= 49-*7_= .;*= 8.9*8= <*7*= 14(&9*)= &)/&(*39= 94= 9-*= 5=<-*7*=(422*7(.&1=&3)=7*(7*&9.43&1=74(0=14'89*7=&3)=&'&143*=+.8-*7.*8=(439.3:*= 94=45*7&9*=-*7*&+9*7=7*+*77*)=94=&8=+.8-*)=8.9*8_== = :7;*>=9*(-3.6:*8= *39-.(= .3;*79*'7&9*8= &3)= )*2*78&1= +.8-*8= <*7*= 8:7;*>*)= :8.3,= :3)*7<&9*7= ;.8:&1= (*38:8= 9*(-3.6:*8= )*8(7.'*)= '>= +),&7= &3)= &77*99= +331_= 9= *&(-= 8.9*`= +4:7= /*82= 97&38*(98=<*7*=)*514>*)=7&3)421>=&143,=9-*=/=2=)*59-=(4394:7=&3)=9-*=&':3)&3(*= &3)= 8.?*= 897:(9:7*= 4+= 74(0= 14'89*78=  &8:8= *)<&7)8.. = &3) = *2*7,*39= '1&(081.5= &'&143*= &1.49.8=7:'7& =<*7*=7*(47)*)='>=).;*78=8*&7(-.3,=&=+=2=897.5=5&7&11*1=94=*&(-=97&38*(9_= ;.9-.3=9-*=8&2*=8*&7(-=&7*&=9-*=&':3)&3(*=4+=8*&=:7(-.38= *1.4(.)&7.8=*7>9-74,7&22& = &3)=(7&'8=
1&,:8.&=(-&'7:8 =<*7*=&184=7*(47)*)_='&143*=8.?*=&9=*2*7,*3(*=*89.2&9*8= <*7*= 4'9&.3*)= '>= 9<4= ).;*78= 8*&7(-.3,= -&'.9&9= /= 2= *.9-*7= 8.)*= 4+= 9-*= 97&38*(9= &3)= 7*897.(9*)='*9<**3=9-*=-=2=&3)=1=2=)*59-=(4394:78_=+2*7,*39=&'&143*=<*7*=)*+.3*)=&8= .3).;.):&18= 349= -.))*3= +742= 9-*= ).;*78= ;.*<= .3= )**5= (7*;.(*8= ':9= *=548*)= 94= 57*)&9478`=<-*7*&8=(7>59.(=.3).;.):&18=<*7*=-.))*3=+742=9-*=).;*78=;.*<=.3=(7*;.(*8= &3)= :3)*7= '4:1)*78_= +89.2&9*8= 4+= (7>59.(= &'&143*= 8.?*= 897:(9:7*8= <*7*= 4'9&.3*)= '>= 1.+9.3,=&3)=8*&7(-.3,=:3)*73*&9-=82&11='4:1)*78= (& _=*_/=:=*_1/=2=).&2*9*7=.3=9-*=&7*&= .3=<-.(-=*2*7,*39=.3).;.):&18=<*7*=2*&8:7*)_=4=7*24;*=4'8*7;*78.3):(*)='.&8*8=.3=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +,1 = =

9-*= (1&88.+.(&9.43= 4+= (7>59.(= &3)= *2*7,*39= &'&143*`= 9-*= 8&2*= ).;*78= <*7*= :8*)= 94= 8:7;*>= &11= 8.9*8= .3= 9-*= 89:)>_= = 2.3.2:2= 4+= ,**= &'&143*= (7>59.(= &3)= *2*7,*39= (42'.3*)=<*7*=(1&88.+.*)=&3)=2*&8:7*)= .3=8.9: =&9=*&(-=8.9*=:8.3,=03.+*8*),*=(&1.5*78_= 4=*38:7*=9-&9=&((:7&9*=*89.2&9*8=4+=8.?*=&9=*2*7,*3(*=(4:1)='*=(&1(:1&9*)=&=2.3.2:2= 4+=1/=(7>59.(=.3).;.):&18=<*7*=7*(47)*)=.3=*&(-=8&251*=<-*7*=5488.'1*_== = -*= &':3)&3(*= 4+= 9-*= )42.3&39= 57*)&947>= )*2*78&1= +.8-`= .3(1:).3,= 9-*= 1&'7.)8=
.(9.1&'7:8=1&9.(1&;.:8 `=
8*:)41&'7:8=58.99&(:1:8 `= 4941&'7:8=+:(.(41& `= _=9*97.(:8 `=49&1&'7:8= &:739.&(:8 b= 9-*= 2434(&39-.)8 = +(&39-&1:9*7*8= ;.99.,*7 `= 7*:8(-*3.&= &:897&1.8 `= 7*:8(-*3.&= +7*>(.3*9. b= 9-*= 1&97.) = E&97.)458.8= +4789*7. b= &3)= 9-*= (-*.14)&(9>1.)8 = -*.14)&(9>1:8= 3.,7.5*8= &3) = _= 85*(9&'.1.8 `= <*7*= 7*(47)*)= '>= ).;*78= 8:7;*>.3,= &= /= 2= <.)*= 897.5= .22*).&9*1>= &'4;*=9-*=7**+=&143,='49-=8.)*8=4+=*&(-=97&38*(9_=9:*=94=9-*=14<=&':3)&3(*8=4+=8*;*7&1= 85*(.*8`=)&9&=<*7*=5441*)=.394=&=,74:5=-*7*&+9*7=(&11*)=)*2*78&1=+.8-=+47=(425&7.843= .3=89&9.89.(&1=9*898_== = 9&9.89.(&1=&3&1>8.8= -*=7*1&9.438-.5='*9<**3=&'&143*=8-*11=1*3,9-=&3)=9-*=89&9*=4+=*2*7,*3(*=(7>59.(=47= *2*7,*39= <&8= )*9*72.3*)= :8.3,= 14,.89.(= 7*,7*88.43= &8= 9-*= 9*(-3.6:*= .8= 2489= 8:.9*)= <-*3= 9-*= )*5*3)*39= ;&7.&'1*= *2*7,*3(*= .8='.342.&11>= ).897.':9*)= &8= &= +:3(9.43= 4+= 9-*=5&7&2*9*78=4+=9-*=.3)*5*3)*39=;&7.&'1*=482*7=]=O*2*8-4<=,***_='&143*=8.?*= &9= *2*7,*3(*= <&8= *89.2&9*)= :8.3,= &= 574'.9= 7*,7*88.43= 24)*1= 9-&9= &88:2*8= 9-&9= 9-*= 5*7(*39=7*85438*=*2*7,*3(*=.8=7*1&9*)=94=9-*=14,=4+=9-*=.3)*5*3)*39=;&7.&'1*=8-*11= 1*3,9-=&8=&=(:2:1&9.;*=3472&1=).897.':9.43=.33*>=+31+_=-*=5*7(*39&,*=4+=&'&143*= *2*7,*39=(&3='*=*89.2&9*)=:8.3,=9-*=14,=4+=8-*11=1*3,9-8=+742=9-*=(:2:1&9.;*=3472&1= ).897.':9.43=<.9-=9-*=2489=7*1.&'1*=(425&7.8438='*9<**3=8.9*8=2&)*=:8.3,=9-*=+.+9.*9-= 5*7(*39.1*_== = 7*1&9.438-.58= '*9<**3= &'&143*= 8.?*= &9= *2*7,*3(*= &3)= 9-*= &':3)&3(*= 4+= 5:9&9.;*= &'&143*=57*)&9478=&3)=(425*9.9478=<*7*=)*+.3*)=:8.3,=&=2:19.51*=89*58<.8*=&)).9.43= 7*,7*88.43=&3)=+.99*)=:8.3,=47).3&7>=1*&89=86:&7*8_=-*=2489=5&78.243.4:8=24)*1=<&8= 7*&(-*)= <-*3= 9-*= 14<*89= 0&.0*= 3+472&9.43= ?7.9*7.43= ?= ;&1:*= &3)= -.,-*89= &)/:89*)=7 ,= ;&1:*8=<*7*=4'9&.3*)=&3)=&=3472&1=A8A=5149=4+=7*8.):&18=+4114<*)=&=./ °= 1.3*_=11=&3&1>8*8=<*7*=:3)*79&0*3=:8.3,=9-*=,,=89&9.89.(&1=84+9<&7*=5&(0&,*=&=;_=3_+= ,,=389.9:9*_= = '&143*= 8.?*= +7*6:*3(>= ).897.':9.438= <*7*= (425&7*)= '*9<**3= 5= &3)= +.8-*)= 545:1&9.438= :8.3,= &= 7&3)42.8&9.43= 574(*):7*= <.9-= 9-*= E4124,474;8,2.734;= 9*89= 89&9.89.(= _=9&9&=<*7*=5441*)=&(7488=8.9*8=<.9-.3=*&(-=97*&92*39=&3)=9-*=9*89=89&9.89.(= (&1(:1&9*)= 4'8 _ =,.?*=+7*6:*3(>=)&9&=+742=9-*=9<4=).897.':9.438=<*7*=9-*3=5441*)=&3)= 7&3)421>= 7*&114(&9*)= '&(0= 94= *&(-= 47.,.3&1= ).897.':9.43= &3)= 9-*= 9*89= 89&9.89.(= 7*(&1(:1&9*)= 7&3) _=-*=574(*):7*=<&8=7*5*&9*)=+***=9.2*8=&3)=9-*=9*89=4+=8.,3.+.(&39= ).++*7*3(*='*9<**3=9-*=9<4=).897.':9.438=2&)*='>=(425&7.3,=9-*=;&1:*=4+=9-*= 4'8= 94= 9-*=).897.':9.43=4+= 7&3) =;&1:*8=4'9&.3*)='>=9-*=7&3)42.8&9.43=574(*):7*_=,.,3.+.(&39=

+,2 = 74/*(9=34_=,**.2*+- = =

).++*7*3(*8= <*7*= .)*39.+.*)= <-*3= 1*88= 9-&3= ,/= 4+= 9-*= 7&3) = ;&1:*8= 4'9&.3*)= +742= 9-*= 7&3)42.8&9.43= 574(*):7*= *=(**)*)= 9-*= ;&1:*= 4+= 4'8 = +4114<.3,= 9-*= 574(*):7*= )*8(7.'*)='>=&))43=,**+_== = 4=*38:7*=2*&3.3,+:1=(425&7.8438='*9<**3=9-*=545:1&9.43=897:(9:7*8=(4:1)='*=2&)*`= <.9-4:9= 9-*= '.&8= 4+= &'841:9*= &':3)&3(*8`= 9-*= 8.?*= +7*6:*3(>= ).897.':9.43= +742= 9-*= 5=545:1&9.43=<&8=7*8(&1*)=94=2&9(-=9-*=8(&1*=4+=9-*=+.8-*)=545:1&9.43_=7*8(&1.3,= <&8=&(-.*;*)='>=(&1(:1&9.3,=&=(42243=8145*=&3)=.39*7(*59=4+=9-*=1.3*&7=7*1&9.438-.5= '*9<**3= +7*6:*3(>= &3)= 8-*11= 1*3,9-`= '*9<**3= +*= 22= &3)= +*.= 22= 8-*11= 1*3,9-8= 82&11*89=.3).;.):&18=8&251*)=&3)=9-*=2.)=54.39='*9<**3=9-*=9<4=8.?*=&9=*2*7,*3(*= *89.2&9*8= 7*85*(9.;*1>`= +47= *&(-= 545:1&9.43_= -*= (42243= 8145*= &3)= .39*7(*59= <*7*= 9-*3=:8*)=94=(&1(:1&9*=9-*=7*8(&1*)=7*1&9.;*=+7*6:*3(.*8=4+=*&(-=8.?*=(1&88=,=22='.38= 4+= 9-*= 5= 545:1&9.43_= -*= 7*8(&1*)= 5= 545:1&9.43=<&8= 9-*3= 51499*)= &,&.389= 9-*= :3(-&3,*)= +.8-*)= 545:1&9.43= 94= &114<= 7*1&9.;*= (425&7.8438='*9<**3= 9-*= 545:1&9.43= 897:(9:7*8=94='*=2&)*_== = /*8:198= &99*738=.3=&'&143*=8.?*=&9=*2*7,*3(*=&3)=545:1&9.43=8.?*=897:(9:7*= +89.2&9*8=4+=&'&143*=8.?*=&9=*2*7,*3(*=,+=;&7.*)=(438.)*7&'1>=&9='49-=5=&3)= +.8-*)= 14(&9.438= .,:7*= .1`= &'1*= +*`= ':9= <&8= (438.89*391>= 1&7,*7= .38.)*= 9-*= 5_= ;-*3=9-*=)&9&=+742=8.9*8=<.9-.3=*&(-=97*&92*39=<*7*=5441*)`=&'&143*=,+=.3=9-*=5= <&8= 8.,3.+.(&391>= ,7*&9*7= 9-&3= &9= &)/&(*39= +.8-*)= 8.9*8= ++1_2= 22= &3)= 21_0= 22= 7*85*(9.;*1>`=5 =0 *_**+_== = -*= 8.?*= +7*6:*3(>= ).897.':9.438= 4+= &'&143*= 545:1&9.438= +742= .38.)*= 9-*= 5= <*7*= 8.,3.+.(&391>=).++*7*39=+742=9-48*=.3=&)/&(*39=+.8-*)=14(&9.438= 4'8 =-=*_-23`=5 =0=*_***+`= <.9-= &'&143*= 1&7,*7= 9-&3= +.*= 22= &((4:39.3,= +47= 9-*= ,7*&9*89= ).++*7*3(*= .3= 9-*= 8.?*= +7*6:*3(>=).897.':9.438=.,:7*=.2_=3=9-*=5=&=82&11*7=+7&(9.43=4+=9-*=545:1&9.43= <&8='*9<**3=9-*=8.?*=&9=*2*7,*3(*=&3)=9-*=2.3.2:2=1*,&1=8.?*=4+=+-0=22=(425&7*)= 94= 9-*= +.8-*)= 8.9*8= +0= &3)= //= 7*85*(9.;*1>_= 3= (4397&89`= 9-*= 5745479.43= 4+= 9-*= 545:1&9.43=&'4;*=9-*=2.3.2:2=1*,&11>=*=514.9&'1*=8.?*=<&8=2:(-=,7*&9*7=.3=9-*=5= 9-&3= &9= +.8-*)= 8.9*8= //= &3)= +2= 7*85*(9.;*1>_= 9*85.9*= 9-*= 4'8*7;*)= ).++*7*3(*8= '*9<**3= *2*7,*39= .3).;.):&18`= 9-*= 5745479.43= 4+= *&(-= 545:1&9.43= 7*2&.3.3,= (7>59.(= <&8=8.2.1&7=,1=+.8-*)=&3)=,3=5_== = ;-*3=9-*=8.?*=+7*6:*3(>=).897.':9.43=4+=9-*=5=545:1&9.43=<&8=7*8(&1*)=7*1&9.;*=94= 9-*=+.8-*)=545:1&9.43`=94=7*24;*='.&8*8=.3=&'841:9*=&':3)&3(*`=9-*7*=<&8=34=*;.)*3(*= 9-&9= 57*)&9.43= 2479&1.9>= -&)= 8.,3.+.(&391>= 7*):(*)= 9-*= 5745479.43= 4+= &'&143*= '*14<= 9-*= 8.?*= &9= *2*7,*3(*= *89.2&9*= .38.)*= 9-*= 5= .,:7*= .3_= 389*&)`= 9-*= 7*1&9.;*= ).++*7*3(*8= '*9<**3= 9-*= 7*8(&1*)= +7*6:*3(>= ).897.':9.438= .3).(&9*)= 9-*= +.8-*)= &3)= 5= 545:1&9.438= <-*7*= 8.2.1&7= .3= 897:(9:7*= :5= 94= 9-*= 2.3.2:2= 1*,&11>= *=514.9&'1*= 8.?*=4+=+-0=22= 4'8 =-=*_*-3`=5 =-=*_.-`=&+9*7=<-.(-=9-*7*=<&8=&=(1*&7=*++*(9=4+=5749*(9.43= 43=&'&143*=8.?*=897:(9:7*= 4'8 =-=*_-23`=5 =0=*_***+_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +,3 = =

= = 1

0.8 e c n e g

r 0.6 e m e f o y t i l i

b 0.4 a b o r P

0.2

0

0 40 80 120 160 200 Shell length (mm) =

*.,:7*=.1= .?*=&9=*2*7,*3(*=%=4+=&'&143*=&9=9*3=8.9*8=<.9-.3=
*7(:7>=&88&,*_=73).;.):&1= 51498=7*57*8*39=9-*=574'&'.1.9>=4+=&'&143*='*.3,==*2*7,*39=&9=&3>=,.;*3=8-*11=1*3,9-= 22=<.9-=841.)=1.3*8=7*57*8*39.3,=8.?*=&9=*2*7,*3(*=*89.2&9*8=+47=8.9*8=.38.)*=9-*=
%`= )&8-*)= 1.3*8= 7*57*8*39.3,= &'&143*= 545:1&9.438= &9= &)/&(*39= 8.9*8= 45*3= 94= +.8-.3,_=147.?439&1=)&8-*)=1.3*=.3).(&9*8=&=*_/=574'&'.1.9>=4+=&'&143*='*.3,=*2*7,*39= &9=9-*=(477*8543).3,=8-*11=1*3,9-_= =

+-* = 74/*(9=34_=,**.2*+- = =

&'1*=+*= :22&7>=4+=&'&143*=8.?*=&9=*2*7,*3(*=*89.2&9*8= )3/= +7= &9= +.;*= 8.9*8= 45*3= 94= +.8-.3,= &3)= +.;*= 8.9*8= .38.)*= 9-*=
&7.&= 781&3)= &= 3489&0*=
%_= .?*= &9= *2*7,*3(*= *89.2&9*8= 7*57*8*39= 9-*= 8-*11= 1*3,9-= <-*3= 9-*7*= .8= &= 574'&'.1.9>= 4+= *_/= 9-&9= &3= .3).;.):&1= <.11= '*= *2*7,*39_= 89.2&9*8= 4+= 8.?*= &9= *2*7,*3(*= +47=
%= &3)= +.8-*)= 545:1&9.438=<*7*=(&1(:1&9*)=43=)&9&=5441*)=&(7488=8.9*8=<.9-.3=*&(-=97*&92*39_== = ,.?*=&9= =4+= = *2*7,*3(*= 8&251*= ,.9*= =22== 0=,+= <= = .8-*)======+= 11_,=1,_082+_+= +/_1= +2/= = = ,= 11_3=1-_+82,_+= ,+_0= +3.= = = -= 3-_.=3+_.83/_,= ,3_-= ,/3= = = .= 2-_3=2*_,821_+= ,/_1= ,,,= = = /= 32_1=3._08+*,_/= ./_3= ,++= = = 441*)= 21_0=20_2822_.= ,1_0= +*1+======5======+= +,+_+=++2_/8+,._-= ,1_+= ,/3= = = ,= +,1_0=+,._.8+-*_.= ,._0= +2-= = = -= +-*_0=+,2_/8+-,_.= -3_.= ,/3= = = .= ++/_0=++*_38++3_*= ,3_.= ,-2= = = /= +**_+=30_28+*,_3= -*_2= ,-.= = = 441*)= ++1_2=++1_+8++2_/= -*_,= ++1-= = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +-+ = =

Fished 0.03 27% 55% 18%

0.02

0.01 Proportion of total population total of Proportion

0 0 40 80 120 160 200

MPA 0.03 29%16% 55%

0.02

0.01 Proportion of total population total of Proportion

0 0 40 80 120 160 200 Shell length (mm) =

*.,:7*=.2= .?*= +7*6:*3(>= ).897.':9.438= 4+= &'&143*= .3= 545:1&9.438= &9= +.8-*)= 8.9*8= <.9-.3=
*7(:7>= &88&,*= &3)= .38.)*= 9-*=
%_= -.897.':9.438= <*7*= (43897:(9*)= '>= 5441.3,= 8.?*=)&9&=&(7488=+.;*=8.9*8=<.9-.3=*&(-=97*&92*39=!=-=+*1+=+.8-*)`=! =-=+,*3=
%_=-*= ).897.':9.438=4+=&'&143*=8.?*8=<*7*=8.,3.+.(&391>=).++*7*39=  &4'8 = -= *_-23`=5=0=*_***+`= <.9-= 9-*= 2&=.2:2= ).;*7,*3(*= '*9<**3= ).897.':9.438= &9= 8-*11= 1*3,9-8= 4+= +.*= 22_= -&8-*)= ;*79.(&1= 1.3*8= 7*57*8*39= 8.?*=&9=*2*7,*3(*=*89.2&9*8= +47= )&9&= 5441*)= &(7488= 8.9*8= <.9-.3= *&(-= 97*&92*39_= 41.)= ;*79.(&1= 1.3*8= 7*57*8*39= 9-*= 2.3.2:2= 1*,&11>= *=514.9&'1*=8.?*=+47=&'&143*=.3=9-*=7*,.43=+-0=22_=

+-, = 74/*(9=34_=,**.2*+- = =

=

Fished 80 MPA

60

40 Relative scaled frequency scaled Relative

20

0 0 40 80 120 160 200 Shell length (mm) =

*.,:7*=.3= +425&7.843= 4+= 7*1&9.;*= 8(&1*)= +7*6:*3(>= ).897.':9.438= +47= &'&143*= 545:1&9.438= &9= +.8-*)= 8.9*8= <.9-.3=
*7(:7>= &88&,*= &3)= 9-*=
&7.&= 781&3)=
%_= -*= ).897.':9.43= +742= 9-*=
%= -&8= '**3= 7*8(&1*)`= :8.3,= &= 8145*= &3)= .39*7(*59= (42243= 94= '49-= ).897.':9.438= +742= 9-*= 1.3*&7= 7*,7*88.43= '*9<**3= +7*6:*3(>= &3)= 8-*11= 1*3,9-= '*9<**3=+*=&3)=+*.=22=8-*11=1*3,9-8=+47=*&(-=545:1&9.43_= -&8-*)= ;*79.(&1= 1.3*8= 7*57*8*39=9-*=2*&3=8.?*=&9=*2*7,*3(*=.3=+.8-*)=&3)=
%= 545:1&9.438=22= &3)= ++2= 7*85*(9.;*1>= &3)= 9-*= 841.)= ;*79.(&1= 1.3*= 9-*= 2.3.2:2= 1*,&11>= *=514.9&'1*= 8.?*= +-022_= = /*1&9.438-.58=<.9-=57*)&9478=&3)=(425*9.9478== -*=2489=5&78.243.4:8=2:19.51*=7*,7*88.43=24)*1=*=51&.3.3,=9-*=5&99*738=.3=&'&143*= 8.?*= &9= *2*7,*3(*= .3(1:)*)= 9-*= .3).;.):&1= 9*728= 4+= 74(0= 14'89*7= &':3)&3(*=  &8:8= *)<&7)8.. ` = 2*&3= 8.?*= 4+= 74(0= 14'89*78= (&7&5&(*= 1*3,9-`= &3)= 9-*= .39*7&(9.43='*9<**3= , 74(0=14'89*7=&3)=8*&=:7(-.3=&':3)&3(*=&'1*=++`= &)/ 7 =-=*_1-`= )-`=-0 =-=-/_11`=5=0*_**+`=?= --*-_3_= -*= .3).;.):&1= 9*728= 4+= (7&'= 
1&,:8.&= (-&'7:8 ` = 57*)&947>= )*2*78&1= +.8-`= *2*7,*39=&'&143*`=*2*7,*39=&'&143*=1+.*=22`=&3)=8*&=:7(-.3=&':3)&3(*= *1.4(.)&7.8=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +-- = =

*7>9-74,7&22& = <*7*= 349= 7*1&9*)= 94= &'&143*= 8.?*= &9= *2*7,*3(*= &3)= 349= 8.,3.+.(&39= (42543*398=.3=9-*=2489=5&78.243.4:8=24)*1=.,:7*=/*_== = &'1*=++= :22&7>=4+=9-*=2489=5&78.243.4:8=2:19.51*=7*,7*88.43=24)*1=*=51&.3.3,=5&99*738= .3=&'&143*=8.?*=&9=*2*7,*3(*=)*5*3)*39=;&7.&'1*= = ?4*++.(.*398= +89.2&9* = ,_+_= 5= = =39*7(*59= 12_.,= -_-1= 0*_**+= = = 74(0=14'89*7=&':3)&3(*= -_31= *_1/= 0*_**+= = = 5*&3=74(0=14'89*7=8.?*=22= *_+-= *_*.1= 0*_*+= = = 74(0=14'89*7=$=,*&=:7(-.3=&':3)&3(* = 8*_*+-= *_**-= 0*_**+= = , , = 5:19.51*=7 =-=*_1/`=)/:89*)=7 =-=*_1-`= )-`=-0 =-=-/_11`=5=0*_**+`=?=--*-_3= = = =

+-. = 74/*(9=34_=,**.2*+- = = a) 140 b) 140

120 120

100 100

80 80 Abalone size at emergence(mm) at size Abalone

0 4 8 12 16 20 0 40 80 120 160 Rock lobster abundance (per 200m 2) Mean rock lobster carapace length(mm) c) 140 d) 140

120 120

100 100

80 80 Abalone size at emergence(mm) at size Abalone

0 2 4 6 8 0 100 200 300 400 Crab abundance (per 200m 2) Sea urchin abundance (per 200m 2) e) 140 f) 140

120 120

100 100

80 80 Abalone size at emergence(mm) at size Abalone

0 20 40 60 0 5 10 15 20 25 Emergent abalone abundance (per 200m 2) Emergent abalone >140 mm abundance (per 200m 2) =

*.,:7*=/*= (&99*751498= 8-4<.3,= 9-*= ).897.':9.43= 4+= &'&143*= 8.?*= &9= *2*7,*3(*= *89.2&9*8= .3= 7*1&9.43= 94`= &= 74(0= 14'89*7= &':3)&3(*= 5 = 0= *_**+`= / ,= -= *_..`= '= 2*&3= 74(0= 14'89*7= (&7&5&(*=1*3,9-=5 =0= *_**+`=/ ,= -=*_//`=(=(7&'=&':3)&3(*`=)=8*&=:7(-.3=&':3)&3(*`=*= *2*7,*39=&'&143*=&':3)&3(*`=&3)=+=*2*7,*39=&'&143*= 1+-022=&':3)&3(*_=7*3)= 1.3*8= 7*57*8*39= 8.,3.+.(&39= 7*1&9.438-.58= '*9<**3= &'&143*= 8.?*= &9= *2*7,*3(*= &3)= 8.3,1*=.3)*5*3)*39=;&7.&'1*8=+47=+.99*)=:8.3,=47).3&7>=1*&89=86:&7*8=7*,7*88.43_==

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +-/ = =

-.8(:88.43= '&143*=&7*=&243,89=9-*=2489=*=514.9*)=4+=&11=9*25*7&9*=.38-47*=+.8-*7.*8_=19-4:,-=&= 1&7,*=;41:2*=4+=1.9*7&9:7*=43=&'&143*='.414,>=&3)=&'&143*=+.8-*7.*8=*=.898`=9-*7*=.8=&= 5&:(.9>= 4+= .3+472&9.43= 43= 9-*= .3).7*(9= *++*(98= 4+= +.8-.3,= 43= &'&143*= 545:1&9.438`= 85*(.+.(&11>= '*-&;.4:7= 4+= &'&143*= &3)= 9-*= 89.2:1.= 7*85438.'1*= +47= *2*7,*3(*= '*-&;.4:7_=>:7=89:)>=+4:3)=8.,3.+.(&39=;&7.&9.43=&(7488=82&11=85&9.&1=8(&1*8=+* -= 2=.3= 9-*=8.?*=&9=<-.(-=&'&143*=*2*7,*=+742=(7>59.(=-&'.9&9`=<-.(-=(477*1&9*)=<.9-='49-=9-*= &':3)&3(*=4+=&3)=2*&3=8.?*=4+=74(0=14'89*78= &8:8=*)<&7)8.. _=O4'89*78=&7*=57*)&9478= 4+=49-*7='*39-.(=.3;*79*'7&9*8=.3(1:).3,=8*&=:7(-.38=,-*&78=]=&'(4(0=,**,b=*)*7843= ]= B4-3843= ,**0= &3)= /:;*3.1*= &'&143*= &77= *9= &1= +330b= 5&>+.*1)= *9= &1= ,**+= .3= 9*25*7&9*=*(48>89*28_= = 3= (4397&89= 9-*= 5&99*738= .3= &'&143*= 8.?*= &9= *2*7,*3(*= <*7*= 349= )*5*3)*39= :543= 9-*= )*38.9>=4+=9-*=2489=(42243=(7&'`=
1&,:8.&=(-&'7:8 `=47=&=8:.9*=4+=57*)&947>=)*2*78&1= +.8-*8= .3(1:).3,= 9-*= 1&'7.)8= 49&1&'7:8= 9*97.(:8= &3)=
.(9.1&'7:8= 1&9.(1&;.:8= <-.(-= &7*= 57*)&9478= 4+=/:;*3.1*= &'&143*= *18*<-*7*= .3= 9*25*7&9*= :897&1.&= ,-*5-*7)= ]= :73*7= +32/b=,-*5-*7)=]=?1&70843=,**+_=-.8=7*8:19=.8=349=8:757.8.3,=,.;*3=9-*=&':3)&3(*=4+= '49-= _=9*97.(:8= &3)=
_=1&9.(1&;.:8 =-&;*=349=7*8543)*)=94=9-*=*++*(9=4+=5749*(9.43=.38.)*= 9-*=5=&77*99=*9=&1=,**1_== = ;-.1*=5&99*738=.3=&'&143*=8.?*=&9=*2*7,*3(*=(477*1&9*=<.9-=9-*=&':3)&3(*=&3)=2*&3= 8.?*=4+=74(0=14'89*78`=8.?*885*(.+.(=57*)&9.43=4+=82&11=&'&143*=(4:1)=349=&((4:39=+47=9-*= ).++*7*3(*8=.3=8.?*=&9=*2*7,*3(*=*89.2&9*8='*9<**3=+.8-*)=8.9*8=&3)=9-*=5_=47=9-.8= 94=-&;*=4((:77*)=9-*7*=<4:1)=-&;*='**3=&=).89.3,:.8-&'1*=,&5=.3=9-*=8.?*=+7*6:*3(>= ).897.':9.43=.22*).&9*1>='*14<=9-*=8.?*=&9=*2*7,*3(*=.38.)*=9-*=5_=-.8=<&8=349= 9-*=(&8*_=>:7=7*8:198=.3).(&9*=9-*=897:(9:7*=&3)=7*1&9.;*=&':3)&3(*=4+=&'&143*='*14<= 9-*=2.3.2:2=1*,&11>=*=514.9&'1*=+-0=22=.38.)*=9-*=5=<*7*=8.2.1&7=94=9-48*=.3=9-*= &)/&(*39= +.8-*)= &7*&8_= 389*&)`= 2479&1.9>= &55*&78= 94= -&;*= &(9*)= :3.+4721>= &(7488= &= <.)*=7&3,*=4+=8.?*=(1&88*8=&3)=7*):(*)=9-*=&'841:9*=&':3)&3(*=4+=82&11=&'&143*=.38.)*= 9-*=5=(425&7*)=94=9-*=&)/&(*39=+.8-*)=8.9*8_== = -*=(1*&7=.3).7*(9=*++*(9=4+=14'89*7=+.8-.3,=43=&'&143*=545:1&9.438=<&8=94=(-&3,*=9-*= 8.?*=4+=*2*7,*3(*_=>:98.)*=9-*=5`=.3=9-*=57*8*3(*=4+=14<*7=3:2'*78=&3)=82&11*7= 8.?*)= 14'89*78`= 247*= 9-&3= -&1+= 4+= 9-*= &3.2&18= '*14<= 9-*= 2.3.2:2= 1*,&1= 8.?*= <*7*= *2*7,*39= //_= -.8= +7&(9.43= <&8= ,7*&91>= 7*):(*)= .38.)*= 9-*= 5= +0= <-*7*= .3).;.):&18=,7*&9*7=9-&3=9-*=2.3.2:2=1*,&11>=*=514.9&'1*=8.?*=4+= +-0=22=&((4:39*)= +47= 247*= 9-&3= -&1+= 9-*= 545:1&9.43= (425&7*)= 94= &)/&(*39= &7*&8= <-*7*= +.8-.3,= -&8= 7*):(*)=9-*=3:2'*7=4+=*=514.9&'1*=.3).;.):&18=94=1*88=9-&3=,*=4+=9-*=545:1&9.43_== = ;-.1*= (425*9.9.;*= .39*7&(9.438= '*9<**3= 49-*7= &'&143*= &3)= 8*&= :7(-.3= 85*(.*8= -&;*= '**3= )4(:2*39*)= <479-= ]= *&78*= +31*b= O4<7>= ]= *&78*= +31-b= ,-*5-*7)= +31-&b= *,3*7=]=O*;.3=+32,`=9-*=*++*(9=4+=8*&=:7(-.3= *1.4(.)&.8=*7>9-74,7&22& =&':3)&3(*= 43= &'&143*= *2*7,*3(*= '*-&;.4:7= <&8= 349= *;.)*39= 4;*7= 9-*= 8(&1*8= &3)= -&'.9&98= <*=

+-0 = 74/*(9=34_=,**.2*+- = =

8:7;*>*)_= ,.2.1&71>`= 9-*= 1&(0= 4+= &3>= (477*1&9.43= '*9<**3= &'&143*= 8.?*= &9= *2*7,*3(*= &3)=9-*=)*38.9>=4+=*2*7,*39=&'&143*=8:,,*898=9-&9=)*38.9>8)*5*3)*39=.39*7=&3)=.397&8 85*(.+.(= (425*9.9.43= )4*8= 349= 51&>= &= 2&/47= 741*= .3= )*9*72.3.3,= &'&143*= *2*7,*3(*= '*-&;.4:7_=4<*;*7`='*(&:8*=4+=9-*=574'1*28=&884(.&9*)=<.9-=&((:7&9*1>=6:&39.+>.3,= 9-*=&':3)&3(*=4+=(7>59.(=&'&143*=.3=9-7**8).2*38.43&1=8:'897&9*`=<*=(&3349=7:1*=4:9= 9-&9=*2*7,*3(*='*-&;.4:7=.8=1.30*)=94=9-*=&':3)&3(*=4+=(7>59.(=&'&143*_== = ,.3(*= 9-*= &':3)&3(*= 4+= 74(0= 14'89*78= .8= (477*1&9*)= <.9-= 5&99*738= 4+= &'&143*= 8.?*= &9= *2*7,*3(*`=&3)=57*)&9.43=2479&1.9>=(&3349=&((4:39=+47=9-*=).++*7*3(*8='*9<**3=5= &3)=&)/&(*39=+.8-*)=14(&9.438=.3=.841&9.43`=-4<=)4=<*=*=51&.3=9-*=5&99*738=.3=&'&143*= 8.?*=&9=*2*7,*3(*=<.9-.3=5*7(:7>=&88&,*
=19-4:,-=9-*=5&99*738=.3=&'&143*=8.?*=&9= *2*7,*3(*=(477*1&9*)=<.9-=9-*=&':3)&3(*=&3)=2*&3=8.?*=4+=74(0=14'89*78`=9-*=5&99*73= 2&>='*=9-*=7*8:19=4+=34381*9-&1=.39*7&(9.438=<.9-=74(0=14'89*78_=?7>59.(=&'&143*=.38.)*= 9-*=5=2&>=*3(4:39*7=74(0=14'89*78=247*=+7*6:*391>=.38.)*=9-*=5=&8=74(0=14'89*7= &':3)&3(*=.3(7*&8*8=&3)=9-*.7=+47&,.3,=.39*38.+.*8=&77*99_=5*78_=4'8_=-*=7*8:19=4+=9-*= .3(7*&8*)= 34381*9-&1= .39*7&(9.43= <.9-= 74(0= 14'89*78= 2&>= &19*7= 9-*='*-&;.4:7= 4+= 82&11= &'&143*= &3)= )*1&>= 9-*.7= *2*7,*3(*= :39.1= 9-*>= 7*&(-= &= 8:.9&'1*= 8.?*= 7*+:,*_= -*= 3438 1*9-&1=.39*7&(9.43=2&>='*=+:79-*7=*3-&3(*)='>=.397&85*(.+.(=(425*9.9.43=<.9-=9-*=1&7,*= *2*7,*39= &'&143*= ):7.3,= (425*9.9.43= +47= 85&(*= &3)= +44)= &3)= )*1&>= 9-*= 438*9= 4+= *2*7,*3(*_= &99*738= .3= &'&143*= 8.?*= &9= *2*7,*3(*= &7*= 1.0*1>= 94= '*= 9-*= 7*8:19= 4+= &= (4251*== (42'.3&9.43= 4+= +&(9478= .3(1:).3,= 57*)&9.43`= .397&8= &3)= .39*7885*(.+.(= (425*9.9.;*=.39*7&(9.438_== = ;-.1*= 4:7= 4'8*7;&9.438= &551>= 94= 9-*= 5&7.&= 81&3)= 5`= 9-*= ,*3*7&1.9>= 4+= 9-*= .39*78 85*(.+.(= .39*7&(9.43= )*8(7.'*)= -*7*= -&8= >*9= 94= '*= 9*89*)= 247*= '74&)1>_= ;-.1*= (1*&7= 7*85438*8= 94= 5749*(9.43= '>= '49-= 74(0= 14'89*7= &3)= &'&143*= 545:1&9.438= -&;*= '**3= 4'8*7;*)= <.9-.3= 9-*= 5&7.&= 81&3)= 5= +),&7= &3)= &77*99= +331b= +333`= :=943= *9= &1= ,**0`= 97*3)8= -&;*= 349= '**3= &8= *;.)*39= .3= 9-7**= 82&11*7= 58= .3= *&89*73= &82&3.&= <-*7*=74(0=14'89*7=.3(7*&8*8=<*7*=349=&1<&>8=&884(.&9*)= <.9-= &'&143*= )*(1.3*8_= -*= ).++*7*3(*= .3=7*85438*=94=5749*(9.43=<.9-.3=9-*=82&11*7=58=-&8='**3=&997.':9*)=94= 9-*=).++*7*3(*8=.3=&7*&=:3)*7=5749*(9.43= (& _=+***=-&=<.9-.3=5&7.&=81&3)=;8_=./:0*=-&= .3= 9-*= 49-*7= 58`= 1&(0= 4+= 8:++.(.*39= 85&(*= 94= 51&(*= 7*51.(&9*= 8:7;*>= 8.9*8= <.9-.3= 7*8*7;*8= 54<*7`= 5742.3*39= *),*= *++*(98`= -.,-*7= .39*38.9>= 4+= +.8-.3,= *++479= (148*= 94= '4:3)&7.*8`= &3)= -&'.9&9= ).++*7*3(*8= :=943= *9= &1= ,**0_= -*= ;&7.&9.43= .3= 7*85438*8= -.,-1.,-98= 9-*= 3**)= 94= -&;*= &= 8*7.*8= 4+= 8:++.(.*391>= 1&7,*= 58`= <.9-= 8:++.(.*39= 89&9.89.(&1= 54<*7`= 94= *++*(9.;*1>= &88*88= 9-*= .25&(9= 4+= 5749*(9.43= 43= 545:1&9.43= )>3&2.(8=&3)=85*(.*8=.39*7&(9.438_== =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +-1 = =

%55*3).==,= 45:1&9.43=897:(9:7.3,=4+='1&(081.5=&'&143*= &1.49.8=7:'7& ='>=9-*=84:9-*73=74(0=14'89*7= )&8:8=*)<&7)8.. = = :9-478=&3)=&))7*88*8a=*)*7843=_=D_ $`=&77*99=<_=,_`=7:8-*7=,_=9_`=:=943=?_=9_= = &82&3.&3= 6:&(:19:7*= &3)= .8-*7.*8= 389.9:9*`= 5&7.3*= 7*8*&7(-= O&'47&947.*8`= 83.;*78.9>=4+=&82&3.&`=7.;&9*=&>=.3`=4'&79`=&82&3.&`=:897&1.&`=1**+= = ?477*8543).3,=&:9-47=$+2&.1a:,-_*)*7843 :9&8_*):_&:= = &=a=0+=-=0,,1=2*-/= = %'897&(9= -*=84:9-*73=74(0=14'89*7= &8:8=*)<&7)8.. =.8=&=5742.3*39=.3;*79*'7&9*=43=74(0>=7**+8= .3= &82&3.&_= ;-.1*= _= *)<&7)8..= .8= &= 2&/47= 57*)&947= 4+= 8*&= :7(-.38`= .98= &'.1.9>= 94= 897:(9:7*=545:1&9.438=4+=49-*7=2&(748.3;*79*'7&9*8=.8=349=(1*&7_=4114<.3,=247*=9-&3=&= )*(&)*=4+=5749*(9.43=+742=+.8-.3,=&(9.;.9>`=74(0=14'89*7=545:1&9.438=.38.)*=9-*=1&7,*89= 5&7.3*= 749*(9*)= 7*&= 5= 43= 9-*= *&89= (4&89= 4+= &82&3.&= 5&7.&= 81&3)= -&;*= *=5&3)*)= 94= 247*= 9-&3= ,*= 9.2*8= 9-*= '.42&88= 4+= &)/&(*39= &7*&8= 8:'/*(9= 94= +.8-.3,_= ?43(:77*39=<.9-=9-*=.3(7*&8*=.3=74(0=14'89*7='.42&88=-&8='**3=&=349.(*&'1*=7*):(9.43= .3= 9-*= &':3)&3(*= 4+= *2*7,*39= '1&(081.5= &'&143*=  &1.49.8= 7:'7& = &3)= 9-*= ,7&):&1= .3(7*&8*=.3=2.3.2:2=*2*7,*39=&'&143*=8.?*_=-*8*=4'8*7;&9.438=8:,,*89*)=9-&9=74(0= 14'89*78= .38.)*= 9-*= 5= <*7*= -&;.3,= &= 3*,&9.;*= *++*(9= 43= &'&143*= 545:1&9.438_= 3= &= 8*7.*8= 4+= 2&3.5:1&9.;*= *=5*7.2*398`= 9*9-*7*)= &'&143*= *=5*7.*3(*)= -.,-*7= 2479&1.9>= 7&9*8=.38.)*=9-*=5=9-&3=9-48*=4+=*6:.;&1*39=8.?*=&9=+.8-*)=8.9*8`=&3)=3*<1>=*2*7,*39= &'&143*= .38.)*= 9-*= 5= <*7*= &12489= &3= 47)*7= 4+= 2&,3.9:)*= 247*= 8:8(*59.'1*= 94= 57*)&9.43= 9-&3= 1&7,*7= (4385*(.+.(8_= 5574=.2&9*1>= /*= 4+= &11= 2479&1.9.*8= .38.)*= 9-*= 5= <*7*= &997.':9*)= 94= 74(0= 14'89*78`= '>= 9-*= 57*8*3(*= 4+= (-&7&(9*7.89.(= )&2&,*= 94= &'&143*= 8-*118`= (425&7*)= 94= 431>= -*= &9= +.8-*)= 8.9*8_= +=5*7.2*39&1= 2&3.5:1&9.438= (&,.3,=7*;*&1*)=9-*=2479&1.9>=4+=&'&143*=<&8=-.,-*7=.3=9-*=57*8*3(*=4+=74(0=14'89*78= ':9= 9-*= *++*(9= <&8= 349= 8.?*= &'&143*= )*5*3)*39_= 7*8:198= +742= 9-*= 2&3.5:1&9.;*= *=5*7.2*398= 8:,,*89= 9-&9= _= *)<&7)8..= .8= &3= .25479&39= 57*)&947= 4+= _= 7:'7& = .3= *&89*73= &82&3.&=&3)=-&8=9-*=549*39.&1=94=897:(9:7*=&'&143*=545:1&9.438_== = E*>= <47)8a= 7**+= +.8-*7.*8`= &'&143*`= 74(0= 14'89*7`= 57*)&947857*>`= 2&7.3*= 5749*(9*)= &7*&8`=545:1&9.43=)>3&2.(8=

+-2 = 74/*(9=34_=,**.2*+- = =

= 73974):(9.43= -*= 84:9-*73= 74(0= 14'89*7= &8:8= *)<&7)8.. = .8= &= )42.3&39= 2&(748.3;*79*'7&9*= 4+= 74(0>= 7**+=*(48>89*28=.3=:897&1.&=&3)=<*<=I*&1&3)`=51&>8=&=;.9&1=741*=&8=&='*39-.(=57*)&947= ,-*&78=]=&'(4(0=,**,`=B4-3843=*9=&1_=,**.`=O&3,14.8=*9=&1_=,**0&`=*)*7843=]=B4-3843= ,**0= &3)= 8:554798= 1:(7&9.;*= 7*(7*&9.43&1= &3)= (422*7(.&1= +.8-*7.*8= 7+= ,**1`= 343>24:8= ,**1_= *(&:8*= 4+= 9-*.7= *(4342.(= ;&1:*`= _= *)<&7)8..= +.8-*7.*8= -&;*= '**3= *=514.9*)= 4;*7= 2&3>= )*(&)*8= 7:8-*7= +331`= E*11>= *9= &1_= ,***= &3)= 9-*7*+47*= 034<1*),*=&'4:9=9-*='.414,>=&3)=*(414,>=4+=9-*=85*(.*8=(42*8=+742=545:1&9.438=9-&9= &7*= &17*&)>= .25&(9*)= '>= +.8-.3,_= 3= *&89*73= &82&3.&`= *=514.9&9.43= -&8= 7*):(*)= 9-*= 1*,&188.?*)='.42&88=4+=9-*=84:9-*73=74(0=14'89*7= _=*)<&7)8..= 94=,:2=4+=9-*=;.7,.3=894(0= 7:8-*7= +331`= <.9-= *=514.9*)= 545:1&9.438= )42.3&9*)= '>= 7*(*39= 7*(7:.98= +),&7= ]= &77*99= +333_= ;.9-= 9-*= &);*39= 4+= 3489&0*= 2&7.3*= 5749*(9*)= &7*&8= 58`= 9-*= 545:1&9.43= )*38.9>= &3)= 8.?*= 897:(9:7*= 4+= _= *)<&7)8.. = <.9-.3= 58= <&8= *=5*(9*)= 94= 7*;*79=94=&=545:1&9.43=897:(9:7*=:3&++*(9*)='>=+.8-.3,_== = ,.3(*= 9-*= )*(1&7&9.43= 4+= +4:7= 3489&0*= 58= .3= *&89*73= &82&3.&= .3= +33+= 9-*7*= -&;*= '**3= 8.,3.+.(&39= (-&3,*8= .3= 8:'9.)&1= (422:3.9>= 897:(9:7*= (425&7*)= 94= 9-48*= .3= &)/&(*39= -&'.9&98= 45*3= 94= +.8-.3,= &(9.;.9>= +),&7= ]=&77*99=+333`=:=943=*9=&1_=,**0_= -*= 2489= 349&'1*= (-&3,*8= -&;*= '**3= 7*(47)*)= .3= 9-*= 1&7,*89= 5= &9= 5&7.&= 81&3)= <-*7*=74(0=14'89*7= &8:8=*)<&7)8.. ='.42&88=-&8=.3(7*&8*)=94=247*=9-&3=,*=9.2*8=9-&9= 4+= &)/&(*39= +.8-*)= -&'.9&98= <.9-= 9-*= 545:1&9.43= .38.)*= 9-*= 5= 34<= )42.3&9*)= '>= 1&7,*=&):198=9-&9=&7*=*++*(9.;*1>=&'8*39=.3=9-*=3*.,-'4:7.3,=+.8-*7>_== = ;-.1*= )7&2&9.(= (-&3,*8= .3= 74(0= 14'89*7= '.42&88= &3)= 8.?*= 897:(9:7*= -&;*= '**3= 4'8*7;*)`= &= 8.2.1&7= *++*(9= +47= &349-*7= -*&;.1>= *=514.9*)= 85*(.*8`= '1&(081.5= &'&143*= &1.49.8= 7:'7& `=-&8=349='**3=&55&7*39_=>;*7=9-*=8&2*=9.2*=5*7.4)= &'&143*= '.42&88= .38.)*=9-*=5=)*(1.3*)`=<.9-=8.,3.+.(&39=)*(7*&8*8=.3=&':3)&3(*=&3)=(-&3,*8=.3=8.?*= 897:(9:7*= (425&7*)= 94= &)/&(*39= +.8-*)= 14(&9.438= :=943= *9= &1_= ,**0_= ,*;*7&1= 2*(-&3.828= *=51&.3.3,= 9-*= )*(1.3*8= .3= &'&143*= '.42&88= .38.)*= 9-*= 5= <*7*= 8:,,*89*)=:=943=*9=&1_=,**0=<.9-=57*)&9.43='>=74(0= 14'89*78= (438.)*7*)= 94= '*= 9-*= 2489= 1.0*1>= ,.;*3= 9-&9= 9-*= 4'8*7;*)= )*(1.3*8= .3= &'&143*= '.42&88= <*7*= 89743,1>= (477*1&9*)=<.9-=9-*=.3(7*&8*=.3=74(0=14'89*7='.42&88_=,:'8*6:*39=89:).*8=.3).(&9*)=9-&9= 2:(-=4+=9-*=4'8*7;*)=)*(1.3*=.3=3*<1>=*2*7,*39=&'&143*=(4:1)='*=&((4:39*)=+47='>= 85&9.&1= ;&7.&9.43= .3= 8.?*= &9= *2*7,*3(*= &3)= 349= 57*)&9.43= 2479&1.9>= .3= .841&9.43= *)*7843= *9= &1_= ,**2_= 19-4:,-= 9-*= 5&99*738= 4+= &'&143*= 8.?*= &9= *2*7,*3(*= <*7*= 8:,,*89*)=94='*=9-*=7*8:19=4+=&=(42'.3&9.43=4+=+&(9478`=.3(1:).3,=57*)&9.43=2479&1.9>= &3)= (425*9.9.;*= .39*7&(9.438`= 9-*= (4397.':9.43= 4+= &3>= 43*= +&(947= (4:1)= 349= '*= )*9*72.3*)_= = =8*7.*8=4+=2&3.5:1&9.;*=*=5*7.2*398=<*7*=(43):(9*)=94=)*9*72.3*=9-*=.25479&3(*=4+= 57*)&9.43= 43= 9-*= 897:(9:7.3,= 4+= &'&143*= 545:1&9.438`= 5&79.(:1&71>= 9-*= (42543*39= &997.':9&'1*=94=74(0=14'89*78_=-*8*=*=5*7.2*398=<*7*=)*8.,3*)=94=*89.2&9*=9-*=7*1&9.;*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +-3 = =

).++*7*3(*= .3= &'&143*= 2479&1.9>= .38.)*= 9-*= 5= &3)= &9= &)/&(*39= 8.9*8= <-*7*= 74(0= 14'89*78=<*7*=+.8-*)`=9-*=8.?*885*(.+.(=3&9:7*=4+=.39*7&(9.438='*9<**3=74(0=14'89*78=&3)= &'&143*`=&3)=&'&143*=2479&1.9>=7&9*8=).7*(91>=&997.':9*)=94=74(0=14'89*78_== =
*9-4)8= .9*=8*1*(9.43== 5&3.5:1&9.;*= *=5*7.2*398= <*7*= (43):(9*)= &9= +4:7= 8.9*8= 43= &82&3.&8= *&89= (4&89= .,:7*= /+_= -*= 8.9*8= <*7*= 14(&9*)= .3= 74(0>= 7**+= -&'.9&98= 9-&9= -&;*= '**3= :8*)= 57*;.4:81>=94=&88*88=9-*=*++*(9.;*3*88=4+=2&7.3*=5749*(9*)=&7*&8=+),&7=]=&77*99=+331`= +333= &3)= 94= )*8(7.'*= 5&99*738= 4+= &'&143*= 8.?*= &9= *2*7,*3(*= .3= 7*1&9.43= 94= 9-*= &':3)&3(*=4+=57*)&9478=&3)=(425*9.9478=*)*7843=*9=&1_=,**2_=<4=8.9*8=<*7*=14(&9*)= .38.)*=9-*=3489&0*=5&7.&=81&3)=5&7.3*=749*(9*)=7*&=-*7*&+9*7=7*+*77*)=94=&8=5= 8.9*8=&3)=9<4=8.9*8=.3=&)/&(*39=&7*&8=45*3=94=(422*7(.&1=&3)=7*(7*&9.43&1=+.8-*7.*8=+47= 74(0=14'89*7`='1&(081.5=&'&143*=&3)=&=7&3,*=4+=)*2*78&1=+.8-=85*(.*8=-*7*&+9*7=7*+*77*)= 94=&8=+.8-*)=8.9*8_=-*=+4:7=8.9*8=<*7*=8.2.1&7=.3=9454,7&5->`=*=548:7*=94=57*;&.1.3,= <*&9-*7= &3)= 8:55479*)= 8.2.1&7= '.414,.(&1= (422:3.9.*8= *=(*59= +47= 9-*= &':3)&3(*= 4+= &3)=8.?*=897:(9:7*=4+=&'&143*=&3)=5:9&9.;*=&'&143*=57*)&9478`=2&.31>=74(0=14'89*78_== = /4(0=14'89*7=&':3)&3(*=8:7;*>8= 74(0= 14'89*7= &':3)&3(*= <&8= &88*88*)= &9= *&(-= 8.9*= 57.47= 94= 9-*= 2&3.5:1&9.;*= *=5*7.2*398=:8.3,=9-*=:3)*7<&9*7=;.8:&1=(*38:8=9*(-3.6:*8=)*8(7.'*)='>=+),&7=&3)= &77*99=+331_=4:7=7*51.(&9*=97&38*(98=<*7*=&88*88*)=&9=*&(-=8.9*='>=&=).;*7=8*&7(-.3,= 9-*=-&'.9&9=.3=&=+=2=<.)*=897.5=5&7&11*1=94=&=/*=2= <*.,-9*)= 1.3*= &3)= 7*(47).3,= 9-*= &':3)&3(*=4+=74(0=14'89*78_=7&38*(98=<*7*=1&.)=5&7&11*1=94=9-*=8-47*`=<.9-4:9=4;*71&5`= &3)= '*9<**3= 9-*= /= 2= &3)= 1= 2= )*59-= (4394:78_= 74(0= 14'89*78= <*7*= (&59:7*)= <-*7*= 5488.'1*= &3)= (&7&5&(*= 1*3,9-= 2*&8:7*)= 94= 9-*= 3*&7*89= 2.11.2*97*= :8.3,= 03.+*8*),*= (&11.5*78_= ;-*7*= 74(0= 14'89*78= (4:1)= 349= '*= (&59:7*)= <.9-4:9= 8.,3.+.(&39= )&2&,*`= &= ;.8:&1= *89.2&9*= <&8= 2&)*= &3)= 1*3,9-8= 7*(47)*)= 94= 9-*=3*&7*89=/=22=8.?*=(1&88_=-*= 8&2*= ).;*7= = (43):(9*)= &11= 8:7;*>8= ):7.3,= 9-*= 89:)>= 94= 7*24;*= &3>= '.&8*8= &884(.&9*)=<.9-=:8.3,=2:19.51*=4'8*7;*78_== = =
&3.5:1&9.;*=*=5*7.2*398= +89.2&9*8=4+=7*1&9.;*=57*)&9.43=.39*38.9>=<*7*=6:&39.+.*)=&9=9<4=8.9*8=.38.)*=9-*=5= <-*7*=74(0=14'89*78=<*7*=.3=-.,-=&':3)&3(*`=&3)=&9= 9<4= &)/&(*39= 8.9*8= <-*7*= 74(0= 14'89*7= &':3)&3(*= -&8= '**3= 7*):(*)= '>= +.8-.3,= &(9.;.9>_= 9= *&(-= 8.9*= 9-7**= ,*= 2= 7*51.(&9*)= 97&38*(98= <*7*= 51&(*)= &9= 7&3)42= &3)= <.9-4:9= 4;*71&5`= 43= 74(0>= 7**+= '*9<**3=9-*=/=2=&3)=1=2=)*59-=(4394:78_=+.,-9=&'&143*=+742=*&(-=4+=9-7**=8.?*=(1&88*8= == &'1*= +,`= 3&2*1>= 9-48*= '*14<= 9-*= 8.?*= &9= *2*7,*3(*`= &'4;*= 8.?*= &9= *2*7,*3(*= ':9= '*14<=9-*=2.3.2:2=1*,&1=(&9(-=8.?*`=&3)=9-48*=&'4;*=9-*=2.3.2:2=1*,&1=(&9(-=8.?*= 1+-0= 22`= <*7*= 9*9-*7*)= 94= *&(-= <*.,-9*)= 97&38*(9= 1.3*_= 3).;.):&1= &'&143*= <*7*= 9*9-*7*)=:8.3,=&=51&89.(=9&,=O*&)*7=&,8`=C.(947.&`=:897&1.&=.38*79*)=.394=43*=4+=9-*= 7*85.7&947>=547*8=43=9-*=2&7,.3=4+=9-*=8-*11=&3)=(433*(9*)=94=9-*=97&38*(9=1.3*=:8.3,=&=

+.* = 74/*(9=34_=,**.2*+- = =

0**= 22= 143,= 89&.31*88= 89**1= (&'1*= *_0= 22= ).&2*9*7= 8*(:7*)= :8.3,= &= 89&.31*88= 89**1= (7.25=81**;*_= = '&143*= :8*)= .3= 9-*= 9*9-*7.3,= *=5*7.2*398= <*7*= (411*(9*)= +742= 9-*= -&'.9&98= 8:774:3).3,=9-*=97&38*(9=1.3*8=&9=*&(-=8.9*=&3)=8479*)=.394=9-*=&'4;*=8.?*=(1&88*8=:8.3,= 9-*=*89.2&9*8=+47=8.?*=&9=*2*7,*3(*=&9=*&(-=8.9*=)*9*72.3*)='>=*)*7843=*9=&1_=,**2_= *9-*7*)=&'&143*=<*7*=&99&(-*)=&9=7&3)42=).89&3(*8=&143,=*&(-=97&38*(9=':9=51&(*)=.3= &7*&8=94=*38:7*=9-&9=9-*>=(4:1)=349=8**0=7*+:,*=.3=(7*;.(*8=47=24;*=:3)*7='4:1)*78_= 7*897.(9.3,=&'&143*=+742=8**0.3,=7*+:,*=*38:7*)=9-&9=&11=8.?*=(1&88*8=<-*7*=*=548*)=94= 57*)&9478= 94= &114<= 7*1&9.;*= (425&7.8438= '*9<**3= 8.9*8= <-.1*= 4;*7(42.3,= 82&1188(&1*= ).++*7*3(*8='*9<**3=-&'.9&98=<-.(-=(4:1)='.&8=7*8:198_== = +=5*7.2*398=<*7*=(43):(9*)=4;*7=&=,28)&>=5*7.4)=&9=*&(-=8.9*=):7.3,=*'7:&7>=&3)= 5&7(-= ,**0_= +89.2&9*8= 4+= &'&143*= 8:7;.;&1= <*7*= 7*(47)*)= 1`= +.= &3)= ,2= )&>8= 5489= 9*9-*7.3,= <.9-= 9-*= 5745479.43= 4+= 8-*118= ).851&>.3,= 8.,38= 4+= 1*9-&1= &3)= 34381*9-&1= .39*7&(9.43= <.9-= 74(0= 14'89*78= 7*(47)*)= 8**= '*14<_= 5479&1.9.*8= 7*(47)*)= ):7.3,= 9-*= &88*882*398=&9=1=&3)=+.=)&>8=5489=9*9-*7.3,=<*7*=349=7*51&(*)_== = = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +.+ = =

= = = = Tasmania = S42°39 a = = = a E148°04 ======Reserve boundary =

J = F2 J MPA1 MPA2 J = Mercury = Passage = Maria Island = = = F1 J ======*.,:7*=/+= 84(&9.43=4+=8.9*8=<-*7*=*=5*7.2*398=<*7*=(43):(9*)=94=&88*88=8.?*885*(.+.(=57*)&9.43= 2479&1.9>= 4+= &'&143*_= <4= 8.9*8= <*7*= 14(&9*)= .38.)*= 9-*= 3489&0*=
&7.3*= 781&3)=
&7.3*= 749*(9*)= %7*&= 
%+`=
%,= &3)= 9<4= 8.9*8= .3= &)/&(*39= -&'.9&98= 45*3= 94= +.8-.3,=*+`=*,_=

+., = 74/*(9=34_=,**.2*+- = =

== &'1*=+,= :22&7>=4+=&'&143*=8.?*=&9=*2*7,*3(*=*89.2&9*8= )3/= +7= &9= +.;*= 8.9*8= 45*3= 94= +.8-.3,= &3)= +.;*= 8.9*8= .38.)*= 9-*=
&7.&= 781&3)= &= 3489&0*=
%_= .?*= &9= *2*7,*3(*= *89.2&9*8= 7*57*8*39= 9-*= 8-*11= 1*3,9-= <-*3= 9-*7*= .8= &= 574'&'.1.9>= 4+= *_/= 9-&9= &3= .3).;.):&1= <.11= '*= *2*7,*39_= 89.2&9*8= 4+= 8.?*= &9= *2*7,*3(*= +47=
%= &3)= +.8-*)= 545:1&9.438=<*7*=(&1(:1&9*)=43=)&9&=5441*)=&(7488=8.9*8=<.9-.3=*&(-=97*&92*39_== = ,.?*=&9= =4+= = *2*7,*3(*= 8&251*= ,.9*= =22== 0=,+= <= = .8-*)======+= 11_,=1,_082+_+= +/_1= +2/= = = ,= 11_3=1-_+82,_+= ,+_0= +3.= = = -= 3-_.=3+_.83/_,= ,3_-= ,/3= = = .= 2-_3=2*_,821_+= ,/_1= ,,,= = = /= 32_1=3._08+*,_/= ./_3= ,++= = = 441*)= 21_0=20_2822_.= ,1_0= +*1+======5======+= +,+_+=++2_/8+,._-= ,1_+= ,/3= = = ,= +,1_0=+,._.8+-*_.= ,._0= +2-= = = -= +-*_0=+,2_/8+-,_.= -3_.= ,/3= = = .= ++/_0=++*_38++3_*= ,3_.= ,-2= = = /= +**_+=30_28+*,_3= -*_2= ,-.= = = 441*)= ++1_2=++1_+8++2_/= -*_,= ++1-= = = .?*885*(.+.(=57*)&9.43= 4= )*9*72.3*= 9-*= 8.?*885*(.+.(= 57*)&9.43= 4+= &'&143*= '>= 74(0= 14'89*78`= &= 8*7.*8= 4+= *=5*7.2*398= <&8= :3)*79&0*3= .3= &3= &6:&7.:2= +&(.1.9>= <-*7*= *=5*7.2*39&1= ;&7.&'1*8= (4:1)= '*= 2&3.5:1&9*)= &3)= 9-*= '*-&;.4:7= 4+= 74(0= 14'89*78= (439.3:4:81>= 243.947*)= :8.3,= &3= .3+7&87*)= ;.)*4= 8>89*2= 5.118= *9= &1_= ,**/_= 74(0= 14'89*78= &3)= &'&143*= <*7*= (411*(9*)= +742= 8.9*8= .3= 84:9-8*&89= &82&3.&= &3)= 97&385479*)= '&(0= 94= 9-*= &6:&7.:2= +&(.1.9>= &9= 9-*= &82&3.&3= 6:&(:19:7*= &3)= .8-*7.*8= 389.9:9*_= 74(0= 14'89*78= &3)= &'&143*=<*7*=&114<*)=1,=-4:78=94=&((1.2&9.8*=94=8947&,*=(43).9.438='*+47*='*.3,=:8*)= .3= *=5*7.2*39&1= 97.&18_= ;-.1*= &'&143*= <*7*= +*)= 43= &= ).*9= 4+= (422*7(.&11>= &;&.1&'1*= 2&(74&1,&1= 5*11*98`= 74(0= 14'89*78= <*7*= 89&7;*)= 57.47= 94= :8*= .3= 97.&18= 94= .3(7*&8*= 9-*= 1.0*1.-44)=4+=57*)&9.43=):7.3,=*&(-=97.&1_== = -7**=8.?*=(1&88*8=4+=&'&143*=<*7*=*=548*)=94=9-7**=8*5&7&9*=74(0=14'89*7=8.?*=(1&88*8= ):7.3,=9-*=8*7.*8=4+=*=5*7.2*398_='&143*=022=22=57*8*2*7,*39`=23:+-/=22=3*<1>= *2*7,*39= &3)= 9-48*= 1&7,*7= 9-&3= 9-*= 2.3.2:2= 1*,&1= (&9(-= 8.?*= 4+= +-0= 22= 5489= *2*7,*39= <*7*= :8*)= .3= &11= 97*&92*39= &3)= (439741= 9&308_= 4:7= .3).;.):&1= +.'7*,1&88= 9&308=2*&8:7.3,=,_/=2===,_/=2===+=2`=*&(-=<.9-=&=8*5&7&9*=<&9*7=8:551>`=<*7*=:8*)=.3= 9-*=+4:7=7*51.(&9*=97.&18_=.;*=&'&143*=+742=*&(-=4+=9-*=9-7**=8.?*=(1&88*8=<*7*=51&(*)=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +.- = =

.394= *&(-= 4+= 9-*= 9&308= &3)= &114<*)= 94= &99&(-= 94= 5:7548*8':.19= -&'.9&98= 2&)*= +742= 8(:159:7*)= &*7&9*)= (43(7*9*= (&_= *_-= 2= == *_-= 2= == *_0= 2_= -7**= 9&308= <*7*= &88.,3*)= 9-7**= 74(0= 14'89*78= 4+= &= 85*(.+.(= 8.?*= (1&88_= -*= 82&11= 8.?*= (1&88= (438.89*)= 4+= 74(0= 14'89*78= 0= ++*= 22= (&7&5&(*= 1*3,9-= ?O`= 9-*= 2*).:2= 8.?*= (1&88= 4+= 74(0= 14'89*78= '*9<**3=+++=22=&3)=+.*=22=?O=&3)=9-*=1&7,*=8.?*=(1&88=4+=74(0=14'89*78=1+.+=22=?O_= 9:*=94=9-*=1&(0=4+=&;&.1&'1*=9&308=+47=7*51.(&9.43=.3=*&(-=97.&1`=&=8.3,1*=7*51.(&9*=4+=*&(-= 97*&92*39=<&8=7*57*8*39*)=.3=*&(-=4+=8*;*3=8*5&7&9*=':9=(438*(:9.;*=97.&18_== = 3).;.):&1=97.&18=<*7*=7:3=+47=&=5*7.4)=4+=+.;*=)&>8=94=&114<=+4:7=3.,-98=4+=74(0=14'89*7= &(9.;.9>=94='*=7*(47)*)='>=&3=.3).;.):&1=.3+7&87*)=(&2*7&=51&(*)=.3=*&(-=9&30=(4;*7.3,= (&_=1/=4+=9-*=9&30=&7*&=':9=+**=4+=9-*=8-*19*7=&;&.1&'1*= 94= &'&143*_= ,:7;.;&1= &3)= 2479&1.9>= *89.2&9*8= <*7*= 7*(47)*)= *&(-= 2473.3,= &3)= 9-*= ;.)*4= +449&,*= 4'8*7;*)= 94= .)*39.+>=9-*=2*9-4)=4+=57*)&9.43_=5479&1.9.*8=<*7*=7*24;*)=+742=9&308=*&(-=2473.3,= &3)= <*7*= 349= 7*51&(*)= ):7.3,= .3).;.):&1= 97.&18_= 8543= (4251*9.43= 4+= *&(-= 97.&1= 74(0= 14'89*78= &3)= &'&143*= <*7*= 7*9:73*)= 94= 9-*= <.1)`= 97*&92*398= 7&3)421>= 7*&88.,3*)= 94= 9&308=&3)=3*<1>=&((1.2&9*)=&'&143*=&3)=74(0=14'89*78=51&(*)=.3=&557457.&9*=9&308_= = 4=&88*88=9-*=8.?*885*(.+.(=3&9:7*=4+=74(0=14'89*7`=57*)&9.43=4+=&'&143*=:3)*7= 3&9:7&1= (43).9.438=&=2&3.5:1&9.;*=*=5*7.2*39=<&8=*89&'1.8-*)=.38.)*=9-*=5&7.&=81&3)=5_= +=5*7.2*39&1= (&,*8= 8.2.1&7= .3= (43897:(9.43= 94= *)*7843= &3)= B4-3843= ,**0= <*7*= 51&(*)=43=74(0>=7**+=-&'.9&9='*9<**3=9-*=12=&3)=3=2= )*59-= (4394:78_= ,.== 7*51.(&9*= (&,*8= .3= *&(-= 4+= 9<4= 97*&92*398= &3)= 9<4= *=5*7.2*39&1= (4397418= <*7*= :8*)= .3= 9-*= )*8.,3_=-*=9<4=97*&92*398=.3;41;*)=(&,*8=<-*7*=+.;*=&'&143*`=+742=9<4=8*5&7&9*=8.?*= (1&88*8=3*<1>=*2*7,*39=++/:+-/=22=&3)=5489=*2*7,*39=1+-0=22`=<*7*=&114<*)=94= 8**0=7*+:,*=<.9-.3=9-*=7**+=.3=*.9-*7=9-*=57*8*3(*=47=&'8*3(*=4+=74(0=14'89*78= (=&3)= 8 = 74(0= 14'89*7= 97*&92*398= 7*85*(9.;*1>_= <49*= 9-&9= 57*)&9.43= 2479&1.9>= 4+= 57*8*2*7,*39= &'&143*= (4:1)= 349= '*= *89.2&9*)= *++*(9.;*1>= ):*= 94= 9-*= ;&7.&'.1.9>= .3= 7*88.,-9.3,= .3).;.):&18=<-.(-=<*7*=(7>59.(=&3)=-.))*3=+742=9-*=).;*78_=<4=74(0=14'89*78=1&7,*7= 9-&3= +.*= 22= (&7&5&(*= 1*3,9-= <*7*= 51&(*)= .394= *&(-= 4+= 9-*= 8.== (= 74(0= 14'89*7= 7*51.(&9*= (&,*8= &3)= &114<*)= 94= 8**0= 7*+:,*= .3= 8:.9&'1*= )*38_= 74(0= 14'89*78= <*7*= 57*;*39*)=+742=1*&;.3,=9-*= (=74(0=14'89*7=97*&92*39`=47=*39*7.3,=9-*= :=74(0=14'89*7= 97*&92*39='>=9-*=&)).9.43=4+=&=744+=94=9-*=945=4+=9-*=(&,*_=4=&88*88=9-*=*++*(9=4+=(&,*8= 43=&'&143*=2479&1.9>`=*89.2&9*8=+742=5&79.&1=(&,*8`=<-.(-=<*7*=8.2.1&7=.3=(43897:(9.43= 94= 9-*= 97*&92*39= (&,*8= ':9= -&)= 45*3.3,8= .3= 9<4= 4+= 9-*= <&118= &3)= 34= 744+`= <*7*= (425&7*)= <.9-= 2479&1.9>= *89.2&9*8= +742= (= 74(0= 14'89*7= 97*&92*39= (&,*8_= -*= 45*3.3,8= .3= 9-*= <&118= 4+= 5&79.&1= (&,*8= &114<*)= 74(0= 14'89*78= &3)= 49-*7= 57*)&9478= 94= ,&.3=&((*88=94=*=5*7.2*39&1=&'&143*_=-*=+1*=.'1*=3*99.3,=:8*)=.3=9-*=(43897:(9.43=4+= 9-*=(&,*8=57*;*39*)=&'&143*=+742=(1.2'.3,=9-*=<&118=&3)=*8(&5.3,=;.&=9-*=45*3.3,8= _=*)*7843=5*78_=4'8_=,.==7*51.(&9*=51498`=<-*7*=34=(&,*=<&8=*7*(9*)=':9=&=8.2.1&7= 8.?*)=5&9(-=4+=7**+=)*1.3*&9*)=:8.3,=<*.,-9*)=1.3*`=8*7;*)=&8=*=5*7.2*39&1=(4397418=+47= 9-*=5&79.&1=(&,*=97*&92*39_=.;*=&'&143*=+742=*&(-=4+=9-*=9<4=8.?*=(1&88*8=<*7*=51&(*)= .394=*&(-=7*51.(&9*=(439741=5149_= =

+.. = 74/*(9=34_=,**.2*+- = =

*+47*= (&,*8= &3)= (439741= 51498= <*7*= 894(0*)= <.9-= *=5*7.2*39&1= &'&143*`= 9-*= -&'.9&9= <&8= 9-474:,-1>= 8*&7(-*)= &3)= 7*8.)*39= &'&143*= 7*24;*)_= +=5*7.2*39&1= &'&143*`= (411*(9*)= +742= &= 3*.,-'4:7.3,= 5&79= 4+= 9-*= 8&2*= 7**+`= <*7*= 9-*3= 51&(*)= .394= (7*;.(*8= 57*;.4:81>= 4((:5.*)= '>= 7*8.)*39= .3).;.):&18= 94= *38:7*= *=5*7.2*39&1= &3.2&18= <4:1)= +.3)= 8:.9&'1*= 7*+:,*_= '&143*= 2479&1.9>= <&8= &88*88*)= 43(*= &= <**0= +47= *.,-9= (438*(:9.;*=<**08='*9<**3=57.1=&3)=5&>=,**0_='&143*=2479&1.9.*8=<*7*=7*(47)*)= &3)=7*24;*)=+742=(&,*8=&3)=(439741=51498=':9=349=7*51&(*)_== = %'&143*=8-*11=8:7;*>= =8:7;*>=94=6:&39.+>=9-*=549*39.&1=8.?*=7&3,*=4+=&'&143*= ;:13*7&'1*= 94= 57*)&9.43='>= 74(0= 14'89*78= <&8= (43):(9*)= &9= 9-*= +4:7= *=5*7.2*39&1= 8.9*8= .3= 5&>= ,**0_= 9.8(&7)*)= &'&143*=8-*118=<*7*=8&251*)=.3=74(0>=7**+=-&'.9&98=&9=*&(-=8.9*`=7*(47).3,=9-*=1*3,9-=4+= *&(-=8-*11=&3)=9-*=57*8*3(*=4+= (-.5=2&708`=8.2.1&7=94=9-48*=43=57*)&9*)=&'&143*=.3= 9-*=&6:&7.:2=97.&1_=9:*=94=:3*6:&1=8&251*=8.?*8`=&3)=9-*=8(&7(.9>=4+=8-*118=&9=842*=4+= 9-*=8.9*8`=)&9&=+742=9-*=9<4=+.8-*)=8.9*8=<*7*=5441*)=<.9-=9-*=7*8:19.3,=8.?*=+7*6:*3(>= ).897.':9.43=(425&7*)=94=9-*=).897.':9.43=4+=5441*)=)&9&=+742=9-*=5=8.9*8_= = 9&9.89.(&1=&3&1>8.8= 7*1&9.;*= ).++*7*3(*8= .3= 57*)&9.43= .39*38.9>= 4+= 9*9-*7*)= &'&143*= <*7*= &88*88*)= :8.3,= 14,.89.(= 24)*11.3,= .3= <-.(-= &= ,*3*7&1.8*)= 1.3*&7= 24)*1= DO5= <&8= &551.*)= 94= 9-*= '.342.&11>=).897.':9*)=7*85438*=;&7.&'1*=2479&1.9>=:8.3,=&=14,81.30=+:3(9.43=482*7= ]=O*2*8-4<=,***b=A:.33=]=E*4:,-=,**,_=3=&)).9.43=9-*=14,.89.(=24)*18=<*7*=&'1*= 94=*89.2&9*=9-*=7*1&9.;*=1.0*1.-44)=4+=&'&143*=2479&1.9>=.3=:3+.8-*)=&3)=+.8-*)=&7*&8_= :11>= 8&9:7&9*)= 14,.89.(= 24)*18= <*7*= (43897:(9*)= :8.3,= 9-*= +4:7= 2&.3= *++*(9= 9*728= 5`=8.9*`=&'&143*=8.?*=&3)=97&38*(9=&3)=&11=5488.'1*=.39*7&(9.438_=54)*1=9*728=<*7*= 7*24;*)=+742=9-*=+:11>=8&9:7&9*)=24)*1=;.&=9-*=89*58<.8*=574(*88=:39.1=&=8.,3.+.(&39= )*(7*&8*=.3=24)*1=+.9= χ,=<&8=4'8*7;*)=7*8:19.3,=.3=9-*=2489=5&78.243.4:8=24)*1_== = 9.++*7*3(*8= .3= &;*7&,*= 74(0= 14'89*7= &':3)&3(*= &9= *=5*7.2*39&1= 8.9*8= <&8= *=&2.3*)= :8.3,= 43*8<&>= <>C= <.9-= 8*5&7&9*= 24)*18= (43897:(9*)= +47= 82&11= 0+**= 22= ?O`= 2*).:2=+++:+.*=22=?O=&3)=1&7,*=74(0=14'89*78=1+.+=22=?O_= 47=&11=<>C8`= .3(1:).3,=9-48*=:8*)=94=&88*88=57*)&9.43=2479&1.9>=.3=(&,.3,=*=5*7.2*398=8**='*14<`= 9-*=7*1&9.438-.5='*9<**3=89&3)&7)=)*;.&9.43=&3)=2*&38=4+=97*&92*39=,74:58=<&8=:8*)= 94= )*9*72.3*= 9-*= &557457.&9*= 97&38+472&9.43= 94= 89&'.1.8*= ;&7.&3(*8`= &3)= 97&38+472*)= )&9&= <*7*= (-*(0*)= +47= '49-= 3472&1.9>= :8.3,= 3472&1= 574'&'.1.9>= 51498= &3)= -4248(*)&89.(.9>_= 7*8:198= &7*= *=57*88*)= .3= 9*728= 4+= 9-*= :397&38+472*)= ;&7.&'1*`= U= 97&5*7=]=,2.9-=+32+_=;*=(425&7*)=2*&38=4+=97*&92*39=,74:58=&+9*7=<>C=:8.3,= 9-*=7>&38D&'7.*18+11.498;*18-=574(*):7*= 7>&38=9*89=+47=2:19.51*=7&3,*=9*898=<-.(-= (4397418=+47=9>5*==*7747=9&>=]=A:.33=+323_== == ,.?*= +7*6:*3(>= ).897.':9.438= 4+= *259>= &'&143*= 8-*118= <*7*= (425&7*)= '*9<**3= 9-*= 5= &3)= +.8-*)= 8.9*8= :8.3,= &= 7&3)42.8&9.43= 574(*):7*= <.9-= 9-*= E4124,474;8 ,2.734;=9*89=89&9.89.(= _=9&9&=<*7*=5441*)=&(7488=8.9*8=<.9-.3=*&(-=97*&92*39=&3)=9-*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +./ = =

9*89=89&9.89.(=(&1(:1&9*)= 4'8 _ =,.?*=+7*6:*3(>=)&9&=+742=9-*=9<4=).897.':9.438=<*7*=9-*3= 5441*)= &3)= 7&3)421>= 7*&114(&9*)= '&(0= 94= *&(-= 47.,.3&1= ).897.':9.43= &3)= 9-*= 9*89= 89&9.89.(= 7*(&1(:1&9*)=  7&3) _= -*= 574(*):7*= <&8= 7*5*&9*)= +***= 9.2*8= &3)= 9-*= 9*89= 4+= 8.,3.+.(&39= ).++*7*3(*= '*9<**3= 9-*= 9<4= ).897.':9.438= 2&)*= '>= (425&7.3,= 9-*= 4'8 = ;&1:*8= 94= 9-*= ).897.':9.43= 4+= 7&3) = ;&1:*8= 4'9&.3*)= '>= 9-*= 7&3)42.8&9.43= 574(*):7*_= ,.,3.+.(&39=).++*7*3(*8=<*7*=.)*39.+.*)=<-*3=0,/=4+=9-*= 7&3) =;&1:*8=*=(**)*)=9-*= 4'8 = ;&1:*=8**=&))43=,**+_= = +89.2&9*8=4+=57*)&9.43=2479&1.9>=&997.':9*)=94=74(0=14'89*78=.3=9-*=(&,.3,=*=5*7.2*39= <*7*= &88*88*)= :8.3,= '49-= &= 9<48<&>= <>C= &3)= &= 14,.89.(= 24)*1_= -*= <>C= .3(1:)*)=+.=*)=2&.3=*++*(98=4+=74(0=14'89*78=<.9-=9<4=1*;*18a=57*8*3(*=&3)=&'8*3(*`= &3)= &'&143*= 9<4= 1*;*18a= *2*7,*39= &3)= 5489= *2*7,*39`= &3)= (425&7*)= &'&143*= 2479&1.9>= &243,= 97*&92*398_= -*= 14,.89.(= 24)*1= (425&7*)= 9-*= 1.0*1.-44)= 4+= &'&143*= 2479&1.9>= .3= 9-*= ).++*7*39= 97*&92*398`= &3)= )&9&= <*7*= 5441*)= &(7488= 7*51.(&9*8= 4+= 9-*= 8&2*=97*&92*39=94=,&.3=&)*6:&9*=8&251*8=8.?*8=+47=9-*=574(*):7*_=9&9&=(411*(9*)=+742= 9-*= (&,.3,= *=5*7.2*39= :8*)= 94= (43897:(9= 9-*= 14,.89.(= 24)*1= +4114<*)= &= '.342.&1= ).897.':9.43=<.9-=9-*=7*85438*=;&7.&'1*`=2479&1.9>`=7*(47)*)=&8=&=5745479.43=4+=9-*=949&1= 9*89=8&251*_=-*=89&9.89.(&1=5&(0&,*=,, =<&8=:8*)=+47=&11=&3&1>8*8_= = /*8:198= 7*)&9.43=2479&1.9>=.3).(*8= *9-*7*)= &'&143*= *=548*)= 94= 57*)&9478= *=5*7.*3(*)= ;&7>.3,= 1*;*18= 4+= 57*)&9.43= 2479&1.9>= '*9<**3= 9-*= 5= &3)= +.8-*)= 8.9*8= .,:7*= /,_= -*= 2.3.2:2= &)*6:&9*= 14,.89.(= 24)*1= *=51&.3.3,= 9-*= 5&99*73= .3= &'&143*= 2479&1.9>= (439&.3*)= 9-*= 2&.3= *++*(9= 9*728`= &11= 4+= 9-*= 9<4= <&>= .39*7&(9.438= &3)= 9-*= 9-7**8<&>= .39*7&(9.43= 4+= 5749*(9.43$8.9*$97&38*(9=  χ,= -= 2_3/`= )+ = -= ,` = 5= -= *_*++._= ((:7&9*= .39*757*9&9.43= 4+= 9-*= 7*8:198= +742= 9-*= 2.3.2:2= &)*6:&9*= 24)*1= <&8= 349= 5488.'1*= &3)= 9-*7*+47*= 9-*= )&9&= <*7*=8*5&7&9*)='>=9-*= 5749*(9.43=+&(947=&3)=&3&1>8*)=.3)*5*3)*391>=94=*89.2&9*=9-*= 7*1&9.;*=).++*7*3(*8=.3=8.?*885*(.+.(=*++*(98_== = '&143*= 8.?*= <&8= 9-*= 431>= 9*72= (4397.':9.3,= 94= &= 8.,3.+.(&39= 24)*1= +.9= +742= )&9&= (411*(9*)=.38.)*=9-*=5= χ,= -=1_,/`= )+ =-=,` =5=-= *_*,01_=<*<1>=*2*7,*39=&'&143*=+-+: +-/=22=&9=5+=&3)=++0:+-/=22=&9=5,=7*85*(9.;*1>=.38.)*=9-*=5=<*7*=&12489= +*=9.2*8=247*=1.0*1>=94=*=5*7.*3(*=57*)&9.43=(425&7*)=94=54898*2*7,*39=&):198=.3=9-*= 8&2*= -&'.9&9= 1+-0= 22b= χ,= -= ._-*`= )+ = -= +` = 5= -= *_*-2+_= 7*8*2*7,*39= &'&143*`= 9-&9= &7*= 3472&11>=-.))*3=+742=57*)&9478`=*=5*7.*3(*)=8.2.1&7=1*;*18=4+=57*)&9.43=(425&7*)=94= 5489=*2*7,*39=&'&143*=1+-0=22_== = -*=5&99*73=&9=+.8-*)=8.9*8=<&8=).++*7*39=+742=9-&9=4'8*7;*)=.38.)*=9-*=5=<.9-=9-*= 9<48<&>=.39*7&(9.43=4+=8.9*$97&38*(9=8.,3.+.(&39=.3=24)*1=+.9= χ,= -=+*_1/`= )+ =-=,` =5=-= *_**/_= -*=8.,3.+.(&39=.39*7&(9.43=9*72=57*(1:)*)=+:79-*7=&3&1>8.8=4+=9-*=)&9&_=4<*;*7`=+742= 9-*=&;*7&,*=2479&1.9>=*89.2&9*8=.9=&55*&78=9-&9=9-*7*=<&8=34=).++*7*3(*=.3=9-*=7*1&9.;*= 1.0*1.-44)=4+=2479&1.9>='*9<**3=9-*=9-7**=8.?*=(1&88*8_=-*=1.0*1.-44)=4+=2479&1.9>=+47=

+.0 = 74/*(9=34_=,**.2*+- = =

3*<1>=*2*7,*39=&'&143*=;&7.*)='*9<**3=9-*=9<4=+.8-*)=8.9*8_=3=(4397&89`=9-*7*=<&8=34= ).++*7*3(*= .3= 9-*= 1.0*1.-44)= 4+= 2479&1.9>= '*9<**3= 8.9*8= +47= 57*= 47= 5489= *2*7,*39= &'&143*_== = +=&2.3&9.43= 4+= *259>= 8-*118= +4114<.3,= 9-*= 9*9-*7.3,= *=5*7.2*39= .3).(&9*)= 9-&9= 9-*= 3:2'*7=4+=&'&143*=2479&1.9.*8=).7*(91>=&997.':9*)=94=74(0=14'89*78`='>=9-*=57*8*3(*=4+= (-.5= 2&708= 43= 9-*= 2&7,.3= 4+= 8-*118= 8**= '*14<`= <&8= -.,-*7= .38.)*= 9-*= 5= (425&7*)=94=&)/&(*39=+.8-*)=8.9*8=.,:7*=/-_=-*=2.3.2:2=14,.89.(=24)*1=)*8(7.'.3,= 9-*=5&99*738=.3=74(0=14'89*7=&884(.&9*)=2479&1.9>=(438.89*)=4+=9-*=9<48<&>=.39*7&(9.43= 4+=5749*(9.43$8.9*= χ,= -=._/2`= )+ =-=+` =5=-= *_*-,=&3)=9-*=.3).;.):&1=2&.3=*++*(9=9*728_=-*= 8.,3.+.(&39= .39*7&(9.43= 9*72= .3).(&9*)= 9-&9= 9-*= 57*)&9.43= 4+= &'&143*= '>= 74(0= 14'89*78= <&8= 85&9.&11>= ;&7.&'1*= &9= &= 8(&1*= 4+= 9-*= ).89&3(*= '*9<**3= 8.9*8_= -*= 3:2'*7= 4+= 2479&1.9.*8=9-&9=(4:1)='*=&997.':9*)=94=74(0=14'89*78=<&8=-.,-*7=&9=8.9*8=.38.)*=9-*=5= (425&7*)=94=+.8-*)=8.9*=+=':9=349=8.,3.+.(&391>=,7*&9*7=9-&3=9-*=3:2'*7=4+=2479&1.9.*8= &9=+.8-*)=8.9*=,=.,:7*=/-_== = 7*8:198= +742= 9-*= 9-7**= 8*5&7&9*= <>C= 24)*18= +4:3)= 34= 8.,3.+.(&39= ).++*7*3(*= '*9<**3= 8.9*8= .3= 9-*= &;*7&,*= &':3)&3(*= 4+= 82&11= 74(0= 14'89*78= 0++*= 22= ?Ob= )-`+/= -= +_.1`=5=-=*_,1,*`=8.,3.+.(&39=).++*7*3(*8='*9<**3=8.9*8=+47=2*).:2=8.?*)=74(0=14'89*78= +++:+.*=22=?Ob= )-`+/= -=,,_**`=5=0*_***+`=&3)=8.,3.+.(&39=).++*7*3(*8='*9<**3=8.9*8=+47= 1&7,*=74(0=14'89*78=1+.+=22=?Ob= )-`+/= -=1_-,`=5=0*_**/_=5:19.51*=7&3,*=(425&7.843=9*898= .3).(&9*)=2*).:2=8.?*)=74(0=14'89*78=<*7*=.3=8.,3.+.(&391>=-.,-*7=&':3)&3(*=&9='49-= 5= 8.9*8= (425&7*)= 94= '49-= +.8-*)= 8.9*8= &3)= <*7*= 8.,3.+.(&391>= 247*= &':3)&39= &9= 5+=(425&7*)=94=5,_=O&7,*=74(0=14'89*78=<*7*=8.,3.+.(&391>=247*=&':3)&39=&9= 5+=(425&7*)=94=*.9-*7=+.8-*)=8.9*=':9=.3=8.2.1&7=&':3)&3(*=94=5,=.,:7*=/._= -*= &':3)&3(*= 4+= 1&7,*= 74(0= 14'89*78= <&8= 349= 8.,3.+.(&391>= ).++*7*39= '*9<**3= 9-*= +.8-*)=8.9*8=&3)=5,_= = = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +.1 = =

Pre-emergent Newly emergent Post emergent 1

0.8 ) e l p m a s l a t 0.6 o t f o n o i t r o p o r 0.4 p ( y t i l a t r o M 0.2

0

Fished 1 Fished 2 MPA 1 MPA 2 = *.,:7*=/,= &1.49.8= 7:'7& _= 89.2&9*8= 4+= 7*1&9.;*= 57*)&9.43= 2479&1.9>`= 7*57*8*39*)= &8= 9-*= 5745479.43=4+=2479&1.9.*8=.3=9-*=949&1=8&251*=4+=9*9-*7*)=&'&143*=&9=+4:7=8.9*8=4;*7=,2= )&>8_=-&9&=8*7.*8=&7*=2*&3=*89.2&9*8=)==+742=9-7**=7*51.(&9*=97&38*(98=&9=*&(-=8.9*= <.9-= 3= -=2=.3).;.):&18=.3=*&(-=8.?*=(1&88=43=*&(-=97&38*(9_=!49*=9-&9=)&9&=8*7.*8=<-*7*= 9-*=*89.2&9*8=4+=2479&1.9>=<*7*=*6:&1='*9<**3=7*51.(&9*8=&3=*7747=*89.2&9*==.8=349= ).851&>*)_= =

+.2 = 74/*(9=34_=,**.2*+- = =

1

Pre-emergent Newly emergent s r

e Post emergent t

s 0.8 b o l k c o r o t d e

t 0.6 u b i r t t a s e i t i l a t 0.4 r o m f o n o i t r o

p 0.2 o r P

0 Fished 1 Fished 2 MPA 1 MPA 2 = *.,:7*=/-= &1.49.8= 7:'7& _= 745479.43=4+=9*9-*7*)=&'&143*=2479&1.9.*8=8-4<.3,= ).89.3(9.;*= 74(0= 14'89*7= 57*)&9.43= 2&708= '&78_= -&9&= 8*7.*8= &7*= 2*&3= *89.2&9*8= )= = +742= 9-7**= 7*51.(&9*= 97&38*(98= &9= *&(-= 8.9*= <.9-= 3= -= 2= .3).;.):&18= .3= *&(-= 8.?*= (1&88= 43= *&(-= 97&38*(9_== = ,:7;*>8=4+=9-*=+4:7=*=5*7.2*39&1=8.9*8`=<-*7*=9*9-*7.3,=*=5*7.2*398=<*7*=:3)*79&0*3`= +4:3)=&=<.)*=8.?*=7&3,*=4+=*259>=&'&143*=8-*118=).851&>.3,=8.,38=4+=.39*7&(9.438='49-= 1*9-&1=&3)=34381*9-&1=<.9-=74(0=14'89*78=.,:7*=//_=-*=8.?*=+7*6:*3(>=).897.':9.43=4+= 8-*118= &9= +.8-*)= 8.9*8= <*7*= 8.,3.+.(&391>= ).++*7*39= +742= 9-48*= <.9-.3= 9-*= 5=  4'8 = -= *_/+3`=5 =0*_***+=<.9-=9-*=2&=.2:2=8*5&7&9.43='*9<**3=9-*=).897.':9.438=&9=+,-=22_== =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +.3 = =

6 Small (<110mm) Medium (111-140mm) Large (>141mm) ) 2

4

2 Average lobster abundance (number per 50m per (number abundance lobster Average

0 Fished 1 Fished 2 MPA 1 MPA 2 Small A A A A Medium C C A B Large B B A A-B = *.,:7*=/.= )&8:8= *)<&7)8.. _= %;*7&,*=74(0=14'89*7=&':3)&3(*8=.3=*&(-=4+=9-*=9-7**= 8.?*= (1&88*8= 82&11=0++*=22`=2*).:2=+++8+.*=22=&3)=1&7,*=1+.+=22=&9=*&(-=4+=9-*=+4:7=8.9*8= 57.47= 94= *=5*7.2*39&1= 2&3.5:1&9.438= '*.3,= 5*7+472*)_= %;*7&,*= &':3)&3(*= &3)= 89&3)&7)=*7747=<*7*=(&1(:1&9*)=+742=+4:7=7*51.(&9*=/*===+2=97&38*(98=&9=*&(-=8.9*=<.9-= ).++*7*3(*8= .3= &;*7&,*= &':3)&3(*= &88*88*)= :8.3,= +8<&>= %!42%= (43897:(9*)= +47= *&(-= 74(0= 14'89*7= 8.?*= (1&88= &3)= />&383&'7.*1811.498E*18-= /3E= 2:19.51*= (425&7.843= 9*89_= .9*8= &88.,3*)= ).++*7*39= /3E= ,74:5.3,= <*7*= 8.,3.+.(&391>= ).++*7*39=<.9-=&15-&=&)/:89*)=94=(439741=+47=>5*=7=*7747= ααα&)/= -=*_**3_= =

+/* = 74/*(9=34_=,**.2*+- = =

0.1 Fished MPA

0.08 e l p m a s

l 0.06 a t o t f o n o

i 0.04 t r o p o r P 0.02

0

0.08 e l p m a s

l 0.06 a t o t f o n o

i 0.04 t r o p o r P 0.02

0 40 80 120 160 200

Shell length (mm) = *.,:7*=//= &1.49.8= 7:'7& _= .?*= +7*6:*3(>= ).897.':9.438= 4+= *259>= &'&143*= 8-*118= <.9-= (-&7&(9*7.89.(=2&70.3,8=.3).(&9.3,=.39*7&(9.43=<.9-=74(0=14'89*78_=-&9&=<*7*=5441*)= &(7488=7*51.(&9*=8.9*8= 3=-=,=<.9-.3=*&(-=97*&92*39_=.?*=+7*6:*3(>=).897.':9.438=<*7*= 8.,3.+.(&391>=).++*7*39=&9=+,-=22=8-*11=1*3,9-= &4'8 =-=*_/+3`=5 =0*_***+_=-&8-*)=;*79.(&1= 1.3*8= 7*57*8*39= 8.?*= &9= *2*7,*3(*= *89.2&9*8= +742= *)*7843= *9= &1_= ,**2= &;*7&,*)= &(7488=8.9*8=<.9-.3=*&(-=97*&92*39_==

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +/+ = =

.?*885*(.+.(=57*)&9.43== 9.7*(9= 4'8*7;&9.438= 4+= 74(0= 14'89*7= '*-&;.4:7= ):7.3,= 9-*= &6:&7.:2= *=5*7.2*39= 8:,,*89*)=9-*=57*+*77*)=2*9-4)=4+=&99&(0.3,=&'&143*=.3;41;*)=74(0=14'89*78='7*&0.3,= 82&11=5.*(*8=4+=8-*11=+742=9-*=2&7,.3=4+=&'&143*=8-*118='*+47*=&551>.3,=1*;*7&,*=:8.3,= 9-*=+.789=9-47&(.(=&55*3)&,*_=7*)&9.43=*;*398=.3;41;.3,=9-.8=9*(-3.6:*=<*7*=4'8*7;*)= '>= 8*;*7&1= 1&7,*= 74(0= 14'89*78= ':9= 349= '>= 9-*= 2*).:2= 8.?*)= +++:+.*= 22= 47= 82&11= 0++*= 22= 74(0= 14'89*78_= O*9-&1= .39*7&(9.438= <*7*= 431>= 4'8*7;*)= 94= 4((:7= '*9<**3= 1&7,*= 74(0= 14'89*78= 1+.+= 22= &3)= 57*8*2*7,*39= &'&143*= 022= 22_= 39*7&(9.438= '*9<**3=74(0=14'89*78=&3)=54898*2*7,*39=&'&143*=<*7*=4'8*7;*)=.3=.3+7&87*)=+449&,*= ':9= 431>= 7*8:19*)= .3= 34381*9-&1= .25&(98_= -*= 7*8:19= 4+= 2&3>= 34381*9-&1= .39*7&(9.438= <*7*=(-&7&(9*7.8*)='>=9-*=74(0=14'89*7=(-.55.3,=9-*=2&7,.3=4+=&'&143*=8-*118=':9=349= 8:((*88+:11>=(438:2.3,=&'&143*_=9:*=94=9-*=*=97*2*1>=14<=3:2'*7=4+=2479&1.9>=*;*398= 4'8*7;*)= ):7.3,= 9-*= &6:&7.:2= *=5*7.2*39`= &= 89&9.89.(&1= &3&1>8.8= 4+= 9-*= 7*8:198= (4:1)= 349= '*= 5*7+472*)= &'1*= +-_= 4<*;*7`= 7*8:198= +742= 9-*= &6:&7.:2= *=5*7.2*398= .3).(&9*=9-&9=2&70.3,8=1*+9=43=9-*=&'&143*=8-*118=(&3='*=:8*)=&8=&3=.3).(&947=4+=*.9-*7= 1*9-&1=47=34381*9-&1=.39*7&(9.438=<.9-=74(0=14'89*78=.,:7*=/0_= = &'1*=+-= %;*7&,*=3:2'*7=4+=&'&143*=2479&1.9.*8`=<.9-=89&3)&7)=*77478=5&7*39-*8*8`=.3=9-7**= 8.?*=(1&88*8`=*=548*)=94=9-7**=).++*7*39=8.?*=(1&88*8=4+= 74(0= 14'89*78_= %;*7&,*8= <*7*= (&1(:1&9*)=+742=8*;*3=8*5&7&9*=':9=(438*(:9.;*=97.&18_== = 5*).:2= ,2&11=14'89*7= 14'89*7== O&7,*=14'89*7= '&143*=8.?*=(1&88= ?439741= 0++*=22= +++:+.*=22= 1+.+=22= 7*8*2*7,*39=022=22= *= *= *_+.-=*_+.-= *_.,3=*_,*,= <*<1>= *2*7,*39= 23:+-/= 22= *= *= *= *_+.-=*_+.-= 489=*2*7,*39=1+-0=22= *= *= *= *=

+/, = 74/*(9=34_=,**.2*+- = =

=

= *.,:7*=/0= &1.49.8= 7:'7& _= %'&143*= 8-*11= 1,= 22= 8-*11= 1*3,9-= ).851&>.3,= )&2&,*= %= (-&7&(9*7.89.(= 4+= 1*9-&1= .39*7&(9.43= <.9-= 1&7,*= 74(0= 14'89*78= 1+.+= 22= ):7.3,= &6:&7.:2=97.&18= 7*)&9.43=2479&1.9>=&997.':9&'1*=94=74(0=14'89*78= ?425&7.843= 4+= 9-*= (&,*= (4397418= <.9-= 9-*= :382&3.5:1&9*)= (4397418= 51498= +4:3)= 34= 8.,3.+.(&39=).++*7*3(*=.3=&'&143*=2479&1.9>=:8.3,=*.9-*7=<>C= )-`,* =-=*_33`=5 =-=*_.+0,= 47=9-*=14,.89.(=24)*1=97*&92*39$8.?*= χ,= -=*_+`= )+ =-=+`=5 =-=*_32b=8.?*= χ,= -=-_.0`= )+ =-=+`=5 =-= *_*1b=97*&92*39= χ,= -=*_0,`= )+ =-=+`=5 =-=*_.-_=-.8=7*8:19=.3).(&9*8=9-*7*=<&8=34=)*9*(9&'1*= *++*(9=4+=9-*=(&,*=43=&'&143*=2479&1.9>=&3)=9-*7*+47*=9-*=:382&3.5:1&9*)=(439741=51498= <*7*=*=(1:)*)=+742=+:79-*7=&3&1>8*8_== = ?425&7.843=4+=&'&143*=2479&1.9>=7&9*8=:8.3,=9-*=<>C=24)*1=+4:3)=&=8.,3.+.(&39= 97*&92*39= *++*(9=  ),`-* = -= 0_.3`= 5 = -= *_**/`= <.9-= &'&143*= 2479&1.9>= 7&9*8= 8.,3.+.(&391>= -.,-*7= .3= 9-*= 57*8*3(*= 4+= 74(0= 14'89*78= .,:7*= /1_= <*<1>= *2*7,*39= &'&143*= *=5*7.*3(*)= 8.2.1&7= 1*;*18= 4+= 57*)&9.43= 2479&1.9>= 94= 5489= *2*7,*39= &'&143*= .3= &11= 97*&92*398= 8.?*= )+`-* =-=*_.-`=5=-=*_/,_='&143*=2479&1.9>=7&9*8=<*7*=349= 8.,3.+.(&391>= ).++*7*39=.3=9-*=57*8*3(*=4+=74(0=14'89*78=&9=*=5*7.2*39&1=)*38.9.*8=.38.)*=(&,*8=*_++= .3).;.):&18=2 8, =47=&9='&(0,74:3)=)*38.9.*8=7*(47)*)=&9=9-*=8.9*=*_+0=.3).;.):&18=2 8, = .3=5&79.&1=(&,*8=<-*7*=74(0=14'89*78=<*7*=&114<*)=+7**=&((*88=9-74:,-=-41*8=.3=9-*=8.)*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +/- = =

4+= (&,*8_= -.8= 7*8:19= .3).(&9*8= 9-&9= 9-*7*= <&8= 34= )*9*(9&'1*= *++*(9= 4+= 7*897.(9.3,= 74(0= 14'89*78=.38.)*=9-*=(&,*8=43=8:'8*6:*39=&'&143*=2479&1.9>_== = 7*8:198= +742= 9-*= 14,.89.(= 24)*1= <*7*= 8.2.1&7= 94= 9-48*= 4+= 9-*= <>C`= <.9-= &= 8.,3.+.(&39=).++*7*3(*='*9<**3=9-*=9-7**=97*&92*398=9<4=*=5*7.2*39&1=97*&92*398=&3)= 9-*= 5&79.&1= (&,*= χ,= -= ,2_,-`= )+ = -= ,`= 5 = 0= *_**+= &3)= 34= 8.,3.+.(&39= ).++*7*3(*= .3= 9-*= 1.0*1.-44)=4+=2479&1.9>='&8*)=43=&'&143*=8.?*= χ,= -=*_11`= )+ =-=+`=5 =-=*_-2+2_=4<*;*7`= <-*3=2:19.51*=(425&7.8438='*9<**3=97*&92*398=<*7*=2&)*`=9-*=1.0*1.-44)=4+=&'&143*= 2479&1.9>= '49-= 8.?*8= <&8= /_+=+* +, = 9.2*8= -.,-*7= .3= 9-*= 57*8*3(*= 4+= 74(0= 14'89*78= (14'89*7= (&,*8= (425&7*)= 94= <-*3= 74(0= 14'89*78= <*7*= &'8*39=  χ,= -= ,2_+/`= )+ = -= +`= 5 = 0= *_**+`= +_-=+* ++ = 9.2*8= 247*= 1.0*1>= <-*3= 74(0= 14'89*78= <*7*= &114<*)= +7**= &((*88= 94= 5&79.&1= (&,*8= ._*_= &9= '&(0,74:3)= )*38.9>= (425&7*)= 94= <-*3= 74(0= 14'89*78= <*7*= *=(1:)*)= χ,= -=+._11`= )+ =-=+`=5 =0=*_**+`=':9=34=).++*7*3(*=.3=9-*=1.0*1.-44)=4+=2479&1.9>= <-*3= 74(0= 14'89*78= <-*7*= *.9-*7= (439&.3*)= .38.)*= (&,*8= (= 14'89*7= 97*&92*39= 47= &114<*)=+7**=&((*88=94=(&,*8=5&79.&1=(&,*8a= χ,= -=-_..`= )+ =-=+`=5 =-=*_*0-/_== =

+/. = 74/*(9=34_=,**.2*+- = =

3 Newly emergent (120-135 mm) Post emergent (>136 mm) ) s y a d 0 6 r e p s l 2 a u d i v i d n i ( s e i t i l a t r o

m 1 e n o l a b a n a e M

0 Cage + Lobster - Lobster Control control

A B A = *.,:7*=/1= &1.49.8= 7:'7& _=
*&3= *89.2&9*8= 4+= &'&143*= 2479&1.9>= 4;*7= &= 0*= )&>= 5*7.4)= .3= 9-*= 57*8*3(*= &3)= &'8*3(*= 47= 74(0= 14'89*78= (= 84'89*7`= 8= 84'89*7= 7*85*(9.;*1>`= (&,*= (4397418= 5&79.&1= (&,*8= &114<.3,= 74(0= 14'89*78= &3)= 49-*7= 57*)&9478= &((*88= &3)= :38 2&3.5:1&9*)= (439741= 51498= &114<.3,= &((*88= '>= &11= 57*)&9478_=
*&3= *89.2&9*8= )= = <*7*= ,&.3*)= +742= 8.== 7*51.(&9*= 97*&92*39= 51498= +:11= (&,*8`= 5&79.&1= (&,*8= 47= :38 2&3.5:1&9*)= 51498= <.9-= +.;*= 7*51.(&9*=&'&143*= .3=*&(-= 8.?*= (1&88= .3= *&(-= 7*51.(&9*= 5149_=8&'*18='*14<=8*7.*8=7*57*8*39=7*8:198=+742=:3.;&7.&9*=%!42%=&3)=/>&38.3498 3&'7.*18E*18(-=/3E=2:19.51*=7&3,*=(425&7.843=9*898=(425&7.3,=2*&3=&'&143*= 2479&1.9>= .3= *&(-= 97*&92*39_= 7*&92*398= &88.,3*)= ).++*7*39= /3E= ,74:5.3,= <*7*= 8.,3.+.(&391>=).++*7*39=+742=*&(-=49-*7=<.9-=&15-&=&)/:89*)=94=(439741=+47=>5*=7=*7747= .3=2:19.51*=(425&7.8438= ααα&)/= -=*_*+1_==

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +// = =

-.8(:88.43= 725479&3(*=4+=74(0=14'89*78 == 74(0= 14'89*78= &7*= 034<3= 94= 57*>= 43= &= ;&7.*9>= 4+= '*39-.(= .3;*79*'7&9*8= &3)= .3= 842*= .389&3(*8= &99&(0= 57*>`= 1*&;.3,= (-&7&(9*7.89.(= 2&70.3,8= 47= 7*2&.38= *,3*7= ]= O*;.3= +32-b=B&2*8=]=43,=+332b=,-*&78=]=&'(4(0=,**,b=*)*7843= ]= B4-3843= ,**0_= 74(0= 14'89*78=.3=4:7=&6:&7.:2=97.&1=&99&(0*)=&'&143*=.3=&=85*(.+.(=<&>=1*&;.3,=.)*39.+.&'1*= 2&708= 43= 9-*= 2&7,.3&1= *),*= 4+= 9-*= 8-*11= .,:7*= /0_= -*8*= (-&7&(9*7.89.(= 2&708= &114<*)= 9-*= 5745479.43= 4+= &'&143*= 2479&1.9.*8= ).7*(91>= &997.':9&'1*= 94= 74(0= 14'89*78= ):7.3,= 9-*= 9*9-*7.3,= *=5*7.2*39= 94= '*= (&1(:1&9*)_= 7*8:198= +742= 9-*= 9*9-*7.3,= *=5*7.2*39=.3).(&9*)=9-&9=&'&143*=2479&1.9>=<&8=).7*(91>=5745479.43&1=94=74(0=14'89*7= &':3)&3(*_=19-4:,-=9-*=*89.2&9*8=4+=57*)&9.43=).7*(91>=&997.':9&'1*=94=74(0=14'89*78= <*7*= (438*7;&9.;*`= 9-*= *89.2&9*8= .3).(&9*)= 9-&9= 74(0= 14'89*78= (4397.':9*)= 94= &= 1&7,*= 5745479.43= 4+= 2479&1.9.*8_= -*= 7*2&.3.3,= 2479&1.9.*8= <*7*= &997.':9*)= 94= &= 7&3,*= 4+= 49-*7=57*)&9478=<-48*=.)*39.9>=7*2&.38=:3034<3_== = 831.0*=57*;.4:8=*=5*7.2*398=*=&2.3.3,=9-*=7*1&9.;*=.25479&3(*=4+='49-=74(0=14'89*78= &3)= 57*)&947>= )*2*78&1= +.8-= &8= '*39-.(= 57*)&9478= *)*7843= ]= B4-3843= ,**0`= 97*&92*398=94=9*89=9-*=*++*(9=4+=57*)&947>=)*2*78&1=+.8-=43=&'&143*=2479&1.9>=<*7*=349= (43):(9*)= .3= 9-.8= 89:)>_= -.8= )*(.8.43= <&8= '&8*)= 43= 57*;.4:8= <470= <-*7*= 34= (1*&7= 7*1&9.438-.58='*9<**3=8:57&8'*39-.(=+.8-=&':3)&3(*=&3)=*.9-*7=&'&143*=&':3)&3(*=47= 8.?*= &9= *2*7,*3(*= <*7*= 4'8*7;*)= &9= 9-*= 8&2*= 89:)>= 8.9*8= *)*7843= *9= &1_= ,**2_= 4<*;*7`=9-*=*=5*7.2*39&1=)*8.,3=&114<8=+47=9-*=*++*(9=4+=57*)&9478=49-*7=9-&3=74(0= 14'89*78= 94= '*= *89.2&9*)= '>= (425&7.3,= &'&143*= 2479&1.9>= .3= 74(0= 14'89*7= .3(1:8.43= (&,*8=(=74(0=14'89*7=97*&92*39=<.9-=9-48*=4+=9-*=5&79.&1=(&,*8_=5479&1.9>=4+=3*<1>=&3)= 5489= *2*7,*39= &'&143*= <&8= 349= 8.,3.+.(&391>= ).++*7*39= '*9<**3= 9-*= 74(0= 14'89*7= .3(1:8.43= 97*&92*39= &3)= 5&79.&1= (&,*8`= .3).(&9.3,= 9-&9= 74(0= 14'89*78= (4397.':9*= 94= 9-*= 2&/47.9>=4+=2479&1.9.*8`=<.9-=49-*7=57*)&9478=(4397.':9.3,=94=;*7>=+*<=2479&1.9.*8_=-*= (42'.3&9.43= 4+= 7*8:198= +742= 9-*= 2&3.5:1&9.;*= *=5*7.2*398= &3)= 8:7;*>8= 8-4<= 9-&9= &8:8= *)<&7)8.. = .8= &3= .25479&39= 57*)&947= 4+= &1.49.8= 7:'7&= &3)= 9-&9= 9-*= 1.0*1.-44)= 4+= 2479&1.9>=.8=7*1&9*)=94=9-*=&':3)&3(*=&3)=8.?*=4+=74(0=14'89*78_== = 7*)&9.43=.39*38.9>=&3)=7&9*= ;-.1*=9*9-*7.3,=*=5*7.2*398=&7*=(438.)*7*)=94='*=.3*++*(9.;*=&9=*89.2&9.3,=57*)&9.43= 2479&1.9>= 7&9*8= ):*= 94= 549*39.&1= &79*+&(98= &884(.&9*)= <.9-= 9-*= 9*9-*7.3,= 574(*88= *9*7843= ]= 1&(0= +33.`= 9-*>= ,.;*= &= (1*&7= .3).(&9.43= 4+= 9-*= 7*1&9.;*= ).++*7*3(*8= .3= 57*)&9.43=.39*38.9>='*9<**3=8.9*8=&3)=&8=8:(-=-&;*='**3=<.)*1>=&551.*)=5(?1&3&-&3= ]= 5:9-.,&= +323b= ,&1&= ]= I&'&1&= +330b= ,-*&78= ]= &'(4(0= ,**,b= *)*7843= ]= B4-3843= ,**0_= 7*8:198= +742= 9-.8= 89:)>= .3).(&9*)= 9-&9= 8.?*885*(.+.(= 57*)&9.43= .39*38.9>= <&8= 85&9.&11>=;&7.&'1*=&9=9-*=8(&1*=4+=9-*=).89&3(*='*9<**3=8.9*8=+* -= 2=&3)=1.30*)=94=9-*= &':3)&3(*= 4+= 1&7,*= 74(0= 14'89*78_= -*= 7*8:198= )*243897&9*= 9-&9= <-*3= &'&143*`= 7*,&7)1*88=4+=8.?*`=&7*=:3&'1*=94=8**0=7*+:,*=.3=57*+*77*)=-&'.9&9`=9-*>=*=5*7.*3(*=-.,-= 1*;*18=4+=2479&1.9>=4;*7=8-479=9.2*=5*7.4)8=<-*3=*=548*)=94=74(0=14'89*78_== =

+/0 = 74/*(9=34_=,**.2*+- = =

7*8:198= +742= 9-*= (&,.3,= *=5*7.2*39= <*7*= 247*= 7*1.&'1*= .3= *89.2&9.3,= 57*)&9.43= 247&1.9>=7&9*8=&8=&'&143*=<*7*=&'1*=94=*89&'1.8-=9-*.7=4<3=548.9.43=43=9-*=8:'897&9*`= .3(1:).3,= 14(&9.438= -.))*3= +742= 57*)&9478= <-.(-= -*158= 94= 7*):(*= 9-*= 1.0*1.-44)= 4+= 57*)&9.43_= *9-*7*)= &'&143*= 4+= 8.2.1&7= 8.?*= 2&>= 349= '*= &'1*= 94= 8*1*(9= 8:.9&'1*= &99&(-2*39= 8:7+&(*8= &3)= 8:++*7= +742= -.,-*7= 1*;*18= 4+= 57*)&9.43_= 7*8:198= +742= 9-*= (&,.3,=*=5*7.2*39=*89.2&9*)=&33:&1=57*)&9.43=2479&1.9>=7&9*8=4+=&'&143*=94='*= (&_ =,_*-= .3).;.):&18= 2 8, =>*&7 8+ _=-*=7&9*=4+=3&9:7&1=2479&1.9>`=*=(1:).3,=57*)&9.43`=<&8=14<*7= 89.11`=<.9-=34=2479&1.9.*8=7*(47)*)=.3=(&,*8=<-*7*=&11=57*)&9478=.3(1:).3,=74(0=14'89*78= <*7*= *=(1:)*)_= -*8*= 7*8:198= 8:,,*89= 9-&9= &'&143*= *=5*7.*3(*= 14<*7= 7&9*8= 4+= 3&9:7&1= 2479&1.9>=<-*3=74(0=14'89*78=&7*=.3=14<=&':3)&3(*=':9=*=5*7.*3(*=8.,3.+.(&391>=-.,-*7= 2479&1.9>= 7&9*8= <-*3= 74(0= 14'89*7= &':3)&3(*= .8= *1*;&9*) _= 7*8:198= +742= &= 8.2.1&7= *=5*7.2*39= (43):(9*)= &9= 9-*= 8&2*= 8.9*= '>= *)*7843= &3)= B4-3843= ,**0= +4:3)= 9-*= (42243= 8*&= :7(-.3=  *1.4(.)&7.8= *7>9-74,7&22& = 94= *=5*7.*3(*= 14<= 1*;*18= 4+= 3&9:7&1= 2479&1.9>=&3)=8.2.1&7=1*;*1=4+=57*)&9.43=2479&1.9>=).7*(91>=&997.':9&'1*=94=74(0=14'89*78= +_33=&3)=-_*2=.3).;.):&18=2 8,= >*&7 8+ _=-.8=7*8:19=8:,,*898=9-&9=8*&=:7(-.38=&3)=&'&143*= &7*=(438:2*)=.3=*6:&1=5745479.438=:3)*7=+.*1)=(43).9.438_= = .?*885*(.+.(=57*)&9.43= 831.0*=49-*7=57*>=.9*28=<-*7*=8.?*=51&>8=&=741*=.3= )*9*72.3.3,= 9-*= 8:8(*59.'.1.9>= 94= 57*)&9.43='>=14'89*78=4114(0=+313b=*,3*7=]=O*;.3=+32-b=74'1*8=*9=&1_=+33*b=B&2*8=]= 43,=+332b=5&>+.*1)=*9=&1_=,**+b=O&3,14.8=*9=&1_=,**0&b=*)*7843=]=B4-3843=,**0`=9-*= 5->8.(&1=8.?*=4+=&'&143*=).)=349=-&;*=&3=.25&(9=43=9-*=1.0*1.-44)=4+=57*)&9.43=.3=9-*= (:77*39=89:)>_=-*=7*8:198=4+=9-*=9*9-*7.3,=*=5*7.2*39=8-4<*)=9-&9='*-&;.4:7=<&8=&3= .25479&39= +&(947= )*9*72.3.3,= 9-*= 8:8(*59.'.1.9>= 4+= &'&143*= 94= 57*)&9.43_= ;-*3= 57*8 *2*7,*39=&'&143*`=<-.(-=<4:1)=3472&11>='*=(7>59.(`=<*7*=9*9-*7*)=&3)=:3&'1*=94=8**0= 7*+:,*= +742= 57*)&9478`= 9-*>= *=5*7.*3(*)= 8.2.1&7= 7&9*8= 4+= 2479&1.9>= &8= 9-*.7= 1&7,*7= (4385*(.+.(8_=-*7*+47*`=9-*=8.?*=&9=<-.(-=&'&143*=*2*7,*=+742=(7>58.8=&55*&78=94='*=&= 2&/47=+&(947=)*9*72.3.3,=9-*.7=8:8(*59.'.1.9>=94=57*)&9.43=2479&1.9>=&3)=2&>=*=51&.3= 9-*= 5&99*738= 4+= &'&143*= 8.?*= &9= *2*7,*3(*= 57*;.4:81>= )*8(7.'*)= '>= *)*7843= *9= &1= ,**2_== = 19-4:,-= ;*7>= +*<= 2479&1.9.*8= <*7*= 7*(47)*)= ):7.3,= 9-*= &6:&7.:2= *=5*7.2*39`= &'&143*=<*7*=431>=(438:2*)='>=9-*=1&7,*89=8.?*=(1&88=4+=74(0=14'89*78=1+.+=22=?O`= 4+=<-.(-`=431>=57*8*2*7,*39=&'&143*=022=22=8:++*7*)=1*9-&1=.39*7&(9.438_=4<*;*7`= 8-*11= )&2&,*= <&8= 4'8*7;*)= 43= 3*<1>= *2*7,*39= 23:+-/= 22= &3)= 5489= *2*7,*39= &'&143*=1+-0=22=&8=&=7*8:19=4+=34381*9-&1=.39*7&(9.43=<.9-=1&7,*=74(0=14'89*78_=-*= 8:7;*>=4+=*259>=8-*118=&9=9-*=+4:7=*=5*7.2*39&1=8.9*8=+4:3)=2&708=43=&'&143*=8-*118= .3).(&9.;*= 4+= .39*7&(9.438= <.9-= 74(0= 14'89*78= &(7488= &= 2:(-= '74&)*7= 7&3,*= 4+= 8.?*= (1&88*8_= 19-4:,-= 9-*= 84:7(*= 4+= 9-*= 2479&1.9>= (4:1)= 349= '*= :3*6:.;4(&11>= .)*39.+.*)`= 9-*= 57*8*3(*= 4+= 9-*= (-&7&(9*7.89.(= 2&708= .3).(&9*)= 9-&9= 74(0= 14'89*78= .39*7&(9`= '49-= 1*9-&11>=&3)=34381*9-&11>`=<.9-=&='74&)=7&3,*=4+=&'&143*=8.?*8_=-*=7&3,*=4+=8-*11=8.?*8= <&8=&184='74&)*7=&9=8.9*8=.38.)*=9-*=5`=<-*7*=74(0=14'89*7=&':3)&3(*=&3)=&;*7&,*= 8.?*=<*7*=*1*;&9*)`=(43+.72.3,=9-&9=74(0=14'89*7=8.?*=51&>8=&=741*=.3=&'&143*=2479&1.9>_ =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +/1 = =

= 7*8:198=+742=9-.8=89:)>=8-4<*)=9-&9=74(0=14'89*78=&7*=.25479&39=57*)&9478=4+=&'&143*= 4+=&82&3.&3=7**+8`=&3)=(438.89*39=<.9-=49-*7=89:).*8=<-.(-=.11:897&9*=9-*=.25479&3(*= 4+=2411:8(8=.3=74(0=14'89*7=).*98=B*73&04++=*9=&1_=+33-b=E*11>=+333b=5&>+.*1)=*9=&1=,***&b= 5&>+.*1)=*9=&1=,**+_=-*=*=5*7.2*39&1=)&9&=7*.3+47(*8=9-*=5&99*738=4'8*7;*)`=':9=349= 9*89*)`= .3= 7*1&9*)= 4'8*7;&9.43&1= 89:).*8= 4+= *(48>89*2= (-&3,*8= &884(.&9*)= <.9-= 58= +),&7=]=&77*99=+333b=:=943=*9=&1=,**0_=7*24;&1=4+=74(0=14'89*78='>=+.8-.3,=-&8=&= 8*7.*8= 4+= (438*6:*3(*8= +47= '74&)*7= *(48>89*2= +:3(9.43= 9-&9= 3**)= 94= '*= 9&0*3= .394= &((4:39= '>= +.8-*7.*8= &3)= (438*7;&9.43= 2&3&,*2*39_= -*= (:77*39= 894(0= 7*':.1).3,= 2&3&,*2*39=897&9*,>=<-.(-=-&8=(1*&7=*(4342.(=&3)=*(414,.(&1='*3*+.98=.3(1:).3,=9-*= 8:557*88.43=4+=8*&=:7(-.3=545:1&9.438=B4-3843=*9=&1=,**.b=B4-3843=*9=&1=,**/`=.8=1.0*1>= 94=-&;*=&=8>3*7,.89.(=*++*(9=43=9-*=&82&3.&3=&'&143*=+.8-*7>=(:77*391>=<479-=.3=*=(*88= 4+=8N+/*=2.11.43=5*7=&33:2_==

+/2 = 74/*(9=34_=,**.2*+- = =

%55*3).==-= -.;*7=6:*89.433&.7*= +_ <&2*= ,_ ?439&(9=&))7*8825-43*=3:2'*7= -_ 9.)=>4:=0**5=&=).&7>=47=14,'440=4+=&'&143*=+.8-.3,
= ._ ;-&9=>*&78=<*7*=>4:=&(9.;*1>=.3;41;*)=.3=(422*7(.&1=&'&143*=).;.3,
= ,9&79=>*&7=2=,945=>*&7= /_ 4<=41)=<*7*=>4:=<-*3=>4:=89&79*)
= 0_ ;-&9=<&8=>4:7='&(0,74:3)='*+47*=>4:=89&79*)
= &_ ;-&9=574259*)=>4:=94=89&79=).;.3,
= '_ ;*7*=>4:7=+&2.1>=.3;41;*)=.3=9-*=+.8-.3,=.3):897>
= (_ ;-*7*=).)=>4:=,74<=:5=.+=7&.8*)=.3=&82&3.&
= )_ 4<=).)=>4:=+.789='*(42*=&<&7*=4+=9-*=&'&143*=+.8-*7>
= *_ 9.)=>4:=034<=&3>=49-*7=).;*78=&9=9-*=9.2*=9-&9=>4:=89&79*)
= 1_ ;-&9=8479=4+=*6:.52*39=).)=>4:=:8*=.3.9.&11>= &_ 7:3&'4:9=47=+.8-.3,='4&9
= '_ 4<=;*-.(1*
= (_ 9.)=>4:=:8*=&=)*(0-&3)=.3.9.&11>
= )_ 9.)=>4:=<470=+742=&3(-47*)='4&98=<.9-=143,=-48*8
= *_ ;*98:.9=:=-4<=).)=>4:=(45*=<.9-=(41)
= +_ ;*7*=>4:=9&:,-9=94=).;*=:=.+=84`='>=<-4
== ,_ ;*7*=>4:=&=).;*7=57.47=94=&'&143*=+.8-.3,
= 2_ ;-&9=<*7*=9>5.(&1=<*.,-98=9-&9=>4:=1&3)*)=.3=9-*=+30*8= &_ 9.)=<*.,-98=(-&3,*=,*9=82&11*7`=1&7,*7=.3=1&9*7=>*&78
= 3_ ;-4=).)=>4:=24891>=8*11=94
= +*_ ;-&9=57.(*=7&3,*=).)=>4:=7*(*.;*=+47=>4:7=+.8-
= ++_ ;-*7*=).)=>4:=89&79=+.8-.3,
= &_ ;-&9=7*,.43
= '_ ;-&9=94<3
= (_ ;-&9='&>8
= )_ ;-&9=)*59-8
= *_ ;*7*=49-*7=).;*78=<470.3,=3*&7'>
= +_ 3=-.3)8.,-9`=<&8=.9=&=,44)=51&(*=94=).;*=+47=&'&143*
= +,_ ;-*7*=).)=>4:=,*9=,44)=(&9(-*8=<-*3=>4:=+.789=89&79*)
= &_ O.89=51&(*8=<-*7*=>4:=(4:1)=&1<&>8=,*9=,44)=(&9(-*8= '_ O.89=51&(*8=9-&9=:8*)=94='*=,44)`=':9=89455*)='*.3,=84= ._ 9.)=&3>=4+=9-48*=51&(*8=*;*39:&11>=7*(4;*7
= .._ 4<=2&3>=>*&78=94=7*(4;*7>
= +-_ 9.)=>4:=349.(*=9-&9=+.8-.3,=.2574;*)=&3>=&7*&8=._*_=89&79*)='&)`=':9=9-*3= 574):(*)=+.8-
=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +/3 = =

+._ 9.)=+.8-.3,=2&0*=842*=&7*&8=<478*=.22*).&9*1>=:=>4:=+.8-*)=.9=43(*=&3)=.9= <&8=3*;*7=&3>=,44)=&+9*7
= +/_ 9.)=>4:=349.(*=9-&9=842*=&7*&8=4+=8(:3,>='49942=.3(7*&8*)
= +0_ ;-&9=8479=4+=)*59-=7&3,*=).)=>4:=(422431>=).;*=94
=97>.3,=94=*89&'1.8-=.+= *&71>=).;*78=+.8-*)=)**5*7=-&'.9&9=9-&3=1&9*7=).;*78= &_ =>';.4:81>=)*5*3)8=:543=<-*7*=>4:=+.8-*)_= '_ ;*7*=>4:=&++*(9*)='>=)*(4257*88.43=8.(03*88
= +1_ ,*&843&1=(-&3,*8=.3=(&9(-=7&9*8=:=<*7*=+&89=?4&89=(&9(-*8=&1<&>8=;&7.&'1*
= +2_ ;->=)4=+&89=?4&89=(&9(-*8=;&7>`=':9=349=;*89=?4&89
=

+0* = 74/*(9=34_=,**.2*+- = =

%55*3).==.= &'1*=4+=8:22&7.8*)=7*85438*8=94=6:*89.438= 6:*89.43= -= .= .= /=0&= 0'= 0(= 0)= 0*= 1&= 1'= 1(= 1)= 1*= 1+= 1,= = = 9.;*7= 9.&7>= ,9&79=>*&7= ,945=>*&7= ,*=&9=89&79= <->=&'&143*= ).;*= &2.1>= +.8-.3,
= &82&3.&3
= 4<= '*(&2*= &<&7*=&'&143*= 4+= +.8-.3,
E3*<= 49-*7= ).;*78
= 7:3&'4:9= 47= .8-.3,='4&9= 94<=;*-.(1*
= :8*= )*(0-&3)
= &3(-47*)= -48*8
:8*=<*98:.9
= 9&:,-9=).;*
= 94= 57.47=).;*7
= '4&982143,= *&71>=+= 34= +30.= +32.= ,.= &2&9*:7= 34= 34= &2&9*:7= 34= ).3,->= 349= 34= 83470* >*8= 34= >*8= ).;*7= ).;.3,= 94<*)= 1= *&71>=,= 34= +30/= +33+= ,.= &2&9*:7= 34= >*8= &2&9*:7= >*8= ).3,->= (&7= 34= >*8= >*8= >*8= ,5*&78 ).;*7= ).;.3,= +.8-.3,= *&71>=-= >*8= +300= +313= ,+= &2&9*:7= 34= >*8= +7.*3)8= >*8= ).3,->= ;&7.4:8= 34= >*8= >*8= 34= >*8= ).;*7= *&71>=.= 34= +303= +321= ,0= &2&9*:7= 34======).;*7= *&71>=/= 34= +303= +33+= ,-= C.(947.& 34= 34= &2&9*:7= >*8= 7:3&'4: /**5= >*8= >*8= >*8= 34= >*8= 3= &'= ).;.3,= 9= ).;*7= *&71>=0= >*8= +30/= +320= +3= &2&9*:7= 34= >*8= &2&9*:7= >*8= 8-47*8 = 34= = 34= 34= >*8= ).;*7= ).;.3,= '&8*)= *&71>=1= 34= +31*= +310= ,0= +7.*3)8= 34= >*8= +7.*3)8= >*8= +.8-.3,= = 34= >*8= >*8= 34= >*8= '4&9= *&71>=2= 34= +30/= +32,= -/= (-&3(*= 34= 34= +7.*3)8= >*8= +.8-.3,= = >*8= >*8= >*8= >*8= 34= '4&9= *&71>=3= 34= +30-= +30.= ,+= &2&9*:7= 34= 34= &2&9*:7= 34= 8-47*8 = 34= 34= 34= 34= >*8= ).;*7= ).;.3,= '&8*)= *&71>=+*= 34= +30-= +32-= +3= &2&9*:7= 34= 34= &2&9*:7= >*8= 8-47*8 = 34= 34= 34= 34= >*8= ).;*7= ).;.3,= '&8*)=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +0+ = =

= 6:*89.43= -= .= .= /=0&= 0'= 0(= 0)= 0*= 1&= 1'= 1(= 1)= 1*= 1+= 1,= = = 9.;*7= 9.&7>= ,9&79=>*&7= ,945=>*&7= ,*=&9=89&79= <->=&'&143*= ).;*= &2.1>= +.8-.3,
= &82&3.&3
= 4<= '*(&2*= &<&7*=&'&143*= 4+= +.8-.3,
E3*<= 49-*7= ).;*78
= 7:3&'4:9= 47= .8-.3,='4&9= 94<=;*-.(1*
= 88*= )*(0-&3)
= 3(-47*)= -48*8
88*=<*98:.9
= &:,-9=).;*
= 94= 7.47=).;*7
= '4&982143,= *&71>=++= >*8= +3/3= +32*= ,2= &2&9*:7= 34= 34= -74:,-= 34= = 34= =>*8= 34= >*8= ).;*7= &2&9*:7= 8-47*8 ).;.3,= '&8*)= *&71>=+,= >*8= +30/= = +1= <470= 34= >*8= +7.*3)8= 34= +.8-.3,= = 34= >*8= >*8= 34= 34= '4&9= *&71>=+-= 34= +3/2= +321= +2= +.8-.3,= >*8= >*8= +.8-.3,= 34= 8-47*8 = 34= =34= 34= ,5*&78 .3):897>= '&8*)= +.8-.3,= *&71>=+.= >*8= +303= +32.= = &2&9*:7= 34= 34= -74:,-= 34= 7:3&'4: 349= 34= >*8= >*8= 34= ,5*&78 ).;*7= &2&9*:7= 9= 94<*)= +.8-.3,= ).;.3,= *&71>=+/= 34= +30.= +312= ,.= (-&3(*= 34= 34= <*<88 34= +.8-.3,= = 34= >*8= >*8= 34= 34= 5&5*7= '4&9= *&71>=+0= >*8= +300= +322= +1= &2&9*:7= 34= 34= +7.*3)8= >*8= +.8-.3,= = 34= 83470* >*8= 34= ,5*&78 ).;*7= '4&9= 1= +.8-.3,======2.))1*=+= 34= +31/= ,**,= +1= +.8-.3,= >*8= >*8= +.8-.3,= >*8= 7:3&'4: 349= >*8= >*8= >*8= 34= 83470* .3):897>= 9= 94<*)= 1= 2.))1*=,= 34= +312= +331= ,/= +.8-.3,= >*8= >*8= +.8-.3,= >*8= 7:3&'4: 4>49&= >*8= 34= >*8= 34= >*8= .3):897>= 9= 2.))1*=-= 34= +31/= +323= ,,= +.8-.3,= 34= 34= +7.*3)8= >*8= 7:3&'4: 4>49&= >*8= 34= >*8= 34= >*8= 9= 2.))1*=.= 34= +31-= +33/= ,0= +7.*3)8= 34= 34= +7.*3)8= >*8= +.8-.3,= >*8= >*8= =34= 34= = '4&9= 2.))1*=/= 34= +310= +33.= ,*= +.8-.3,= 34= >*8= (-&3(*= 34= 7:3&'4: O&3)74;* 34= >*8= >*8= 34= 34= 9= 7=

+0, = 74/*(9=34_=,**.2*+- = =

= 6:*89.43= -= .= .= /=0&= 0'= 0(= 0)= 0*= 1&= 1'= 1(= 1)= 1*= 1+= 1,= = = 9.;*7= 9.&7>= ,9&79=>*&7= ,945=>*&7= ,*=&9=89&79= <->=&'&143*= ).;*= &2.1>=+.8-.3,
= &82&3.&3
= 4<=&<&7*= '*(&2*= &'&143*=+.8-.3,
= 4+= E3*<=).;*78
= 49-*7= 7:3&'4:9=.8-.3,='4&9= 47= -48*8
88*=<*98:.9
= &:,-9=94=).;*
= 7.47=).;*7
= 88*=)*(0-&3)
= 3(-47*)= '4&982143,=

2.))1*=0= 34= +312= +33.= ,*= +.8-.3,= 34= >*8= (-&3(*= 34= 7:3&'4: O&3)74;*94<=;*-.(1*
34= >*8= >*8= 34= >*8= 9= 7= 2.))1*=1= 34= +32*= +330= -2= +.8-.3,= 34= 34= (-&3(*= >*8= 7:3&'4: 4>49&= >*8= 34= >*8= >*8= >*8= 9======(:77*39=+= 34= +33-= = ,1= +.8-.3,= 34= = +.8-.3,= >*8= 7:3&'4: 4>49&= >*8= 34= >*8= 34= >*8= .3):897>= 9= (:77*39=,= 34= ,***= = ,/= +.8-.3,= 34= 34= (-&3(*= >*8= ).3,->= =>*8= 34= >*8= 34= = (:77*39=-= 34= +33.= = -*= +.8-.3,= >*8= >*8= +.8-.3,= >*8= 7:3&'4: =>*8= 34= =34= = .3):897>= 9= (:77*39=.= >*8= +320= = ,2= (-&3(*= 34= 34= +7.*3)8= >*8= 7:3&'4: 4>49&= >*8= 34= )7>8 34= >*8= 9= 8:.9= (:77*39=/= 34= +33.= = -/= +.8-.3,= >*8= 34= +.8-.3,= >*8= 7:3&'4: 4>49&= >*8= 34= >*8= 34= >*8= .3):897>= 9= (:77*39=0= 34= +322= = -.= +.8-.3,= 34= >*8= +.8-.3,= >*8= 7:3&'4: 4>49&= >*8= 34= >*8= 34= >*8= .3):897>= 9= (:77*39=1= 34= ,**-= = --= +.8-.3,= 34= >*8= +.8-.3,= >*8= ).3,->= = >*8= 34= >*8= 34= >*8= .3):897>= (:77*39=2= 34= +332= = ,.= +.8-.3,= >*8= >*8= +.8-.3,= >*8======.3):897>= (:77*39=3= 34= +33,= = -,= +.8-.3,= 34= >*8= +.8-.3,= >*8= 7:3&'4: 4>49&= >*8= 34= >*8= 34= >*8= .3):897>= 9= (:77*39= 34= +332= = .-= +.8-.3,= 34= >*8= +.8-.3,= >*8= 7:3&'4: 4>49&= >*8= 34= >*8= 34= >*8= +*= .3):897>= 9=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +0- = =

= == 6:*89.4 2=2&= 3= +*= ++=+,&= +,'= +,'.= +,'..= +-= +.= +/=+0&= +0'= +1= +2= 3= = = = (&9(-*8= <->= 34= ;&7.&'.1.9 >= .3= 9.;*7= 9>5.(&1= <*.,-98= <*.,-98= (-&3,*
= 574(*8847
= 57.(*
= <-*7*=).)= >4:= 89&79= +.8-.3,
= 51&(*8= &1<&>8= ,44)
= 51&(*8= ,44)= ':9= ,49=<478*= 51&(*8= 9-&9= 7*(4;*7*) >*&78= 94= 7*(4;*7>= 51&(*8= 9-&9= .2574;*)= .22*).&9 *=*++*(9= .3(7*&8*= 4+= 8(:3,>= )*59-= 7&3,*= +.8-*)
&++*(9*)= +&89= ?4&89= '49942
'>=9?,
= *&71>=+= 0**= 82&11* 0)21'= 94;*7= (9&*43 = = = 14(0=,,= >*8= >*8= 0.*= 34= >*8= = 7= 8= +**9= 94;*7= .8-*7. *&71>=,= -**8 = 0)21'= ,4:9-= 94;*7= E*11>8= = = 34= >*8= >*8= 0.*= &.7= >*8= 8= 8<*11= .**= 74(08`= +**9= *2'8 944= 0**58= &797.), 41.8 2:(-= <**)= *=8= 2= <**)= (4;*7=

,&+(41`= 1&3*9= )4<3= *&71>=-= ,**= 34= 2&3 +*)8 7:3>= 5&7.43= = 543:8 +*= 5:3748== = >*8= 8-&114 34= >*8= 8<*11= >= 21'= &>= 2*39= >*&78= <= 0**58= &>`= <**)= *11+.7 (4;*7= *=1:++= )4<3= *&71>=.= = = = = +&89= .(-*34= .(-*34= = = 34= 34= 34= 8-&114 34= >*8= 8= 8<*11= ?4&89= <= 944= 0**58= 2:(-= <**)= <**)= (4;*7= )4<3= *&71>=/= -**8 = = +&89= 94:,-8 ;= ]= <= = = 34= 34= 34= &11= 34= >*8= = .**= ?4&89= '4>8`= 8.)*8= )*59-8= 5*77.(08 5&7&:)= `= D*47,*= 8`= 74(08= 38438`=

,&+(41= D&7)*38=

+0. = 74/*(9=34_=,**.2*+- = =

*&71>=0= ,**= '.,,*7= ,?= 0)21'= = 84:9-= =D:1(-`= 5(O*&3= = = 34= >*8= >*8= 8-&114 >*8= >*8= 8= 1*88= *&89= ,*>24:7 &>= <= &'8= ,4= (7>59.(= `= 7**+8= :3)*7= -&'.9&9= *251*8 74(08= 94<*=*9(= 6:*89.4 2=2&= 3= +*= ++=+,&= +,'= +,'.= +,'..= +-= +.= +/=+0&= +0'= +1= +2= 3= = = = 9.;*7= 9>5.(&1= <*.,-98= <*.,-98= (-&3,*
= 574(*8847
= 57.(*
= <-*7*=).)= >4:= 89&79= +.8-.3,
= 51&(*8= &1<&>8= ,44)
= 51&(*8= ,44)= ':9= ,49=<478*= 51&(*8= 9-&9= 7*(4;*7*) >*&78= 94= 7*(4;*7>= 51&(*8= 9-&9= .2574;*)= .22*).&9 *=*++*(9= .3(7*&8*= 4+= 8(:3,>= )*59-= 7&3,*= +.8-*)
&++*(9*)= +&89= ?4&89= (&9(-*8= <->= 34= ;&7.&'.1.9 >= .3= '49942
'>=9?,
= *&71>=1= ,/*= 34= .*(8 +&89= ,*>24:7 5(O*&3= 3*;*7= = 34= >*8= 34= ./8/*= 34= >*8= = 21'= ?4&89= `=:,-*8= &>= 94= +**9= 7**+8`= +472*7= 7.*3)1>= *=9*39=

1:*=<&9*78= *&(-*8= *&71>=2= -**8 = ,?= +821'= ,9472= ;*),*= 7*)*7.( = 143,= =>*8= = 00*= 34= >*8= = .**= &>= &>= 0= *37>= 9.2*= +**9= &>=

*&71>=3= ,**8 = ,?= 0)21'= +&89= D:1(-`======,*8-*= >*8= = = -**= ?4&89= 7.(*= +**9= *''1*`= ?4)= 74(0= *&71>=+*= ,**8 82&11* 1)21'= ,9472= ;*),*= &74:3)= = ,8+*= 34= 34= >*8= 0+,*= 34= >*88= 8<*11= -/*= 7= &>= &>`= 94;*7`= >*&78= +**9= <**)= 0**58= D4&9= D&7)*38= <**)= .118`= (4;*7= (9&*43 )4<3=

;&7.4:8= 8=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +0/ = =

*&71>=++= 0**= 82&11* 0)21'= ,9472= 9= 479= = =34= 34= >*8= 0+**= >*8= >*8= 8= 8<*11= 7= &>= 79-:7`= 79-:7= +**9= 944= 0**58= ;*),*`= 2:(-= <**)= .7&9*8`= <**)= (4;*7= 5&7.43= )4<3=

;&7.4:8= &>8= *&71>=+,= 0/**= +1:(9:& +*)8 <479-= <479-= .+= ,44)= = = 34= +1&9= 8*&843&1 = 0+*2= 34= >*8= 8= 8<*11= 9*)= 21'= +&89= +&89`= &1<&>8= 7**+8= 944= 0**58= ,9472= ,44)= 2:(-= <**)= &>= <**)= (4;*7=

;&7.4:8= )4<3= 6:*89.4 2=2&= 3= +*= ++=+,&= +,'= +,'.= +,'..= +-= +.= +/=+0&= +0'= +1= +2= 3= = = = >*&78= 94= 7*(4;*7>= 51&(*8= 9-&9= .2574;*)= .22*).&9 *=*++*(9= .3(7*&8*= 4+= 8(:3,>= )*59-= 7&3,*= +.8-*)
&++*(9*)= +&89= ?4&89= (&9(-*8= <->= 34= ;&7.&'.1.9 >= .3= 9.;*7= 9>5.(&1= <*.,-98= <*.,-98= (-&3,*
= 574(*8847
= 57.(*
= <-*7*=).)= >4:= 89&79= +.8-.3,
= 51&(*8= &1<&>8= ,44)
= 51&(*8= ,44)= ':9= ,49=<478*= 51&(*8= 9-&9= 7*(4;*7*) '>=9?,
= '49942
*&71>=+-= = ,?= -)21'= 94;*7= (9&*43 '&>8= .3= = = 34= 34= 34= &11= >*8= = = 8== ,4:9-= )*59-8= )*5*3)*)= 43=2&70*9= *&71>=+.= -**8 +1:(9:& ++(8 <479-= D*47,*= &3(>= = = 34= >*8= = 8-&114 34= >*8= 8= 8<*11= .**= 9*)= 21'= +&89= 74(08`= 7**+`= <= &'8= ,4= 0**58= &7<&>`= D&7)*38= :3)*7= <**)= 94:,-8 74(08`= (4;*7=

9<>*78= '4>8= <**)= )4<3= *&71>=+/= +/*8 '.,,*7= = ,4:9-= = 3&774<= = =34= >*8= >*8= -*8-/= 34= >*8= <&;*8`= +2*= '49942= +**9= *=5488 :7*= 94;*7= .8-*7.*8= *&71>=+0=,**='.,,*7======34= = =

======

+00 = 74/*(9=34_=,**.2*+- = =

2.))1*= ,**= '.,,*7= 3/(8 14<*7= D4&9= &11= D4&9= -8.= ,4:9-*71 >*8= 34= 0,/= >*8= >*8= 8= = += 20,= +&89= .118`= 51&(*8= .118= >*&78= >= 7**+8= 2*97*8= &'8= ,4= ?4&89= C.8(-*7= -&;*= 4++= 49942= :3)*7= 81&3)`= 5*7.4)8= 74(08`= O&,443= <**)=

C.(947.&= ?&33.3,=?4>= &>= 2.))1*= 3*8 +1:(9:& N,_+* ,4:9-= (9&*43 = = = 34= >*8= 34= 8-&114 >*8= >*8= 8= = ,= .**= 9*)= 20,= 8= <= &'8= ,4= 94= 8.)*8= 4+= 74(08`=

4=&118= <**)= 6:*89.4 2=2&= 3= +*= ++=+,&= +,'= +,'.= +,'..= +-= +.= +/=+0&= +0'= +1= +2= 3= = = = >*&78= 94= 7*(4;*7>= 51&(*8= 9-&9= .2574;*)= .22*).&9 *=*++*(9= .3(7*&8*= 4+= 8(:3,>= )*59-= 7&3,*= +.8-*)
&++*(9*)= +&89= ?4&89= (&9(-*8= <->= 34= ;&7.&'.1.9 >= .3= 9.;*7= 9>5.(&1= <*.,-98= <*.,-98= (-&3,*
= 574(*8847
= 57.(*
= <-*7*=).)= >4:= 89&79= +.8-.3,
= 51&(*8= &1<&>8= ,44)
= 51&(*8= ,44)= ':9= ,49=<478*= 51&(*8= 9-&9= 7*(4;*7*) '>=9?,
= '49942
2.))1*= +/*8 34= = <479-= .3&143,= D&7)*38`= D&7)*38`= = 34= 34= 34= )**5*7=>*8= = = -= ,**= +&89= &>= 94= .3&143,= .3&143, D*47,*= &>=

,&+(41= 74(08= 2.))1*= ,**8 = = = ;*89= *;*7>8 2489= ,*9= 2489= =34= 34= =0,/= 34= >*8= = .= -**= ?4&89= <-*7*= <478*= 2*97*8= <-*3= +.8-*)= 944= -&7)= 2.))1*= ,,*8 34= = N+_,* <479-= D&7)*38`= = = = 5&7.&= 34= =0-*= 34= >*8= 8= 8<*11= /= ,/*= 20,= +&89= D*47,*= 81&3)= +**9= <**)= 0**58= 74(08= (4;*7= <**)= )4<3=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +01 = =

2.))1*= ,,*8 34= = N+_,* <479-= D&7)*38`======>*8= 0-*= 34= >*8= 8= 8<*11= 0= ,/*= 20,= +&89= D*47,*= +**9= <**)= 0**58= 74(08= (4;*7= <**)= )4<3= 2.))1*= ,**8 82&11* = = ,4:9-= 9+397*( 3&774<= = =34= 34=>*8= = = = = 1= -**= 7= &89*&:== '49942= ?-&33*1`= 84:9-*73= '&>8= = 6:*89.4 2=2&= 3= +*= ++=+,&= +,'= +,'.= +,'..= +-= +.= +/=+0&= +0'= +1= +2= 3= = = )*59-= 7&3,*= +.8-*)
&++*(9*)= +&89= ?4&89= (&9(-*8= <->= 34= ;&7.&'.1.9 >= .3= 9.;*7= 9>5.(&1= <*.,-98= <*.,-98= (-&3,*
= 574(*8847
= 57.(*
= <-*7*=).)= >4:= 89&79= +.8-.3,
= 51&(*8= &1<&>8= ,44)
= 51&(*8= ,44)= ':9= ,49=<478*= 51&(*8= 9-&9= 7*(4;*7*)= >*&78= 94= 7*(4;*7>= 51&(*8= 9-&9= .2574;*)= .22*).&9 *=*++*(9= .3(7*&8*= 4+= 8(:3,>= '49942
'>=9?,
= (:77*39= -**= +1:(9:& = = <479-= D&7)*38 38438`= D&7)*38= = 34= 34= >*8= &11= 34= >*8= 8= 8<*11= += 9*)= +&89= `= D*47,*= D&7)*38 )*59-8= <**)= 0**58= 74(08`= `= 7*)= (4;*7= <**)= +))>894 74(08`= )4<3= 3*= *''1>= (:77*39= ,**= = = ,4:9-= (9&*43 (9&*43 >*8= -8.= 7*&08= 34= >*8= &11= 34= = = ,= 8= 8= >*&78= )*59-8= ;&7.4:8= (:77*39= ,**= = = ,4:9-= (9&*43 (9&*43 >*8= -8.= 34= 34= 34= 0,*= 34= = = -= 8= 8= >*&78= 2*97*8= ;&7.4:8=

+02 = 74/*(9=34_=,**.2*+- = =

(:77*39= = = N38 <479-= D&7)*38 38438`= = = +&89= >*8== 349= 0,*= 34= >*8= 8= = .= N+.8 +&89= `= D*47,*= D&7)*38 ?4&89= 349.(* 2*97*8= &'8= ,4= 20,= 74(08`= `=,1445= +33*8= )= :3)*7= +))>894 74(08`=

,&+(41= 3*= <**)= (:77*39= ,/*8 34= = = <479-= ,*>24: D&7)*38 7*>(.3* 7.*3) 34= 34= 34= 8-&114 34= >*8= 8= = /= -/*= +&89= 7= `= 3479-= 9= 81>= <= &'8= ,4= 5&79= 4+= 4.39`= 24891>= :3)*7= 7*>(.3* 7438 74(08`= 9= -4:8*= <**)= (:77*39= = = = (9&*43 = .8-*78= 8&2*= ,=>*&78= 34= 34= >*8= 8= 0+*= 34= >*8= 8= 8<*11= 0= 8= 4.39= 8*&843 2*97*8= 944= 0**58= &+9*7= &= &1= 2:(-= <**)= 89472= <**)= (4;*7=

94;*7= .8-*7.*8= )4<3= 6:*89.4 2=2&= 3= +*= ++=+,&= +,'= +,'.= +,'..= +-= +.= +/=+0&= +0'= +1= +2= 3= = = )*59-= 7&3,*= +.8-*)
&++*(9*)= +&89= ?4&89= (&9(-*8= <->= 34= ;&7.&'.1.9 >= .3= 9.;*7= 9>5.(&1= <*.,-98= <*.,-98= (-&3,*
= 574(*8847
= 57.(*
= <-*7*=).)= >4:= 89&79= +.8-.3,
= 51&(*8= &1<&>8= ,44)
= 51&(*8= ,44)= ':9= ,49=<478*= 51&(*8= 9-&9= 7*(4;*7*)= >*&78= 94= 7*(4;*7>= 51&(*8= 9-&9= .2574;*)= .22*).&9 *=*++*(9= .3(7*&8*= 4+= 8(:3,>= '49942
'>=9?,
= (:77*39= = = 7&15 = (9&*43 = = = =34= 34= >*8= &11= 34= = = 1= -8= 8= )*59-8=

(:77*39= = = = = <479-= = 7&301.3= 2&3>= 349= = =>*8= &11= 34= = = 2= +&89= ,4:3)= 51&(*8=.3= 7*(4;* )*59-8= 7&301.3= 78*)= ,4:3)= (:77*39= ,/*8 = = =(9&*43 (9&*43 (9&*43 (9&*43 -8.= = 34= >*8= &11= 34= >*8= <&;*8= 3= -**= 8= 8`=7:3>= 8= 8= >*&78= )*59-8= 0**5= 0*15= )4<3=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +03 = =

(:77*39= ,**8 82&11* = = .(-*34= ,*>24: .(-*34= 842*= +8+*= 34= 34= >*8= /8+*= 34= >*8= 8= 8<*11= +*= -**= 7= &+9*7= 7= 5&798= 4+= >*&78= 2*97*8= 944= (:98= ,***= .(-*34= 2:(-= <**)= <**)= '&(0=

+1* = 74/*(9=34_=,**.2*+- = =

%55*3).==/=
&58=4+=9-*=+.;*='14(08=8-4<.3,=51&(*8 3&2*8=7*+*77*)=94=.3=9*=9= ,14(0=+-=

=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +1+ = =

,14(0=+.=

= ,14(0=,-=

= =

+1, = 74/*(9=34_=,**.2*+- = =

,14(0=,2=

= ,14(0=-*=

=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +1- = =

%55*3).==0= %=241*(:1&7=&5574&(-=94=.)*39.+>=57*>=4+= 9-*=84:9-*73=74(0=14'89*7= =

.__=/*)) +`- $`=_!_=0&72&3 2`=_-_=*7:8-*7 -=&3)=+_/_=04-3843 +=

1School of Zoology, 83.;*78.9>=4+=&82&3.&`=7.;&9*=&,=/`=4'&79`=,=1**+`=:897&1.&a= 29*5&792*39=4+=9-*=+3;.7432*39=&3)=*7.9&,*`=:897&1.&3=39&7(9.(=9.;.8.43`=,*-= ?-&33*1=.,-<&>`=E.3,8943`=,= 1*/*`=:897&1.&a= 3&82&3.&3=6:&(:19:7*=&3)=.8-*7.*8=389.9:9*` 5&7.3*=7*8*&7(-= O&'47&947.*8`=83.;*78.9>=4+=&82&3.&`=7.;&9*=&,=.3`=4'&79`=,=1**+`=:897&1.&= =

%'897&(9= ;*=)*243897&9*=9-*=:8*=4+=241*(:1&7=9*(-3.6:*8=94=)*9*(9=85*(.+.(=57*>=(438:2*)='>= 9-*=84:9-*73=74(0=14'89*7= &8:8=*)<&7)8.. _==6:.(0=&3)=34381*9-&1=2*9-4)=<&8=:8*)=94= (411*(9=74(0=14'89*7=+&*(&1=2&9*7.&1=&3)=&=241*(:1&7=57494(41=<&8=*2514>*)=94=.841&9*= 57*>= 9<= +742= +&*(&1= 8&251*8_= -*= .841&9*)= 9<= <&8= &251.+.*)= :8.3,= 9-*= 541>2*7&8*= (-&.3= 7*&(9.43= ?7= <.9-= ?7= 57.2*78= )*8.,3*)=94=9&7,*9=85*(.+.(=57*>= .9*28_=**).3,=*=5*7.2*398=)*9*72.3*)=9-&9=9<=+742='1&(081.55*)=&'&143*= &1.49.8= 7:'7& =&3)=8*&=:7(-.38= *397489*5-&3:8=74),*78..= &3)= *1.4(.)&7.8=*7>9-74,7&22& =(&3='*= )*9*(9*)=.3=74(0=14'89*7=+&*(&1=8&251*8=<.9-.3=8*;*3=-4:78=&3)=7*2&.38=57*8*39=+47=:5= 94=0*=-=&+9*7=.3,*89.43_== ((*59*)=-=9*(*2'*7=,**1= ,**2=?&2'7.),*=83.;*78.9>=7*88= = .*><47)8a= &8:8= *)<&7)8..`= &1.49.8= 7:'7&`= 541>2*7&8*= (-&.3= 7*&(9.43= ?7`= 57*>= )*9*(9.43`=74(0=14'89*7=).*9= = $:9-47=+47=(477*8543)*3(*= &=a=(0+=-=0,,0=,1./= +82&.1a=087*)) :9&8_*):_&:= =

73974):(9.43= 3=2&3>=3*&788-47*=9*25*7&9*=7**+=*(48>89*28`=74(0=14'89*78=&7*=&=)42.3&39=57*)&947= *++*(9.3,= &= 9458)4<3= (439741= 4+= '*39-.(= (422:3.9>= 897:(9:7*= &77= *9= &1 _`= +330b= 5&>+.*1)=]=7&3(-`=,***b=,-*&78=]=&'(4(0`=,**-_=4<*;*7`=)*9&.1*)=034<1*),*=4+=

+1. = 74/*(9=34_=,**.2*+- = =

74(0= 14'89*7= ).*98= &3)= 85&9.&1= &3)= 9*2547&1= ;&7.&'.1.9>= .3= ).*9= .8= :3034<3_= -.8= .3+472&9.43= .8=(7:(.&1= 94=.3+472*)=2&3&,*2*39=&9=&3=*(48>89*2=1*;*1=4+=74(0>=7**+8= &3)= 9-*= .25479&39= +.8-*7.*8= 9-*>= 8:55479_= -*= *89&'1.8-2*39= 4+= 3489&0*= 2&7.3*= 5749*(9*)=&7*&8=58`=<-*7*=(422*7(.&1=&3)=7*(7*&9.43&1=+.8-.3,=.8=574-.'.9*)`=-&8= 574;.)*)=&=:8*+:1=7*84:7(*=+47=243.947.3,=4+=0*>=9*25*7&9*=7**+=47,&3.828=+),&7= *9= &1 _`= +331_= -.8= -&8= 7*(*391>= 1*)= 94= 85*(:1&9.43= 9-&9= 84:9-*73= 74(0= 14'89*7=  &8:8= *)<&7)8.. =57*)&9.43=2&>=:3)*75.3=&3=&55&7*39=)*(7*&8*=.3=)*38.9.*8=4+=>4:3,=&'&143*= <.9-.3= 9-*= &82&3.&3= 58= +),&7= ]= &77*99`= +333b= &77*99= *9= &1 _`= ,**-_= ?:77*391>`= 9-*7*=.8=34=2*9-4)=94=9*89=9-.8=.)*&=47=94=*;&1:&9*=9-*=57*)&9.43=5&99*738=4+=84:9-*73= 74(0=14'89*78=.3=9-*=<.1) . :79-*7247*`=9-*8*=&7*='49-=-.,-=;&1:*=+.8-*7>=85*(.*8=&3)`= 9-:8`=&3=.39*7*89.3,=9745-.(=.39*7&(9.43=94=243.947_

7*;.4:8=7*8*&7(-=43=57*)&947:57*>=7*1&9.438-.58=4+=(7:89&(*&38=-&8=1&7,*1>=.3;41;*)= ,:9=).88*(9.43=&3)=7*1.*)=43=;.8:&1=&3&1>8.8=94=.)*39.+>=57*>=7*2&.38=.(02&3`=+3./b= .*1)*7`=+30/b=+33.8`=+31-b=B*73&04++= *9=&1 _`=+33-b=5&>+.*1)= *9=&1 _`=,***(_=-.8=&5574&(-= -&8= 8-4<3= 9-&9= 9-*= ).*9= 4+= 14'89*78= ;&7.*8= <.)*1>= <.9-= 8*&843= &3)= 9-&9= 14'89*78= &7*= 8*1*(9.;*=+**)*78=B411=]=-.11.58`=+32.b=&70&.= *9=&1 _`=+330b=5&>+.*1)= *9=&1 _`=,***&`'_=-*= 5->8.(&1= 574(*88= 4+= ).,*89.43`= -4<*;*7`= 2&0*8= ;.8:&1= &88*882*39= 4+= ,:9= (439*398= ).++.(:19`= &3)= ,:9= (439*39= &3&1>8.8= -&8= 2&3>= '.&8*8= ):*= 94= ;&7>.3,= 7&9*8= 4+= ,:9= 7*9*39.43`=).,*89.43=&3)=*748.43=4+=57*>=2&9*7.&1_=-*=(411*(9.43=4+=+47*,:9=(439*398=+47= .385*(9.43= &184= 3*(*88.9&9*8= 9-*= 2479&1.9>= 4+= 9-*= 89:).*)= 14'89*7= .(02&3`= +3./b= ;.11.&28`=+32+b=B411=]=-.11.58`=+32.b=B*73&04++= *9=&1 _`=+33-b=5&>+.*1)= *9=&1 _`=,***&`(=84= 9-&9= 1&7,*88(&1*= 8:7;*>8= &7*= 574'1*2&9.(_= E.11.3,= &3.2&18= 94= .)*39.+>= 57*>= .8= &184= :31.0*1>=94='*=&((*59&'1*=.+=9-*=89:)>=545:1&9.43=7*8.)*8=.3=&3=5=;&7)= *9=&1 _`=,**+_= C.8:&1=.385*(9.43=4+=,:9=(439*398=.8=034<3=94=2.88=84+98'4).*)=57*>=47,&3.828`=8:(-= &8= &'&143*= &3)= 49-*7= ,&897454)= 2411:8(8`= &3)= 2&>= 7*8:19= .3= :5= 94= 3*= 4+= 9-*= ,:9= (439*398= '*.3,= :3.)*39.+.&'1*= 5&>+.*1)= *9= &1 _`= ,***(_= <4381*9-&1= 9*(-3.6:*8= 94= )*9*72.3*=).*9&7>=.39&0*=&7*=*88*39.&1='*(&:8*=4+=9-*=-.,-=;&1:*=4+=1.;*=74(0=14'89*78=.3= 9-*=(422*7(.&1=+.8-*7>=&3)=94=*3&'1*=43,4.3,=<470=.38.)*=58_= = 47= 2489= 2&7.3*= 57*)&9478`= :3'.&8*)= .)*39.+.(&9.43= 4+= 57*>= .8= 574'1*2&9.(`= ':9= 3*<= 57494(418= &7*= *2*7,.3,= 9-&9= &114<= 9-*= :3&2'.,:4:8= )*9*(9.43= 4+= 57*>= 85*(.*8= .3= 57*)&947= ).*98_= 7*(*39= &);&3(*8= .3= 241*(:1&7= '.414,>= -&;*= '**3= :8*)= 94= *1:(.)&9*= ).*98=4+=&3.2&18=.3=&=<.)*=7&3,*=4+=9&=4342.(=,74:58`=8:(-=&8=+.8-=748*1=]=E4(-*7`= ,**,`=,.&39=86:.)=9*&,1*= *9=&1 _`=,**/&`=<&858=E&85*7= *9=&1 _`=,**.`=85.)*78=,:89.= *9= &1 _`=,**-=&3)=*;*3=.3974):(*)=.38*(98=(&5&'1*=4+=+47&,.3,=.3=3&9.;*=+47*898=,-*55&7)= *9=&1 _`=,**._=541*(:1&7=9*(-3.6:*8=9&0*=&);&39&,*=4+=:3.6:*=9<=8*6:*3(*8=.3=85*(.*8= 47= .3= ,74:58= 4+= 47,&3.828= &3)= (&3= 574;.)*= )*9&.1*)= &3)= 57*(.8*= .3+472&9.43= &'4:9= 57*)&947:57*>= 7*1&9.438-.58= ,:89.= *9= &1 _`= ,**-b= <*/89,&&7)= *9= &1 _`= ,**-b= B&72&3= ]= ;.1843`=,**.b=9*&,1*= *9=&1 _`=,**/&b=B:*3=]=7&:,499`=,**/_= = 3=9-*=2&7.3*=*3;.7432*39`=57494(418=-&;*='**3=)*;*145*)=8:((*88+:11>=94=.841&9*=57*>= 9<=+742=9-*=+&*(*8=4+=57*)&9478=<*/89,&&7)= *9=&1 _`=,**-b=B&72&3= *9=&1 _`=,**.b=9*&,1*= *9=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +1/ = =

&1 _`= ,**/'b= C*89-*.2= *9= &1 _`= ,**/_= -*= 9<= .8= &251.+.*)= :8.3,= 541>2*7&8*= (-&.3= 7*&(9.43=?7=<.9-=85*(.+.(=57.2*78=9-&9=9&7,*9=,*3*=7*,.438=4+=57*>=85*(.*8=B&72&3= *9= &1 _`=,**.b=,-*55&7)=]=&7<44)`=,**/_=-*=9*(-3.6:*8=)*;*145*)=-&;*=8-4<3=9-&9=9-*= .)*39.9>=4+=57*>=85*(.*8=(&3='*=:3&2'.,:4:81>=)*9*(9*)=.3=9-.8=2&33*7=,>243)843`= ,**,_==2&/47=.3(*39.;*=+47=)*;*1452*39=4+=3438.3;&8.;*=9*(-3.6:*8=&8=&3=&19*73&9.;*= 94= ).7*(9= 8942&(-= (439*39= &3&1>8.8= -&8= '**3= 94= &114<= 9-*= 34381*9-&1= 89:)>= 4+= *3)&3,*7*)= 47= 5749*(9*)= &3.2&1= 85*(.*8= 9*&,1* = *9= &1_ `= ,**/'b= &77*11 = *9= &1_ `= ,***b= B&72&3 =*9=&1_ `=,**,b=B&72&3 =*9=&1_ `=,**.b=B&72&3=]=;.1843`=,**.b=,>243)843`=,**,_= = 3= &82&3.&`= 14'89*78= &7*= 9-*= '&8.8= +47= &= 1:(7&9.;*= (422*7(.&1= +.8-*7>= <-*7*= +.8-*78= 1&3)=&3)=8*11=9-*.7=14'89*78=1.;*=94=).8(*73.3,=)42*89.(=&3)=.39*73&9.43&1=2&70*98_=47= +.8-*78=94=8:55479=4:7=7*8*&7(-`=.9=<&8=3*(*88&7>=94=4'9&.3=).*9&7>=.3+472&9.43=<-.1*= 89.11=1*&;.3,=9-*=14'89*78=.3=5*7+*(9=(43).9.43=+47=8:'8*6:*39=8&1*_=-*=(&5&(.9>=94=:8*= &3.2&18= (&:,-9= .3= 97&58= <&8= &184= .25479&39= 94= *3&'1*= 7*8*&7(-*78= 94= 4'9&.3= 8&251*8= &'4&7)= (422*7(.&1= 74(0= 14'89*7= +.8-.3,= ;*88*18`= 94= &((*88= 7*249*= &7*&8= 4+= 14'89*7= -&'.9&9= &3)= 94= 4'9&.3= &3.2&18= +742= )**58<&9*7= 7**+8= 4:98.)*= 89&3)&7)= 8(:'&= ).;.3,= )*59-8_== = -*=&.28=4+=9-.8=5&5*7=<*7*=9-7**+41)_=.789`=<*=)*243897&9*)=&=34381*9-&1=&5574&(-= 94=4'9&.3.3,=).*9&7>=8&251*8b=8*(43)`=<*=)*9*72.3*)=.+=+&*(&1=2&9*7.&1=(4:1)='*=:8*)= 94=.)*39.+>=57*>=:8.3,=241*(:1&7=2*9-4)8b=&3)`=9-.7)`=<*=)*9*72.3*)=.+=9-*=143,*;.9>= 4+= 9-*= 9<= 8.,3&1= <&8= 8:++.(.*39= 94= .3(1:)*= 57*>= .9*28= +742= 14'89*78= 9-&9= <4:1)='*= 7*9&.3*)=.3=97&58=+47=:5=94=,.=-4:78_== =

&9*7.&18=&3)=2*9-4)8= ***).3,=97.&18= 74(0=14'89*78=+47=+**).3,=97.&18=<*7*=(&59:7*)='>=8(:'&=).;.3,=.3=9-*=?7&>+.8-=4.39= 5&7.3*=7*8*7;*=&9=&7443&`=&82&3.&=.,_3/J,`=+.1_-.J+=.3=57.1=,**.=&3)=5&>=,**/_= O4'89*78=<*7*=(411*(9*)=455479:3.89.(&11>`=*38:7.3,=&3=*;*3=).897.':9.43=4+=8*=*8=&3)=&= <.)*= 7&3,*= 4+= 8.?*8_= 11= (&59:7*)= 14'89*78= <*7*= 2*&8:7*)= &3)= (&7&5&(*= 1*3,9-= ?O= <&8=7*(47)*)=94=9-*=3*&7*89=2.11.2*97*_== = ?&59:7*)=14'89*78=<*7*=.22*).&9*1>=9&0*3=94=9-*=1&'47&947>=&3)=0*59=.3=&*7&9*)`=+14<8 9-74:,-= 8*&<&9*7= 9&308_= 47= 9-*= ):7&9.43= 4+= 9-*= +**).3,= 97.&18`= 14'89*78= <*7*= 2&.39&.3*)= :3)*7= &2'.*39= 1.,-9= (43).9.438= &3)= <&9*7= 9*25*7&9:7*8= .3= 4:9)447= &6:&7.&=&9=9-*=5&7.3*=7*8*&7(-=O&'47&947.*8`=&7443&`=&82&3.&_== = 47=*&(-=97.&1`=9-*=14'89*78=<*7*=51&(*)=.3=43*=8*(9.43=4+=&=./*81.97*=9&30=8*5&7&9*)=.394= 9-7**=8*(9.438=<.9-=51&89.(=2*8-=&3)=).;.)*78_=+&(-=14'89*7=<&8=574;.)*)=<.9-=&=.**= 22=,=,**=22=(43(7*9*='14(0=&8=&=8-*19*7_=11=14'89*78=<*7*=89&7;*)=+47=1,=-4:78=57.47= 94= *&(-= +**).3,= 97.&1= 94= +&(.1.9&9*= ,:9= *;&(:&9.43= &3)= 94= 7*24;*= &3>= 7*2&.3.3,= 57*>= 9<= +742= 9-*= ).,*89.;*= 97&(9_= 47= *&(-= 97.&1`= &5574=.2&9*1>= +/= ,7&28= 4+= +7*8-= +44)=

+10 = 74/*(9=34_=,**.2*+- = =

2&9*7.&1= <&8= ,.;*3= 94= *&(-= 14'89*7_= -.8= 2&9*7.&1= <&8= 57*5&7*)= '>= 8-:(0.3,= 1.;*= &'&143*=  &1.49.8= 7:'7& = &3)= (:99.3,= 9-*= +449= 9.88:*= .394= &5574=.2&9*1>= +/8,7&2= 5479.438_= ?42243= 8*&= :7(-.38=  *1.4(.)&7.8= *7>9-74,7&22& = &3)= 143,885.3*)= 8*&= :7(-.38=  *397489*5-&3:8= 74),*78..= <*7*= 8-:(0*)= &1.;*= &3)= &5574=.2&9*1>= +/8,7&2= 5479.438=4+=74*=&3)=;.8(*7&=<*7*=:8*)=&8=+44)_=44)=<&8=.3974):(*)=94=*&(-=14'89*7=&9= +1**=-4:78=&3)=.3).;.):&1=14'89*78=<*7*=243.947*)=+47=+**).3,=&(9.;.9>_=>31>=14'89*78= 9-&9=&(9.;*1>=+*)=&3)=(438:2*)=9-*=*39.7*=+44)=8&251*=<.9-.3=9-*=+.789=-4:7=<*7*=:8*)= .3=9-*=+**).3,=97.&18_=<4=&)).9.43&1=+44)=<&8=574;.)*)=94=14'89*78=+47=9-*=):7&9.43=4+= 9-*=97.&1=&3)=*&(-=14'89*7=<&8=8&251*)=43(*=5*7=+**).3,=97.&1_=O4'89*78=<*7*=8*1*(9*)= +47=+&*(&1=(411*(9.43=4;*7=9-*=3*=9=+.;*=)&>8=&9=9-*=9.2*8=-4:78=&+9*7=(422*3(*2*39=4+= +**).3,= ,.;*3= .3= &'1*= +._= O4'89*78= <*7*= 8*1*(9*)= 7&3)421>= 94= *1.2.3&9*= &3>= 9&30= *++*(9_=47=*&(-=8&251.3,=9.2*`=+&*(&1=2&9*7.&1=<&8=(411*(9*)=+742=&=2.3.2:2=4+=9-7**= 8*5&7&9*= 14'89*78_= 47= *&(-= 4+= 9-*= .3).;.):&1= +&*(&1= 8&251*8`= ?7= &88&>8= <*7*= 5*7+472*)=9<.(*=94=,:&7&39**=9-*=(438.89*3(>=4+=9-*=7*8:19_=-*8*=+**).3,=*=5*7.2*398= <*7*=7*5*&9*)=4;*7=&=5*7.4)=4+=0/=)&>8=<.9-=++0=+&*(&1=8&251*8=(411*(9*)=.3=949&1_== 949&1= 4+= 0+= 14'89*78= <*7*= :8*)= .3= 9-*8*= 97.&18`= (4257.8.3,= ,.= +*2&1*8= &3)= -1= 2&1*8_= O4'89*78=7&3,*)=.3=8.?*=+742=/-=94=+0+=2.11.2*97*8=(&7&5&(*=1*3,9-_= &'1*=+.= ***).3,=97.&1=8(-*):1*=4;*7=+.;*=)&>8`=(4;*7.3,=30=-4:78=&+9*7=.3.9.&9.43=4+=+**).3,= *5.84)*8_=&(-=9.2*=.3).(&9*8=<-*3=8&251*8=<*7*=(411*(9*)=&3)=9-*=-4:78=&+9*7=9-*= (422*3(*2*39=4+=+**).3,_==

-&>= = = &251.3,=9.2*=-4:78=&+9*7=(422*3(*2*39=4+=+**).3,=

-&>=+== = ,***=-=-`=,,**=/=- =

-&>=, = ****=1=-`=*,**=3=-`=*.**=++=-`=*0**=+-=-`=*2**=+/=-`=+***=+1=

-`=+,**=+3=-`=+.**=,+=-`=+1**=,.=-`=,-**=-*=-=

-&>=- == = */**=-0=-`=++**=.,=-`=+1**=.2=-`=,-**=/.=-=

-&>=. == = */**=0*=-`=++**=00=-`=+1**=1,=-`=,-**=12=-=

-&>=/ == = */**=2.=-`=++**=3*=-`=+1**=30=-=

=

*&*(&1=2&9*7.&1=(411*(9.43= = (7&)1*=)*;.(*=<&8=)*8.,3*)=&3)=':.19=+47=9-*=5:7548*=4+=7*897&.3.3,=14'89*78=<-.1*= 8&251*8=(4:1)='*=9&0*3=+742=9-*=-.3),:9=7*,.43_=O4'89*78=<*7*=51&(*)=.3=9-*=(7&)1*`= <-.(-= -41)8= 9-*= &3.2&1= :58.)*8)4<3= &3)= .224'.1.?*8= 9-*= 5489*7.47= +4:7= 5&.78= 4+= <&10.3,= 1*,8_= -*= &39*7.47= 9*1843= <&8= -*1)= +.721>= '>= 9-*= 7*8*&7(-*7= 94= 89&'.1.?*= 9-*= &')42.3&1=7*,.43=&3)=9&.1=<-.1*=(411*(9.3,=+&*(*8_= =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +11 = =

O4'89*7= +&*(*8= <*7*= (411*(9*)= :8.3,= &= +**:+***= µ1= 5.5*99*= <.9-= ).8548&'1*= 9.58_= 47= *&(-= +&*(&1= 8&251*`= &= 3*<= 89*7.1*= 9.5= <&8= :8*)= 94= 57*;*39= (439&2.3&9.43= '*9<**3= 8&251*8_= -*= 9.5= <&8= .38*79*)= ).7*(91>= .394= 9-*= &3&1= 547*= 4+= 9-*= 14'89*7= 94= 7*24;*= +&*(*8=+742=9-*=-.3),:9=7*,.43_=-*=(411*(9*)=2&9*7.&1=<&8=.22*).&9*1>=5.5*99*)=.394= &= +_/= 21= 2.(74= (*397.+:,*= 9:'*= (439&.3.3,= /**= µ1= 4+= 1*= *9-&341_= +9-&341= -&8= '**3= 8-4<3=94='*=&3=*++*(9.;*=57*8*7;&9.;*=+47=+.*1)=8&251*8=&3)=)4*8=349=7*6:.7*=+7**?.3,= 47= &3>= 85*(.&1= -&3)1.3,= B&72&3= *9= &1 _`= ,**._= -*= ;41:2*= (411*(9*)= ;&7.*)= +742= &5574=.2&9*1>=+*= µ1=94=+=21=)*5*3).3,=43=9-*=8.?*=4+=14'89*7=&3)=+:113*88=4+=-.3),:9=&9= 9-*=9.2*=4+=8&251.3,_=+9-&341=<&8=7*24;*)=+742=8&251*8='*+47*=9<=*=97&(9.43='>= (*397.+:,.3,=&9=+*`***=,=+47=-*=8_=+=(*88=*9-&341=<&8=54:7*)=4++=&3)=9-*=8&251*=9:'*8= (*397.+:,*)=&,&.3_=3>=7*2&.3.3,=*9-&341=<&8=9-*3=7*24;*)='>=5.5*99*_== -!%=*=97&(9.43= -*7*= <*7*= 34= 57*;.4:81>= 5:'1.8-*)= 89:).*8= :8.3,= 74(0= 14'89*7= +&*(&1= 2&9*7.&1= &8= &= 84:7(*=4+=57*>=9<_=.88:*=8&251*8=+742=57*)&947=&3)=57*>=85*(.*8=<*7*=(411*(9*)=94= 9*89=?7=57.2*7=85*(.+.(.9>=&3)=94=:8*=&8='49-=548.9.;*=&3)=3*,&9.;*=9<=(4397418=.3= 1&9*7= *=5*7.2*398_= .88:*= 8&251*8= <*7*= 9&0*3= +742= +7*8-= &3.2&18= &3)= &= 82&11= 5*_,/= 21=5479.43=<&8=:8*)=+47=949&1=(*11:1&7=9<=*=97&(9.43_=349-*7=5479.43=5,=21=4+=9-*= 9.88:*= <&8= 8947*)= .3= 1*= *9-&341= &8= &= ;4:(-*7= 85*(.2*3_= -*= 9<*&8> ?= .88:*= E.9= AD+<=<&8=:8*)=94=*=97&(9=,*342.(=9<=+742=57*)&947=&3)=57*>=9.88:*8`=&3)=9-*= 2&3:+&(9:7*78=&3.2&1=9.88:*=57494(41=<&8=+4114<*)_= = -*= 8197&= ?1*&3(= *(&1= 9<= E.9= 54= .4= O&'47&947.*8`= 3(_= <&8= :8*)= +47= 9<= *=97&(9.438=43=74(0=14'89*7=+&*(&1=8&251*8=+4114<.3,=9-*=2&3:+&(9:7*78=57494(418=<.9-= 9-*=8:551.*)=57457.*9&7>=':++*78=&3)=7*&,*398_=11=9<=*=97&(9*)=+742=+&*(&1=8&251*8= :8.3,=9-.8=0.9=<&8=7*&)>=+47=?7`=&3)=9-*=2&3:+&(9:7*78=57494(41=&55*&7*)=94=7*24;*= &3>=549*39.&1=?7=.3-.'.9478_== = +/=&251.+.(&9.43= 7*(&:9.438= <*7*= 9&0*3= ):7.3,= 57*5&7&9.43= 4+= ?7= 7*&(9.438= 94= 2.3.2.?*= 9-*= 5488.'.1.9>=4+=(439&2.3&9.43='>=*=97&3*4:8=9<_=*7484187*8.89&39='&77.*7=5.5*99*=9.58= <*7*=:8*)=+47=57*5&7.3,=&11=?7=7*&(9.438`=&3)=5.5*99*=9.58=<*7*=*.9-*7=89*7.1*=&3)=57*8 5&(0&,*)=47=&:94(1&;*)=57.47=94=:8*_=11=?7=7*&(9.438=<*7*=57*5&7*)=.3=&=)*).(&9*)= -44)= <-*7*= ?7= 9:'*8`= 5.5*99*8= &3)= 5.5*99*= 9.58= <*7*= 8:'/*(9*)= 94= 8C= 1.,-9= +47= &= 2.3.2:2=4+=+*=2.3=57.47=94=8*99.3,=:5=*&(-=?7=7*&(9.43_== = -*=(42543*398=4+=9-*=,*= 1=?78=<*7*=/*=25=E?O`=+/=25=7.8_?1=5=-_*`=/_*=25= 5,?1 ,`= +**= ,=21 :+ ='4;.3*=8*7:2=&1':2.3`=*_/=25=4+=*&(-=)<`=,=25=*&(-=57.2*7= D*3*<4708`=+=:3.9=251.&6=D41) =9<=541>2*7&8*=,.,2&`=&3)=5,*=3,=9*251&9*= 9<_= 49-= 548.9.;*= &3)= 3*,&9.;*= (4397418= <*7*= 7:3= <.9-= *&(-= '&9(-= 4+= ?78_= 47= 3*,&9.;*= (4397418`= ,= 1= 5.11.A=  ,>= <&8= :8*)= &8= 9*251&9*b= &3)`= +47= 548.9.;*= (4397418`= 5,*= 3,= 9*251&9*= 9<= +742= &1.49.8= 7:'7& `= *397489*5-&3:8= 74),*78.. = &3)= *1.4(.)&7.8= *7>9-74,7&22& =<&8=:8*)=94=(43+.72=7*&(9.43=8:((*88_=?7=7*51.(&9.43=<&8=5*7+472*)= '>=7:33.3,=7*&(9.438=&=2.3.2:2=4+=9<4=9.2*8=94=*38:7*=&=(438.89*39=7*8:19_=

+12 = 74/*(9=34_=,**.2*+- = =

= -*=?7=57.2*7=8*98=:8*)=.3=9-.8=*=5*7.2*39=&'1*=+/=<*7*=)*;*145*)=57*;.4:81>=94= ).89.3,:.8- =&1.49.8=7:'7& =9.88:*=+742=9-&9=4+=49-*7 =&1.49.8 =85*(.*8=+47=+47*38.(= 5:7548*8=+11.499= *9=&1 _`=,**,=&3)=+47=.)*39.+.(&9.43=4+=*(-.34)*728=&8=57*>=.9*28=.3= 2&7.3*=*(48>89*28= (Jarman et al ., 2006). =7.2*78=<*7*=4'9&.3*)=+742=D*3*;4708=9>= O9)=?:8942=>1.,43:(1*49.)*=8*7;.(*=&3)=).1:9*) to 10 )M +47=:8*=.3=8*99.3,=:5=?7= 7*&(9.438_ = = ?7=9-*72&1=(>(1.3,=(43).9.438=+47=&1?>,D+<=&3)=&1?>,D+<=57.2*78=<*7*a= )*3&9:7&9.43=&3)=9<=541>2*7&8*=&(9.;&9.43=&9=3/J?=+47=+*=2.3=+4114<*)='>=+*=.3.9.&1= &251.+.(&9.43=(>(1*8a=3.J?=+47=-*=8`=&33*&1.3,=&9=0*://J?=+47=-*=8`=1,J?=+47=+=2.3=<.9-=&= )*(7*&8*=.3=9-*=&33*&1.3,=9*25*7&9:7*='>=*_/J?=+47=*&(-=4+=9-*=+*=(>(1*8_=<*39>8+.;*= +:79-*7=&251.+.(&9.43=(>(1*8=<*7*=(&77.*)=4:9a=3.J?=+47=-*=8`=//J?=+47=-*=8=&3)=1,J?=+47= +=2.3_=-*=+.3&1=*=9*38.43=89*5=<&8=1,J?=+47=/=2.3=&3)=9-*=7*&(9.43=<&8=-*1)=&9=+*J?= :39.1=7*24;*)=+742=9-*=5B=7*8*&7(-=?8,**+=-*72&1=?>(1*7_= = ?7= 9-*72&1= (>(1.3,= (43).9.438= +47= +(-.3<,,+28+2+(-.3<,,+287= 57.2*78= <*7*a= )*3&9:7&9.43= &3)= 9<= 541>2*7&8*= &(9.;&9.43= &9= 3/J?= +47= +*= 2.3= +4114<*)= '>= -/= &251.+.(&9.43=(>(1*8a=3/J?=+47=/=8`=&33*&1.3,=9*25*7&9:7*=&9=/+J?=+47=-*=8`=1,J?=+47=-*=8_= -*=+.3&1=*=9*38.43=89*5=<&8=1,J?=+47=/=2.3=&3)=9-*=7*&(9.43=<&8=-*1)=&9=+*J?=:39.1= 7*24;*)=+742=9-*=5B=7*8*&7(-=?8,**+=-*72&1=?>(1*7_= = ?7= 574):(98= <*7*= ;.8:&1.8*)= '>= *1*(9745-47*8.8= 43= +_/=&,&748*=,*18=89&.3*)=<.9-= *9-.).:2='742.)*=/= µ1=*9-.).:2='742.)*=5*7=+**=21=&,&748*_=+&(-=,*1=<&8=14&)*)= <.9-=1= µ1=4+= ?7=574):(9`=&3)=&=+**='5=1&))*7=<&8=:8*)=43=*;*7>=,*1=94=)*9*72.3*= +7&,2*39=8.?*=&3)=94=(43+.72=9-*=7*8:198=4+=*&(-=?7_=11=&,&748*=,*18=7&3=+47=,*=2.3= &9=2*=C_== = =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +13 = =

= &'1*=+/= +/=57.2*78=:8*)`=.3(1:).3,=8*6:*3(*=4+=*&(-=57.2*7`=9&7,*9=47,&3.82=47=,74:5`=&3)= -!%=7*,.43=&251.+.*)_=-!%=7*,.438=&7*=2.94(-43)7.&1=(>94(-742*=4=.)&8*=8:':3.9= 7=29=+47=&3)=9-*=3:(1*&7=1&7,*=8:':3.9=7.'4842&1=/!%=,*3*=+28=7-!%_= = 7.2*7= =*6:*3(*=/:-= = = = &7,*9= 85*(.*82,74:5

= -!%=7*,.43=

&1?>,D+< = = ?=U=D=?U=?=5?=?D=? ======&1.49.8=7:'7&= = = == 29=

?> =

&1?>,D+<===??==7=?D=D==?D=D?=?= === &1.49.8=7:'7&= = = == 29=

?>=

+(-.3<,,++=====D?D=D?===D=D======+(-.34)*72&9&= = =+28=

79<=

+(-.3<,,7+=====?D=??=D7=7=D?D=?=?=D= = ===+(-.34)*72&9&= = =+28=

79<=

= /*8:198= ***).3,=97.&18= 88.3,= &1?>,D+<= &3)= &1?>,D+<= 57.2*78`= +7&,2*398= 4+= +3-= '5= <*7*= 8:((*88+:11>=&251.+.*)=+742='49-='1&(081.55*)=&'&143*=9.88:*=9<=&3)=+&*(&1=8&251*8= +742= 14'89*78= +*)= &= ).*9= 4+= '1&(081.55*)= &'&143*= +.,_= +_= 88.3,= +(-.3<,,++= &3)= +(-.3<,,7+= 57.2*78`= +7&,2*398= 4+= +0*= '5= <*7*= 8:((*88+:11>= &251.+.*)= +742= *397489*5-&3:8= 74),*78.. = &3)= *1.4(.)&7.8= *7>9-74,7&22& = 9.88:*= 9<`= &3)= +742= +&*(&1= 8&251*8=+742=14'89*78=+*)=&=).*9=4+='49-=:7(-.3=85*(.*8=.,:7*=/2_=7*>=<&8=.3.9.&11>= )*9*(9*)= .3= &11= 8&251*8= &9= 1= -= &+9*7= +**).3,= &3)= <&8= (438.89*391>= )*9*(9*)= .3= &11= 8&251*8=:39.1=0*=-=&+9*7=9-*=+**).3,=*5.84)*_=-*7*=<*7*=34=)*9*(9.438=.3=&3>=4+=9-*= 8&251*8= 9&0*3= &9= -= &3)= /= -= 47= +47= 9-*= 8.== 8&251.3,= 9.2*8= +742= 00= -= 94= 30= -= &+9*7= (422*3(*2*39=4+=+**).3,_=

+2* = 74/*(9=34_=,**.2*+- = =

= = *.,:7*=/2= *(.+.(.9>= 4+= 1&1+4,3!%21&1+4,3!,= &3)= (-.3!++2(-.3!7+= +/= 57.2*78_= %,&748*= ,*1= 8-4<.3,= +/= 574):(98= &251.+.*)= +742= 74(0= 14'89*7= +**).3,= *=5*7.2*398= :8.3,= ,74:5= &3)= 85*(.*8885*(.+.(= +/= 57.2*78_= 8&3*8= +:/= 8-4<= -!%= &251.+.(&9.43= :8.3,= +/= 57.2*78= 85*(.+.(= 94= &1.49.8= 7:'7& = &3)= 1&3*8= 1:++= 8-4<= -!%=&251.+.(&9.43=:8.3,=+/=57.2*78=85*(.+.(=94=(-.34)*72&9&_=8&3*8=0=&3)=+,=&7*= +**='5=-!%=7*+*7*3(*=1&))*78=.3).(&9.3,=7*1&9.;*=8.?*=4+=-!%=+7&,2*398=.3=8&251*= 1&3*8_=8&3*8=+`=,=&3)=-=.3).(&9*=+/=&251.+.*)=74(0=14'89*7=+&*(&1=8&251*8=+742=2`=,.= &3)=30=-=&+9*7=+**).3,=43='1&(081.55*)=&'&143*_=8&3*= /= 8-4<8= -!%= &251.+.(&9.43= :8.3,= &1.49.8= 7:'7& =9.88:*_=8&3*8=1`=2`=3=&3)=+*=8-4<=+/=&251.+.*)=74(0= 14'89*7= +&*(&1=8&251*8=+742=+,`=-0`=.2=&3)=1,=-=&+9*7=+**).3,=43= *397489*5-&3:8= 74),*78.. _= 8&3*8=.=&3)=++=&7*=3*,&9.;*=(4397418=<.9-=<&9*7=.389*&)=4+=-!%=8&251*=9*251&9*_= = -.8(:88.43= -*= +&*(&1= (411*(9.43= 9*(-3.6:*= )*;*145*)= 2*9= 9-*= .25479&39= 7*6:.7*2*39= 4+= '*.3,= 34381*9-&1_= 9:7.3,= 9-*= +**).3,= 97.&18`= 8*;*7&1= .3).;.):&1= 14'89*78= <*7*= 8&251*)= 9*3= 9.2*8=4;*7=+4:7=2439-8=:8.3,=9-*=3438)*897:(9.;*=+&*(&1=(411*(9.43=9*(-3.6:*=<.9-=34= 4';.4:8= )*1*9*7.4:8= .25&(98_= -*= &'.1.9>= 94= 7*5*&9*)1>= 8&251*= 9-*= 8&2*= .3).;.):&1= 14'89*7=(43+.728=9-*=14<=.25&(9=3&9:7*=4+=9-.8=2*9-4)=&3)=&114<8=+47=&=,7*&9*7=7&3,*= 4+=*=5*7.2*39&9.43=43=14'89*7=).*9=&3)=+**).3,='*-&;.4:7_=&*(&1=2&9*7.&1=<&8=*&8.1>= &3)=8:((*88+:11>=*=97&(9*)=+742='49-=8*=*8=4+=14'89*78=&3)=&=<.)*=7&3,*=4+=8.?*=(1&88*8= /-=22=?O8+0+=22=?O_= This indicates that faecal material is useful to study ontogenetic dietary shifts and dietary changes associated with maturity and reproduction. 541*(:1&7=57*>=)*9*(9.43=)*5*3)8=:543=9-*=&'.1.9>=4+=9<=94=7*8.89=).,*89.43=.3=9-*= 57*)&947=,:9=&3)=43=9-*=54<*7=4+=?7=94=&251.+>=&=57*>=85*(.+.(=7*,.43=4+=9<=+742= 8*2.8).,*89*)=2&9*7.&1=B&72&3= *9=&1 _`=,**,b=<*/89,&&7)= *9=&1 _`=,**-b=9*&,1*= *9=&1 _`=,**/'b= &78438= *9= &1 _`=,**/_=-*=*=9*39=4+=9<='7*&0)4<3=&+9*7=).,*89.43='>= 74(0= 14'89*78= <&8= 57*;.4:81>= :3034<3`= &19-4:,-= 5&>+.*1)= *9= &1 _= ,***(= +4:3)= 9-&9= ).,*89.43= 7*3)*7*)= 9-*= :8*= 4+= 8*7414,.(&1= 2*9-4)8= :38:.9&'1*_= -.8= 89:)>= 8-4<8`= +47= 9-*= +.789= 9.2*`=9-&9=57*>=9<=8:7;.;*8=).,*89.43`=(&3='*=.841&9*)=+742=14'89*7=+&*(&1=2&9*7.&1= &3)=(&3='*=8:((*88+:11>=&251.+.*)=:8.3,=?7_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +2+ = =

= -*= 143,*;.9>= 4+= 9-*= 241*(:1&7= 8.,3&1= .3).(&9*8= 9-&9= 8&251*8= 4'9&.3*)= +742= 97&58= ):7.3,=74:9.3*=+.8-.3,=45*7&9.438=<4:1)=7*9&.3=57*>=9<=(438:2*)=57.47=94=*39*7.3,= 9-*=97&5_=3= &8:8=*)<&7)8.. =+.8-*7.*8`=97&58=&7*=8*9=+47=&=2&=.2:2=4+=,.=-_=-*8*=7*8:198= 8:,,*89= 9-&9= ).*9&7>= .3+472&9.43= 8-4:1)= 89.11='*= &;&.1&'1*= +742= +&*(&1= 2&9*7.&1= +47= &9= 1*&89= 9-*= ,.= -= 57.47= 94= *39*7.3,= 9-*= 97&5= &8= 9-*= ).*9&7>= 8.,3&1= <&8= 7*(47)*)= .3= &11= 8&251*8=:5=94=0*=-=&+9*7=9-*=(422*3(*2*39=4+=+**).3,_== = 47= &3.2&18= 8:(-= &8= 74(0= 14'89*78= <-*7*= 57*;.4:8= ).*9&7>= 89:).*8= -&;*= '**3= .3(43(1:8.;*`=9<=-41)8=(438.)*7&'1*=5742.8*=+47=&88*88.3,=85*(.+.(=57*>=;&7.&'.1.9>= &(7488=85&9.&1=&3)=9*2547&1=8(&1*8_=19-4:,-=74(0=14'89*78=&3)=&'&143*=&7*=(42243= 43= 9*25*7&9*= 7**+8= &74:3)= 9-*= <471)= *_,_= ,4:9-= +7.(&`= <*<= I*&1&3)`= :897&1.&`= 9-*7*= &7*= 34= 7*(47)8= 4+= 9-*= 57*8*3(*= 4+= &'&143*= .3= 74(0= 14'89*7= ).*9&7>= 89:).*8= .(02&3`= +3./b= &77= *9= &1 _`= +330b= 5&>+.*1)= ]= 7&3(-`= ,***b= 5&>+.*1)= *9= &1 _`= ,***(_= ?422*7(.&1=&'&143*=).;*78=4+9*3=7*5479=*259>=&'&143*=8-*118=.3=+7439=4+=14'89*7=)*38_= -*=+&.1:7*=4+=57*;.4:8=89:).*8=94=.)*39.+>=&'&143*=.3=14'89*7=,:98=.8=5488.'1>=):*=94=9-*= +449= 9.88:*= '*.3,= 9-*= 431>= 5&79= (438:2*)= '>= 74(0= 14'89*78= &3)= <.9-4:9= &3>= 8-*11= +7&,2*398`=9-.8=9.88:*=<4:1)='*=:3.)*39.+.&'1*_=83)*789&3).3,=9-*=.39*7&(9.43='*9<**3= 9-*8*= 9<4= ;&1:&'1*= 7*(7*&9.43&1= &3)= (422*7(.&1= 85*(.*8= .8= 43*= *=&251*= 4+= 9-*= 549*39.&1= 4+= 9<= ).*9&7>= 89:).*8= +47= .2574;.3,= 4:7= :3)*789&3).3,= 4+= 2&7.3*= *(48>89*28_= 25479&391>`= 9-*= &'.1.9>= 94= 4'9&.3= ).*9&7>= .3+472&9.43= 3438)*897:(9.;*1>= *3&'1*8= (425&7.8438= '*9<**3= +.8-*)= &3)= 3438+.8-*)= *_,_= 58= 7*,.438`= 94= '*99*7= :3)*789&3)=9-*=9745-.(=.25&(98=4+=-&7;*89.3,=2&7.3*=7*84:7(*8_== = %(034<1*),*2*398= -.8=7*8*&7(-=<&8=&=(42543*39=4+=,7&39=,**.2*+-= 4<&7)8= .39*,7&9*)=2:19.885*(.*8= 2&3&,*2*39= 4+= :897&1.&8= ,+= 7**+= +.8-*7.*8a= = &82&3.&3= *=&251*`= <-.(-= .8= 8:55479*)='>=+:3).3,=+742=9-*=.8-*7.*8=7*8*&7(-=&3)=9*;*1452*39=?47547&9.43=43= '*-&1+= 4+= 9-*= :897&1.&3= D4;*732*39_= :3).3,= <&8= &184= 574;.)*)= '>= 9-*= =1.0*=94=9-&30=&11=9-*=.3).;.):&18=&9=9-*=5&7.3*=7*8*&7(-=O&'47&947.*8=<-4= &88.89*)=<.9-=74(0=14'89*7=-:8'&3)7>=&3)=9-*=(411*(9.43=4+=14'89*78=&3)=57*>=85*(.*8_= 11=*=5*7.2*398=<*7*=(&77.*)=4:9=.3=&((47)&3(*=<.9-=9-*=:897&1.&3=?4)*=4+=7&(9.(*= +47=9-*=?&7*=&3)=88*=4+=3.2&18=+47=,(.*39.+.(=:7548*8=19-=+).9.43=,**._= = =

+2, = 74/*(9=34_=,**.2*+- = =

%55*3).==1= 745-.(=*++*(98=4+=+.8-.3,=84:9-*73=74(0= 14'89*7= )&8:8=*)<&7)8.. =8-4<3='>= (42'.3*)=+&99>=&(.)=&3)=89&'1*=.84945*= &3&1>8*8= =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = +2- = Vol. 388: 169–184, 2009 MARINE ECOLOGY PROGRESS SERIES Published August 19 doi: 10.3354/meps08096 Mar Ecol Prog Ser

Trophic effects of fishing southern rock lobster Jasus edwardsii shown by combined fatty acid and stable isotope analyses

M. A. Guest 1, *, S. D. Frusher 1, P. D. Nichols 2, 3 , C. R. Johnson 4, K. E. Wheatley 4

1Tasmanian Aquaculture and Fisheries Institute, Marine Research Laboratories, Nubeena Crescent, Taroona, Tasmania 7053, Australia 2CSIRO Marine and Atmospheric Research, Castray Esplanade, Hobart, Tasmania 7000, Australia 3Antarctic and Climate Ecosystems, University of Tasmania, Private Bag 80, Hobart, Tasmania 7001, Australia 4School of Zoology, University of Tasmania, Private Bag 5, Hobart, Tasmania 7001, Australia

ABSTRACT: The southern rock lobster Jasus edwardsii is a commercial species that has benefited from the complete protection offered by no-take reserves, with higher abundances and larger ani- mals recorded in reserves than in adjacent fished areas. What remains unclear is whether there is any change in the diet of lobsters in reserves, for example, as a result of increased intraspecific competi- tion for food. We used combined chemical tracers to examine the diet of lobsters in fished and reserve areas in 2 bioregions in eastern Tasmania. δ15 N values of lobsters were richer in fished than in reserve areas, indicating that lobsters eat a greater proportion of food items from higher trophic levels in fished areas. Mixing models suggest that ascidians, sea urchins and the turbinid gastropod were all important food sources for lobsters, but the importance of these food items differed between biore- gions. This spatial variability may suggest that the small size of the reserve in one bioregion is inad- equate at ensuring the diet of lobsters is protected from fishing pressure. Fatty acid profiles of lobsters supported the importance of these food sources to lobsters. Differences between bioregions, or inside and outside of reserves, were not apparent using fatty acids. The present study highlights that lobster fishing has the capacity to alter the trophic status of prey for generalist predators and suggests that fatty acid analyses may be limited in detecting changes in the dietary composition of such generalist feeders.

KEY WORDS: Effects of fishing · Food webs · Marine protected areas · Stable isotopes · Fatty acids

Resale or republication not permitted without written consent of the publisher

INTRODUCTION 1991, Dahlgren & Sobel 2000, Schroeter et al. 2001, Shears et al. 2006). Not surprisingly, the abundance No-take marine protected areas, or reserves, are an and often mean size of fished species is generally increasingly common tool used to mitigate the effects found to increase in reserves compared with adjacent of fishing and preserve biodiversity (Jennings 2000). In fished areas (Edgar & Barrett 1997, Follesa et al. 2007, the absence of manipulative experiments and data that Sonnenholzner et al. 2009). More recently, however, is collected prior to fishing activities, no-take marine the indirect effects of fishing on the trophic structure of reserves also provide a unique opportunity to test spe- reserve and fished communities have been considered cific hypotheses about the effects of fishing on commu- with evidence of trophic cascades in several communi- nity structure and dynamics (Pinnegar et al. 2000). ties following the increase of predator densities in re- Typically, these hypotheses have focused on evaluat- serve areas (Scheffer et al. 2005, Kramer & Heck 2007). ing the direct effects of fishing, such as changes to the The southern rock lobster Jasus edwardii (Hutton) is density of targeted species (e.g. Roberts & Polunin one species demonstrated to benefit from the estab-

*Email: [email protected] © Inter-Research 2009 · www.int-res.com 170 Mar Ecol Prog Ser 388: 169–184, 2009

lishment of marine reserves in which complete cessa- (Karnovsky et al. 2008, Tierney et al. 2008) and mam- tion of fishing is enforced (Edgar & Barrett 1997, 1999, mals (Krahn et al. 2008, Tucker et al. 2008). No previ- Shears et al. 2006). Increases in the abundance of J. ous studies have examined the diet of lobsters, includ- edwardsii have been linked with trophic cascades in ing wild Jasus edwardsii , using combined stable reserves that shifted from sea urchin- to algal-domi- isotope and fatty acid analyses. More importantly, nated reef habitats (Shears & Babcock 2003). What combined tracers have not previously been applied to remains unclear, however, is the potential dietary shift understanding potential differences in the feeding of lobsters due, in part, to greater lobster density after ecology of a consumer between spatial management reserve establishment (e.g. via intraspecific competi- zones. The present study, on the east coast of Tasma- tion) that may have unknown effects on other compo- nia, uses a combined chemical tracer approach to nents of the reef community. determine if lobster diet differs between fished areas Chemical tracers such as stable isotope and fatty with low lobster density and reserve areas with higher acid analyses are means by which the diet of lobsters lobster density. In doing so, it provides insight into in fished and reserve areas may be determined. As lob- both the feeding ecology of lobsters and its response to sters macerate their food upon ingestion, the chemical spatial management, and the efficacy of chemical trac- tracer approach has advantages over conventional ers in resolving spatial differences in a consumer’s diet. methods of dietary analysis, such as gut content analy- sis where identification is often labour intensive, requires taxonomic expertise and soft bodied organ- MATERIALS AND METHODS isms may be overlooked (Sheppard & Harwood 2005). Moreover, chemical tracers identify food that is assim- Study sites and species. The diet of Jasus edwardsii ilated over a period of time and is of nutritional impor- was studied in fished and reserve areas in 2 bioregions tance, rather than that which is ingested at one point in in eastern Tasmania, Australia (Fig. 1). The Maria time (Thomas & Cahoon 1993). The basis of the chem- Island reserve protects ~7 km of coastline and was ical tracer approach is that consumers incorporate the established principally to preserve marine habitats marker, or signature, of their food source into their representative of the Tasmanian east coast, whilst the somatic and other tissues with minimal or predictable Governor Island reserve at Bicheno protects ~1 km of changes, thus providing an integrated record of the coastline and was established to restore recreational main food items in their diet (Peterson 1999, Dalsgaard fisheries species such as lobster back to unfished levels & St John 2004). (Edgar & Barrett 1999). Both regions are characterised Stable isotope signatures refer to the variation in the by shallow algal reefs which support J. edwardsii and ratio of rare heavy isotopes (e.g. 13 C, 15 N) to the more the blacklip abalone Haliotis rubra , the 2 most impor- common lighter isotopes (e.g. 12 C, 14 N) in the target tant fisheries species in Tasmania. organism relative to an international standard (Peter- Each bioregion is represented by a single reserve son & Fry 1987). As carbon changes very little between with adjacent fished locations. Two locations (1 & 2) successive trophic levels (0 to 1‰, McCutchan et al. were selected within each reserve, as well as 3 loca- 2003), the carbon isotope can often indicate the ulti- tions (3 to 5; see Fig. 1) in fished areas adjacent to each mate source of primary production at the base of a con- reserve, to maximise habitat similarity in terms of wave sumer diet. The nitrogen isotope experiences greater exposure and macroalgal communities between treat- fractionation per trophic level (3 to 4‰) and is thus ments. There were multiple sites within each location used to infer the trophic status of a consumer to ensure samples were representative of each loca- (McCutchan et al. 2003). Signature fatty acids include tion. Reserve and fished locations in each bioregion individual fatty acids that are rare and unique ratios of were similar to those used by Edgar & Barrett (1997, commonly occurring fatty acids, both of which can be 1999). Locations within each fished and reserve area reflected in the fatty acid profile of a consumer (Dals- were separated by at least 1 km, and within each loca- gaard et al. 2003). The combined use of stable isotope tion, multiple sites were separated by approximately and fatty acid analyses therefore results in a greater 100 m. capacity than that of a single technique to discriminate At Maria Island, both total density and the density of between potential food sources contributing to the diet large Jasus edwardsii were higher in reserves than of lobsters in fished and reserve areas. adjacent fished areas (Edgar & Barrett 1997, 1999, Bar- The combined use of stable isotope and fatty acid rett et al. 2009). There were no apparent differences in analyses has been successfully applied to understand- the density of J. edwardsii at Governor Island between ing the feeding ecology of marine invertebrates (Khar- reserve and fished areas (Edgar & Barrett 1999, Barrett lamenko et al. 2001, Guest et al. 2008, Jaschinski et al. et al. 2009), but observations suggested that lobsters 2008, Soreide et al. 2008, Stevens et al. 2008), birds moved to deeper water and beyond surveying depth Guest et al.: Trophic effects of fishing Jasus edwardsii 171

Fig. 1. Sampling locations (1 to 5) at Governor and Maria Islands, Tasmania. In each bioregion, Locations 1 and 2 are reserves (outlined) and 3 to 5 are fished

(5 m) in poor weather at this more exposed location were similar between fished and reserve areas at Gov- (N. Barrett pers. comm.), making potentially higher ernor Island, and strong recruitment at one location at densities of lobsters in reserves at Governor Island dif- Maria Island apparently caused the significantly ficult to detect. higher abundance of T. undulatus recorded there Potential lobster prey items included the blacklip (Buxton et al. 2006). No data are available on the den- abalone Haliotis rubra , the turbinid gastropod Turbo sity of ascidians. Red algal cover at 5 m depth was 11 to undulatus ; the purple sea urchin Heliocidaris erythro- 24% at Maria Island and 10 to 20% at Governor Island. gramma , the long-spined sea urchin Centrostephanus Dominant brown algal canopy species were Durvillea rodgersii , and the solitary ascidians Herdmania potatorum , Ecklonia radiata and Phyllospora comosa momus , Cnemidocarpa radicosa and Pyura gibbosa . and their total cover was 40 to 80% at Maria Island and The density of small abalone ( H. rubra) was lower than nearly 100% at Governor Island (Edgar & Barrett 1999). large abalone in reserves than in fished areas (Edgar & Sample collection and processing. A minimum of 3 Barrett 1999). The densities of H. erythrogramma and samples of Jasus edwardsii and potential prey items C. rodgersii were greater in fished areas compared were collected from each site within each location in with reserve areas for both bioregions (Barrett et al. reserve and fished areas for both stable isotope and 2009). Densities of the turbinid gastropod T. undulatus fatty acid analyses. All samples were collected on 172 Mar Ecol Prog Ser 388: 169–184, 2009

SCUBA by hand. Due to the limited dive time, uneven gas chromatograph operating conditions previously numbers of samples among species and locations and described (Phillips et al. 2003a). Individual compo- between bioregions often resulted. Sampling of J. nents were identified using mass spectral data (Finni- edwardsii occurred inside and outside of reserve areas gan Thermoquest GCQ GC-MS) and by comparing and was non-destructive, involving the removal of the retention times with those of authentic laboratory stan- second or third walking leg in situ before release. Nel- dards. son et al. (2005) showed the fatty acid profiles of leg tis- Statistical analyses. Stable isotopes: A nested sue to be similar to that of muscle tissue in both wild ANOVA tested for differences in carbon and nitrogen and cultured lobsters. Where possible, J. edwardsii isotope values of lobster and potential food sources from different size classes (small: <80 mm carapace among fished and reserve locations (reserve effect: length [CL]; medium: 80–120 mm CL; large: >120 mm fixed, 2 levels). Location was a random factor and, CL) were collected to examine potential ontogenetic where possible, nested within reserve effect, but was shifts in diet. Common red algae Plocamium angustum unbalanced as 2 locations were in reserve areas and 3 and brown algae ( Ecklonia radiata , Phyllospora comosa ) were in fished areas. Tests for differences between were collected at the same locations as the lobsters, fished and reserve areas were done separately for each and all samples were taken at 5 to 10 m depth. bioregion using the general linear models (GLM) pro- All samples were frozen after collection (–20°C), cedure in SAS version 9.1.3 (SAS Institute), except for then thawed and rinsed in distilled water prior to pro- ascidians where there were too few data within either cessing. A leg muscle of lobster samples was removed bioregion among reserve and fished areas to be from the exoskeleton, and a 2 cm 3 section of muscle analysed. The GLM procedure uses the method of was removed from the abalone foot for later analysis. least squares to fit GLMs, and is particularly suited to Muscular tissue of Turbo undulatus was also separated unbalanced data (Quinn & Keough 2002). Data were from the shell and other organs. Similarly, a portion of checked for normality and homogeneity of variance by ascidian tissue, including the tunic, washed free of epi- examination of residuals, and square root-transformed phytes, was also removed. Samples of sea urchin, com- where necessary. Spearman rank correlation was used prising the lantern only, were rinsed, and small to determine if there was a relationship between lob- amounts of flesh removed for analysis. From each algal ster size and carbon and nitrogen isotope values. sample, tissue was selected haphazardly from the tip, Mixing model of Jasus edwardsii diet: Mixing mod- midline and lower portion of each frond. All samples els cannot provide a unique solution where there are were then freeze-dried for 24 to 48 h and ground with more sources than elements, as in the present study. a mortar and pestle. Samples were then partitioned for Instead, the IsoSource model (Phillips & Gregg 2003) fatty acid and stable isotope analyses. uses the average carbon and nitrogen isotope values of Stable isotope analysis. The ratios of 13 C/ 12 C and lobster and its potential prey items to calculate the 15 N/ 14 N for all samples were calculated as the relative upper and lower limits of the contribution that each per mille (‰) difference between the sample and the food source makes to the diet of lobster. All possible recognized international standard (Pee Dee belemnite combinations of each food source contribution (0 to carbonate for carbon; air for nitrogen) and analysed on 100%) are examined in 1% increments. Combinations a Micromass Isochrom continuous flow-isotope ratio that sum to 0.5% of the lobster signature are consid- mass spectrometer. Precision of the mass spectrometer ered feasible contributions. Results are reported as the calculated from duplicate samples was 0.2‰. distribution of feasible solutions for each food source as Fatty acid analysis. Dried animal and algal samples recommended by Phillips & Gregg (2003). The 1st and (15 mg of each) were trans-methylated to produce fatty 99th percentiles are also given rather than the full acid methyl esters (FAME) using methanol–chloro- range, which is sensitive to small numbers of observa- form–conc. hydrochloric acid (10:1:1, 80°C, 2 h). Direct tions on the tails of the distribution (Melville & Con- trans-methylation of samples has previously been vali- nolly 2003). dated against conventional methods (Christie 1982) for The average carbon and nitrogen isotope values of a microheterotroph (Lewis et al. 2000) and for striped Jasus edwardsii and the potential prey items — aba- trumpeter larvae and rotifers (M. P. Bransden & G. A. lone Haliotis rubra , the turbinid Turbo undulatus , the Dunstan unpubl. data). FAME were extracted into sea urchins Heliocidaris erythrogramma (Maria Island hexane–chloroform (4:1, 3 × 1.5 ml). Analysis of gas only) and Centrostephanus rodgersii (Governor Island chromatograms was performed with an Agilent Tech- only), ascidians, brown algae and the red alga Plo- nologies 6890N GC equipped with an HP-5 capillary camium angustum — for reserve and fished areas column (50 m × 0.32 mm internal diameter), a flame within each bioregion were corrected for fractionation. ionization detector (FID), a split/splitless injector and Trophic fractionation for carbon is on average 0.5‰ an Agilent Technologies 7683 auto sampler using per trophic level (McCutchan et al. 2003). For nitrogen, Guest et al.: Trophic effects of fishing Jasus edwardsii 173

fractionation is larger and on average 3.5‰ per trophic lum were used in PCA. A 1% cutoff was chosen to min- level (McCutchan et al. 2003, Waddington & Mac- imise chromatographic overlap. Results were consis- Arthur 2008). Fractionation rates can vary between tent with analysis of mg g –1 fatty acid data (data not species with such issues as diet type (Vanderklift & shown, but see Phillips et al. 2003b). The relationship Ponsard 2003) and dietary studies are required to con- between lobster size and principal component score, firm the fractionation rates of individual species (Pitt et derived from fatty acids present in the profile of J. al. 2009). As this was beyond the scope of the present edwardsii , was examined using Spearman’s rank cor- study, the sensitivity of the IsoSource mixing model relation. All statistical analyses were performed using was run for each species using a range of fractionation SAS version 9.1.3 (SAS Institute). rates for carbon and nitrogen. Changes in fractionation rates between 0.5 to 1.5‰ did not change the overall order of contributions made by most prey items to RESULTS lobster diet (data not shown), thus the above standard levels of fractionation were used here. Lobsters were Stable isotopes assumed to be 2.5 trophic levels above the base autotrophic source, ascidians 1.5 levels above base Carbon and nitrogen isotope values could be distin- autotrophic source (Bingham & Walters 1989) and the guished between broad phylogenetic groups (Fig. 2). grazers, including abalone (Guest et al. 2008), tur- For sea urchins, ascidian and brown algal species, the binids and sea urchins, 1 trophic level above base carbon and nitrogen values of similar species (e.g. autotrophic source. Isotope values for ascidians, sea Heliocidaris erythrogramma and Centrostephanus urchins and brown algae were pooled within each rodgersii ) could not be distinguished and the isotopic respective phylum as, for the purposes of the model, values of these species were averaged for subsequent there were insufficient differences between isotope modelling of lobster diet (Fig. 3). As not all species values to discriminate individual species’ contributions were present in each bioregion, differences among to lobster diet. For modelling of the reserve effect at bioregion in stable isotope values were not tested. Governor Island, stable isotope values of only one Spearman’s rank correlation showed no relationship reserve and one fished location were available, and between carbon (r S = 0.06, p = 0.70, n = 46) or nitrogen not all data were available for each species/phylum. isotope values (r S = 0.16, p = 0.29) and size of Jasus Fatty acid profiles: The diet of lobsters was com- edwardsii , so lobsters from all size classes were pooled pared between fished and reserve areas using princi- for further analyses. pal component analysis (PCA) based on the fatty acid Nitrogen values of Jasus edwardsii were signifi- profiles of Jasus edwardsii and potential food sources. cantly more enriched at fished compared with reserve PCA reduces the number of dimensions produced by areas for both Maria (fished: 14.0 ± 0.3‰; reserve: 13.0 the large number of variables and uses linear correla- ± 0.1‰) and Governor Islands (fished: 13.9 ± 0.2‰; tions (components) to identify those fatty acids that reserve: 13.4 ± 0.1‰; Table 1). Nitrogen values of contribute most to the separation between observed Plocamium angustum were also significantly more groups (Best et al. 2003). PCA was run on each spe- enriched at fished (8.9 ± 0.2‰) compared with reserve cies/phylum separately for fished and reserve areas in areas (6.0 ± 0.1‰). Nitrogen values of Haliotis each bioregion to ensure that potential variability in rubra differed significantly among locations, but not fatty acid profiles of individual species/phylum due to between fished and reserve areas. Carbon values of environmental factors did not preclude subsequent J. edwardsii , H. rubra , Heliocidaris erythrogramma , trophic interpretation of data. For each species/phy- brown algae and P. angustum were significantly differ- lum, a nested ANOVA on the scores of the first princi- ent among locations (Table 1). There were no signifi- pal component (PC1, which described the majority of cant differences in carbon or nitrogen isotope values the variance between phyla) was then used to test between fished and reserve areas for any other spe- for differences among bioregion (random, 2 levels), cies/phyla. whether there was an effect of reserve (fixed, 2 levels) and for differences among location within reserve treatments (random, 5 levels) using the GLM proce- Mixing model of Jasus edwardsii diet dure in SAS. PCA was then run on all species/phyla combined to examine the trophic relationships at IsoSource modelling of δ13 C and δ15 N values at Maria fished and reserve areas in each bioregion. All analy- Island suggested a singular dominant potential con- ses were performed on percent composition data, and tributor to the diet of lobsters at fished (ascidians, 80 to fatty acids that contributed a mean of >1.0% of total 93%) and reserve areas ( Turbo undulatus , 57 to 91%), fatty acids to the fatty acid profile for each species/phy- with all other food sources making much smaller con- 174 Mar Ecol Prog Ser 388: 169–184, 2009

Maria Is. and Governor Is. combined reserve areas at Maria Island (0 to 19%) was similar 16 to that at Governor Island. Turbo undulatus also made a minor contribution to lobster diet in fished areas at Maria Island (0 to 7%) and in fished (0 to J. edwardsii 16%) and reserve areas (0 to 11%) at Governor Island, and was the dominant contributor in reserve C. rodgersi i areas at Maria Island (57 to 91%). Brown and red 12 algae were consistently estimated to be unimportant H. erythrogramma contributors to the diet of lobsters in fished and reserve areas in both bioregions (Fig. 4).

N (‰) H. momus T. undulatus 15 δ P. angustum C. radicosa P. gibbosa H. rubra P. comosa 8 Fatty acid profiles E. radiata Fatty acids 16:0 (7.3 to 55.9% of total fatty acids), 20:4n-6 (4.4 to 19.0%) and 20:5n-3 (3.4 to 13.3%) com- monly occurred in all species/phyla (Table S1 in online supplementary material, see www.int-res.com/articles/ 4 suppl/m388p169_app.pdf ). For Jasus edwardsii , 18:1n- 9 (15.7 to 16.1%) was the most abundant fatty acid, with relatively high levels of 22:6n-3 (8.2 to 8.7%), 18:0 –35 –30 –25 –20 –15 (6.4 to 6.6%) and 16:1n-7 (3.9 to 4.1%). Haliotis rubra δ13 C (‰) and Turbo undulatus were characterised by relatively high levels of 22:5n-3 (8.9 to 9.4%) which was low or Fig. 2. Mean (±SE) stable isotope values of δ15 N and δ13 C for Jasus edwardsii and potential prey items by species ( Haliotis absent in all other phyla. In addition to 20:4n-6 and rubra , Turbo undulatus , Heliocidaris erythrogramma , Centro- 20:5n-3, Heliocidaris erythrogramma and Centro- stephanus rodgersii , Herdmania momus , Cnemidocarpa radi- stephanus rodgersii also had high levels of 20:1n- cosa , Pyura gibbosa ) pooled across bioregion and locations. 7,9,11 (13.6 to 19.7%) and 20:3n-6 (11.7 to 15.1%). Values for autotrophic sources ( Plocamium angustum , Eck- Ascidians had relatively high levels of 18:0 (4.0 to lonia radiata , Phyllospora comosa ) are also included for comparison 8.8%) and 22:6n-3 (1.4 to 8.3%). Fatty acids 14:0 (5.2 to 7.5%), 16:1n-7 (4.5 to 6.3%), 18:1n-9 (17.6 to 22.4%) and 18:4n-3 (3.9 to 7.3%) were common in both brown tributions (Fig. 4). The pattern of likely food source algal species. Fatty acids 14:0 (9.5 to 9.9%), 22:0 + contributions between fished and reserve areas was hydroxy (OH)20:0 (3.4 to 3.9%), 16:1n-7 (2.6 to 3.1%) different for Governor Island. Sea urchins made sub- and 20:3n-6 (3.4 to 3.6%) were the most abundant in stantial contributions to the diet of Jasus edwardsii in the red alga Plocamium angustum . Percentages of both fished and reserve areas but were the most domi- fatty acids for all species/phyla were similar between nant contributor in fished areas at Governor Island (58 fished and reserve areas (Table S1) and this pattern to 71%). Ascidians also made a strong likely contribu- was consistent for absolute concentrations of fatty tion to lobster diet (24 to 53%) in both fished and acids (mg g –1 , not shown). reserve areas but were most pronounced in reserve Spearman’s rank correlation showed no relation- areas at Governor Island. ship between lobster size and PC1 scores derived

Sea urchins were the second most important poten- from the fatty acid profile of Jasus edwardsii (r S = tial contribution to lobster diet in fished areas at 0.16, p = 0.13, n = 91); therefore, lobsters from all Maria Island, but, as previously mentioned, this con- size classes were pooled for all analyses although tribution was much larger at Governor (58 to 71%) size classes are delineated in Fig. 5. All species/ than at Maria Island (0 to 13%). Sea urchins were phyla could be distinguished using PCA based on also an important potential contributor in the Maria fatty acids contributing more than 1% of the lobster Island reserve (4 to 22%) but to a much lesser extent profile (Fig. 5), with the greatest overlap between than at Governor Island. Haliotis rubra was the next Haliotis rubra and Turbo undulatus and some red most important potential food source for lobster in and brown algae samples. PCAs that used a subset both fished (0 to 25%) and reserve (0 to 32%) areas of fatty acids based on metabolic relationships or at Governor Island, but made a relatively minor con- ratios of n-3/n-6 polyunsaturated fatty acids (PUFA) tribution to lobster diet in fished areas at Maria Island can sometimes yield additional information (e.g. (0 to 8%); the potential contribution of H. rubra in Alonzo et al. 2005), but displayed no additional Guest et al.: Trophic effects of fishing Jasus edwardsii 175

16 Maria Is. Reserve Maria Is. Fished

12

P. angustum

N (‰) Brown algae 15 δ 8 H. erythrogramma H. erythrogramma P. angustum T. undulatus Brown algae J. edwardsii T. undulatus H. rubra Ascidians Ascidians 4 J. edwardsii H. rubra

16 Governor Is. Reserve Governor Is. Fished

12 N (‰) 15 δ 8 C. rodgersii C. rodgersii

T. undulatus Brown algae T. undulatus Brown algae P. angustum P. angustum J. edwardsi i 4 H. rubra J. edwardsii H. rubra Ascidians Ascidians

–35 –30 –25 –20 –15 –35 –30 –25 –20 –15 δ13 C (‰) δ13 C (‰)

Fig. 3. Mean (±SE) stable isotope values of δ15 N and δ13 C for Jasus edwardsii and potential prey items corrected for fractionation (3.5‰ for 15 N, and 0.5‰ for 13 C per trophic level). Species names are given in full in Fig. 2. J. edwardsii is assumed to be 2.5 lev- els above its autotrophic source; Haliotis rubra , Turbo undulatus , Heliocidaris erythrogramma and Centrostephanus rodgersii are assumed to be 1 level above; and the remaining ascidians are assumed to be 1.5 levels above their autotrophic source. These val- ues were used in the IsoSource mixing model. Values are shown for reserve and fished treatments for each bioregion. Isotope val- ues for Governor Island were unavailable for some species/phyla. For reserve areas, the red alga Plocamium angustum and the sea urchin C. rodgersii are from Governor Island fished locations; for one fished area, the turbinid T. undulatus and brown algae are from Governor Island reserve (n = 1). For T. undulatus at Maria Island reserve areas and ascidians at Governor Island fished areas, SE are too small to be seen and are shown as a single horizontal line dietary patterns in the present study (see Nelson et acids to PC1 were similar for each bioregion and al. 2002). For all species/phyla combined, at both reserve treatment (Fig. 5). Of those fatty acids that bioregions and at fished and reserve areas, 78.8 to can indicate dietary contribution, 20:4n-6 and 22:5n-3 82.1% of the total variance was explained by PC1 were important in distinguishing among species/ (Fig. 5). Along PC1 at fished and reserve areas, J. phyla along PC1, and 20:3n-6, 20:2n-6, 22:6n-3 and edwardsii was always closest to H. rubra and T. 22:5n-3 were important in distinguishing among undulatus . Sea urchins and red algae were always species/phyla on PC2. furthest from lobsters, and brown algae intermediate PC2 explained 6.4 to 8.6% of the total variance between these groups. The major contributing fatty among species/phyla observed for each bioregion, 176 Mar Ecol Prog Ser 388: 169–184, 2009

Table 1. Results of ANOVAs using δ13 C and δ15 N values for each species/phylum. As there were insufficient replicates of all species/phyla at each bioregion and/or location, species/phyla and bioregion are analysed separately. Data are pooled across location for some species/phyla where there were insufficient data among locations for each treatment to permit analyses. Superscripts (M: Maria Island; G: Governor Island) denote the bioregion(s) analysed. Degrees of freedom are the same for δ13 C and δ15 N and thus only reported once. δ15 N values for Jasus edwardsii , Haliotis rubra and Ecklonia radiata were square root-transformed

Factor df δ13 C δ15 N MS F p MS F p

Jasus edwardsii Reserve effect M 1 0.517 0.13 0.740 0.178 49.49 0.006 Location(Reserve effect) 3 3.921 4.74 <0.001 0.004 0.12 0.947 Error 41 0.827 0.296 Reserve effect G 1 0.561 2.11 0.182 0.641 5.29 0.050 Error 8 0.265 0.121 Haliotis rubra Reserve effect M 1 0.483 0.01 0.920 1.321 7.44 0.072 Location(Reserve effect) 3 40.70 9.07 <0.0001 0.178 5.02 0.004 Error 50 4.487 0.035 Reserve effect G 1 0.055 0.04 0.848 0.014 0.18 0.684 Error 7 1.411 0.078 Ascidians Species M, G 1 0.133 0.05 0.824 7.847 1.41 0.244 Error 31 2.663 5.575 Reserve effect M, G 1 8.857 3.72 0.062 3.637 0.64 0.431 Error 31 2.382 5.711 Heliocidaris erythrogramma Reserve effect M 1 4.293 0.31 0.618 11.570 5.76 0.096 Location(Reserve effect) 3 13.953 6.67 0.001 2.009 1.19 0.331 Error 40 2.093 1.689 Brown algae Species M 1 35.757 6.74 0.012 23.962 2.05 0.587 Error 39 5.599 11.698 Ecklonia radiata Reserve effect M 1 0.082 0.01 0.920 1.231 9.33 0.055 Location(Reserve effect) 3 6.919 0.89 0.458 0.132 0.83 4.984 Error 28 7.759 0.159 Phyllospora comosa Reserve effect M 1.217 0.51 0.550 16.941 2.14 0.281 Location(Reserve effect) 2 2.397 1.16 0.342 7.915 0.29 0.751 Error 14 2.069 27.122 Plocamium angustum Reserve effect M 1 18.328 0.32 0.631 36.791 34.31 0.028 Location(Reserve effect) 2 57.929 3.68 0.048 1.072 3.32 0.062 Error 16 15.750 0.323

fished and reserve areas. Sea urchins and red algae sequent data for each species was pooled across biore- were most remote from lobsters along PC2 and lobsters gions to test for differences in fatty acid profiles equidistant between ascidians and Haliotis rubra . between fished and reserve areas. Differences in the PCA of individual species showed that most of the PC1 scores of fatty acid profiles between Heliocidaris total variance was explained by PC1 for all species (94 erythrogramma and Centrostephanus rodgersii (p < to 99%, Table 2). For some species there was insuffi- 0.001, Table 2) and insufficient numbers of each spe- cient data to allow a comparison of fatty acid profiles cies at a single bioregion meant only a single region for between fished and reserve areas at each bioregion. these species was used to test for differences in fatty For Herdmania momus and Pyura gibbosa , ANOVA acid profiles between fished and reserve areas. For showed significant differences PC1 scores of fatty acid each species/phylum analysed separately, the ANOVA profiles between species (p = 0.001, Table 2) and sub- on PC1 scores of fatty acid profiles showed no signifi- Guest et al.: Trophic effects of fishing Jasus edwardsii 177

100 cant differences between fished and reserve areas 93 91 (Table 2). PC1 scores based on major fatty acids of Haliotis rubra (p = 0.006), and H. erythrogramma (p = 0.039) showed significant differences among locations 80 80 (Reserve effect × Bioregion), and brown algae showed Maria Is. significant differences among bioregion (p = 0.010).

60 DISCUSSION 57

More enriched δ15 N values for lobsters in fished areas 40 than in reserve areas at Maria Island and, to a lesser ex- Source contribution (%) contribution Source tent, Governor Island, provide direct evidence that the diet of Jasus edwardsii differs between areas of low 22 (fished areas) and high (reserve areas) lobster density. 20 19 The results of the IsoSource mixing model for Maria Is- 13 land supports this apparent shift in potential food 10 9 9 8 7 sources with the model indicating lobsters eat a larger 1 4 0 proportion of ascidians in fished areas than they do in 0 δ15 0 0 0 0 0 0 0 0 0 adjacent reserves. Differences in N values of lobster could not be attributed to differences in the size of lob- R F R F R F R F R F R F sters between fished and reserve areas. Turbo undula- tus was identified as the dominant food source in re- 100 serve areas at Maria Island, and although the results of the mixing model for Governor Island support the im- portance of ascidians in the diet of lobsters, there was 80 only a slightly greater contribution of ascidians to the diet of lobsters in reserves compared with fished areas. 71 Sea urchins made a similar contribution to ascidians in Governor Is. reserves at Governor Island and were the dominant 60 food source for lobsters in fished areas in this bioregion. 53 58 Fatty acid profiles of lobsters and potential prey items 49 also highlighted the potential contribution of ascidians but did not suggest any difference in the diet of lobsters 40 37 42 in fished and reserve areas. As such, all subsequent Source contribution contribution (%) Source 32 comparisons of the diet of lobsters between reserve and 25 fished areas refer to the IsoSource mixing model re- sults. Fatty acid profiles indicating Haliotis rubra and T. 20 24 16 undulatus are important prey of lobsters were consis- 11 10 tent with the mixing model results. 10 6 0 1 0 0 0 0 0 0 0 0 0 Lobster diet: reserve vs. fished areas

R F R F R F R F R F R F More enriched values of δ15 N at fished areas com- pared with reserve areas suggest that lobsters in fished H. rubra areas obtain a greater proportion of their diet from Ascidians T. undulatus Sea urchinsBrown algae P. angustum higher trophic levels, although such differences are not Fig. 4. Range of feasible contributions of the 6 potential food large. The ascidians Herdmania momus and Pyura sources to the diet of the southern rock lobster Jasus edwardsii haustor have previously been reported to consume in- after correcting for both 15 N and 13 C fractionation. Bars are the vertebrate larvae (Bingham & Walters 1989) and this is 1st and 99th percentiles for the distribution of feasible contribu- consistent with the higher trophic level assigned to as- tions. Species within phyla (i.e. ascidians, sea urchins and brown algae) are pooled where isotopic signatures between cidians ( H. momus and Pyura gibbosa ) compared with species were not sufficiently distinct to be used in the model. urchins, abalone and the turbinid in the present study. See Fig. 2 for full species names. R: reserve area; F: fished area Note that zooplankton was observed to be a common 178 Mar Ecol Prog Ser 388: 169–184, 2009

2 2 Maria Is. reserve only Maria Is. fished only

1 1 Other 75–5 (0.336) 22:6n-3 (0.274) 22:5n-3 (0.269) Other 75–5 (0.390) 22:2NMI (0.263) 22:5n-3 (0.392)

0 0 PC2 8.6% –1 PC2 7.4% –1

–2 –2 20:3n-6 (–0.481) 24:1 (–0.231) 20:3n-6 (–0.476) 20:2n-6 (–0.193) 22:1n-7,9,11 (–0.300) –3 22:1n-7,9,11 (–0.267) –3 4 4.5 55.5 6 4 4.4 4.8 5.2 5.6 6 Other 75–2 (0.001) PC1 80.0% 16:0 (0.404) Other 75–2 (0.014) PC1 78.8% 16:0 (0.407) 22:2 NMI (0.001) 20:4n-6 (0.375) 22:2NMI (0.092) 20:4n-6 (0.367) 22:0 (0.013) 18:1n-9 (0.339) 22:5n-3 (0.165) 20:5n-3 (0.330)

3 6 Governor Is. reserve only Governor Is. fished only

2 Other 75–5 (0.445) 22:5n-3 (0.439) 22:2NMI (0.365) 22:6n-3 (0.349 16:1n-7 (0.238) Other 75 (0.270) 4

1 J. edwardsii (small) J. edwardsii (medium) 2 J. edwardsii (large) PC2 6.4% PC2 7.4% 0 H. rubra T. undulatus Ascidians 0 –1 Sea urchins Brown algae Red algae 20:3n-6 (–0.398) 20:2n-6 (–0.183) 22:1n-7,9,11 (–0.172) 22:5n-3 (–0.417) 22:2NMI (–0.358) 22:4n-6 (–0.300) –2 –2 4 4.5 5 5.5 6 1 2 3 4 5 6 16:1n-5 (0.007) PC1 82.1% 16:0 (0.387) 16:1n-5 (0.008) PC1 81.5% 16:0 (0.425) 22:0 (0.010) 20:4n-6 (0.349) 22:0 (0.011) 20:4n-6 (0.360) αOH22:0 (0.010) 18:1n-9 (0.345) 21:0 (0.020) 18:1n-9 (0.339)

Fig. 5. Ordination of the first and second principal component (PC) scores, and corresponding loading weights (in parentheses) derived from the major fatty acids contributing >1% to the profile of Jasus edwardsii and potential food sources (see Fig. 2 for full species names) for Maria and Governor Islands at fished and reserve locations. Percentage variance explained by each compo- nent is marked on each axis. Fatty acids listed along each axis are those that contribute most to the distribution of phyla within each region and treatment component of the planktonic community at the time of Fernández-de-Lara et al. 2005) but a wide variety of Jasus edwardsii sampling, suggesting that, at least in- consumers have been reported to eat ascidians (e.g. termittently, ascidians have access to an invertebrate gastropods, chitons, sea stars: Kott 1997, Stotz et al. food source which contributes to their higher trophic 2003; crabs: Bernárdez et al. 2000). The apparent pre- status. dominance of ascidians in the diet of Jasus edwardsii Ascidians have been reported as only a minor com- in fished compared with reserve areas at Maria Island ponent in the diet of Panulirus interruptus (Castañeda- may be due to the reduced competition among lobsters Guest et al.: Trophic effects of fishing Jasus edwardsii 179

Table 2. Results of ANOVAs of scores of the first principal component of the main fatty Factor df MS F p PC1 acids for each species/phylum. Data are score pooled across bioregion for some species/ phyla where there were insufficient data for Jasus edwardsii 0.994 a reserve effect to be analysed. Superscripts Reserve effect 1 0.001 0.08 0.829 (M: Maria Island; G: Governor Island) denote Bioregion 1 0.007 2.73 0.160 the bioregion(s) analysed. Degrees of free- Bioregion × Reserve effect 1 0.001 0.51 0.508 dom are the same for δ13 C and δ15 N and thus Location(Bioregion × Reserve effect) 5 0.002 1.42 0.226 only reported once. Significant differences Error 82 0.002 among species meant that each species was then analysed separately to test for differ- Haliotis rubra 0.992 ences among reserve and fished treatments Reserve effect 1 0.004 0.26 0.699 and location nested within each. PC1 scores Bioregion 1 0.019 1.24 0.308 of Heliocidariserythrogramma were square Bioregion × Reserve effect 1 0.017 1.13 0.330 root-transformed Location(Bioregion × Reserve effect) 6 0.015 4.34 0.006 Error 99 0.003 Turbo undulatus 0.995 Reserve effect 1 0.023 1.36 0.452 for this food source, and thus the poten- Bioregion 1 0.017 3.84 0.121 tially greater availability of ascidians in Bioregion × Reserve effect 1 0.017 3.70 0.127 fished areas. Additionally, the ease with Location(Bioregion × Reserve effect) 4 0.004 1.81 0.168 which lobster can capture ascidians Error 19 0.002 may make them an attractive food Ascidians 0.961 source given their relatively high levels Species 2 0.688 16.62 <0.001 Error 54 2.170 of omega-3 long-chain ( ≥C20 ) PUFA, M,G particularly 22:6 (n-3), which are impor- Herdmania momus 0.987 Reserve effect 1 0.010 0.05 0.822 tant for the functioning of the nervous Error 28 0.200 system, adaptive processes and immu- Pyura gibbosa M,G 0.965 nity to infections and parasitic diseases Reserve effect 1 0.065 2.01 0.187 (Kolakowska et al. 2003). The absence Error 10 0.032 of seasonality in the abundance of Sea urchins M,G 0.992 ascidians examined here may also Species 1 0.200 11.33 <0.001 make them an attractive food source to Error 64 0.018 lobsters given their more continuous Heliocidaris erythrogramma M 0.993 supply. Whilst there are no data on the Reserve effect 1 0.001 0.86 0.412 potential difference in the density of Location(Reserve effect) 3 0.001 3.06 0.039 Error 40 0.0005 ascidians between fished and reserve G areas, Herdmania momus and Pyura Centrostephanus rodgersii 0.995 Reserve effect 1 0.006 7.62 0.110 gibbosa are common species on the east Location(Reserve effect) 2 0.001 0.48 0.625 coast of Tasmania. It remains for future Error 16 0.001 studies to examine the potential rela- Brown algae 0.992 tionship between ascidian density, Reserve effect 1 0.021 1.21 0.470 nutritional quality and lobster diet. Bioregion 1 0.093 13.50 0.010 The slightly higher contribution of Bioregion × Reserve effect 1 0.017 2.52 0.164 ascidians to lobster diet in reserve com- Location(Reserve effect × Bioregion) 6 0.007 1.13 0.353 pared with fished areas at Governor Species 1 0.500 91.69 0.066 × Island, as suggested by the mixing Species Reserve effect 1 0.001 3.70 0.305 Species × Bioregion 1 0.005 0.67 0.447 model, contrasts with that recorded at Species × Reserve effect × Bioregion 1 0.0003 0.03 0.864 Maria Island, and could be related to Species × Location 6 0.008 1.34 0.249 differences in the availability of ascid- (Reserve effect × Bioregion) ian prey between bioregions. Addition- Error 81 0.006 ally, the small size of the reserve at Plocamium angustum 0.994 Governor Island (~1 km of coastline) Bioregion 1 0.013 0.611 0.439 may not be sufficient to ensure that the Error 38 0.021 trophic structure in the reserve reflects Reserve effect 1 0.040 1.59 0.297 Location(Reserve effect) 3 0.025 1.20 0.322 that of unfished habitat in this biore- Error 35 0.721 gion. The role of reserve size in preserv- 180 Mar Ecol Prog Ser 388: 169–184, 2009

ing habitat structure and trophic function in marine Changes in behaviour of potential prey such as systems is poorly understood and beyond the scope of abalone, and low or decreased abundance of preferred the present study, but is increasingly a topic of exami- prey type such as ascidians and sea urchins, may nation (e.g. Guest & Connolly 2006, Martins et al. explain the predominance of T. undulatus in the diet of 2007). The greater similarity between the potential lobster at Maria Island reserves. Further work is contributions of ascidians (and sea urchins) in fished required to determine if T. undulatus also alter their and reserve areas at Governor Island indicates differ- size at emergence in the presence of more and larger ences in the diet of lobsters may be attributed to differ- lobsters to confirm the validity of this hypothesis. Dif- ences among bioregion rather than a specific reserve ferences in the contribution of T. undulatus between effect. bioregions could be due to the regional availability of Sea urchins were also identified as an important food this species. source for lobsters at Governor Island, with a slightly Haliotis rubra was not a major contributor to lobster greater contribution to lobster diet in reserves than diet but ostensibly made greater contributions at Gov- adjacent fished areas. This is consistent with previous ernor Island than that at Maria Island. While anecdotal studies that also report sea urchins to be an important evidence suggests that abalone are a common prey food source for lobsters ( Homarus americanus : Carter item for Jasus edwardsii , there are no studies that & Steele 1982; Jasus lalandii : Mayfield et al. 2001; J. demonstrate the relative contribution of abalone to edwardsii : Andrew & MacDiarmid 1991, Pederson & lobster diet. Mayfield et al. (2001), however, indicated Johnson 2006). The predominance of lower order sea that consumption of abalone by J. lalandii declined urchins in the diet of lobsters at Governor Island may where more preferred food such as mussels were account for depleted δ15 N values of lobsters in this available. In the present study, greater consumption of bioregion. more preferred and/or easily available food such as At Maria Island, sea urchins contributed less to the ascidians may explain the relatively low contribution diet of lobsters than at Governor Island, irrespective of of abalone to lobster diet. treatment. The density of Heliocidaris erythrogramma is lower at Governor Island (~10 ind. 200 m –2 ) than at Maria Island (>200 ind. 200 m –2 , Barrett et al. 2009), Lobster diet: previous studies most likely because the more exposed reef at Governor Island is less favourable to H. erythrogramma (Under- Previous characterisation of lobster diet using stable wood et al. 1991, Edgar 2000). It is also possible that isotope or fatty acid analysis has generally been as a lower densities of sea urchins at Governor Island are means to describe the nutritional requirements of post- due to the greater predation on sea urchins by lobsters pueruli and juvenile Jasus edwardsii in aquaculture to in this bioregion. However, lower lobster density at maximize lobster growth rate and condition for com- Governor Island compared with Maria Island suggests mercial exploitation (James & Tong 1997, Crear et al. that despite lower sea urchin density (Barrett et al. 2002, Johnston et al. 2003, Ward et al. 2003, Nelson et 2009), there may be sufficient sea urchins available to al. 2004). To date, no other studies have used stable support lobsters in this bioregion. isotopes of either carbon or nitrogen to examine the Turbo undulatus was a major contributor to the diet diet of adult, wild J. edwardsii . The fatty acid profile of of lobsters in reserves at Maria Island, but made minor J. edwardsii from the present study is similar to those contributions to the diet of lobsters in fished areas or at of wild lobsters used in a previous study to examine Governor Island, regardless of treatment. The density nutritional and taste differences between wild and cul- of T. undulatus did not differ inside and outside the tured lobster (Nelson et al. 2005). reserve at Maria Island and thus cannot explain the For some species of lobsters, ontogenetic shifts in larger contribution of T. undulatus to lobster diet in the diet have been recorded between early and late juve- Maria Island reserve. The shift by lobsters towards a nile stages owing to the different social organisation of more molluscan diet, however, indicates the potential these life-history stages (Johnston 2003). We found no influence of protection on lobster diet, and is likely a evidence of any difference in diet between the lobsters result of the increase in lobster density on the behav- of different size classes (<80, 80–120 and >120 mm CL) iour and/or density of alternate food sources such as examined here. This is most likely due to the similarity ascidians, abalone and sea urchins. For example, Bar- in the size of the lobsters and the limitations of chemi- rett et al. (2009) hypothesized that the apparent cal tracer techniques in detecting minor shifts in the decline in abundance of small abalone in Maria Island relative contributions of same-type food sources. For reserves could be due to changes in juvenile abalone example, wholesale shifts in dietary choices associated behaviour which delays the size at which abalone with lobsters are usually between pueruli or post- emerge in the presence of more and larger lobsters. pueruli and juvenile stages, where diets shift from Guest et al.: Trophic effects of fishing Jasus edwardsii 181

algal- to invertebrate-dominated (Jernakoff et al. Figs. 2 & 5), and thus determining the relative contri- 1993). All of the lobsters examined here were late- bution of those groups to a consumer’s diet. The com- juvenile to adult stages, where changes in diet most bined chemical tracer approach, however, is limited in likely comprise a change in the proportion of existing distinguishing the contribution of individual species invertebrate food sources rather than a complete within phyla to the diet of lobsters. Despite being sta- replacement of food types. tistically different, the stable isotope and fatty acid val- ues of various ascidian, sea urchin and brown algae species could not be distinguished within their respec- Spatial variability in chemical tracers tive phyla for the purposes of trophic analyses (also see Johns et al. 1979, Nelson et al. 2002), and so the dietary For some species, δ13 C and/or δ15 N values were contribution of individual species within these phyla significantly different among locations within reserve/ remains unclear. fished areas or bioregion, however, the spatial variabil- As stable isotopes reveal a bulk signal of all biomol- ity of lobsters and other consumers did not track those ecules present in a sample, the lack of separation in of their potential food items among locations. Variabil- isotopic signatures between species shown in this and ity in δ13 C values of the red alga Plocamium angustum other studies is partly explained by the taxonomic and may indicate a difference in carbon source or the rate functional similarity of food items (e.g. algae, grazers). of productivity of red algae at Location 5, which was δ13 C is most strongly influenced by carbon source and more depleted in 13 C than other locations sampled. the physiology of the target species (Farquhar et al. Small-scale spatial variability in δ13 C values of the con- 1989, Raven et al. 2002), which may be similar in sumers Haliotis rubra and Heliocidaris erythrogramma closely related taxonomic groups. δ15 N values are could indicate minor shifts in dietary composition influenced by the trophic status of a consumer, and among locations, although for H. erythrogramma this become difficult to detect for species of the same or is unlikely as shifts in δ13 C values of consumers were overlapping trophic positions. For example, the iso- not consistent with those of primary producers at the topic separation of algal species, or the detection of a same locations. P. angustum and H. rubra also showed proportional change to lobster diet (in response to significant differences in δ15 N values among locations. changes in lobster density) is difficult in situations For P. angustum , variation in δ15 N values may be due where lobsters are consuming a wide range of food + 15 to differences in nitrogen source (NO 2 or NH 4 , Peter- items from differing trophic levels. δ N values can also son & Fry 1987) among locations. For H. rubra , differ- be influenced by diet quality (Vander Zanden & Ras- ences in δ13 C and δ15 N values among locations were mussen 2001) and can vary between the tissue types of minor and negligible in terms of food web studies, but the target species (Pitt et al. 2009). Manipulative feed- may suggest minor variation in the proportion of bacte- ing trials were beyond the scope of the present study rial and macroalgal food sources to the diet of abalone but may help to calibrate the feeding relationships among locations. indicated by stable isotopes in the present context. Fatty acid profiles exhibited less spatial variability By contrast, fatty acid analyses reveal the lipid frac- than that of stable isotopes showing no differences tion of a consumer diet, which can be labile and vary among treatments, and only minor differences for a according to the physiology and nutritional condition few species among bioregion (brown alga) or location of the target species (Ju & Harvey 2004). In addition, (Haliotis rubra and Heliocidaris erythrogramma ). This the lipid content of the target species may influence suggests that fatty acids are less sensitive to propor- the fatty acid profile of the tissues/species being exam- tional changes in the diet of consumers than those of ined (Ju & Harvey 2004), with different fatty acids bulk signal stable isotopes and are best applied to mobilised at varying rates both within and between resolve large differences in dietary contribution and species. This variation in lipid content and the mobili- separating the role of potential food sources that can- sation of individual fatty acids that occurs over differ- not be discriminated using stable isotopes (e.g. bacte- ent time periods to that of stable isotopes may explain ria, Guest et al. 2008). potential differences in the signatures between the 2 techniques. Again, manipulative feeding trials are therefore required to calibrate the feeding relation- Resolution of chemical tracers and lobster diet ships observed here. Previous studies show that the lipid content of most The present study demonstrates the capacity of sta- species used in the present study are low in lipids ble isotope and fatty analyses as powerful tools in dis- (algae, Johns et al. 1979; abalone, Nelson et al. 2002; tinguishing between broad phylogenetic groups (e.g. lobster, Nelson et al. 2005). For lobsters, lipids in mus- lobster, abalone, sea urchins, brown and red algae, cular tissues such as walking legs are primarily stored 182 Mar Ecol Prog Ser 388: 169–184, 2009

as phospholipids, which are resilient to short-term data on sea urchin, turbinid and lobster density in fished and changes in environmental and physiological factors reserve areas. D. Holdsworth managed the CSIRO GC-MS (Cockcroft 1997), and are therefore considered useful facility. Thanks to 3 anonymous reviewers whose comments helped to improve the manuscript. for understanding longer term dietary changes (Corazze 1999). Variation in the lipid content and the corresponding LITERATURE CITED fatty acid profile among different tissue types within a ➤ Alonzo F, Virtue P, Nicol S, Nichols PD (2005) Lipids as single consumer can also indicate the diet of a con- trophic markers in Antarctic krill. II. Lipid composition of sumer over different time periods. Here, the use of sea the body and digestive gland of Euphausia superba in urchin lanterns for fatty acid analysis, compared to controlled conditions. Mar Ecol Prog Ser 296:65–79 lipid-rich gonads thought to be consumed by lobsters, ➤ Andrew NL, MacDiarmid AB (1991) Interrelations between may explain the lower contribution of sea urchins to sea urchins and spiny lobsters in northeastern New Zealand. Mar Ecol Prog Ser 70:211–222 lobster diet indicated by fatty acid profiles compared Barrett NS, Edgar GJ, Buxton CD (2009) Changes in inverte- with stable isotopes. It would be useful for future work brate and macroalgal populations within Tasmanian to examine differences in fatty acid profiles of lanterns marine reserve in the decade following protection. J Exp and gonads to verify the contribution of sea urchins to Mar Biol Ecol 370:104–119 ➤ Bernárdez C, Freire J, González-Gurriarán E (2000) Feeding lobster diet using fatty acid analyses. of the spider crab Maja squinado in rocky subtidal areas of the Ria de Arousa (north-west Spain). J Mar Biol Assoc UK 80:95–102 CONCLUSIONS Best NJ, Bradshaw CJA, Hindell MA, Nichols PD (2003) Ver- tical stratification of fatty acids in the blubber of southern elephant seals ( Mirounga leonine ): implications for diet This is the first study to apply the use of combined analysis. Comp Biochem Physiol B 134:253–263 chemical tracer techniques to examine the trophic ➤ Bingham BL, Walters LJ (1989) Solitary ascidians as predators effects of removing a significant predator from temper- of invertebrate larvae: evidence from gut content analyses ate reefs. The present study compared the chemical and plankton samples. J Exp Mar Biol Ecol 131:147–159 Buxton C, Barrett N, Haddon M, Gardner C, Edgar GJ (2006) tracer profiles of lobsters in fished areas of low lobster Evaluating the effectiveness of marine protected areas as density and reserve areas of high lobster density. Dif- a fisheries management tool. Report No. FRDC 1999/162. ferences in δ15 N values of lobsters between fished and Fisheries Research and Development Corporation, Deakin reserve areas indicated that lobsters eat a greater pro- ➤ Carter JA, Steele DH (1982) Stomach contents of immature portion of food items from higher trophic levels in lobsters ( Homarus americanus ) from Placentia Bay, New- foundland. Can J Zool 60:337–347 fished areas than adjacent reserves. Differences in the Castañeda-Fernández-de-Lara V, Serviere-Zaragoza E, stable isotope values between treatments, however, Hernández-Vázquez S, Butler MJ (2005) Feeding ecology were not large and demonstrate the dietary plasticity of juvenile spiny lobster, Panulirus interruptus on the of lobsters and the difficulty in evaluating potential Pacific coast of Baja California Sur, Mexico. NZ J Mar Freshw Res 39:425–435 trophic cascades in response to fishing pressure. Christie WW (1982) Lipid analysis. Pergamon Press, Oxford Future application of chemical tracer techniques to ➤ Cockcroft AC (1997) Biochemical composition as a growth detect changes in trophic structure and diet in predictor in male west-coast rock lobster ( Jasus lalandii ). response to fishing pressure may indicate more pro- Mar Freshw Res 48:845–856 nounced effects for dietary specialists. For generalist Corazze G (1999) Lipid nutrition. In: Guillaume J, Metailler R, Kaushik S, Bergot P (eds) Nutrition and feeding of fish and predators such as Jasus edwardsii , conclusions about crustaceans. Springer, London, p 111–130 fishing effects should be cautious, as it may be difficult ➤ Crear B, Hart P, Thomas C, Barclay M (2002) Evaluation of to demonstrate potential trophic cascades until there commercial shrimp grow-out pellets as diets for juvenile are notable changes in the biota and functioning of southern rock lobster, Jasus edwardsii : influence on growth, survival, color, and biochemical composition. reef systems. The present study also provides insight J Appl Aquacult 12:43–57 into the diet of wild J. edwardsii and is the first to Dahlgren CP, Sobel J (2000) Designing a Dry Tortugas eco- recognise the role of ascidians and turbinid gastropods logical reserve: How big is big enough? To do what? Bull to lobster diet. Further work is required to identify the Mar Sci 66:707–709 species of ascidians important to J. edwardsii . ➤ Dalsgaard J, St John M (2004) Fatty acid biomarkers: valida- tion of food web and trophic markers using 13 C-labelled fatty acids in juvenile sandeel ( Ammodytes tobianus ). Can J Fish Aquat Sci 61:1671–1680 Acknowledgements. We thank B. Connell, S. Fava, S. Ibbott, ➤ Dalsgaard J, St John M, Kattner G, Müller-Navarra D, Hagen and R. Kilpatrick for assistance in the field. Thanks to G. W (2003) Fatty acid trophic markers in the pelagic marine Edgar and J. Valentine, who helped with identification of red environment. Adv Mar Biol 46:225–340 algal species. The assistance of B. Mooney with laboratory Edgar GJ (2000) Australian marine life: the plants and ani- processing and interpretation of fatty acid profiles was espe- mals of temperate waters. Reed New Holland, Chatswood cially helpful. Thanks to N. Barrett and G. Edgar for use of ➤ Edgar GJ, Barrett NS (1997) Short term monitoring of biotic Guest et al.: Trophic effects of fishing Jasus edwardsii 183

change in Tasmanian marine reserves. J Exp Mar Biol Florida Keys patch reef marine protected areas. Mar Ecol Ecol 213:261–279 Prog Ser 349:111–123 ➤ Edgar GJ, Barrett NS (1999) Effect of the declaration of ➤ Lewis T, Nichols PD, McMeekin TA (2000) Evaluation of marine reserves on Tasmanian reef fishes, invertebrates extraction methods for recovery of fatty acids from lipid- and plants. J Exp Mar Biol Ecol 242:107–144 producing microheterotrophs. J Microbiol Methods 43: ➤ Farquhar GD, Ehlerlinger JR, Hubrick KT (1989) Carbon iso- 107–116 tope discrimination and photosynthesis. Annu Rev Plant ➤ Martins GM, Hawkins SJ, Thompson RC, Jenkins SR Physiol Plant Mol Biol 40:503–537 (2007) Community structure and functioning in inter- ➤ Follesa MC, Cuccu D, Cannas R, Sabatini A, Cau A (2007) tidal rock pools: effects of pool size and shore height at Emigration and retention of Palinurus elephas (Fabricins, different successional stages. Mar Ecol Prog Ser 329: 1787) in a central western Mediterranean marine pro- 43–55 tected area. Sci Mar 71:279–285 ➤ Mayfield S, de Beer E, Branch GM (2001) Prey preference and ➤ Guest MA, Connolly RM (2006) Movement of carbon among the consumption of sea urchins and juvenile abalone by estuarine habitats: the influence of saltmarsh patch size. captive rock lobsters ( Jasus lalandii ). Mar Freshw Res 52: Mar Ecol Prog Ser 310:15–24 773–780 ➤ Guest MA, Nichols PD, Frusher SD, Hirst AJ (2008) Evidence ➤ McCutchan JH, Lewis WM, Kendall C, McGrath CC (2003) of abalone ( Haliotis rubra ) diet from combined fatty acid Variation in trophic shift for stable isotope ratios of carbon, and stable isotope analyses. Mar Biol 153:579–588 nitrogen, and sulfur. Oikos 102:378–390 ➤ James PJ, Tong LJ (1997) Differences in growth and moult ➤ Melville AJ, Connolly RM (2003) Spatial analysis of stable iso- frequency among post-pueruli of Jasus edwardsii fed tope data to determine primary sources of nutrition for fresh, aged or frozen mussels. Mar Freshw Res 48:931–934 fish. Oecologia 136:499–507 ➤ Jaschinski S, Brepohl DC, Sommer U (2008) Carbon sources Nelson MM, Leighton DL, Phleger CF, Nichols PD (2002) and trophic structure in an eelgrass Zostera marina bed, Comparison of growth and lipid composition in the green based on stable isotope and fatty acid analyses. Mar Ecol abalone, Haliotis fulgens , provided specific macroalgal Prog Ser 358:103–114 diets. Comp Biochem Physiol B 131:695–712 ➤ Jennings S (2000) Patterns and prediction of population recov- ➤ Nelson MM, Crear BJ, Nichols PD, Ritz DA (2004) Growth ery in marine reserves. Rev Fish Biol Fish 10:209–231 and lipid composition of phyllosomata of the southern rock ➤ Jernakoff P, Phillips BF, Fitzpatrick JJ (1993) The diet of post- lobster, Jasus edwardsii , fed enriched Artemia . Aquac puerulus western rock lobster, Panulirus cygnus George, Nutr 10:237–246 at Seven Mile Beach, Western Australia. Aust J Mar Nelson MM, Olley J, Crear BJ, Lewis T, Nichols PD (2005) Freshw Res 44:649–655 Comparison of wild and cultured adult southern rock lob- ➤ Johns RB, Nichols PD, Perry GJ (1979) Fatty acid composition ster, Jasus edwardsii : growth, sensory analysis and oil of ten marine algae from Australian waters. Phytochem- composition. Food Aust 57:499–509 istry 18:799–802 ➤ Pederson HG, Johnson CR (2006) Predation of the sea urchin ➤ Johnston DJ (2003) Ontogenetic changes in digestive enzyme Heliocidaris erythrogramma by rock lobsters ( Jasus activity of the spiny lobster, Jasus edwardsii (Decapoda; edwardsii ) in no-take marine reserves. J Exp Mar Biol Ecol Palinuridae). Mar Biol 143:1071–1082 336:120–134 ➤ Johnston DJ, Calvert KA, Crear BJ, Carter CG (2003) Dietary ➤ Peterson BJ (1999) Stable isotopes as tracers of organic matter carbohydrate/lipid ratios and nutritional condition in juve- input and transfer in benthic food webs: a review. Acta nile southern rock lobster, Jasus edwardsii . Aquaculture Oecol 20:479–487 220:667–682 ➤ Peterson BJ, Fry B (1987) Stable isotopes in ecosystem stud- ➤ Ju SJ, Harvey HR (2004) Lipids as markers of nutritional con- ies. Annu Rev Ecol Syst 18:293–320 dition and diet in the Antarctic krill Euphausia superba ➤ Phillips DL, Gregg JW (2003) Source partitioning using stable and Euphausia crystallorophias during austral winter. isotopes: coping with too many sources. Oecologia 136: Deep-Sea Res II 51:2199–2214 261–269 ➤ Karnovsky NJ, Hobson KA, Iverson S, Hunt GL Jr (2008) Sea- ➤ Phillips KL, Jackson GD, Nichols PD (2003a) Temporal varia- sonal changes in diets of seabirds in the North Water tions in the diet of the squid Moroteuthis ingens at Mac- Polynya: a multiple-indicator approach. Mar Ecol Prog Ser quarie Island: stomach contents and fatty acid analyses. 357:291–299 Mar Ecol Prog Ser 256:135–149 ➤ Kharlamenko VI, Kiyashko SI, Imbs AB, Vyshkvartzev DI Phillips KL, Nichols PD, Jackson GD (2003b) Size-related (2001) Identification of food sources of invertebrates from dietary changes observed in the squid Moroteuthis ingens the seagrass Zostera marina community using carbon and at Falkland Islands: stomach contents and fatty acid analy- sulphur stable isotope ratio and fatty acid analyses. Mar ses. Polar Biol 26:474–485 Ecol Prog Ser 220:103–117 ➤ Pinnegar JK, Polunin NV, Francour P, Badalamenti F and oth- Kolakowska A, Olley J, Dunstan GA (2003) Fish lipids. In: ers (2000) Trophic cascades in benthic marine ecosystems: Zikorski ZE, Kolakowska A (eds) Chemical and functional lessons for fisheries and protected-area management. properties of food lipids. CRC Press, Boca Raton, FL, Environ Conserv 27:179–200 p 221–264 ➤ Pitt KA, Connolly RM, Meziane T (2009) Stable isotope and Kott P (1997) Tunicates (Subphylum Tunicata). In: Shepherd fatty acid studies in energy and nutrient studies of jelly- SA, Davies M (eds) Marine invertebrates of southern Aus- fish: a review. Hydrobiologia 616:119–132 tralia, part III. South Australian Research and Develop- Quinn GP, Keough MJ (2002) Experimental design and data ment Institute, Adelaide, p 1092–1255 analysis for biologists. Cambridge University Press, Cam- ➤ Krahn MM, Pitman RL, Burrows DG, Herman DP, Pearce RW bridge (2008) Use of chemical tracers to assess diet and persistent ➤ Raven JA, Johnston AM, Kubler JE, Korb R and others (2002) organic pollutants in Antarctic Type C killer whales. Mar Mechanistic interpretation of carbon isotope discrimina- Mamm Sci 24:643–663 tion by marine macroalgae and seagrasses. Funct Plant ➤ Kramer LK, Heck KL Jr (2007) Top-down trophic shifts in Biol 29:355–378 184 Mar Ecol Prog Ser 388: 169–184, 2009

➤ Roberts CM, Polunin NVC (1991) Are marine reserves effec- tative evaluation of the diet and feeding behaviour of tive in management of reef fisheries? Rev Fish Biol Fish the carnivorous gastropod, Concholepas concholepas 1:65–91 (Braguiere, 1789) (Muricidae) in subtidal habitats in the ➤ Scheffer M, Carpenter S, de Young B (2005) Cascading effects southeastern Pacific upwelling system. J Shellfish Res 22: of overfishing marine systems. Trends Ecol Evol 20: 147–164 579–581 ➤ Thomas CJ, Cahoon LB (1993) Stable isotope analyses differ- ➤ Schroeter SC, Reed DC, Kushner DJ, Estes JA, Ono DS (2001) entiate between different trophic pathways supporting The use of marine reserves in evaluating the diver fishery rocky-reef fishes. Mar Ecol Prog Ser 95:19–24 for the warty sea cucumber ( Parastichopus parvimensis ) in ➤ Tierney M, Nichols PD, Wheatley KE, Hindell MA (2008) Califonia, USA. Can J Fish Aquat Sci 58:1773–1781 Blood fatty acids indicate inter- and intra-annual variation ➤ Shears NT, Babcock RC (2003) Continuing trophic cascade in the diet of Adelie penguins: comparison with stomach effects after 25 years of no-take marine protection. Mar content and stable isotope analysis. J Exp Mar Biol Ecol Ecol Prog Ser 246:1–16 367:65–74 ➤ Shears NT, Grace RV, Usmar NR, Kerr V, Babcock RC (2006) ➤ Tucker S, Bowen WD, Iverson SJ (2008) Convergence of diet es- Long-term trends in lobster populations in a partially pro- timates derived from fatty acids and stable isotopes within tected vs. no-take marine park. Biol Conserv 132:222–231 individual grey seals. Mar Ecol Prog Ser 354:267–276 ➤ Sheppard SK, Harwood JD (2005) Advances in molecular Underwood AJ, Kingsford MJ, Andrew NL (1991) Patterns in ecology: tracking trophic links through predator–prey shallow subtidal marine assemblages along the coast of food-webs. Funct Ecol 19:751–762 New South Wales. Aust J Ecol 6:231–249 Sonnenholzner JI, Ladah LB, Lafferty KD (2009) Cascading Vander Zanden MJ, Rasmussen JB (2001) Variation in δ15 N effects of fishing on Galapagos rocky reef communities: and δ13 C trophic fractionation: implications for aquatic reanalysis using corrected data. Mar Ecol Prog Ser 375: food web studies. Limnol Oceanogr 46:2061–2066 209–218 ➤ Vanderklift MA, Ponsard S (2003) Sources of variation in con- ➤ Soreide JE, Falk-Petersen S, Hegseth EN, Hop H, Carroll ML, sumer-diet δ15 N enrichment: a meta-analysis. Oecologia Hobson KA, Blachowiak-Samolyk K (2008) Seasonal feed- 136:169–182 ing strategies of Calanus in the high-Arctic Svalbard ➤ Waddington K, MacArthur L (2008) Diet quality and muscle region. Deep-Sea Res II 55:2225–2244 tissue location influence consumer–diet discrimination in ➤ Stevens CJ, Limén H, Pond DW, Gélinas Y, Juniper SK (2008) captive-reared rock lobsters ( Panulirus cygnus ). Mar Biol Ontogenetic shifts in the trophic ecology of two alvinocari- 154:569–576 did shrimp species at hydrothermal vents on the Mariana ➤ Ward LR, Carter CG, Crear BJ, Smith DM (2003) Optimal Arc, western Pacific Ocean. Mar Ecol Prog Ser 356: dietary protein level for juvenile southern rock lobster, 225–237 Jasus edwardsii , at two lipid levels. Aquaculture 217: Stotz WB, Gonzalez SA, Caillaux L, Aburto J (2003) Quanti- 483–500

Editorial responsibility: Yves Cherel, Submitted: May 6, 2008; Accepted: May 4, 2009 Villers-en-Bois, France Proofs received from author(s): July 28, 2009 The following supplement accompanies the article

Trophic effects of fishing southern rock lobster Jasus edwardsii shown by combined fatty acid and stable isotope analyses

M. A. Guest 1, *, S. D. Frusher 1, P. D. Nichols 2, 3 , C. R. Johnson 4, K. E. Wheatley 4

1Tasmanian Aquaculture and Fisheries Institute, Marine Research Laboratories, Nubeena Crescent, Taroona, Tasmania 7053, Australia 2CSIRO Marine and Atmospheric Research, Castray Esplanade, Hobart, Tasmania 7000, Australia 3Antarctic and Climate Ecosystems, University of Tasmania, Private Bag 80, Hobart, Tasmania 7001, Australia 4School of Zoology, University of Tasmania, Private Bag 5, Hobart, Tasmania 7001, Australia

*Email: [email protected]

Marine Ecology Progress Series 388:169–184 (2009)

Table S1. Mean percentage fatty acid composition (±SE) of Jasus edwardsii and potential prey items for fished and reserve treat- ments. As general linear models showed no significant differences between Maria and Governor Island bioregions (except for brown algae), fatty acid values have been pooled across bioregions for each species. SFA: saturated fatty acids; MUFA: monoun- saturated fatty acids; PUFA: polyunsaturated fatty acids. All double bonds are cis geometry unless otherwise indicated. Asterisks indicate those fatty acids whose identity could not be separated due to chromatographic overlap

Fatty acids Jasus Haliotis Turbo Heliocidaris Centrostephanus Herdmania edwardsii rubra undulatus erythrogramma rodgersii momus

Fished n=44 n=74 n=20 n=27 n=9 n=26 14:0 1.0 ± 0.1 1.9 ± 0.1 1.0 ± 0.0 3.3 ± 0.2 3.9 ± 0.2 2.5 ± 0.3 i15:0 0.1 ± 0.0 0.1 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.2 ± 0.0 1.2 ± 0.1 15:0 0.6 ± 0.0 1.0 ± 0.0 1.0 ± 0.0 0.1 ± 0.0 0.5 ± 0.1 1.0 ± 0.1 16:0 12.9 ± 0.2 19.9 ± 0.1 23.5 ± 0.4 9.1 ± 0.2 7.8 ± 0.3 13.1 ± 0.9 17:0 1.2 ± 0.0 1.9 ± 0.0 1.8 ± 0.1 0.1 ± 0.0 0.3 ± 0.0 1.1 ± 0.0 18:0 6.4 ± 0.1 6.2 ± 0.1 6.5 ± 0.2 5.0 ± 0.1 2.6 ± 0.1 4.3 ± 0.1 20:0 0.7 ± 0.0 0.4 ± 0.0 0.5 ± 0.0 0.5 ± 0.0 0.6 ± 0.1 3.3 ± 0.2 21:0 0.2 ±0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 1.3 ± 0.1 22:0 + OH20:0* 0.7 ± 0.0 0.2 ± 0.0 0.3 ± 0.0 0.0 ± 0.0 0.1 ± 0.0 2.0 ± 0.2 Sum SFA 24.0 ± 0.4 31.4 ± 0.3 34.6 ± 0.8 18.1 ± 0.6 16.1 ± 0.8 29.8 ± 1.9 16:1n-7 3.9 ± 0.1 1.5 ± 0.0 1.0 ± 0.1 0.2 ± 0.0 0.6 ± 0.1 3.4 ± 0.3 16:1n-5 0.2 ± 0.0 0.3 ± 0.0 0.3 ± 0.0 1.5 ± 0.1 0.2 ± 0.0 0.5 ± 0.0 18:1n-9 16.1 ± 0.4 6.8 ± 0.1 6.3 ± 0.2 1.6 ± 0.0 1.6 ± 0.1 5.1 ± 0.2 18:1n-7 3.5 ± 0.1 7.6 ± 0.1 1.8 ± 0.1 3.5 ± 0.1 2.3 ± 0.1 5.9 ± 0.3 20:1n-7,9,11 + 20:3n-3* 2.4 ± 0.1 2.7 ± 0.1 1.9 ± 0.1 13.6 ± 0.6 19.5 ± 0.4 1.8 ± 0.1 22:1n-7,9,11,13* 0.3 ± 0.0 0.8 ± 0.0 0.0 ± 0.0 4.9 ± 0.3 3.1 ± 0.2 0.9 ± 0.1 Sum MUFA 26.4 ± 0.8 19.7 ± 0.4 11.2 ± 0.4 25.3 ± 1.2 27.3 ± 0.9 17.6 ± 0.9 18:2n-6 1.2 ± 0.0 1.1 ± 0.0 3.4 ± 0.2 0.0 ± 0.0 0.2 ± 0.0 1.9 ± 0.1 18:4n-3 0.5 ± 0.0 0.4 ± 0.0 0.3 ± 0.0 0.1 ± 0.0 0.2 ± 0.0 1.4 ± 0.1 20:2n-6 1.2 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 1.5 ± 0.1 1.2 ± 0.3 0.4 ± 0.0 20:3n-6 + 20:2 NMI* 0.6 ± 0.1 0.5 ± 0.0 0.3 ± 0.0 11.9 ± 0.3 15.1 ± 0.4 0.4 ± 0.0 20:4n-6 11.1 ± 0.2 11.5 ± 0.1 12.3 ± 0.3 18.5 ± 0.4 14.6 ± 0.6 6.8 ± 0.5 20:5n-3 13.2 ± 0.3 6.1 ± 0.2 3.4 ± 0.2 10.1 ± 0.3 6.2 ± 0.3 9.5 ± 0.5 22:2NMI + C22PUFA* 0.3 ± 0.0 4.6 ± 0.1 1.2 ± 0.0 0.4 ± 0.0 0.4 ± 0.0 0.2 ± 0.0 22:2NMI2 + 22:4n-3* 0.2 ± 0.0 0.1 ± 0.0 2.9 ± 0.2 0.7 ± 0.1 0.3 ± 0.1 0.1 ± 0.0 22:4n-6 1.4 ± 0.1 2.4 ± 0.0 5.4 ± 0.2 0.0 ± 0.0 0.9 ± 0.1 0.4 ± 0.0 22:5n-3* 2.0 ± 0.1 9.4 ± 0.1 9.7 ± 0.4 0.0 ± 0.0 0.5 ± 0.1 0.6 ± 0.1 22:6n-3 8.7 ± 0.4 0.2 ± 0.0 0.8 ± 0.1 0.0 ± 0.0 1.9 ± 0.3 6.7 ± 0.5 Sum PUFA 40.5 ± 1.3 36.3 ± 0.6 39.7 ± 1.5 43.2 ± 1.2 41.4 ± 2.2 28.5 ± 2.0 Sum Other >1%a 4.4 ± 0.2 7.9 ± 0.2 9.6 ± 0.3 6.7 ± 0.2 8.7 ± 0.4 9.6 ± 0.9 Sum Other <1%b 4.8 ± 0.3 4.7 ± 0.2 4.8 ± 0.4 6.7 ± 0.7 6.5 ± 1.0 12.6 ± 1.2 Reserve n=47 n=35 n=7 n=19 n=9 n=5 14:0 1.3 ± 0.1 1.8 ± 0.1 1.1 ± 0.0 3.7 ± 0.3 3.1 ± 0.3 2.2 ± 0.5 i15:0 0.1 ± 0.0 0.1 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.3 ± 0.0 1.0 ± 0.2 15:0 0.6 ± 0.0 0.7 ± 0.0 1.0 ± 0.1 0.1 ± 0.0 0.6 ± 0.0 0.8 ± 0.1 16:0 12.0 ± 0.2 19.8 ± 0.2 23.2 ± 0.4 8.9 ± 0.2 7.3 ± 0.2 12.7 ± 1.5 2 Table S1 (continued)

Fatty acids Jasus Haliotis Turbo Heliocidaris Centrostephanus Herdmania edwardsii rubra undulatus erythrogramma rodgersii momus

17:0 1.2 ± 0.0 1.6 ± 0.0 1.5 ± 0.0 0.1 ± 0.0 0.4 ± 0.0 1.0 ± 0.0 18:0 6.6 ± 0.1 6.6 ± 0.1 6.6 ± 0.2 5.3 ± 0.1 2.7 ± 0.1 4.7 ± 0.2 20:0 0.7 ± 0.0 0.8 ± 0.3 0.5 ± 0.0 0.5 ± 0.0 0.7 ± 0.0 3.6 ± 0.4 21:0 0.2 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.1 ± 0.0 0.0 ± 0.0 1.2 ± 0.3 22:0 + OH20:0* 0.6 ± 0.0 0.2 ± 0.0 0.3 ± 0.1 0.0 ± 0.0 0.2 ± 0.0 2.0 ± 0.5 Sum SFA 23.3 ± 0.5 31.5 ± 0.7 34.3 ± 0.8 18.7 ± 0.6 15.2 ± 0.7 29.2 ± 3.6 16:1n-7 4.1 ± 0.1 1.4 ± 0.1 0.9 ± 0.1 0.2 ± 0.0 0.6 ± 0.1 2.9 ± 0.5 16:1n-5 0.3 ± 0.0 0.3 ± 0.1 0.2 ± 0.0 1.7 ± 0.1 0.2 ± 0.0 0.4 ± 0.0 18:1n-9 15.7 ± 0.4 7.7 ± 0.2 6.2 ± 0.1 1.7 ± 0.1 1.5 ± 0.1 6.1 ± 0.3 18:1n-7 3.6 ± 0.1 7.8 ± 0.1 1.9 ± 0.1 3.6 ± 0.1 2.3 ± 0.1 4.2 ± 0.3 20:1n-7,9,11 + 20:3n-3* 2.9 ± 0.2 2.8 ± 0.1 2.0 ± 0.1 13.7 ± 0.3 19.7 ± 0.4 1.3 ± 0.1 22:1n-7,9,11,13* 0.4 ± 0.0 0.8 ± 0.0 0.0 ± 0.0 4.1 ± 0.2 3.4 ± 0.2 0.7 ± 0.1 Sum MUFA 26.9 ± 0.9 20.8 ± 0.5 11.2 ± 0.5 25.0 ± 0.8 27.6 ± 0.8 15.7 ± 1.3 18:2n-6 1.1 ± 0.0 1.1 ± 0.0 2.8 ± 0.3 0.1 ± 0.0 0.2 ± 0.0 1.9 ± 0.1 18:4n-3 0.5 ± 0.0 0.4 ± 0.0 0.2 ± 0.0 0.1 ± 0.0 0.2 ± 0.0 1.2 ± 0.2 20:2n-6 1.1 ± 0.1 0.0 ± 0.0 0.0 ± 0.0 1.5 ± 0.2 1.3 ± 0.3 0.2 ± 0.1 20:3n-6 + 20:2 NMI* 1.0 ± 0.1 0.4 ± 0.0 0.4 ± 0.1 11.7 ± 0.3 14.2 ± 0.4 0.4 ± 0.0 20:4n-6 11.4 ± 0.3 11.9 ± 0.2 11.7 ± 0.7 19.0 ± 0.4 15.4 ± 0.6 8.4 ± 1.1 20:5n-3 13.3 ± 0.3 5.0 ± 0.2 4.9 ± 0.5 9.2 ± 0.3 5.9 ± 0.3 9.6 ± 0.9 22:2NMI + C22PUFA* 0.3 ± 0.0 4.8 ± 0.1 1.1 ± 0.1 0.4 ± 0.0 0.4 ± 0.0 0.1 ± 0.0 22:2NMI2 + 22:4n-3* 0.2 ± 0.0 0.1 ± 0.0 2.1 ± 0.5 0.7 ± 0.1 0.3 ± 0.1 0.2 ± 0.0 22:4n-6 1.5 ± 0.1 2.8 ± 0.1 5.1 ± 0.5 0.0 ± 0.0 1.0 ± 0.0 0.5 ± 0.1 22:5n-3* 2.0 ± 0.1 8.9 ± 0.2 11.4 ± 0.4 0.0 ± 0.0 0.6 ± 0.0 0.6 ± 0.2 22:6n-3 8.2 ± 0.4 0.2 ± 0.0 0.6 ± 0.1 0.0 ± 0.0 2.3 ± 0.2 8.3 ± 0.9 Sum PUFA 40.6 ± 1.5 35.6 ± 0.8 40.5 ± 3.1 42.6 ± 1.3 41.7 ± 2.0 31.4 ± 3.6 Sum Other >1%a 4.5 ± 0.3 8.0 ± 0.3 9.7 ± 1.6 6.3 ± 0.3 8.3 ± 0.5 10.3 ± 1.9 Sum Other <1%b 4.8 ± 0.3 4.0 ± 0.3 4.3 ± 1.0 7.3 ± 0.7 7.1 ± 0.8 11.9 ± 1.6

Fatty acids Pyura Cnemidocarpa Ecklonia Phylospora Plocamium gibbosa radicosa radiata commosa angustum

Fished n=6 n=5 n=36 n=24 n=25 14:0 3.9 ± 0.8 2.7 ± 0.5 6.9 ± 0.3 5.2 ± 0.2 9.5 ± 0.5 i15:0 0.8 ± 0.2 0.6 ± 0.1 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 15:0 1.8 ± 0.2 0.8 ± 0.1 0.8 ± 0.0 0.5 ± 0.0 1.1 ± 0.1 16:0 21.4 ± 1.6 16.4 ± 1.0 20.6 ± 0.7 22.3 ± 0.5 55.9 ± 1.1 17:0 1.0 ± 0.2 1.4 ± 0.1 0.3 ± 0.0 0.5 ± 0.2 0.3 ± 0.0 18:0 4.5 ± 0.4 8.0 ± 0.6 1.4 ± 0.2 0.9 ± 0.1 1.2 ± 0.0 20:0 3.9 ± 0.2 1.0 ± 0.1 1.3 ± 0.1 0.6 ± 0.0 0.3 ± 0.0 21:0 1.1 ± 0.4 0.2 ± 0.1 0.0 ± 0.0 0.4 ± 0.1 0.0 ± 0.0 22:0 + OH20:0* 1.1 ± 0.5 0.7 ± 0.1 0.0 ± 0.0 0.3 ± 0.0 3.9 ± 0.3 Sum SFA 39.4 ± 4.3 31.8 ± 2.7 31.4 ± 1.4 30.8 ± 1.1 72.3 ± 2.0 16:1n-7 5.4 ± 0.4 8.0 ± 0.9 6.0 ± 0.4 5.0 ± 0.2 3.1 ± 0.1 16:1n-5 0.6 ± 0.2 0.9 ± 0.2 0.5 ± 0.0 0.6 ± 0.1 0.0 ± 0.0 18:1n-9 8.1 ± 0.8 7.4 ± 0.5 22.4 ± 0.7 17.6 ± 0.3 1.8 ± 0.1 18:1n-7 3.4 ± 0.4 5.9 ± 0.7 0.3 ± 0.1 0.2 ± 0.0 2.1 ± 0.1 20:1n-7,9,11 + 20:3n-3* 1.5 ± 0.3 0.7 ± 0.1 1.0 ± 0.1 0.8 ± 0.1 1.3 ± 0.1 22:1n-7,9,11,13* 0.7 ± 0.3 0.6 ± 0.1 0.0 ± 0.0 0.2 ± 0.0 0.0 ± 0.0 Sum MUFA 19.7 ± 2.4 23.4 ± 2.4 30.1 ± 1.2 24.3 ± 0.7 8.3 ± 0.3 18:2n-6 2.1 ± 0.2 2.5 ± 0.1 3.7 ± 0.1 6.2 ± 0.2 0.7 ± 0.0 18:4n-3 2.1 ±0.5 1.8 ± 0.2 7.3 ± 0.6 4.0 ± 0.3 0.0 ± 0.0 20:2n-6 0.1 ± 0.1 0.5 ± 0.0 0.0 ± 0.0 0.7 ± 0.1 0.7 ± 0.0 20:3n-6 + 20:2 NMI* 0.2 ± 0.1 0.5 ± 0.1 0.8 ± 0.0 1.5 ± 0.0 3.6 ± 0.2 20:4n-6 7.4 ± 0.7 4.4 ± 1.0 15.9 ± 0.4 17.7 ± 0.6 6.8 ± 0.6 20:5n-3 8.2 ± 1.3 12.6 ± 1.5 5.3 ± 0.2 5.0 ± 0.3 6.3 ± 0.6 22:2NMI + C22PUFA* 0.1 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 22:2NMI2 + 22:4n-3* 0.1 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.1 ± 0.0 0.0 ± 0.0 22:4n-6 1.3 ± 1.0 0.3 ± 0.1 0.0 ± 0.0 0.4 ± 0.0 0.0 ± 0.0 22:5n-3 0.2 ± 0.1 0.4 ± 0.1 0.0 ± 0.0 0.1 ± 0.0 0.0 ± 0.0 22:6n-3 1.4 ± 0.6 6.9 ± 1.0 0.0 ± 0.0 0.2 ± 0.0 0.0 ± 0.0 Sum PUFA 23.1 ± 4.5 29.8 ± 4.3 33.0 ± 1.4 36.0 ± 1.6 18.1 ± 1.4 Sum Other >1%a 9.1 ± 1.6 5.3 ± 1.5 0.2 ± 0.1 3.6 ± 0.3 0.2 ± 0.0 Sum Other <1%b 8.7 ± 3.2 9.1 ± 2.0 5.2 ± 0.6 5.3 ± 0.7 1.1 ± 0.2 Reserve n=6 n=5 n=24 n=18 n=15 14:0 4.5 ± 0.6 1.0 ± 0.4 7.5 ± 0.4 5.2 ± 0.2 9.9 ± 0.5 i15:0 0.9 ± 0.1 0.6 ± 0.1 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 Table S1 (continued) 3

Fatty acids Jasus Haliotis Turbo Heliocidaris Centrostephanus Herdmania edwardsii rubra undulatus erythrogramma rodgersii momus

15:0 2.0 ± 0.1 0.5 ± 0.1 0.8 ± 0.1 0.5 ± 0.1 1.1 ± 0.1 16:0 18.4 ± 0.5 10.3 ± 1.4 22.3 ± 0.3 23.1 ± 0.4 55.4 ± 2.6 17:0 1.2 ± 0.2 1.4 ± 0.1 0.3 ± 0.0 0.2 ± 0.0 0.3 ± 0.0 18:0 4.0 ± 0.5 8.8 ± 0.6 1.1 ± 0.1 0.8 ± 0.1 1.3 ± 0.1 20:0 4.1 ± 0.3 1.8 ± 0.4 1.3 ± 0.1 0.6 ± 0.1 0.3 ± 0.0 21:0 1.8 ± 0.2 0.3 ± 0.1 0.1 ± 0.0 0.4 ± 0.1 0.0 ± 0.0 22:0 + OH20:0* 2.3 ± 0.3 1.1 ± 0.3 0.0 ± 0.0 0.4 ± 0.0 3.4 ± 0.4 Sum SFA 39.4 ± 2.6 25.9 ± 3.5 33.4 ± 1.0 31.3 ± 0.9 71.7 ± 3.7 16:1n-7 4.8 ± 0.4 3.7 ± 1.3 6.3 ± 0.3 4.5 ± 0.3 2.6 ± 0.2 16:1n-5 0.6 ± 0.0 1.1 ± 0.7 0.5 ± 0.0 0.8 ± 0.1 0.0 ± 0.0 18:1n-9 7.8 ± 0.5 8.6 ± 0.5 22.1 ± 0.4 18.0 ± 0.4 2.1 ± 0.1 18:1n-7 2.5 ± 0.2 6.1 ± 1.2 0.4 ± 0.1 0.3 ± 0.0 1.6 ± 0.1 20:1n-7,9,11 + 20:3n-3* 1.9 ± 0.1 1.3 ± 0.6 1.2 ± 0.1 0.7 ± 0.1 1.1 ± 0.1 22:1n-7,9,11,13* 1.3 ± 0.1 0.7 ± 0.4 0.1 ± 0.0 0.3 ± 0.0 0.0 ± 0.0 Sum MUFA 19.0 ± 1.4 21.6 ± 4.7 30.6 ± 0.8 24.5 ± 0.9 7.5 ± 0.5 18:2n-6 2.1 ± 0.1 1.6 ± 0.2 3.5 ± 0.1 6.1 ± 0.3 0.6 ± 0.0 18:4n-3 1.5 ± 0.2 1.3 ± 0.1 6.3 ± 0.5 3.9 ± 0.3 0.0 ± 0.0 20:2n-6 0.2 ± 0.1 0.2 ± 0.1 0.0 ± 0.0 0.5 ± 0.0 0.5 ± 0.0 20:3n-6 + 20:2 NMI* 0.2 ± 0.1 0.7 ± 0.3 0.8 ± 0.0 1.5 ± 0.0 3.4 ± 0.3 20:4n-6 7.1 ± 0.5 8.4 ± 1.2 14.8 ± 0.3 18.5 ± 0.7 6.2 ± 0.8 20:5n-3 5.8 ± 0.7 7.6 ± 1.3 4.5 ± 0.2 4.8 ± 0.3 8.5 ± 1.3 22:2NMI + C22PUFA* 0.2 ± 0.1 0.1 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 22:2NMI2 + 22:4n-3* 0.1 ± 0.0 0.1 ± 0.0 0.0 ± 0.0 0.1 ± 0.0 0.0 ± 0.0 22:4n-6 0.5 ± 0.1 0.4 ± 0.1 0.0 ± 0.0 0.5 ± 0.0 0.0 ± 0.0 22:5n-3 0.3 ± 0.1 0.2 ± 0.1 0.0 ± 0.0 0.1 ± 0.0 0.0 ± 0.0 22:6n-3 2.8 ± 0.4 3.7 ± 0.9 0.0 ± 0.0 0.3 ± 0.0 0.0 ± 0.0 Sum PUFA 20.7 ± 2.3 24.2 ± 4.3 29.9 ± 1.1 36.5 ± 1.6 19.1 ± 2.5 Sum Other >1%a 8.3 ± 1.3 13.0 ± 2.4 0.4 ± 0.1 2.7 ± 0.2 0.5 ± 0.1 Sum Other <1%b 12.6 ± 2.9 14.5 ± 3.9 5.6 ± 0.8 5.0 ± 0.8 1.2 ± 0.3 aOther >1%: ·OH16:0 (OH denotes hydroxyl), ·OH21:0, ·OHbranched22:0, 3 fatty aldehydes (derived from plasmalogens; identified by a base peak at m/z 75) bOther <1%: i14:0, 14:1n-7, 14:1n-5, 4,812TMTD (trimethyl tetradecanoic acid), a15:0, 15:1n-6, C16PUFA, i16:0, 16:1n-9, 16:1, 16:2, 16:1n-13t, 7Methyl17:1, i17:0, ‚OHbranched15:0, ·OHbranched15:0, a17:0, 17:1n-8, 17:1n-6, 5 fatty aldehydes, 18:3n-6, C18PUFA, i18:0, 18:1n-9, 18:3n-3, 18:1n-7t, ·OH16:1, 18:1n-5, ‚OH16:0, i19:0, ·OHbranched17:0, ·OHi17:0, ·OHa17:0, 19:1, ·OH17:0, C20PUFA, 20:2Non Methylene Interrupted (NMI), 20:4n-3, ·OH18:0, 20:1, C21PUFA, 21:5n-3, 21:1, 22:5n-6, 22:3 n-6, 23:0, C24PUFA, ·OH22:1, 22:1, 24:1, ·OH22:0, 24:0 =

55*3).==2= ;.)*3(*=4+=&'&143*=
&1.49.8=7:'7& =).*9= +742=(42'.3*)=+&99>=&(.)=&3)=89&'1*=.84945*= &3&1>8*8== =
_=_=#:*89 &`=%_=&_='.(-418 '`=( `=_&_=(7:8-*7 &`=_)_=*.789 &= = &&82&3.&3=6:&(:19:7*=&3)=.8-*7.*8=389.9:9*`=&7443&`=&82&3.&= '=&7.3*=&3)=92485-*7.(=*8*&7(-`=4'&79`=:897&1.&= (39&7(9.(=&3)=1.2&9*=(48>89*28`= 3.;*78.9>=4+=&82&3.&`=4'&79`=&82&3.&= = '897&(9= '&143*=&7*=(42243=-*7'.;47*8=9-74:,-4:9=9*25*7&9*=&3)=9745.(&1=<&9*78`=&3)=>*9= 9-*= (4397.':9.43= 4+= 7*)= &3)= '74<3= 2&(74&1,&*= 94= 9-*= ).*9= 4+= <.1)= &'&143*= 7*2&.38= :3(1*&7_= 3= 9-*= 3479-*73= -*2.85-*7*`= &):19= &'&143*= &7*= (438.)*7*)= 94= (438:2*= 57*)42.3&391>='74<3=&1,&*`=':9=.3=9-*=84:9-*73=-*2.85-*7*=&'&143*=&7*=9-4:,-9=94= 57*+*7=7*)=&1,&*_=43;*39.43&1=2*9-4)8=8:(-=&8=,:9=(439*39=&3&1>8.8=&3)=+**).3,=97.&18= 574;.)*= 842*= .38.,-9= .394= ).*9= (-4.(*`= ':9= 9-*= &884(.&9*)= '.&8*8= 4+= 9-*8*= 9*(-3.6:*8= (7*&9*=:3(*79&.39>=8:774:3).3,=9-*=&+47*2*39.43*)=;&7.&'.1.9>=.3=&'&143*=).*9_=&*=:8*= (42'.3*)=89&'1*=.84945*=&3)=+&99>=&(.)=&3&1>8.8=94=)*9*72.3*=9-*=7*1&9.;*=(4397.':9.43= 4+= 7*)= &1,&*`= '74<3= &1,&*= &3)= )*97.9:822.(74&1,&*= 94= 9-*= ).*9= 4+= <.1)= &'&143*= .3= &82&3.&3=<&9*78_=9&'1*=.84945*8=4+=(&7'43=8:,,*89=9-&9='74<3=&1,&*=&3)=)*97.9:8=&7*= &=247*=.25479&39=84:7(*=4+=(&7'43=9-&3=7*)=&1,&*_=&99>=&(.)=&3&1>8.8=(43+.72*)=9-*= 1&7,*7= (4397.':9.43= 4+= '74<3= &1,&*= 94= 9-*= ).*9= 4+= &'&143*`= &3)= &184= .)*39.+.*)= 9-*= '&(9*7.&1=&3)=).&942=(42543*39=4+=)*97.9:8=94='*=&3=.25479&39=(4397.':947=94=&'&143*= ).*9_=-*8*=7*8:198=8-4<=(42'.3*)=:8*=4+=(-*2.(&1=97&(*78=94='*=&=5742.8.3,=9*(-3.6:*= +47= 7*841;.3,= &'&143*= ).*9`= &3)= (-&11*3,*= (:77*39= 5*7(*59.438= 7*,&7).3,= 85&9.&1= ;&7.&'.1.9>=.3=&'&143*=).*9=(-4.(*_= = +*><47)8a= &'&143*=).*9`=2&(74&1,&*`=89&'1*=.84945*8`=+&99>=&(.)8=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,*- = =

23974):(9.43= '&143*= &7*= <.)*1>= ).897.':9*)= .3= 9*25*7&9*= &3)= 9745.(&1= <&9*78= 9-74:,-4:9= 9-*= <471)= ).3)'*7,= +33,_= -*>= &7*= &= ;&1:*)= (422*7(.&1= 85*(.*8= <-48*= ).*9&7>= 57*+*7*3(*8=-&;*='**3=;&7.4:81>=)*8(7.'*)`=':9=(438.)*7&'1*=:3(*79&.39>=7*2&.38=&8=94= 9-*= (4397.':9.43= 4+= 2&/47= &1,&1= ,74:58= 94= &'&143*= 3:97.9.43_= 3= 9-*= 3479-*73= -*2.85-*7*`= +**).3,= 57*+*7*3(*= 97.&18= .3= &6:&7.&= 8:,,*89*)= '74<3= &1,&1= 85*(.*8= *_,_=
&2.3&7.&=8.3(1&.7.. `= &(74(>89.8=5>7.+*7& `= *7*4(>89.8=1:*90*&3& `= ,7*,.&=2*3?.*8..`=(0143.&= 2&=.2& = <*7*= (438.)*7*)= .25479&39= 94= &'&143*= ).*9=  &1.49.8= 7:+*8(*38 `= _= +:1,*38 `= _= 2.)&* = )*.,-943= &3)= /441449.&3= +30-b= /&70&.= ]= 57.++.9-8= +320b= &.39*7= ]= 89*8= +33,b= 7*1843= *9= &1_= ,**,_= 3= 9-*= 84:9-*73= -*2.85-*7*`= +**).3,= 57*+*7*3(*= 97.&18= .3= &6:&7.&= .3).(&9*)=7*)=&1,&*=*_,_= 14(&2.:2 =85_= 9*74(1&).&=(&5.11&(*& `=85&7&,458.8=&72&9& =<*7*= 9-*=57*+*77*)=+44)=4+=&'&143*= &1.49.8=7:'7& `= _=1&*;.,&9& `= _=74*. a=8**=4&1*=]=:&>=+33,b= -*5-*7)=]=9*.3'*7,=+33,b`=1*2.3,=+33/`=':9='74<3=&1,&*=*_,_= ->1148547&=(4248& `= "&7,&88:2 =85_=-&;*='**3=+4:3)=.3=9-*=,:9=4+=<.1)=&'&143*=-*5-*7)=+31-'b=&*118=]= =**8.3,=+323_== = *;*7&1= (-*2.(&1= &3)= 5->8.(&1= +&(9478= &7*= 9-4:,-9= 94= .3+1:*3(*= ).*9= 57*+*7*3(*= 4+= -&1.49.)8_= 47= *=&251*`= 8:'89&39.&1= ).++*7*3(*8= '*9<**3= 541>5-*341.(= (439*39= 4+= 3479-*73=&3)=84:9-*73=-*2.85-*7*='74<3=&1,&*=9*.3'*7,=+323=-&;*='**3=1.30*)=94= ).*9=57*+*7*3(*=4+=&'&143*=.3=9-*8*=7*,.438=&.39*7=]=89*8=+33,_=3=&)).9.43`=).*9&7>= 57*+*7*3(*= 4+= &'&143*= 2&>= '*= .3+1:*3(*)= '>= &1,&1= 94:,-3*88= (-&3*= *9= &1_= +33.`= 3:97.9.43&1= ;&1:*= 1*2.3,= +33/`= &3)= 9-*= &':3)&3(*= &3)= 9-*7*+47*= &;&.1&'.1.9>= 4+= &1,&*=94=&'&143*=-*5-*7)=+31-'_== = -*= .3-*7*39= '.&8*8= &884(.&9*)= <.9-= (42243= 2*9-4)8= 4+= *;&1:&9.3,= &'&143*= ).*9= (4397.':9*= 94= 9-*= ).++.(:19>= .3= (1&7.+>.3,= 9-*= 7*1&9.;*= (4397.':9.43= 4+= ).++*7*39= &1,&1= 84:7(*8=94=&'&143*=).*9=.3=(42'.3&9.43=<.9-`=47=8*5&7&9*=+742`=&3=*=&2.3&9.43=4+=9-*= 2*(-&3.828= 9-&9= ).(9&9*= ).*9= (-4.(*_= 47= *=&251*`=&6:&7.&= &3)= .3= 8.9: = +**).3,= 97.&18= *_,_=-*5-*7)=]=9*.3'*7,=+33,b=1*2.3,=+33/=2&>=.3974):(*=&79.+&(98=.394=(438:2*7= ).*9= (-4.(*= @*9*7843= ]= /1&(0= +33._= .11*7= &3)= 5&>147)= ,**1= +4:3)= (&,*8= &3)= &884(.&9*)= (&,*8(4397418= 94= 7*):(*= <&9*7= +14<='>= :5= 94= .1= .3= -.,-8*3*7,>= 8:'9.)&1= &3)=.39*79.)&1=*3;.7432*398`=9-:8=-&;.3,=9-*=549*39.&1=94=&19*7=+**).3,='*-&;.4:7=9-&9= .8= )*5*3)*39= 43= (:77*39= +14<= 8:(-= &8= 9-&9= )*8(7.'*)= +47= &1.49.8= 1&*;.,&9& = -*5-*7)= +31/_==(42243=&79.+&(9=&884(.&9*)=<.9-=,:9=(439*39=&3&1>8.8=*_,_=-*5-*7)=+31-'b= &*118= ]= =**8.3,= +323= .8= 9-&9= .9= (&3= 4;*7*89.2&9*= 9-48*= +44)= .9*28= 1*88= 7&5.)1>= ).,*89*)=&3)=:3)*7*89.2&9*=247*=1&'.1*=+44)=.9*28=5**=+323b=:&18,&&7)=*9=&1_=,**-b= -*55&7)= ]= &7<44)= ,**/_= 47= *=&251*`= '74<3= &1,&*= -&;*= '**3= +4:3)= 94= '*= ).,*89*)=247*=814<1>=.3=9-*=,:9=4+= _=2.)&* =:&>=]=440=+33/=&3)= _=7:'7& =4&1*=]= :&>=+33,=9-&3=7*)=&1,&*`=9-:8=1.2.9.3,=9-*=:8*=4+=,:9=(439*39=&3&1>8.8=&8=&=2*&38=94= &((:7&9*1>=)*9*72.3*=9-*=7*1&9.;*=(4397.':9.43=4+=7*)=&3)='74<3=&1,&*=94=&'&143*=).*9_== = -*2.(&1=97&(*78=8:(-=&8=89&'1*=.84945*=&3)=+&99>=&(.)=&3&1>8*8=&7*=2*&38='>=<-.(-=9-*= .)*39.9>= 4+= +44)= 9-&9= .8= &88.2.1&9*)= '>= &= (438:2*7= &3)= 9-*7*+47*= 4+= 3:97.9.43&1=

,*. = %74/*(9=34_=,**.2*+- = =

.25479&3(*= 2&>= '*= )*9*72.3*)_= -*= (-*2.(&1= 97&(*7= &5574&(-= -&8= &);&39&,*8= 4;*7= (43;*39.43&1= 2*9-4)8= 4+= ).*9&7>= &3&1>8.8= 8:(-= &8= +**).3,= 97.&18= &3)= ,:9= (439*39= &3&1>8.8`= &8= .9= 4;*7(42*8= 9-*= 3**)= +47= (4397.;*)= 1&'47&947>= (43).9.438= &3)= )4*8= 349= 7*6:.7*=+44)=.9*28=94='*=57*8*39=.3=9-*=,:9=4+=&=(438:2*7=+47=.)*39.+.(&9.43_=-*='&8.8= 4+= 9-*= (-*2.(&1= 97&(*7= &5574&(-= .8= 9-&9= (438:2*78= .3(47547&9*= 9-*= 2&70*7`= 47= 8.,3&9:7*=4+=9-*.7=+44)=84:7(*=.394=9-*.7=842&9.(=&3)=49-*7=9.88:*8=<.9-=2.3.2&1=47= 57*).(9&'1*= (-&3,*8= 574;.).3,= &3= .39*,7&9*)= 7*(47)= 4+= 9-*= 2&.3= +44)= .9*28= .3= 9-*.7= ).*9=@*9*7843=+333b=:&18,&&7)=]=9=E4-3=,**._== = 9&'1*=.84945*=8.,3&9:7*8=7*+*7=94=9-*=;&7.&9.43=.3=9-*=7&9.4=4+=7&7*=-*&;>=.84945*8=*_,_= +- `= +/ 7= 94= 9-*= 247*= (42243= 1.,-9*7= .84945*8= *_,_= +, `= +. 7= .3= 9-*= 9&7,*9= 47,&3.82= 7*1&9.;*= 94= &3= .39*73&9.43&1= 89&3)&7)= @*9*7843= ]= 7>= +321_= 8= (&7'43= (-&3,*8= ;*7>= 1.991*= '*9<**3= 8:((*88.;*= 9745-.(= 1*;*18= *:+`= (:9(-&3= *9= &1_= ,**-`= 9-*= (&7'43= .84945*=(&3=4+9*3=.3).(&9*=9-*=:19.2&9*=84:7(*=4+=57.2&7>=574):(9.43=&9=9-*='&8*=4+=&= (438:2*7=).*9_=-*=3.974,*3=.84945*=*=5*7.*3(*8=,7*&9*7=+7&(9.43&9.43=5*7=9745-.(=1*;*1= -8.=&3)=.8=9-:8=:8*)=94=.3+*7=9-*=9745-.(=89&9:8=4+=&=(438:2*7`=':9=2&>=&184=7*+1*(9= 3.974,*3=84:7(*=(:9(-&3=*9=&1_=,**-_=.,3&9:7*=+&99>=&(.)8=.3(1:)*=.3).;.):&1=+&99>= &(.)8=9-&9=&7*=7&7*`=&3)=:3.6:*=7&9.48=4+=(422431>=4((:77.3,=+&99>=&(.)8`='49-=4+=<-.(-= (&3= '*= 7*+1*(9*)= .3= 9-*= +&99>= &(.)= 574+.1*= 4+= &= (438:2*7_= -*= (42'.3*)= :8*= 4+= 89&'1*= .84945*8=&3)=+&99>=&(.)=&3&1>8.8=9-*7*+47*=,.;*8=&=,7*&9*7=(&5&(.9>=9-&3=9-&9=4+=&=8.3,1*= 9*(-3.6:*=94=).8(7.2.3&9*='*9<**3=549*39.&1=+44)=84:7(*8=(4397.':9.3,=94=9-*=).*9=4+=&= (438:2*7_== = @7*;.4:8=(-&7&(9*7.8&9.43=4+=&'&143*=).*9=:8.3,=89&'1*=.84945*=47=+&99>=&(.)=&3&1>8.8=-&8= ,*3*7&11>='**3=&8=&=2*&38=94=)*8(7.'*=9-*=3:97.9.43&1=7*6:.7*2*398=4+=/:;*3.1*=&'&143*= .3= &6:&(:19:7*= 94= 2&=.2.8*= &'&143*= ,74<9-= 7&9*= &3)= 8:7;.;&1= +47= (422*7(.&1= *=514.9&9.43=57:'*79=*9=&1_=,**.b=:=*9=&1_=,**0_=-*7*=-&;*='**3=34=89:).*8=9-&9=-&;*= :8*)= (42'.3*)= 89&'1*= .84945*= &3)= +&99>= &(.)= &3&1>8.8= 94= )*9*72.3*= 9-*= ).*9= 4+= <.1)= &'&143*_=-.8=89:)>=:8*8=89&'1*=.84945*8=4+=(&7'43=&3)=3.974,*3=&3)=+&99>=&(.)=&3&1>8.8= 94=).8(7.2.3&9*='*9<**3=9-*=549*39.&1=741*=4+=7*)=&3)='74<3=&1,&*=94=9-*=).*9=4+=<.1)= &'&143*=43=9-*=*&89=(4&89=4+=&82&3.&_== =
*9-4)8= -*=).*9=4+=<.1)=&'&143*= &1.49.8=7:'7& =<&8=89:).*)=&9=+.;*=14(&9.438=&9=&7.&=81&3)`= *&89*73= &82&3.&`= :897&1.&= .,:7*= /3_= )4(&9.438= <*7*= 8*5&7&9*)= '>= &9= 1*&89= 43*= 0.142*97*`=&3)=<.9-.3=*&(-=14(&9.43`=2:19.51*=8.9*8=<*7*=8&251*)=9-&9=<*7*=8*5&7&9*)= '>=&5574=.2&9*1>=+**=2*97*8=94=*38:7*=8&251*8=<*7*=7*57*8*39&9.;*=4+=*&(-=14(&9.43= 3=-=-=+47=14(&9.438=+`=,=&3)=-=+47='49-=89&'1*=.84945*=&3)=+&99>=&(.)=&3&1>8*8b=3=-=-=+47= 14(&9.438=.`=/`=+47=+&99>=&(.)=&3&1>8*8b=&3)=3=-=+=+47=89&'1*=.84945*=&3&1>8*8_='&143*= 2*&3= 8.?*= +*2= 22`= )= -_0/= 8*`= 7&3,*= /*:+2*= 22`= <*7*= (411*(9*)= +742= )*59-8= 4+= &5574=.2&9*1>=/:1=2*97*8_=42243=7*)=&1,&*= 14(&2.:2=&3,:89:2 `= _=).1&9&9:2 =&3)= -&(*14(&75:8= 5*5*74(&75:8 `= '74<3= &1,&*=  (0143.&= 7&).&9& `= ->1148547&= (4248& = &3) = #:7;.11&*&=549&947:2 =&3)=)*97.9:8=<*7*=(411*(9*)=&9=9-*=8&2*=14(&9.438=&8=&'&143*=&3)=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,*/ = =

&1<&>8= &9= 9-*= 8*;*382*97*= )*59-= .39*7;&1= <.9-= 9-*= *=(*59.43= 4+= #_= 549&947:2 = <-.(-= ,74<8=247*=(422431>=.3=8-&114<*7=<&9*78_=-.8=85*(.*8=<&8=(411*(9*)=&8=(148*=94=9-*= +.;*82*97*=)*59-=.39*7;&1=&8=5488.'1*_=),&7=&3)=/&77*99=+331`=+333=)*8(7.'*=9-*=7*)= &3)='74<3=&1,&1=(4;*7=&9=9-*=+.;*82*97*=)*59-=.39*7;&1=&9=9-*8*=14(&9.438_=3=&;*7&,*`= 7*)=&1,&1=85*(.*8=(4257.8*)=++:,.=4+=&1,&1=(4;*7`=&3)='74<3=&1,&*=(4257.8*)=&'4:9= .*:2*=4+=&1,&1=(&345>=(4;*7=4;*7=9-*=8.=8>*&7=5*7.4)_=8=&'&143*=2&>=(438:2*=1.;*`= )7.+9= 47= )*97.9&1= &1,&1= (42543*398= ;.&= '74<8.3,= 9-*= 7**+= 8:7+&(*`= -*5-*7)= +31-'`= )*97.9&1=+7&,2*398=<.9-.3=9-*=7**+=2&97.==<*7*=&184=*=&2.3*)_=:*97.9:8=.3=9-*=(:77*39= (439*=9=7*+*78=94=82&11=5&79.(:1&9*=47,&3.(=2&99*7=9-&9=8*991*8=.394=9-*=.39*789.9.&1=85&(*8= <.9-.3=9-*=7**+=2&97.=_=-*2.(&1=97&(*7=574+.1*8=4+=1&7,*=)7.+9=&1,&*=<*7*=349=*=&2.3*)= 85*(.+.(&11>=&8=57*;.4:8=89:).*8=-&;*=8-4<3=9-&9=9-*=)*(42548.9.43=4+=&1,&*=4;*7=0*: +,/= )&>8= (&:8*8= 431>= 97.;.&1= 5+= (-&3,*8= .3= 9-*= (&7'43= 7&9.4= 4+= 9-*= 84:7(*= &1,&1= 2&9*7.&1=9*5-*3843=*9=&1_=+320b=*3943=]=.9?=+322_=:*97.9:8=<&8=(411*(9*)=2&3:&11>= <-.189= 43=  /= '>= 8(7&5.3,= 8:7+&(*= 2&9*7.&1= 8*).2*39`= 47,&3.(= 2&99*7= &3)= 2.(74&1,&*= +742= 8&3)>= 5&9(-*8= 3*89*)= <.9-.3= 9-*= 7**+= 94= &= )*59-= 4+= &5574=.2&9*1>= 43*=(*39.2*97*=:8.3,=&=43*81.97*=(411*(9.43=/&7_=11=8&251*8=<*7*=+74?*3=&+9*7=(411*(9.43_= = &251*8=<*7*=9-&<*)=&3)=&'&143*=&3)=&1,&1=8&251*8=7.38*)=.3=).89.11*)=<&9*7=57.47=94= 574(*88.3,_= 2&11= &24:398= 4+= *3(7:89.3,= (&1(&7*4:8= *5.5->9.(= &1,&*= <*7*= &184= 7*24;*)= +742= 2&(74&1,&*`= :8.3,= &= ):11= 7&?47='1&)*=':9= <*7*= 349= *=&2.3*)= &8= 9-*>= <*7*=(438.)*7*)=&3=:31.0*1>=(42543*39=4+=&'&143*=).*9=@7.3(*=+323_=&-*7*=57*8*39`= 9-7**= 8&251*8= 4+= *&(-= &1,&1= 85*(.*8`= &3)= &9= 1*&89= 9-7**= &'&143*= <*7*= &3&1>8*)= +742= *&(-= 8.9*_= 742= *&(-= &1,&1= 8&251*`= 9.88:*= <&8= -&5-&?&7)1>= 8*1*(9*)= +742= 9-*= 9.5`= 2.)1.3*= &3)= 14<*7= 5479.43= 4+= *&(-= +743)_= = 9<4= (:'.(= (*39.2*97*= 8*(9.43= 4+= 2:8(1*= <&8=7*24;*)=+742=9-*=&'&143*=+449`=&3)='49-=&'&143*=&3)=&1,&1=8&251*8=<*7*=+7**?*= )7.*)= +47= ,.:.2= -4:78_= :7.*)= &'&143*= &3)= &1,&1= 8&251*8= <*7*= 9-*3= ,74:3)= :8.3,= &= 2479&7=&3)=5*891*=&3)=5&79.9.43*)=+47=+&99>=&(.)=&3)=89&'1*=.84945*=&3&1>8*8_== = :*97.9&1=8&251*8= +47=89&'1*=.84945*=&3&1>8.8= <*7*=<&8-*)=9-74:,-=&=+,/= 2=8.*;*=94= 7*24;*=8-*11=,7.9=&3)=1&7,*=)*'7.8`=&3)=2&9*7.&1=5&88.3,=9-74:,-=9-*=2*8-=<&8=9-*3= <&8-*)=9-74:,-=&=/-= 2=2*8-_=&9*7.&1=7*9&.3*)=43=9-.8= 2*8-= <&8=&))*)=94=&=9*89= 9:'*= (439&.3.3,= (4114.)&1= 8.1.(&= ) :M  `= )*38.9>= -= +_,+`= <-.(-= <&8= 8-&0*3= 94= +&(.1.9&9*=9-*=8*5&7&9.43=4+=7*2&.3.3,=.3+&:3&_=3+&:3&=+14&9*)=94=9-*=8:7+&(*=&3)=(4:1)= '*=2&3:&11>=7*24;*)=+742=9-*=2.=9:7*_=-*=7*2&.3.3,=)*97.9&1=+7&,2*398=<*7*=&,&.3= 7.38*)= 9-74:,-= &= /-= 2= 2*8-= 94= 7*24;*= 9-*= (4114.)&1= 8.1.(&_= 385*(9.43= 4+= 9-*= 7*2&.3.3,=)*97.9&1=8&251*=8-4<*)=.9=94='*=2&.31>=82&11=+7&,2*398=4+=2&(74&1,&*=&3)= 842*=).&9428_=:*97.9:8=<&8=9-*3=51&(*)=.394=9.3=(&58:1*8=+47=8:'8*6:*39=89&'1*=.84945*= &3&1>8.8_= :1+:74:8= &(.)= <&8= &))*)= 94= *&(-= 9.3= (&58:1*= 94= 7*24;*= &3>= 7*2&.3.3,= (&7'43&9*8= &3)= '.(&7'43&9*8_= -*= 7&9.48= 4+= +- 2 +, = &3)= +/ 72 +. 7= +47= &11= 8&251*8= <*7*= (&1(:1&9*)= &8= 9-*= 7*1&9.;*= 5*7= 2.1= = ).++*7*3(*= '*9<**3= 9-*= 8&251*= &3)= 9-*= 7*(4,3.8*)= .39*73&9.43&1= 89&3)&7)= @**= :**= '*1*23.9*= (&7'43&9*= +47= (&7'43b= &.7= +47= 3.974,*3= &3)= &3&1>8*)= 43= &3= 8457.2*= 2&88= 85*(9742*9*7_= @7*(.8.43= 4+= 9-*= 2&88= 85*(9742*9*7=(&1(:1&9*)=+742=):51.(&9*=8&251*8=<&8=*_,_=

,*0 = %74/*(9=34_=,**.2*+- = =

=

= (.,:7*=/3= &251.3,=14(&9.438=3:2'*7*)=+:/=.3=
*7(:7>=%&88&,*`=
&7.&=281&3)=8&82&3.&= = &*9=)*97.9&1=8&251*8`=&3)=+/=2.11.,7&28=4+=*&(-=)7.*)=&'&143*=&3)=&1,&1=8&251*8`=<*7*= 97&3882*9->1&9*)= 94= 574):(*= +&99>= &(.)= 2*9->1= *89*78= = :8.3,= 2*9-&341: (-1474+472:(43(_= ->)74(-147.(= &(.)= +*a+a+`= 2*J`= ,= -7_= :.7*(9= 97&3882*9->1&9.43= 4+=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,*1 = =

8&251*8=-&8=57*;.4:81>='**3=;&1.)&9*)=&,&.389=(43;*39.43&1=2*9-4)8=-7.89.*=+32,= +47=&=2.(74-*9*749745-=)*<.8=*9=&1_=,***=&3)=+47=897.5*)=97:25*9*7=1&7;&*=&3)=749.+*78= /7&38)*3= ]= ::389&3= :35:'1.8-*)= )&9&_= = <*7*= *=97&(9*)= .394= -*=&3*: (-1474+472= .a+`= -= ×= +_/= 2)_= 5&8= (-742&94,7&5-.(= 5= &3&1>8*8= <*7*= 5*7+472*)= <.9-= &= ,.1*39= *(-3414,.*8= 023*7= 5= ;43)&1*`= @*338>1;&3.&`= = *6:.55*)= <.9-=&3=@8/=(&5.11&7>=(41:23=/*=2= ×=*_-,=22=._)_`=&3=:`=&=851.92851.91*88=.3/*(947= &3)= &3= ,.1*39= *(-3414,.*8= 102-= &:94= 8&251*7= :8.3,= 5= 45*7&9.3,= (43).9.438= 57*;.4:81>= )*8(7.'*)= @-.11.58= *9= &1_= ,**-&_= 3).;.):&1= (42543*398= <*7*= .)*39.+.*)= :8.3,=2&88=85*(97&1=)&9&=.33.,&3=-*7246:*89=5O=582&88=85*(9742*9*7=&3)='>= (425&7.3,= 7*9*39.43= 9.2*= )&9&= <.9-= 9-48*= 4'9&.3*)= +47= &:9-*39.(= &3)= 1&'47&947>= 89&3)&7)8_== = 9&9.89.(&1=&3&1>8*8= 9&'1*=.84945*8= 8=349=&11=85*(.*8=<*7*=57*8*39=&9=&11=14(&9.438`=85*(.*8=<*7*=,74:5*)='>=5->1&_==9<48 <&>=7P=<&8=:8*)=94=9*89=+47=).++*7*3(*8=.3=.84945.(=;&1:*8='*9<**3=5->1&=+.=*)`= -=1*;*18a=7*)=&1,&*`='74<3=&1,&*`=&'&143*=&3)=14(&9.438=8.9*8=5441*)`=7&3)42`=/=1*;*18a= 14(&9.438= += 94= /= Q= 3= 84+9<&7*`= Q= 3(= ;&389.1= )`= _= :.++*7*3(*8= &243,= 14(&9.438= <*7*= 349= 4+= 85*(.+.(= .39*7*89`= ':9= <*7*= .3(1:)*)= 94= )*9*72.3*= .+= ).++*7*3(*8= '*9<**3= 5->1&= <*7*= (438.89*39= &(7488= 14(&9.438_= :&9&= <*7*= (-*(0*)= +47= -424,*3*.9>=4+=;&7.&3(*=:8.3,=4(-7&38=9*89=&3)=34=97&38+472&9.438=<*7*=3*(*88&7>_= -*7*=<*7*=&3=.38:++.(.*39=3:2'*7=4+=)*97.9:8=8&251*8=94=5*72.9=&3&1>8.8_== =
.=.3,=24)*1=4+=&'&143*=).*9= :&9&=<*7*=+.789=&3&1>8*)=:8.3,=9-*=(&7'43=.84945*=;&1:*8=4+=&'&143*`=7*)=&1,&*`='74<3= &1,&*=&3)=)*97.9:8=&;*7&,*)=&(7488=&11=14(&9.438_=&7'43=.84945*=;&1:*8=+47=*&(-=&1,&1= 85*(.*8=<*7*=,74:5*)=&((47).3,=94=5->1&`=&8=&1,&1=85*(.*8=<.9-.3=*&(-=5->1&=(4:1)=349= '*=).89.3,:.8-*)_=8=9-*=3.974,*3=.84945*=(4:1)=349=).89.3,:.8-='*9<**3=&1,&1=85*(.*8= 47= 5->1&`= ;&1:*8= +47= 3.974,*3= <*7*= 349= :8*)= .3= 9-*= 2.=.3,= 24)*1_= .=.3,= 24)*18= (&3349=574;.)*=&=:3.6:*=841:9.43=<-*7*=9-*7*=&7*=247*=84:7(*8=9-&3=*1*2*398_=389*&)= 9-*=8484:7(*=24)*1=:8*8=9-*=(&7'43=.84945*=;&1:*8=4+=&'&143*`=&1,&*`=&3)=)*97.9:8=94= (&1(:1&9*=9-*=:55*7=&3)=14<*7=1.2.98=4+=9-*=(4397.':9.43=9-&9=*&(-=+44)=84:7(*=2&0*8= 94= 9-*= ).*9= 4+= &'&143*= @-.11.58= ]= 57*,,= ,**-_= 11= 5488.'1*= (42'.3&9.438= 4+= *&(-= &1,&12)*97.9&1= (4397.':9.43= *:+**= &7*= *=&2.3*)= .3= += .3(7*2*398_= 42'.3&9.438= 9-&9= 8:2= 94= *_+= 4+= 9-*= &'&143*= 8.,3&9:7*= &7*= (438.)*7*)= +*&8.'1*= (4397.':9.438_= *8:198= &7*= 7*5479*)= &8= 9-*= ).897.':9.43= 4+= +*&8.'1*= 841:9.438= +47= *&(-= +44)= 84:7(*= &8= 7*(422*3)*)='>[email protected]=&3)=57*,=,**-_=-*=+.789=5*7(*39.1*=&3)=33 9- =5*7(*39.1*=&7*= &184= ,.;*3= 7&9-*7= 9-&3= 9-*= +:11= 7&3,*= <-.(-= .8= 8*38.9.;*= 94= 82&11= 3:2'*78= 4+= 4'8*7;&9.438=43=9-*=9&.18=4+=9-*=).897.':9.43=*1;.11*=]=433411>=,**-_=4=&((4:39=+47= 9-*=2.347=+7&(9.43&9.43=.3=(&7'43=*=5*7.*3(*)='>=(438:2*78=<.9-.3=*&(-=9745-.(=1*;*1`= <*=&)/:89*)=9-*=.84945*=;&1:*8=4+=(&7'43=+47=&'&143*='>=*_/=(:9(-&3=*9=&1_=,**-_= =

,*2 = %74/*(9=34_=,**.2*+- = =

(&99>=&(.)=574+.1*8== &99>=&(.)=574+.1*8=<*7*=(425&7*)=&243,=5->1&=&'&143*`=7*)=&1,&*`='74<3=&1,&*=&3)= )*97.9:8= :8.3,= 57.3(.5&1= (42543*39= &3&1>8.8= @`= &3)= 14(&9.43= :8.3,= 34382*97.(= 2:19.8).2*38.43&1= 8(&1.3,= 3:= 47).3&9.438= ,*3*7&9*)= +742= &= :(1.)*&3= ).89&3(*= 2&97.=_= 3&1>8.8= 4+= 8.2.1&7.9.*8= 7= <&8= :8*)= 94= .)*39.+>= 8.2.1&7.9.*8= &243,= 14(&9.438=&(7488=5->1&_=@=7*):(*8=9-*=3:2'*7=4+=).2*38.438=574):(*)='>=9-*=1&7,*= 3:2'*7=4+=;&7.&'1*8=&3)=:8*8=1.3*&7=(477*1&9.438=(42543*398=94=.)*39.+>=9-48*=+&99>= &(.)8= 9-&9= (4397.':9*= 2489= 94= 9-*= 8*5&7&9.43= '*9<**3= 4'8*7;*)= ,74:58= /*89= *9= &1_= ,**-_= 7= (425&7*8= 7&30*)= 8.2.1&7.9.*8='*9<**3=&3)= <.9-.3= ,74:58= 8*1*(9*)= &= 57.47. =:8.3,=&=7&3)42.8&9.43=9*89=4+=8.,3.+.(&3(*_=@&.7<.8*=7=(425&7.8438=<*7*= 2&)*= '*9<**3= &11= 14(&9.438= :8.3,= /***= 8.2:1&9.438= .3= *&(-= (&8*_= &99>= &(.)8= 9-&9= (4397.':9*)= &= 2*&3= 4+= 1*88= 9-&3= +_*= 4+= 949&1= +&99>= &(.)8= 94= 9-*= &'&143*= +&99>= &(.)= 574+.1*=<*7*=42.99*)=+742=89&9.89.(&1=&3&1>8*8_=11=&3&1>8*8=<*7*=)43*=43=5*7(*39&,*= (42548.9.43=)&9&=&3)=7*8:198=<*7*=(43+.72*)='>=&3&1>8.8=4+=2,2,=+&99>=&(.)=)&9&=349= 8-4<3`=':9=&184=8**[email protected]=*9=&1_=,**-'_=:19.;&7.&9*=89&9.89.(&1=&3&1>8*8=<*7*=)43*= :8.3,=@=0=84+9<&7*=@8`=@1>24:9-`= =_==

9*8:198= +- =&3)= +/ 7=;&1:*8=<*7*=8.2.1&7='*9<**3=85*(.*8=<.9-.3=&1,&1=5->1&=.,:7*=0*`=':9= &8=&11=&1,&1=85*(.*8=<*7*=349=57*8*39=&9=&11=14(&9.438`=&1,&1=85*(.*8=<*7*=,74:5*)=.394= 5->1&=7*)=&3)='74<3=&1,&*=+47=&3&1>8.8=&3)=8:'8*6:*39=24)*11.3,=4+=(&7'43=.84945*= ;&1:*8_=-*7*=<*7*=.38:++.(.*39=8&251*8=4+=)*97.9:8=3=-=,=+47=89&'1*=.84945*=&3&1>8.8`=3= -=-=+47=+&99>=&(.)=&3&1>8.8=94=5*72.9=89&9.89.(&1=&3&1>8.8_= -*= +- = ;&1:*8=4+=&11=5->1&= <*7*=8.,3.+.(&391>=).++*7*39=7*)=&1,&*`=8-*_*`=)=*_3b='74<3=&1,&*`=8+1_3`=)=*_-b=&3)= &'&143*`=8+3_2`=)=*_-`==-=23_3`=@=0=*_**+`=<.9-=842*=5->1&=).++*7.3,=&243,=14(&9.438= @->1&$)4(&9.43`= = -= ,_*1`= @= -= *_*._= 47= *=&251*`= '74<3= &1,&*= <*7*= 81.,-91>= 247*= *37.(-*)= &9= 9<4= 4+= 9-*= +.;*= 14(&9.438`= ':9= 9-.8= ).++*7*3(*= 431>= &((4:39*)= +47= &= *_.= := *_/= *37.(-2*39= .3= (&7'43= ;&1:*8_= -*=  +- = ;&1:*8= 4+= )*97.9:8= 8+/_*`= )= +_-= <*7*= 81.,-91>=247*=*37.(-*)=9-&3=9-*=2*&3=;&1:*=4+='74<3=&1,&*=8+1_3`=)=*_-_=-*= +/ 7= ;&1:*8=<*7*=:3&'1*=94=).89.3,:.8-='*9<**3=5->1&=7*)=&1,&*`='74<3=&1,&*=&3)=&'&143*`= =-=+_//`=@=1=*_+*`=':9=9-*7*=<&8=&=8.,3.+.(&39=).++*7*3(*=@=0=*_**+=&243,=14(&9.438_== =

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,*3 = =

11

10 Phyllophora comosa Haliotis rubra 9 Plocamium dilatatum Durvillaea potatorum 8 Plocamium angustum Detritus Ecklonia radiata

N (‰) 7

15 Red algae  6 Abalone Brown algae 5 Phacelocarpus peperocarpus Detritus 4 -35 -30 -25 -20 -15 -10

13 C (‰) = (.,:7*=0*=
*&3=)=+==(&7'43=&3)=3.974,*3=.84945*= ;&1:*8= 4+= &'&143*`=
&1.49.8= 7:'7& b= 7*)= &1,&*`= -&(*14(&75:8=5*5*74(&75:8 `= 14(&2.:2=).1&9&9:2 `= 14(&2.:2=&:,:89:2 b=&3)= '74<3=&1,&*`= :7;.11&*&=549&947:2 `= ->1148547&=(4248& `= (0143.&=7&).&9& _= 8484:7(*=24)*11.3,=4+= +- =;&1:*8=&;*7&,*)=&(7488=&11=14(&9.438=8-4<*)=9-*=7&3,*=4+= +*&8.'1*=(4397.':9.438=94='*=1&7,*=&3)=:3.3+472&9.;*=+47='49-='74<3=&1,&*=*:22=&3)= )*97.9:8= *:1+`= ':9= 247*= 7*897.(9*)= +47= 7*)= &1,&*= +,:-3_= -*= 1&(0= 4+= 8*5&7&9.43= '*9<**3=9-*= +- =;&1:*8=4+=)*97.9:8=&3)='74<3=&1,&*=(4397.':9*)=94=9-*=1&7,*=7&3,*=4+= +*&8.'1*=(4397.':9.438=(&1(:1&9*)=:8.3,=9-*=8484:7(*=2.=.3,=24)*1_=8=8:(-`=9-*=2*&3= 4+='74<3=&1,&*=&3)=)*97.9:8=<&8=(&1(:1&9*)= &3)=9-*=(4397.':9.438= 4+=7*)=&3)='74<3= &1,&*2)*97.9:8= <*7*= 7*24)*11*)= :8.3,= &= 8.3,1*= .84945*`= 9<4= 84:7(*= 2.=.3,= 24)*1`= 84*7747`= @-.11.58= ]= 57*,,= ,**+= <-.(-= (&1(:1&9*8= 84:7(*= 5745479.43&1= (4397.':9.438= &3)=89&3)&7)=*77478_=/74<3=&1,&*2)*97.9:8=2*&3=8+1_2`=)=*_*.=(4397.':9*)=&=2*&3= 4+=21_/=)=*_*.=4+=(&7'43=94=9-*=).*9=4+=&'&143*`=&3)=7*)=&1,&*=(4397.':9*)=&=2*&3=4+= +,_/=)=*_*._== = &99>=&(.)8=`=+0a*=+3_,=:=//_1=4+=949&1=`=,*a/ 38-=/_-=:=+*_.=&3)=+.a*=/_*=:= 3_/= <*7*= 9-*= 2489= &':3)&39= .3= &11= &1,&1= &3)= &'&143*= 8&251*8= <.9-= -.,-*89= 5*7(*39&,*8= +4:3)= .3= 7*)= &1,&1= 85*(.*8= &'1*= +0_= '&143*= &184= (439&.3*)= 7*1&9.;*1>= -.,-= 1*;*18= 4+= = ,,a/ 38-= 3_/_= ,,a/ 38-= <&8= ,*3*7&11>= &'8*39= &(7488= &11= 49-*7= 8&251*8=<.9-=9-*=*=(*59.43=4+=9-*='74<3=&1,&= ->1148547&=(4248& =*_+=&3)=)*97.9:8= *_0_=8+0a+381(=*_3=:=+-_.`=+2a+ 383(=+_2=:=-*_-=&3)=,*a.380=-_+=:=+3_-= <*7*= (42243= &(7488= &11= 85*(.*8`= <.9-= -.,-*7= 5*7(*39&,*8= 57*8*39= .3= '74<3= &1,&*_= :*97.9:8=8&251*8=-&)=-.,-=5*7(*39&,*8=4+==+2a+381(=,,_,`=+0a*=+1_0`=+0a+381= +-_.=&3)=,*a/38-=-_,_=

,+* = %74/*(9=34_=,**.2*+- = =

8&'1*=+0=
*&3=5*7(*39&,*=+&99>=&(.)=(42548.9.43=)=8*=4+=1,&*='>=85*(.*8=&3)='>=,74:5`=&'&143*=&3)=)*97.9:8_= 3=.8= 8&251*=8.?*` =(=.8=8&9:7&9*)= +&99>=&(.)8`=
=(=.8=2434:38&9:7&9*)=+&99>=&(.)8`=%=(=.8=541>:38&9:7&9*)=+&99>=&(.)8_=

======&99>=&(.)= 14(&2.:2= _= -&(*14(&75:8= 11=7*)= ->1148547&= (0143.&= #:7;.11&*&= 11= :*97.9:8= &1.49.8= &:,:89:2 = ).1&9&9:2= 5*5*74(&75:8= &1,&*= (4248&= 7&).&9&= 549&947:2= '74<3= = 7:'7&======&1,&*= = = 3=-=-,= 3=-=0= 3=-=-= 3=-=.+= 3=-=,1= 3=-=./= 3=-=-= 3=-=2+= 3=-=-= 3=-=2*======+.a*= =3_.=)=*_.= =3_/=)=+_-= =._+=)=*_,= =3_*=)=*_.= =/_*=)=*_,= =0_3=)=*_-= =/_3=)=*_-= =0_,=)=*_,= =*_0=)=*_+= =+_3=)=*_+= +/a*= =+_+=)=*_+= =*_*=)=*_*= =*_2=)=*_+= =*_3=)=*_+= =*_/=)=*_*= =*_2=)=*_*= =*_/=)=*_*= =*_0=)=*_*= =+_*=)=*_,= =+_*=)=*_*= .+/a*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =+_*=)=*_,= =*_+=)=*_*= &+/a*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =+_,=)=*_-= =*_*=)=*_*= +0a*= //_1=)=+_/= //_-=)=+_+= .+_0=)=+_2= /._0=)=+_-= ,+_3=)=*_-= ,+_*=)=*_0= +3_,=)=*_.= ,+_-=)=*_.= +1_0=)=*_3= +3_3=)=*_+= +1a*= =*_*=)=*_*= =*_*=)=*_*= =*_.=)=*_*= =*_-=)=*_*= =*_,=)=*_*= =*_-=)=*_*= =*_.=)=*_*= =*_-=)=*_*= =*_,=)=*_,= =+_3=)=*_*= .+1a*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =+_*=)=*_+= =*_.=)=*_*= &+1a*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =+_,=)=*_*= =*_+=)=*_*= +2a*= =+_-=)=*_*= =+_0=)=*_+= =,_+=)=*_+= =+_.=)=*_+= =*_2=)=*_+= =+_-=)=*_,= =+_3=)=*_+= =+_+=)=*_+= =-_*=)=*_,= =0_,=)=*_+= ,*a*= =*_-=)=*_*= =*_-=)=*_+= =*_*=)=*_*= =*_-=)=*_*= =*_0=)=*_*= =+_,=)=*_*= =+_*=)=*_*= =+_*=)=*_*= =*_3=)=*_,= =*_/=)=*_+= ,,a*= =-_2=)=*_,= =*_-=)=*_+= =*_/=)=*_*= =-_*=)=*_-= =*_-=)=*_*= =*_*=)=*_*= =*_/=)=*_*= =*_+=)=*_*= =*_1=)=*_+= =*_,=)=*_*= :2== 1+_1=)=,_,= 01_*=)=,_1= .3_/=)=,_,= 03_.=)=,_,= ,3_,=)=*_1= -+_/=)=+_,= ,3_/=)=*_2= -*_2=)=*_2= -*_,=)=,_/= -,_+=)=*_.= +0a+ 381(= =,_2=)=*_+= =._0=)=*_,= =+_3=)=*_,= =-_*=)=*_+= =._/=)=*_,= =/_/=)=*_,= =*_3=)=*_+= =/_*=)=*_,= +-_.=)=+_/= =+_/=)=*_*= +0a+2+0a,= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =+_.=)=*_,= =*_*=)=*_*= +0a+ 38/(= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_1=)=*_+= =*_.=)=*_*= =*_+=)=*_*= =*_/=)=*_*= =+_+=)=*_+= =*_-=)=*_*= +1a+ 382(= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_+=)=*_*= =*_*=)=*_*= =*_+=)=*_*= =+_+=)=*_,= =*_/=)=*_*= +1a+ 380(= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =+_/=)=*_+= =*_+=)=*_*= +2a+ 383(= =+_3=)=*_+= =+_2=)=*_,= +-_+=)=*_/= =,_1=)=*_/= +1_-=)=*_-= ,,_/=)=*_/= -*_-=)=+_+= ,*_3=)=*_/= =/_.=)=*_,= =0_3=)=*_+= +2a+ 381(= =+_3=)=*_*= =,_/=)=*_*= =,_,=)=*_*= =,_*=)=*_*= =*_,=)=*_*= =*_,=)=*_*= =*_*=)=*_*= =*_,=)=*_*= ,,_,=)=*_*= =1_0=)=*_+= +2a+ 3819= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =+_2=)=*_,= =*_+=)=*_*= ,*a+ 38 1`3`++(= =+_+=)=*_+= =+_3=)=*_/= =*_*=)=*_*= =+_+=)=*_+= =*_0=)=*_+= =+_*=)=*_+= =*_1=)=*_+= =*_2=)=*_+= =,_.=)=*_1= =,_0=)=*_*= ,.a+= =*_*=)=*_*= =*_*=)=*_*= =._/=)=*_+= =*_-=)=*_,= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= :2= = =1_2=)=*_-= +*_1=)=+_,= ,+_1=)=+_,= =3_,=)=+_*= ,-_.=)=*_1= ,3_2=)=+_*= -+_3=)=+_-= ,1_0=)=*_2= /*_-=)=._0= +3_1=)=*_.= +2a. 38-= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =._0=)=*_,= =1_1=)=*_/= =,_+=)=*_/= =0_-=)=*_-= =*_/=)=*_+= =*_.=)=*_*= +2a, 38-= =*_0=)=*_*= =*_*=)=*_*= =*_2=)=*_*= =*_/=)=*_*= =0_1=)=*_+= =-_1=)=*_/= =3_+=)=*_+= =/_*=)=*_,= =+_,=)=*_+= =+_*=)=*_*=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,++ = =

,*a. 380= =0_/=)=*_.= =2_1=)=*_.= =-_.=)=*_.= =0_0=)=*_.= +3_-=)=*_/= +/_0=)=*_-= +1_,=)=*_.= +1_*=)=*_.= =-_+=)=*_.= ++_.=)=*_.= ,*a/ 38-= =1_0=)=*_1= =0_/=)=*_0= +*_.=)=+_2= =1_1=)=*_0= =/_/=)=*_,= =/_-=)=*_,= =0_-=)=*_,= =/_.=)=*_+= =-_,=)=*_3= =0_+=)=*_,= ,*a- 380= (= ,*a,= =-_1=)=*_,= =._+=)=*_-= =*_*=)=*_*= =-_/=)=*_,= =+_/=)=*_*= =*_2=)=*_*= =*_2=)=*_*= =+_+=)=*_*= =*_0=)=*_+= =*_.=)=*_*= 7= ,*a. 38-= =*_+=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_3=)=*_*= =+_*=)=*_*= =+_*=)=*_+= =*_3=)=*_*= =*_-=)=*_+= =*_+=)=*_*= ,*a, 380= =*_0=)=*_*= =+_,=)=*_*= =*_*=)=*_*= =*_0=)=*_*= =*_1=)=*_+= =*_*=)=*_*= =*_3=)=*_*= =*_-=)=*_*= =*_/=)=*_*= =*_*=)=*_*= ,,a. 380= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_/=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_,=)=*_*= =*_0=)=*_-= =,_/=)=*_*= ,,a/ 38-=:@= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_+=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_0=)=*_,= =3_.=)=*_+= ,,a,7= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =*_*=)=*_*= =._1=)=*_+= :2=@ = +3_*=)=+_0= ,*_/=)=+_2= +._0=)=,_*= +2_3=)=+_/= -3_1=)=+_,= -._*=)=+_,= -1_.=)=,_*= -0_,=)=+_,= +*_2=)=,_3= -0_+=)=*_0= $9-*7=1=+= =*_-=)=*_+= =*_*=)=*_*= +-_+=)=*_2= =+_,=)=*_/= =._+=)=*_.= =*_1=)=*_+= =*_+=)=*_+= =+_3=)=*_-= =+_.=)=*_,= =1_0=)=*_,= 2@= =*_3=)=*_*= =+_.=)=*_+= =*_-=)=*_*= =*_3=)=*_+= =-_0=)=*_+= =-_*=)=*_+= =,_1=)=*_*= =-_,=)=*_+= =+_*=)=*_2= =,_*=)=*_+= $$9-*7=0=+= =+_+=)=*_,= =*_+=)=*_*= =+_,=)=*_+= =+_*=)=*_,= =-_0=)=*_0= =-_3=)=*_/= =+_+=)=*_+= =-_1=)=*_0= =1_-=)=,_+= =._/=)=*_,= = `=8&9:7&9*)=+&99>=&(.)8`= `=2434:38&9:7&9*)=+&99>=&(.)8`=@ `=541>:38&9:7&9*)=+&99>=&(.)8_= $9-*7=1+a=
8=+0a*`=9-*7=1/8/`=
='7,,a*`=&3)=43*=:3.)*39.+.*)=+&99>=&(.)= $$9-*7=0=+a=.+.a*`=+.a+ 381(`=+.a+ 38/(`=.`2+,:`=+/a+ 380(`=+0@ `=.+0a*`=+0a+ 38+-9`=+0a+ 383(`=9-*7`=1*+1a+`=
'7+/a*`=+2@ `=.+2a*`=+2a- 380`=
=+0a+`=+2a+ 38/(`=8=+0a*`=.+3a*`=
'7+1a*`=
.+1a*`=
&+1a*`=+3a+`=
+1a*`=,*@ `=,*a,7`=
+2a*`=,*a+`=
=+2a*`=,+@ `=,+a/ 38-`= ,+a+`=,+a*`=,,a0 38-=:`=,,a/ 380=:@0`=,,a- 380`=,,a,7(,,a. 38-`=,,a+ 3818+-(`=,,a*=(=,*a*`=
,+a*`=,-a*`=,.@ `=
,,a+`=
,,a+=(=,.a+`=,.a+`=
,,a*`=,.a*=&3)=8*;*7&1=:3.)*39.+.*)=+&99>=&(.)8_= =

,+, = %74/*(9=34_=,**.2*+- = =

11= 5->1&= (4:1)='*= ).89.3,:.8-*)= :8.3,= 57.3(.5&1= (42543*39= &3&1>8.8= @= .,:7*= 0+`=&3)=9-.8=5&99*73=<&8=(438.89*39=<.9-=9-&9=8-4<3=.3=9-*=3:=47).3&9.43=.,:7*= 0,_= 3/_1= 4+= 9-*= ;&7.&'.1.9>= &243,= 5->1&= <&8= *=51&.3*)= '>= 9-*= +.789= 9-7**= 57.3(.5&1= (42543*398= @-= 349= 8-4<3_= &/47= (4397.':9.3,= +&99>= &(.)8= 94= @+= <*7*= 8= +0a*`= ,*a. 380`= ,*a/ 38-`=&3)=+.a*`=<-.(-=*=51&.3*)=1,_3=4+=9-*=949&1=;&7.&3(*_= -*= +&99>= &(.)=574+.1*8=4+=&'&143*`='74<3=&1,&*=&3)=)*97.9:8=<*7*=4;*71&55.3,=43=@+`=<-*7*&8= 7*)= &1,&*= (4:1)= '*= (1*&71>= ).89.3,:.8-*)_= />= (4397&89`= 7*)= &1,&*= <*7*= .39*72*).&9*= '*9<**3= &'&143*`= )*97.9:8= &3)= '74<3= &1,&*= 43= @,= <-.(-= *=51&.3*)= +3_/= 4+= 9-*= ;&7.&3(*_= &/47= (4397.':9.3,= +&99>= &(.)8= 94= @,= <*7*= 8= ,,a/ 38-`= +2a+ 381`= &3)= ,*a. 380_='&143*=&3)=)*97.9:8=<*7*=8*5&7&9*)=43=@-=<-.(-=*=51&.3*)=431>=-_-=4+= 9-*= 949&1= ;&7.&3(*_= &/47= +&99>= &(.)8= (4397.':9.3,= 94= 9-*= 8*5&7&9.43= 4+= &'&143*= &3)= )*97.9:8= 43= @-= <*7*= 8= +0a+ 381`= +2a+ 381= &3)= ,*a. 380_= 3:= 8-4<*)= 34= 8*5&7&9.43= 4+= +&99>= &(.)= 574+.1*8= &243,= 8&251.3,= 8.9*8= 349= 8-4<3`= &3)= 431>= 2.347= 8*5&7&9.43= &243,= 14(&9.438= <.9-.3= 5->1&= .,:7*= 0,_= -*= 7= 9*898= 8-4<*)= ).++*7*3(*8= &243,= 5->1&= &3)= 14(&9.43= 94= '*= 8.,3.+.(&39= @->1&`= 514'&1= = -= *_32`= @= 0= *_**+`=514'&1==+47=5&.7<.8*=(425&7.843=4+=5->1&=7&3,*)='*9<**3=*_33=&3)=+_**`=@=0= *_**+`= )4(&9.43_= 514'&1= = -= *_,.`= @= 0= *_**+b= 514'&1= = +47= 5&.7<.8*= (425&7.843= 4+= 14(&9.43=7&3,*)='*9<**3=*_*-=&3)=*_/,`=@=0=*_**+_== =

20

-6) Brown algae n 20:4(

0 PC2 Detritus -3) -7) n n Red algae Abalone 22:5( 18:1(

-20 -20 0 20 40 60 20:4( n-6) PC1 16:0 22:5( n-3) 14:0 = (.,:7*=0+= >.5149=4+=9-*=+.789=&3)=8*(43)=%?=)*7.;*)=+742=9-*=+&99>=&(.)=(42548.9.43=4+=&'&143*`= )*97.9:8=7*)=&1,&*=&3)='74<3=&1,&*_=%?+=*=51&.3*)=1,= 4+= 9-*= ;&7.&'.1.9>= '*9<**3= ,74:58_= %?,= *=51&.3*)= +3_/= 4+= 9-*= ;&7.&'.1.9>_= 774<8= .3).(&9*= +&99>= &(.)8= (4397.':9.3,=2489=94=9-*=).897.':9.43=4+=5->1&=&143,=*&(-=(42543*39_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,+- = =

Location 1 Location 2 Detritus Location 3 Location 4 Location 5

Abalone

Red algae

Brown algae

= (.,:7*=0,= 8<4=).2*38.43&1=47).3&9.43=4+=3
&='&8*)= 43= :(1.)*&3= ).89&3(*= 8.2.1&7.9.*8= 4+= +&99>=&(.)=574+.1*8=+742=7*)=&1,&*`='74<3=&1,&*`=)*97.9:8=&3)=&'&143*=897*88=-=*_*._= =.8=8(&1*8=&7*=&7'.97&7>=.3=
&=&3)=&7*=9-*7*+47*=42.99*)_= = &.8(:88.43= -.8=.8=9-*=+.789=89:)>=94=:8*=(42'.3*)=89&'1*=.84945*=&3)=+&99>=&(.)=&3&1>8*8=94=&88*88= 9-*= ).*9= 4+= <.1)= &):19= &'&143*_= ;.)*3(*= +742= '49-= 89&'1*= .84945*8= &3)= +&99>= &(.)8= .3).(&9*=9-&9='74<3=&1,&*=&3)=)*97.9:8=5&79.(:1&9*=2&(74&1,&*`=).&9428=&3)='&(9*7.&= 2&0*=&=,7*&9*7=(4397.':9.43=94=9-*=).*9=4+=&'&143*=9-&3=7*)=&1,&*_=-*=(42'.3*)=:8*=4+= 89&'1*= .84945*8= &3)= +&99>= &(.)8= 574;.)*)= ,7*&9*7= ).8(7.2.3&947>= 54<*7= &243,= +44)= 84:7(*8= 9-&3= 9-&9= <-.(-= (4:1)='*= &(-.*;*)= :8.3,= &= 8.3,1*= 97&(*7_= = 8:22&7>= 4+= 9-*= 5->14,*3*9.(=8*5&7&9.43=&(-.*;*)=:8.3,=(-*2.(&1=97&(*7=9*(-3.6:*8=.8=+.789=57*8*39*)=94= 574;.)*=9-*=(439*=9=+47=9-*=8:'8*6:*39=).8(:88.43=4+=&'&143*=).*9_= = *5&7&9.43=4+=5->1&=:8.3,=(-*2.(&1=97&(*78= -*7*=&7*=+*<=89:).*8=9-&9=7*5479='49-=9-*=(&7'43=&3)=3.974,*3=.84945*=;&1:*8=4+=7*)= &1,&1=85*(.*8`=&19-4:,-=(&7'43=.84945*=;&1:*8=4+= 14(&2.:2 =85_=.3=9-*=(:77*39=(439*=9= &7*= (438.89*39= <.9-= 9-&9= 7*5479*)= 57*;.4:81>= +47= 9-*= 8&2*= ,*3*7&= *_,_= 14(&2.:2 = &3,:89:2 `== 8-*_3`=*3943=]=.9?=+323`= 14(&2.:2 =85=8-+_*=94=8-._1`=&;*3=*9=&1_=,**,_=&-.189= 49-*7= ,*3*7&= -&;*= 247*= *37.(-*)= (&7'43= .84945*= ;&1:*8= 
&:7*3(.& = 855`= 8+2_*`= 433411>=*9=&1_=,**/`= &12&7.&=5&12&9& `=8+0_/=94=8,+_0`=&;*3=*9=&1_=,**,`=9-*>=(422431>= -&;*=&=).++*7*39=2475-414,>=94=9-*=7*)=&1,&1=85*(.*8=*=&2.3*)=-*7*_==(425&7.843=4+= +- =;&1:*8=&243,=7*)`='74<3=&3)=,7**3=&1,&*=8-4<*)=9-&9=2489=2&7.3*=2&(74&1,&*= <.9-= +- =;&1:*8=4+=2=8-*`=&7*=7*)=&1,&*=85*(.*8=&;*3=*9=&1_=,**,_== =

,+. = %74/*(9=34_=,**.2*+- = =

84945*=;&1:*8=4+=(&7'43=+47='74<3=&1,&*=&7*=9>5.(&11>=1.,-9*7=.3= +- =9-&3=7*)=&1,&*= *_,_=
&2.3&7.&=143,.(7:7.8 =8+,=94=8,*`=9*5-*3843=*9=&1_=+32.`= &(74(>89.8=5>7.+*7& `=8++_+= 94=8,*_1`= (0143.&=7&).&9& `=8+3_-`=&;*3=*9=&1_=,**,_=:(-=).++*7*3(*8=.3=+- =;&1:*8= 4+=7*)=&3)='74<3=&1,&*=&7*=):*=94=).++*7*39=5-4948>39-*9.(=5&9-<&>8=4+= ,=&3)247= &(9.;*=:59&0*=4+= -8=&76:-&7=*9=&1_=+323`=&;*3=*9=&1_=,**,_== = 3=9-*=(:77*39=89:)>`=.9=<&8=349=5488.'1*=94=8*5&7&9*=9-*=(&7'43=.84945*=;&1:*=4+='74<3= &1,&*= +742= )*97.9:8`= 8:,,*89.3,= 9-&9= )*97.9:8= (4257.8*)= 57*)42.3&391>= +7&,2*39*)= '74<3=&1,&1=2&9*7.&1_=:*(42548.9.43=4+= (0143.&=7&).&9& =&3)=
&2.3&7.&=143,.(7:7.8 =4;*7= &=0*:+,/=)&>=5*7.4)=.3=57*;.4:8=89:).*8=7*8:19*)=.3=431>=2.347=(-&3,*8=5+=.3=9-*= +- =;&1:*=4+=9-*8*=85*(.*8=*3943=]=.9?=+322b=9*5-*3843=*9=&1_=+320=.3).(&9.3,=9-&9= )*9&(-*)='74<3=&1,&*=2&>=7*9&.3=.98= +- =;&1:*8=4;*7=9-*=8-479=94=2*).:2=9*72`=&3)= 9-.8=(4:1)=*=51&.3=9-*=1&(0=4+=8*5&7&9.43='*9<**3=)*97.9:8=&3)='74<3=&1,&*= +- =;&1:*8= .3= 9-*= (:77*39= 89:)>_= -*= 1&7,*= '.42&88= 4+= '74<3= &1,&18)*7.;*)= )*97.9:8= +7&,2*398= 2&>=&184=2&80=&3>= +- =(4397.':9.43=+742='&(9*7.&=47=2.(74&1,&*_=47=*=&251*`=.9=.8= 5488.'1*=9-&9=9-*=1&7,*='.42&88=4+=&=8.3,1*=2&(74&1,&1=85*(.*8`= #:7;.11&*&=549&9:7:2 =8 +/_**= )= *_,/= 8<&25*)= 9-*=  +- = (4397.':9.43= 4+= 2.(74&1,&*= &3)= '&(9*7.&= .3= 9-*= )*97.9&1= 8&251*= 8+/_**= )= +_-.= ):*= 9-*.7= (425&7&9.;*1>= 82&11= '.42&88= 8**= .,:7*= 0*_= = -*7*=<&8=1.991*=85&9.&1=;&7.&'.1.9>=.3=9-*= +- =;&1:*8=&243,=14(&9.438=+47=&11=5->1&`=':9= 9-*=2.347=;&7.&'.1.9>=.3= +- =;&1:*8=4'8*7;*)=+47='74<3=&1,&*=*_/=2&>=.3).(&9*=&= ).++*7*3(*=.3=(&7'43=84:7(*=47=9-*=7&9*=4+=574):(9.;.9>=4+='74<3=&1,&*=14(&9*)=&9=9-.8= 8.9*=5:*89=*9=&1_=,**._=:(-=;&7.&'.1.9>=.8=3*,1.,.'1*=.3=9*728=4+=+44)=<*'=89:).*8=&3)= )4*8=349=57*(1:)*=9-*=:8*=4+=89&'1*=.84945*8=4+=(&7'43=.3=9-*=(:77*39=(439*=9_== = &-.189=9-*7*=&7*=34=)&9&=43= +/ 7=;&1:*8=+47=9-*=2&(74&1,&1=85*(.*8=*=&2.3*)=-*7*`=.3=&= 8.2.1&7= 7**+= 8>89*2`=  +/ 7= ;&1:*8= 4+= 85*(.*8= <.9-.3= 7*)`='74<3= &3)= ,7**3= &1,&1= 5->1&= <*7*= .3).89.3,:.8-&'1*= P&3)*701.+9= ,**,_= P&7.&9.43= .3=  +/ 7= ;&1:*8= .3= 57.2&7>= ( 574):(*78=&7*=):*=94=).++*7*3(*8= .3=3.974,*3=84:7(*=7 ,=47=7 . `=@*9*7843=&3)=7>= +321`= &3)= 9-*= 8.2.1&7.9>= .3= 3.974,*3= ;&1:*8= 4+= 57.2&7>= 574):(*78= &243,= 14(&9.438= 8:,,*898= 9-&9= 3.974,*3= 84:7(*= &243,= 14(&9.438= .8= 8.2.1&7= +47= &11= 2&(74&1,&*_= -*7*= -&;*='**3=34=57*;.4:8=89:).*8=9-&9=7*5479=9-*= +/ 7=;&1:*=4+=<.1)=&'&143*_== = *5&7&9.43= 4+= +&99>= &(.)= 574+.1*8= 4+= 7*)= &3)= '74<3= &1,&*= .8= (438.89*39= <.9-= 9-&9= 7*(47)*)=57*;.4:81>`=&3)=(43+.728=9-*=1&(0=4+=8*5&7&9.43=&243,=85*(.*8=<.9-.3=*&(-= 5->1&=E4-38=*9=&1_=+313b=7*1843=*9=&1_=,**,_=-*=8*5&7&9.43=&243,=&11=5->1&=&(-.*;*)= '>=+&99>=&(.)=&3&1>8.8=.8=8.2.1&7=94=9-&9=4+=(&7'43=.84945*=&3&1>8.8`=*=(*59=9-&9=+&99>=&(.)= 574+.1*8=(4:1)=247*=7*&).1>=).89.3,:.8-='*9<**3=)*97.9:8=&3)='74<3=&1,&*`=57.2&7.1>= ):*=94=9-*=57*8*3(*=4+=).89.3(9='&(9*7.&1= +2a+ 381`=@-1*,*7=*9=&1_=,**/&b=@-1*,*7=*9=&1_= ,**/' = &3)= ).&942= +0a*`= +0a+ 381`= +0= @ `= &3)= ,*a/ 38-`= ::389&3= *9= &1_= +33.`= P4102&3= *9= &1_= +32*`= P.79:*= *9= &1_= +33- ='.42&70*78_= 8= @ = )*,7&)*= 6:.(01>`= 9-*= 7*1&9.;*1>=14<=;&1:*8=+47=,*a/ 38-=.3=)*97.9:8=.3).(&9*=9-&9=9-*=).&942=(42543*39=4+=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,+/ = =

9-*= )*97.9:8= <&8= )*,7&)*)_= )).9.43&1= '&(9*7.&1= '.42&70*78=  +/ = &3)=  +1 = .848= &3)= &39*.848'7&3(-*)==+:79-*7=8:55479*)=9-*=57*8*3(*=4+='&(9*7.&=.3=)*97.9:8=8&251*8`= (411*(9.;*1>=(4389.9:9.3,=0=4+=9-*=949&1=+&99>=&(.)8=57*8*39=.3=)*97.9:8_=:9:7*=89:).*8= 2&>='*3*+.9=+742=9-*=:8*=4+=89*741='.42&70*78=94=+:79-*7=).8(7.2.3&9*=9-*=.)*39.9>=4+= 2&(74&1,&*=*_,_=P4102&3=+320=.3=9-*=)*97.9:8=8&251*8_= = -*=2489=(42243=+&99>=&(.)8=4+=<.1)=&'&143*=.3=9-*=(:77*39=89:)>=&7*=(438.89*39=<.9-= 9-48*=4+=57*;.4:8=89:).*8=7*1843=*9=&1_=,**,b=:=*9=&1_=,**0=.3(1:).3,=9-*=57*8*3(*=4+= 9-*=8.,3&9:7*=34382*9->1*3*=.39*77:59*)=7=+&99>=&(.)8=9-&9=4((:7=.3=&'&143*=&3)= 49-*7= 2&7.3*= 2411:8(8= (02&3= ]= 445*7= +31-_= 5&9.&1= ;&7.&'.1.9>= .3= +&99>= &(.)= 574+.1*8= &243,= 14(&9.438= .8= 1.0*1>= 94= '*= &997.':9&'1*= 94= ).++*7*3(*8= .3= 85*(.*8= (42548.9.43= 4+= &1,&1= 5->1&= &243,= 14(&9.438_= *,&7)1*88= 4+= ).++*7*3(*8= .3= +&99>= &(.)= 574+.1*8=&243,=14(&9.43`=9-*=9745-.(=.39*757*9&9.43=4+=&'&143*=7*2&.38=:3(-&3,*)_== = '&143*=).*9== &7'43= .84945*= ;&1:*8= 574;.)*= 57.2&7>= *;.)*3(*= 9-&9= '74<3= &1,&*= &3)247= )*97.9:8= (4397.':9*= 247*= (&7'43= 94= 9-*= ).*9= 4+= &'&143*= 9-&3= 7*)= &1,&*_= -*= 1&(0= 4+= ).8(7.2.3&9.43= '*9<**3= 9-*= (&7'43= .84945*= ;&1:*8= 4+= '74<3= &1,&*= &3)= )*97.9:8`= -4<*;*7`= 2*&38= 9-*= 8484:7(*= 2.=.3,= 24)*1= <&8= :3&'1*= 94= 6:&39.+>= 9-*= 1.0*1>= (4397.':9.43= 4+= *&(-= 549*39.&1= +44)= 84:7(*_= -*= (*79&.39>= 4+= 7*8:198= <&8= .2574;*)= :8.3,=9-*=(42'.3*)=&;*7&,*=4+=(&7'43=.84945*=;&1:*8=+47='74<3=&1,&*=&3)=)*97.9:8=.3= 9-*= 8.3,1*= *1*2*39`= 9<4884:7(*= 2.=.3,= 24)*1= 84*7747`= <-.(-= 8-4<*)='74<3= &1,&*= &3)=)*97.9:8=94='*=247*=.25479&39=.3=9-*=).*9=4+=&'&143*=(425&7*)=94=9-&9=4+=7*)=&1,&*_= 9=.8=5488.'1*=9-&9=*=(1:8.43=4+=49-*7=84:7(*8=8:(-=&8=2.(74&1,&*=47='&(9*7.&=+742=9-*= 2.=.3,=24)*1=2&>=4;*7*89.2&9*=9-*=7*1&9.;*=(4397.':9.43=4+=+44)=84:7(*8=.3(1:)*)=.3= 9-*=24)*1`=&19-4:,-=9-*=(425&7&9.;*=)42.3&3(*=4+='74<3=&1,&18)*7.;*)=(&7'43=4;*7= 7*)=&1,&*=94=9-*=).*9=4+=&'&143*=7*2&.38=:3(-&3,*)_== = &99>= &(.)= 574+.1*8= &7*= (438.89*39= <.9-= 9-48*= 4+= (&7'43= .84945*8= &3)= .3).(&9*= 9-&9= )*97.9:8= &3)= '74<3= &1,&*= (4397.':9*= 247*= 94= 9-*= ).*9= 4+= &'&143*= 9-&3= 7*)= &1,&*_= 57&5-.(&1= 7*57*8*39&9.43= 4+= 9-*= +.789= 9<4= 57.3(.5&1= (42543*398= 8-4<= +&99>= &(.)= 574+.1*8= 94= ,.;*= ,7*&9*7= 7*841:9.43= 7*,&7).3,= 9-*= (4397.':9.43= 4+= '74<3= &1,&*= &3)= )*97.9:8`=&3)= .3).(&9*)=9-&9=).&9428=&3)='&(9*7.&=&7*=&=2&/47=(42543*39=4+=)*97.9:8= &3)= &7*= &3= .25479&39= 84:7(*= 4+= +44)= +47= &'&143*_= -*5-*7)= +31-'= &184= 7*(47)*)= &'&143*= _=7:'7& `= _=(>(14'&9*8 =&3)= _=8(&1&7.8 =94=(438:2*=)*97.9:8='>='74<8.3,=43=9-*= 74(0=8:7+&(*=&3)=9-.8=(4:1)='*=9-*=+**).3,=24)*='>=<-.(-=)*97.9:8=.8=(438:2*)=.3=9-*= (:77*39=89:)>_== = -*=9745-.(=(4397.':9.43=4+='74<3=&1,&*=94=&'&143*=).*9=.8=.11:897&9*)='>=9-*=+&99>=&(.)= 574+.1*8=43=@+=<-.(-=*=51&.3=1,=4+=9-*=;&7.&'.1.9>=&243,=8&251*8_=/74<3=&1,&*=-&)= -.,-*7=5*7(*39&,*8=4+=*88*39.&1=+&99>=&(.)8==,*a.380=&3)=,*a/38-=9-&3=7*)=&1,&*`= &3)=9-.8=.8=(438.89*39=<.9-=9-*=-.,-*7=5*7(*39&,*8=4+=9-*8*=+&99>=&(.)8=.3=9-*=574+.1*=4+= &'&143*_= 8= *88*39.&1= +&99>= &(.)8= 2:89= '*= )*7.;*)= +742= 9-*= ).*9= 4+= &= (438:2*7`= 9-*=

,+0 = %74/*(9=34_=,**.2*+- = =

-.,-*7= 5745479.43= 4+= `= &3)= 9-*7*+47*= -.,-*7= 3:97.9.43&1= ;&1:*= 4+= '74<3= &1,&*= (425&7*)=94=7*)=&1,&*`=2&>=*=51&.3=9-*=57*)42.3&3(*=4+='74<3=&1,&*=.3=9-*=).*9=4+= &'&143*=7*1843=*9=&1_=,**,_== = 9=.8=5488.'1*=9-&9=49-*7=&1,&1=85*(.*8=349=*=&2.3*)=.3=9-*=(:77*39=89:)>=&7*=9-*=2&.3= 84:7(*=4+=2&(74&1,&*=+47= _=7:'7& _=47=7*)=&1,&*`=&19-4:,-=(&7'43=.84945*=;&1:*8=2&>= ;&7>=<.9-=).++*7.3,=2475-414,>=&;*3=*9=&1_=,**,`=+&99>=&(.)=574+.1*8=4+=7*)=&1,&*=&7*= (438.89*39= &(7488= 9-.8= 5->1&= *_,_= ::389&3= *9= &1_= +330_= 9= .8= 9-*7*+47*= :31.0*1>= 9-&9= 8&251.3,=&=<.)*7=7&3,*=4+=7*)=&1,&1=85*(.*8=<4:1)=(-&3,*=9-*=7*1&9.;*=(4397.':9.43=4+= 7*)=&1,&*=94=9-*=).*9=4+=&'&143*=*=&2.3*)=-*7*_=.2.1&71>`=9-*=1&(0=4+=).8(7.2.3&9.43= &243,= 85*(.*8= +47= '74<3= &1,&*`= :8.3,= '49-= (&7'43= .84945*8= &;*3= *9= &1_= ,**,= &3)= +&99>= &(.)= 574+.1*8= E4-38= *9= &1_= +313`= 8:,,*898= 9-&9= 9-*= (42'.3*)= (-*2.(&1= 97&(*7= 9*(-3.6:*=.8=&=74':89=2*&38='>=<-.(-=&'&143*=).*9=2&>='*=*=&2.3*)_== = -*8*=7*8:198=4'9&.3*)=+742=(-*2.(&1=97&(*7=9*(-3.6:*8=&7*=.3=(4397&89=94=9-&9=4'8*7;*)= '>= -*5-*7)= &3)= 9*.3'*7,= +33,_= 3= &= +**).3,= 57*+*7*3(*= 97.&1`= 9-7**= 85*(.*8= 4+= &'&143*=(438.89*391>=&9*=9<4=7*)=&1,&1=85*(.*8=&3)=43*=(479.(&9*)='74<3=&1,&=&9=-.,-*7= 7&9*8= 9-&3= 49-*7= &1,&1= 85*(.*8_= -*5-*7)= &3)= 9*.3'*7,= +33,= 574548*)= 9-&9= 9-*= 94:,-3*88=4+=1&2.3&7.&3=&1,&1=85*(.*8=*_,_= (0143.&=7&).&9& =&3)=-.,-=(43(*397&9.43=4+= :35&1&9&'1*= 541>5-*341.(8= 2&>= *=51&.3= 9-*= 14<= (438:259.43= 7&9*8= 4+= _= 7&).&9& = 4'8*7;*)= <.9-.3= 9-*= +**).3,= 97.&1_= 47= &1.49.8= 74*. `= 9-*>= (43(1:)*)= 9-&9='74<3= &1,&*= 8:(-=&8= _=7&).&9& =2&>='*=(438:2*)=<-*3=9-*=247*=57*+*77*)=7*)=&1,&*=<*7*=&'8*39_== = 3=9-*=(:77*39=(439*=9=<-*7*=7*)=&1,&*=<*7*=&=(42243=+*&9:7*=4+=9-*=7**+=),&7=]= /&77*99=+331`=+333`=.9=.8= 349=(1*&7=<-&9=2*(-&3.828=&7*=)*9*72.3.3,=9-*=8*1*(9.43=4+= '74<3=&1,&*=4;*7=&55&7*391>=247*=57*+*7&'1*=7*)=&1,&1=85*(.*8=349*)='>=-*5-*7)=&3)= 9*.3'*7,=+33,`=-*5-*7)=+31-'`=+31/=&3)=49-*78_=1*&71>`=+&(9478=9-&9=)7.;*=&'&143*= ).*9=(-4.(*=&7*=247*=(4251*==9-&3=&1,&1=&':3)&3(*=&143*_=743*9-*1*88`=.9=<4:1)=2&0*= &3= .39*7*89.3,= (425&7.843= 94= )*9*72.3*= <-*9-*7= &'&143*= 7*8.).3,= &9= )*59-8= )*5&:5*7&9*=.3='74<3=&1,&*=._*_=1+/:,*=2=(438:2*=&=-.,-*7=5745479.43=4+=7*)=&1,&*= 9-&3=9-&9=4'8*7;*)=-*7*_=5.;*3=9-&9=9-*=541>5-*341.(=(439*39=4+=&1,&*=8:(-=&8= _=7&).&9& = .8=9-4:,-9=94=)*9*7=,7&?.3,='>=&'&143*=-*5-*7)=]=9*.3'*7,=+33,`=.9=.8=5488.'1*=9-&9= '74<3= &1,&*= 8:(-= &8= ->1148547&= (4248& = &3)= #:7;.11&*&= 549&947:2 = 9-&9= &7*= 14<= .3= 541>5-*341.(8= (425&7*)= 94= (0143.&= 7&).&9&= 9*.3'*7,= +323= &7*= 9-*= 2&/47= &1,&1= (4397.':9478= 94= 9-*= ).*9= 4+= &'&143*= .3= 9-*= (:77*39= 89:)>_= :9:7*= &551.(&9.43= 4+= :7= 2&70*78= *_,_= :*&,1*= *9= &1_= ,**/&b= :*&,1*= ]= 411.99= ,**0= 2&>= 574;*= :8*+:1= .3= 8*5&7&9.3,= 9-*= .)*39.9>= 4+= '74<3= &1,&*= (438:2*)= '>= &'&143*= &9= &7.&= 81&3)`= 9-&9= <*7*=:3&'1*=94='*=8*5&7&9*)=:8.3,=89&'1*=.84945*8=47=+&99>=&(.)8=.3=9-*=(:77*39=89:)>_== = 7:97.9.43&1=;&1:*=&3)=).,*89.'.1.9>=&7*=+:79-*7=(-&7&(9*7.89.(8=4+=2&(74&1,&*=(438.)*7*)= 94=51&>=&=741*=.3=9-*=).*9=(-4.(*=4+=&'&143*=-*5-*7)=]=9*.3'*7,=+33,_=7*1843=*9=&1_= ,**,= +*)= 85*(.+.(= 2&(74&1,&1= ).*98= 94= 9-*= &1.+473.&3= &'&143*= &1.49.8=+:1,*38 = 2*&3= 8-*11=1*3,9-=.,:03=22=94=9*89=9-*=.25479&3(*=4+=+&99>=&(.)8=@=&3)==94=9-*=).*9=4+=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,+1 = =

&'&143*_='&143*=,74<9-=7&9*=<&8=1.30*)=94=9*25*7&9:7*`=&3)=9-*=-.,-*89=,74<9-=7&9*8= 4((:77*)=.3=&'&143*=+*)=9-*='74<3=&1,&= ,7*,.&=2*3?.*8.. =(425&7*)=94=9-48*=&'&143*= +*)=7*)=47=,7**3=&1,&*_= _=2*3?.*8.. = -&)= -.,-*89= 1*;*18= 4+= ,*= @ = &3)= 9-*= -.,-*89= 7&9.4= 4+= ,*a.380= 94= ,*a/38-_= /74<3= &1,&*= .3= 9-*= (:77*39= 89:)>= &184= -&)= -.,-*7= 5745479.438`=43=&;*7&,*`=4+=,*=@ =&3)=,*a.380=94=,*a/38-=9-&3=7*)=&1,&*`=&3)=.9= 2&>='*=9-.8=-.,-*7=3:97.9.43&1=;&1:*=4+='74<3=&1,&*=.3=9-.8=89:)>=9-&9=.8=&3=.25479&39= )*9*72.3&39=.3=.98=8*1*(9.43_== = /&(9*7.&=7*8.)*39=.3=9-*=,:9=4+=&'&143*=.3=9-.8=7*,.43=2&>=&184=+&(.1.9&9*=9-*=).,*89.43=4+= '74<3=&1,&*_=47=*=&251*`='&(9*7.&=7*8.)*39=.3=9-*=,:9=4+= _=2.)&* =-&;*='**3=8-4<3=94= 51&>=&=741*=.3=9-*=).,*89.43=4+=(4251*==541>8&((-&7.)*8=(422431>=+4:3)=.3= _=2&=.2& = &3)=49-*7='74<3=&1,&1=85*(.*8=7&82:8=*9=&1_=+331_==*158+*)=&3.2&18=&184=&55*&7*)=94= '*= &'1*= 94= &)/:89= 9-*.7= *3?>2&9.(= &(9.;.9>= 94= :9.1.?*= 9-.8= +44)= 84:7(*= 7&82:8 = *9= &1_= +331_=-*=741*=4+=,:9='&(9*7.&=.3=+&(.1.9&9.3,=9-*=).,*89.43=4+='74<3=&1,&*=+47=&'&143*= _=7:'7& =14(&9*)=&9=&7.&=81&3)=7*6:.7*8=+:79-*7=89:)>_== = -.8= 89:)>=574;.)*8=7*8:198=(4397&7>=94=842*=(42243=5*7(*59.438=&'4:9=9-*=).*9=4+= :897&1.&3= &'&143*= &3)= 549*39.&11>= 574;.)*8= 9-*= +.789= *;.)*3(*= 9-&9= :897&1.&3= <.1)= &'&143*= &7*= &'1*= 94= )*7.;*= &= 2&/47= 5479.43= 4+= 9-*.7= 3:97.9.43&1= 7*6:.7*2*398= +742= '74<3= &1,&*_= &*= &184= (43+.72= 9-*= 741*= 4+= ).&9428= &3)= )*97.9&1= 2&99*7= .3= 9-*= ).*9= 4+= &'&143*_=:79-*7=<470=.8=7*6:.7*)=94=)*9*72.3*=9-*=2*(-&3.828=)7.;.3,=&'&143*=).*9= (-4.(*_=-*=;&1:*=4+=(42'.3*)=(-*2.(&1=97&(*7=&5574&(-=.8=)*243897&9*)=&3)=4++*78=&= 5742.8.3,=9441=+47=+:9:7*=).*9&7>=89:).*8_=== = (034<1*),*2*398= &*=9-&30=/_=433*11`=_=&;&`=_=''499`=&3)=_==.15&97.(0= +47=&88.89&3(*= .3=9-*=+.*1)_= -&308= 94= 5_= ),&7= &3)= E_= P&1*39.3*= <-4= -*15*)= <.9-= .)*39.+.(&9.43= 4+= 7*)= &1,&*= 85*(.*8_= -*= &88.89&3(*= 4+= /_= 443*>`= _= .11*7`= =_= &-*&91*>= <.9-= 1&'47&947>= 574(*88.3,=&3)=.39*757*9&9.43=4+=+&99>=&(.)=574+.1*8=<*7*=*85*(.&11>=-*15+:1_=-&308=94= E_= &0*8= +47= &);.(*= <.9-= &3&1>8.8= 4+= )*97.9&1= 8&251*8_= :_= 41)8<479-= 2&3&,*)= 9-*= = 58= +&(.1.9>_= );.(*= +742= = *;.11= <&8= :8*+:1= .3= 24)*11.3,= &3)= .39*757*9&9.43=4+=89&'1*=.84945*=;&1:*8_=422*398=43=9-*=2&3:8(7.59='>=_=:3)>`=_= -*5-*7)=&3)=9<4=&343>24:8=7*;.*<*78=&7*=&557*(.&9*)=&3)=-*15*)=94=.2574;*=9-*= 2&3:8(7.59_=-&308=94=_=47++*<=+47=(7*&9.3,=9-*=2&5_= = =

,+2 = %74/*(9=34_=,**.2*+- = =

55*3).==3a=239*11*(9:&1=%745*79>= 74=(422*7(.&11>=;&1:&'1*=.39*11*(9:&1=5745*79>=7*8:19*)=+742=9-.8=7*8*&7(-_= *8:198=&7*=574;.)*)=<.9-=34=5749*(9.43=47=(43+.)*39.&1.9>_= =

55*3).==+*a=9&++= 8&82&3.&3=6:&(:19:7*=&3)=(.8-*7.*8=9*8*&7(-=2389.9:9*=8(2= 884(.&9*=@74+*8847=9*<&79=7:8-*7`== @74+*8847=41.3=/:=943= @74+*8847=7&.,=E4-3843= =*;.3=*))= :7=7*;.11*=/&77*99= :7=E4*=P&1*39.3*= :7=:,-=@*)*7843= :7=.(-&*1&=5:*89= :&;.)=&7'&9-= E:89.3=:118= = ?29D= :7=@*9*7=7.(-418= = &= :7=.243=E&72&3=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,+3 = =

9*+*7*3(*8= = >9=,**1= :897&1.&3=.8-*7.*8=9&9.89.(8=,**0`=&3'*77&`=:897&1.&_= (02&3= 9#`= *445*7= ' = +31-= 74382*9->1*3*8.39*77:59*)= +&99>= &(.)8= .3= 1.5.)8= 4+= 8-&114<8<&9*7= 2&7.3*= .3;*79*'7&9*8a= &= (425&7.843= 4+= 9<4= 2411:8(8= 
.9947.3&= 1.9947*& = &3)=
:3&9.&= 97.8*7.&9& = <.9-= 9-*= 8&3)= 8-7.25=  %7&3,43= 8*59*285.348:8 _= %425=&.4(-*2=->8.41 =.0> `=+/-8+0/_= ,:89.`='`=-&>1*7`=`=*&7<44)`=)`=E&:,-&3`=2`=:3)*71&3)`=+`=>243)843`=F= ,**-= 411*2'41&= &8= &19*73&9.;*= 57*>= 8:89&.3.3,= 85.)*78= .3= &7&'1*= *(48>89*28a= 57*>= )*9*(9.43= <.9-.3= 57*)&9478= :8.3,= 241*(:1&7= 2&70*78_= 41*(:1&7= (414,> = +, `= -.01: -.1/_= 3)*7843`=
)`=F.11.8=8) =,**-=&343.(&1=&3&1>8.8=4+=57.3(.5&1=(447).3&9*8a=&=:8*+:1= 2*9-4)=4+=(43897&.3*)=47).3&9.43=+47=*(414,>_= (414,> =2. `=/++8/,/_= 3)7*<= 'G`=
&(&.&72.)= > = +33+= 39*77*1&9.438= '*9<**3= 8*&= :7(-.38= &3)= 85.3>= 14'89*78=.3=3479-*&89*73=7*<=\*&1&3)_= &7=(41=74,7*88="*7.*8 =1* `=,++8,,,_= 3)7*<= 'G`= =3)*7<44)= ) = +33,= 884(.&9.438= &3)= &':3)&3(*= 4+= 8*&= :7(-.38= &3)= &'&143*=43=8-&114<=8:'9.)&1=7**+8=.3=84:9-*73=7*<=4:9-=&&1*8_= &7='7*8-<=)*8 = .- `=+/.18+//3_= 343>24:8 = +333= )*;.*<=4+=9-*=2&3&,*2*39=51&3=4+=9-*=*&82&3.&3=&'&143*= +.8-*7>`= , _= :*5&792*[email protected]&7>=3):897.*8`=&&9*7=&3)=2514>2*39`=4'&79_= 343>24:8 =,**1= '.8-= 43*9&7>="94(0=((4:39=+330:,**0 `=:(01&3)`=7*<=\*&1&3)= 90.3843 = G)`=
&>+.*1)= `= ?4(0(74+9 = ?= ,**/= -*= 549*39.&1= +47= :8.3,= &(4:89.(= 97&(0.3,=94=243.947=9-*=24;*2*39=4+=9-*=&*89=4&89=74(0=14'89*7= 1&8:8=1&1&3).. _= +7.(&3=14:73&1=4+= &7.3*="(.*3(* =,1 `=.*+8.*2_== :897&1.&3= >:7*&:= 4+= 9&9.89.(8 = ,**/= :897&1.&3= (438:2*7= 57.(*= .3)*=a= (43(*598`= 84:7(*8=&3)=2*9-4)8`=&'1*=,_+`=*9&.1=(438:2*7=57.(*=.3)*==3:2'*78`=&9_=34_= 0.0+_*`=;.*<*)=+-=:*(*2'*7=,**1_== >&'(4(0=9?`=+*11>=`=-*&78='8`=F&10*7=)F`=F.11.8=8)=+333=-&3,*8=.3=(422:3.9>= 897:(9:7*=.3=9*25*7&9*=2&7.3*=7*8*7;*8_= &7=(41=74,="*7 =+23 `=+,/8+-._== >&70&.= `= >7&3(-= #
= +322= 3*7,>= 7*6:.7*2*398= +47= &= )*38*= 545:1&9.43= 4+= 74(0= 14'89*78= 1&8:8= 1&1&3).. a= 34;*1= .25479&3(*= 4+= :3479-4)4== +44)= 84:7(*8_= &7= (41= 74,="*7 =/* `=2-830_== >&70&.=`=&&;.8=?`=8:,<*11== +330=@7*>=8*1*(9.43='>=9-*=4:9-=+7.(&3=(&5*=74(0= 14'89*7= 1&8:8=1&1&3).. a=(414,.(&1=&3)=5->8.414,.(&1=&5574&(-*8_= &:11*9.3=4+= &7.3*= "(.*3(* =/2 `=+:2_= >&70&.=9`=#7.++.9-8=?G =+320=:.*9=4+=4:9-=+7.(&3=&'&143*= &1.49.8=2.)&* _= "=+7=1= &7= "(. =.`=-18.._=

,,* = %74/*(9=34_=,**.2*+- = =

>&77*99= '`= ),&7= #`=
47943= `= >:=943= ?= ,**-= = )*(&)*= 4+= 89:)>= .3= &82&3.&3= @88@&79=,_= '.8-.3,=*4)&> =+0 `=,+:,-_= >&77*99='`=),&7=#)`=>:=943=?& =.3=57*88=-&3,*8=.3=.3;*79*'7&9*=&3)=2&(74&1,&1= 545:1&9.438= <.9-.3= &82&3.&3= 2&7.3*= 7*8*7;*= .3= 9-*= )*(&)*= +4114<.3,= 5749*(9.43_= 1==5= &7=&.41=(41_ = >&77*99= '`= ),&7= #)`= >:=943= ?&`= *&))43=
= ,**1= -&3,*8= .3= +.8-= &88*2'1&,*8= +4114<.3,=+*=>*&78=4+=5749*(9.43=.3=&82&3.&3=2&7.3*=5749*(9*)=&7*&8_= 1==5= &7= &.41=(41 =-./ `=+.+8+/1_= >*11<44)= &9`= *:,-*8= 8%`= (410*= ?`= '>8974*2=
= ,**.=43+7439.3,=9-*=(47&1=7**+= (7.8.8_= &9:7* =.,3 `=2,182--_= >*73&3)*?=?`=(7*.7*=)`=#43?&1*?8#:77.&7&3== ,***=**).3,=4+=9-*=85.)*7=(7&'= &/&= 86:.3&)4= .3=74(0>=8:'9.)&1=&7*&8=4+=9-*=.&=)*=74:8&=3479-8<*89=5&.3_= 1= &7= &.41=884(=45 =2* `=3/8+*,_= >*89= ')`= >7&)8-&<= ?)`= *.3)*11=
`= '.(-418= %& = ,**-= P*79.(&1= 897&9.+.(&9.43= 4+= +&99>= &(.)8= .3= 9-*= '1:''*7= 4+= 84:9-*73= *1*5-&39= 8*&18=  .74:3,&= 1*43.3* a= .251.(&9.438=+47=).*9=&3&1>8.8_= %425=&.4(-*2=->8.41 =+-.> `=,/-8,0-_= >.3,-&2=>G`=F&19*78=G)= +323=41.9&7>=&8(.).&38=&8=57*)&9478=4+=.3;*79*'7&9*=1&7;&*a= ;.)*3(*= +742= ,:9= (439*39= &3&1>8*8= &3)= 51&30943= 8&251*8_= 1= =5= &7= &.41= (41 = +-+ `=+.18+/3_= >7*.9':7,`=&G =+32.=*8.):&1=*++*(98=4+=,7&?.3,a=3-.'.9.43=4+=(425*9.947=7*(7:.92*39= '>=*3(7:89.3,=(47&11.3*=&1,&*_= (414,> =0/ `=++-08++.-_== >:11*7.=(`=>*794((.=2`=
.(-*1.`=( =,**,=39*751&>=4+=*3(7:89.3,=(47&11.3*=&1,&*=&3)=8*&= :7(-.38=.3=2&.39&.3.3,=&19*73&9.;*=-&'.9&98_= &7=(41=74,="*7 =,.- `=+*+8+*3_= >:=943= ?`= >&77*99= '`= *&))43=
`= #&7)3*7= ?`= ),&7= #) = ,**0= ;&1:&9.3,= 9-*= *++*(9.;*3*88= 4+= 2&7.3*= 5749*(9*)= &7*&8= &8= &= +.8-*7.*8= 2&3&,*2*39= 9441_= *5479= 74_= := +3332+0,`= .8-*7.*8= *8*&7(-= &3)= :*;*1452*39= 47547&9.43`= :897&1.&_= ?&((&2.8* =:`=*).3==+32/=3=&*74)>3&2.(='&8.8=+47=8*1*(9.3,=97&382.99*7=14&)8= .3=3.7)8_= 6.1843=&:11*9.3 =31 -`=-*08-+2_= ?&79*7= )`= 9**1*= &* = +32,= 942&(-= (439*398= 4+= .22&9:7*= 14'89*78=  42&7:8= &2*7.(&3:8 =+742=@1&(*39.&=/&>`=7*<+4:3)1&3)_= %&3=1=7441 =0* `=--18-.1_= ?&89&3*)&8(*73&3)*?8&*8G&7&= E`= *7;.*7*8H&7&,4?&= `= **73&3)*?8E&?6:*?= `= >:91*7=
) =,**/=**).3,=*(414,>=4+=/:;*3.1*=85.3>=14'89*7`=&3:1.7:8=.39*77:59:8 = 43=9-*=@&(.+.(=(4&89=4+=/&/&=&1.+43.&=:7`=*=.(4_=7\=E=&7=7*8-<&9=*8= -3 `=.,/8 .-/_= ?-&52&3= 9D = +32+= 9&'.1.9>= 4+= 8*&= :7(-.3= )42.3&9*)= '&77*3= ,74:3)8= +4114<.3,= )*897:(9.;*=,7&?.3,=4+=0*15=.3=9_=&7,&7*98=/&>`=*&89*73=&3&)&_= &7_=&.41_ =0, `= -*18-++_= ?-7.89.*=FF=+32,=
.5.)=3&1>8.8 _=@*7,&243=@7*88`==+47)_= ?1&70*= +9= +33-= 7435&7&2*97.(= 2:19.;&7.&9*= &3&1>8*8= 4+= (-&3,*= .3= (422:3.9>= 897:(9:7*_= :89=1=(41 =+2 `=++18+.-_==

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,,+ = =

?433*11=& =,**-=-*=2434541.?&9.43=4+=:3)*78947*>=-&'.9&9='>=8:'9.)&1=*3(7:89.3,= (47&11.3*= &1,&*a= &= 9*89= 4+= 9-*= (42'.3*)= *++*(98= 4+= (&345>82*).&9*)= 1.,-9= &3)= 8*).2*39&9.43_= &7=&.41= +., `=+*0/8+*1+_== ?433411>= 9
`= *.3)*11= )`= #472&3= & = ,**/= *&,7&88= &3)= *5.5->9.(= &1,&*= 8:55479= 3:97.9.43=4+=&=+.8-*7.*8=85*(.*8= ".11&,4=8(-42':7,0.. =.3=&)/&(*39=.39*79.)&1=-&'.9&98_= &7=(41=74,="*7 =,20 `=03813= ?4<*3=9+ =+32-=-*=*++*(9=4+=8-**5-*&)= "*2.(488>5-:8=5:1(-*7 =57*)&9.43=43=7*)=8*&= :7(-.3=  "9743,>14(*39749:8= +7&3(.8(&3:8 = 545:1&9.438a= &3= *=5*7.2*39&1= &3&1>8.8_= *(414,.&= /2 `=,.38,//_= ?7*&7=>`=*&79=%`=8-42&8=?`=>&7(1&>=
=,**,=;&1:&9.43=4+=(422*7(.&1=8-7.25=,74<8 4:9=5*11*98=&8=).*98=+47=/:;*3.1*=84:9-*73=74(0=14'89*7`= 1&8:8=*)<&7)8.. a=.3+1:*3(*=43= ,74<9-`=8:7;.;&1`=(4147`=&3)='.4(-*2.(&1=(42548.9.43_= 1=551=6:&(:19= +, `=.-8/1_= &&-1,7*3=?%`=4'*1=) =,***=:*8.,3.3,=&=)7>=9479:,&8=*(414,.(&1=7*8*7;*a=4<='.,=.8= '.,=*34:,-
=4=)4=<-&9
= &:11= &7="(. =00 `=1*181*3_= &&18,&&7)= )`= 9= )4-3=
= ,**.= &99>= &(.)= '.42&70*78a= ;&1.)&9.43= 4+= +44)= <*'= &3)= 9745-.(= 2&70*78= :8.3,= +-81&'*11*)= +&99>= &(.)8= .3= /:;*3.1*= 8&3)**1=  224)>9*8= 94'.&3:8 _= %&3=1='.8-=6:&9="(. =0+ `=+01+8+02*_= &&18,&&7)= )`= 9= )4-3=
`= +&993*7= #`=
:11*78'&;&77&`= *&,*3= F= ,**-= &99>= &(.)= 9745-.(=2&70*78=.3=9-*=5*1&,.(=2&7.3*=*3;.7432*39_=);= &7=&.41 =.0 `=,,/8-.*_= &&:2*= `= >7&3)8#&7)3*7= `= F4*10*71.3,= F) = +333= *991*2*39= 4+= &'&143*= 1&7;&*= &1.49.8=1&*;.,&9& =.3=7*85438*=94=3438,*3.(:1&9*=(47&11.3*=7*)=&1,&*=47&11.3&1*8`= -4)45->9&_= 1==5= &7=&.41=(41 =,-. `=+,/8+.-_= &&>=`=>7&3(-=#
=,**,=++*(98=4+=8*&=:7(-.38= &7*(-.3:8=&3,:148:8 =43=7*(7:.98=&3)= /:;*3.1*8=4+=&'&143*= &1.49.8=2.)&* _= (41= 434,7 =1, `=--8+.3_= &&>= 9F`= ?440= % = +33/= /.&8= 94<&7)8= '74<3= &1,&*= .3= )*9*72.3.3,= ).*9= &3)= +44)= 57*+*7*3(*8a=9-*=4:9-=+7.(&3=&'&143*= &1.49.8=2.)&* _= &7='7*8-<&9=)*8 =.0 `=0,-8 0,1_= &&>=9F`=I:.33=#% =+323=425&7.843=4+=97*&92*398=&+9*7=&3=&3&1>8.8=4+=;&7.&3(*=.3= *(414,>_= (41= 434,7 =/3` =.--8.0-_= &&>943= %+ = +31+= 425*9.9.43`= ).89:7'&3(*`= &3)= (422:3.9>= 47,&3.?&9.43a= 9-*= 574;.8.43= &3)= 8:'8*6:*39= :9.1.?&9.43= 4+= 85&(*= .3= &= 74(0>= .39*79.)&1= (422:3.9>= (41= 434,7= -+ `=-/+8-23_= &*&,1*= >`= 8411.9= & = ,**0= O:&39.9&9.;*= &3&1>8.8= 4+= 57*>= :7= .3= 5.33.5*)= +&*(*8a= 549*39.&1=94=*89.2&9*=).*9=(42548.9.43
=438*7;=5*3*9= 2`=1.-81.1_= &*&,1*= >`= 8411.9= &`= )&72&3= `= *.3)*11=
`= 87.9*8= `= #&1*8= '= ,**/'= 41*(:1&7= 8(&9414,>=&8=&=9441=94=89:)>=).*9a=&3&1>8.8=4+=57*>=:7=.3=8(&98=+742=(&59.;*=9*11*7= 8*&=1.438_= 41*(:1&7=(414,> =+. `=+2-+:+2.,_= &*&,1*=>`=)&72&3='`=%*2'*7943=&`=#&1*8=') =,**/&=5*3*9.(=8(7**3.3,=+47=57*>=.3= 9-*=,:9=(439*398=+742=&=,.&39=86:.)= 7(-.9*:9-.8 =85__= 1=*7*) =30 `=.+1:.,-_= &7&5*7='9`=2.9-=* =+32+= 551.*)=7*,7*88.43=&3&1>8.8 _=E4-3=&.1*>=]=438`=7*<=Q470`= 7Q_=

,,, = %74/*(9=34_=,**.2*+- = =

&:,&3= )`= &&;.8= # = +33-= 551.(&9.438= 4+= 2&7.3*= 7*+:,.&= 94= (4&89&1= +.8-*7.*8= 2&3&,*2*39_= %&3&).&3=14:73&1=4+='.8-*7.*8=&3)=6:&9.(="(.*3(*8 =/* `=,*,38,*.,_= &:389&3= #`=>&.11.*= *)`=>&77*99=
`=E4102&3=)+ =+330=++*(9= 4+=).*9=43=9-*=1.5.)= (42548.9.43=4+=<.1)=&3)=(:19:7*)=&'&143*_= 6:&(:19:7* =+.* `=++/8+,1_= &:389&3= #`= E4102&3= )+`= >&77*99= 
`= G*94.= )
`= )*++7*>= F= +33.= 88*39.&1= 541>:38&9:7&9*)= +&99>= &(.)8= +742= +.= 85*(.*8= 4+= ).&942= /&(.11&7.45->(*&*_= ->94(-*2.897> =-/ `=+//8+0+_= ),&7= #`=
4;*71*>= )`= >&77*99= '`= %*9*78= &`= 9**)= ?= +331= -*= (438*7;&9.4387*1&9*)= '*3*+.98= 4+= &= 8>89*2&9.(= 2&7.3*= '.414,.(&1= 8&251.3,= 574,7&22*a= -*= &82&3.&3= 7**+='.47*,.43&1.8&9.43=&8=&=(&8*=89:)>_= &.414,.(&1=%438*7;&9.43 =13 `=,,1:,.*_= ),&7= #) = +32.= 5*3*7&1= +*&9:7*8= 4+= 9-*= *(414,>= &3)= '.4,*4,7&5->= 4+= &82&3.&3= 8:'9.)&1=74(0>=8-47*=(422:3.9.*8_= 74(=)="4(=*&8 =++2 `=+1-8+20_= ),&7=#) =,***= :897&1.&3=2&7.3*=1.+*a=9-*=51&398=&3)=&3.2&18=4+=9*25*7&9*=<&9*78 _=**)= 7*<=411&3)`=:897&1.&_= ),&7= #)`= >&77*99= ' = +331= -479= 9*72= 243.947.3,= 4+= '.49.(= (-&3,*= .3= &82&3.&3= &7.3*=*8*7;*8_= 1==5= &7=&.41=(41 =,+- `=,0+8,13_= ),&7=#)`=>&77*99=' =+333=++*(9=4+=9-*=)*(1&7&9.43=4+=2&7.3*=7*8*7;*8=43=&82&3.&3= 7**+=+.8-*8`=.3;*79*'7&9*8=&3)=51&398_= 1==5= &7=&.41=(41 =,., `=+*18+.._= 11.499='#`=>&791*99=)`=;&38=>`=D++.(*7=9`=*&))43=
= ,**,=551.(&9.43=4+=241*(:1&7= ,*3*9.(8= 94= 9-*= :897&1.&3= &'&143*= +.8-*7.*8a= +47*38.(= 57494(418= +47= 85*(.*8= .)*39.+.(&9.43= &3)= '1&(01.5= 894(0= 897:(9:7*_= 55_= +,:,. = .3= = &7.3*= *8*&7(-`= &3)=.8-*7.*8=*8*&7(-=&3)=:*;*1452*39=47547&9.43_== 33.8= # = +31- = 44)`= +**).3,`= &3)= (43).9.43= 4+= 14'89*78`= 42&7:8= &2*7.(&3:8 `= 9-74:,-4:9= 9-*= 8*&843&1= (>(1*= .3= /43&;.89&= /&>`= 7*<+4:3)1&3)_= 14:73&1= 4+= 9-*= '.8-*7.*8=)*8*&7(-=&4&7)=4+=%&3&)& =-* `=+3*/:+3*3_= 7&82:8= )*`= ?440= %`= ?4>3*= E = +331= -*= 741*= 4+= '&(9*7.&= .3= 9-*= ).,*89.43= 4+= 8*&<**)='>=9-*=&'&143*= &1.49.8=2.)&* _= 6:&(:19:7* =// `=-118-20_= 89*8= )`= %&12.8&34= )( = +31.= *&= 499*78a= 9-*.7= 741*= .3= 897:(9:7.3,= 3*&78-47*= (422:3.9.*8_= "(.*3(* =+2/ `=+*/28+*0*_= (&76:-&7=#&`=-1*71.3,*7=)9`=*:'7.(0=+8= +323=&7'43=.84945*=).8(7.2.3&9.43=&3)= 5-4948>39-*8.8_= 33=)*;=1&39=->8.41=1&39= 41=&.41 =.* `=/*-8/-1_= (&77*11= `= 942&3= )`= :36:.89= = ,***= :.*9&7>= 8*5&7&9.43= 4+= 8>25&97.(= (&73.;47*8= .)*39.+.*)='>=241*(:1&7=&3&1>8.8=4+=8(&98_= 41*(:1&7=(414,> =3 `=+/2-:+/3*_= (*3943=#`=9.9?=& =+322=-&3,*8=.3=(&7'43=&3)=->)74,*3=89&'1*=.84945*=7&9.48=4+= 2&(74&1,&*= &3)= 8*&,7&88= ):7.3,= )*(42548.9.43_= 89:&7= %4&89= "-*1+= "(. = ,0 `= .,38 .-0_= (*3943= #`= 9.9?= &= +323= 5&9.&1= ;&7.&'.1.9>= 4+= +- a +, = &3)= :a= .3= (0143.&= 7&).&9& = _,_=E_=,&7)-=)&2.3&7.&1*8_= 89:&7=%4&89="-*1+="(. =,2 `=3/8+*,_= (.*1)*7= &= +30/= -*= 5.3>= )4'89*7`= 1&8:8= 1&1&3)*. = _= .13*= )<&7)8`= .3= 4:9-= :897&1.&a=44)`=**).3,`=&3)=)4(424947=(9.;.9>_= :897&1.&3=14:73&1=4+= &7.3*=&3)= '7*8-<&9*7=)*8*&7(- =+0 `=-/+:-01_= (.33*>=&) =+31+= 74'.9=&3&1>8.8 _=&2'7.),*= 3.;*78.9>=@7*88`=&2'7.),*_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,,- = =

(1*2.3,=  = +33/= :. ,*89.;*= *++.(.*3(>= 4+= 9-*= :897&1.&3= &'&143*= &1.49.8= 7:'7& = .3= 7*1&9.43=94=,74<9-=&3)=+**)=57*+*7*3(*_= 6:&(:19:7* =+-. `=,138 ,3-_ = (1*9(-*7= F) = +321= 39*7&(9.438= &243,= 8:'9.)&1= :897&1.&3= 8*&= :7(-.38`= ,&897454)8`= &3)=&1,&*a=++*(98=4+=*=5*7.2*39&1=7*24;&18_ =(41= 434,7 =/1 `=23 8+*3_= (4&1*= `= &&>= 9 = +33,= *(4,3.8&'.1.9>= 4+= &1,&*= .3,*89*)= '>= &'&143*_= :89= 1= &7= '7*8-<&9=)*8 =.- `=+--+8 +--2_ = (411*8&=
?`=?:((:=&`= ?&33&8=9 `=&'&9.3.=`=?&:= =,**1=2.,7&9.43=&3)=7*9*39.43= 4+= &1.3:7:8=*1*5-&8 =&'7.(.38`=+121=.3=&=(*397&1=<*89*73=*).9*77&3*&3= 2&7.3*= 5749*(9*)=&7*&_= "(.*39.&= &7.3& =1+ `=,138,2/_= (478>9-= 
`= ?1&70*=
)`= ?&1;*7= ?9`=
(?1*3&,-&3=
%`= ?47'*99= +&`= E.(&7>=
) = ,**/&= 9*414,>= 4+= 3479-*&89= *&82&3.& _= *).9.43= ,**/_+_= 5*414,.(&1= 91&8= +a,/*`***= ).,.9&1=8*7.*8_=.3*7&1=*84:7(*8=&82&3.&_ = (4<1*78 F&10*7=
)`= ?433*11= & = ,**,= 5548.3,= 89&9*8= 4+= 8:'9.)&1= -&'.9&9= &(7488= 9*25*7&9*= :897&1.&a= (438.89*3(>= &3)= 57*).(9&'.1.9>= .3= 0*15= (&345> 8'*39-.(= &884(.&9.438_= &7=(41=74,="*7= ,.* `=.38/0_= (7:8-*7=  = +331= "94(0= &88*882*39= 7*5479`= 74(0= 14'89*7 _= &7.3*= *84:7(*8= :.;.8.43`= :*5&792*[email protected]&7>=3):897 .*8=&3)=.8-*7.*8`=4'&79`=:897&1.&_ = #**=)
=+323=3=*(414,.(&1=&3)=*(4342.(=7*;.*<=4+=2*.4+&:3&=&8=+44)=+47=+.8-_= 7441=1=
.33="4( =30 `=,.-8,0+_= #.81&843= *`= .3(1&.7=
`= &.38':7>= +)`= D>4>1*= 9 = ,***= >2548.:2= 4;*7;.*89*2=4'/*(9.;*8= <.9-.3=+.8-*7.*8=2&3&,*2*39_= :%"=14:73&1=4+= &7.3*="(.*3(* =/1 `=.028 .1/_ = #41*9 = F)`= (45*1= &`= ?445*7= >`= F&9843= 222 = F* = ,**0= :&.1>= 5&99*738= 4+= 14(4249.43= *=57*88*)= '>= 2*7.(&3= )4'89*78=  42&7:8= &2*7.(&3:8 = .3= 9-*.7= 3&9:7&1= -&'.9&9_= 14:73&1=4+=%7:89&(*&3= &.414,> =,0 .`=0+*80,*_= #47+.3*= *+`= *&79= 
`= ?&11&3=
% = +330= ;&1:&9.43= 4+= 2*9-4)8= 94= &88*88= &'&143*= &':3)&3(* `= := 57&39= 3-2+**_= P.(947.&3= .8-*7.*8= *8*&7(-= 389.9:9*`= *1'4:73*_= #7:'*79=
`=&:389&3=#`=9.9&7=) =,**.= ).5.)=&3)=+&99>=&(.)=(42548.9.43=4+=57* 8= &3)= 54898 85&<3.3,= '1&(01.5=  &1.49.8= 7:'7& = &3)= ,7**31.5=  &1.49.8= 1&*;.,&9& = &'&143*= (43).9.43*)=&9=9<4=9*25*7&9:7*8=43=&=+472:1&9*)=+**)_= 6:&(:19:7* =,., `= ,318-++_== #:*89=
`=?433411>=9
=,**0=4;*2*39=4+=(&7'43=&243,=*89:&7.3*=-&'.9&98a=9-*= .3+1:*3(*=4+=8&192&78-=5&9(-=8.?*_= &7=(41=74,="*7 =-+* `=+/8,._ = #:*89=
`=?433411>=9
`= G43*7&,&3='9 =,* *.=&.9-.3=&3)=&243, 88.9*=;&7.&'.1.9>=.3= )*19&= 8 +-= &3)= )*19&= 7 8+/= +47= 9-7**= *89:&7.3*= 574):(*78`= "5474'41:8= ;.7,.3.(:8 `= 7489*7&=(&57.(473. `=&3)=*5.5->9*8=4+= 78(&57.(473. _= 6:&9=&49 =13 `=21 83._= #:*89=
`= '.(-418= %&`= (7:8-*7= &`= *.789= )= ,**2= ;.)*3(*= 4+= & '&143*=  &1.49.8= 7:'7& = ).*9= +742= (42'.3*)= +&99>= &(.)= &3)= 89&'1*= .84945*=&3&1>8*8_= &7= &.41 = +/- `= /138/22_=

,,. = %74/*(9=34_=,**.2*+- = =

*&))43=
=,**+= 4)*11.3,=&3)=6:&39.9&9.;*=2*9-4)8=.3=+.8-*7.*8 `=-&52&3=]=&112= @7*88`=/4(&=&943`=)_= *&77.843= ) = +32-= *-*= *&82&3.&3= &'&143*= +.8-*7> _= &82&3.&3= .8-*7.*8= *8*&7(-`= 4'&79`=&82&3.&3=.8-*7.*8=:*;*1452*39=:9-47.9>`=55_=+038+2+_= *&<0.38= ) = +32-= 39*7&(9.438= 4+= &9*11& = &3)= 2&(74&1,&*= <.9-= 8*991.3,= "*2.'&1&3:8 = '&1&34.)*8 =)__= 1==5= &7=&.41=(41 =1+ `=//81,_= *.(02&3=E= +3./=749*8=43=9-*=&82&3.&3=7&>+.8-`= 1&8:8=1&1&3).. =.13*=)<&7)8_= &5*78=&3)=74(**).3,8=4+=9-*=)4>&1="4(.*9>=4+=*&82&3.& `=,1:-2_= *44,* = %'`= .(-*31&:'= F
`= 414243= + = ,**+= 8.3,= 5= 94= &3&1>?*= &3.2&1= 24;*2*398= .3= 9-*= 2&7.3*= *3;.7432*39_= 3= "5&9.&1= 574(*88*8= &3)= 2&3&,*2*39= 4+= 2&7.3*=545:1&9.438 _=5==7:8*`=7=/*?`==/449-`==:473=&3)==.118=*)8_=&.7'&308`= 1&80&`=1&80&=*&=57&39=411*),*=@74,7&2 `= -18/+_= *482*7=&F`=G*2*8-4<= =,***= 551.*)=14,.89.(=7*,7*88.43 `=E4-3=&.1*>=&3)=438`=7*<= Q470_= 27;.3,= &`= ?433*11= &`= #.11&3)*78= >
= ,**.= )4(&1= (4251*=.9>= .3= 5&99*738= 4+= (&345>8'*39-48= &884(.&9.438= 574):(*8= 7*,.43&1= 5&99*738= &(7488= 9*25*7&9*= :897&1&8.&= &7_=&.41_ =+.. `=-0+8-02_= 27;.3,=&`=?433*11`=& =,**0=@->8.(&1=).89:7'&3(*='>=0*15=&'7&)*8=*7*(9=&1,&*=+742= 9-*=:3)*78947*>_= &7=(41=74,="*7= -,. `= +,18+-1_= )&2*8= %)`= 843,= G) = +331= :.++*7*3(*8= .3= ,74<9-= &3)= 24:19= +7*6:*3(>= &243,= 54898 5:*7:1.=4+= 1&8:8=*)<&7)8.. =+*)=+7*8-`=&,*)=47=+74?*3=2:88*18_= &7='7*8-<=)*8 =.2 `= 3-+83-._= )&2*8=%)`=843,=G)= +332=**).3,=9*(-3.6:*`=(7.9.(&1=8.?*=&3)=8.?*=57*+*7*3(*=4+= 1&8:8= *)<&7)8.. =+*)=(:19:7*)=&3)=<.1)=2:88*18_= &7='7*8-<=)*8 =.3 `=+/+8+/0_= )&72&3= `= &*&,1*= >`= #&1*8= '= ,**.= 574:5885*(.+.(= 541>2*7&8*= (-&.3= 7*&(9.43= +47= :78'&8*)=&3&1>8.8=4+=85*(.*8=).;*78.9>=&3)=.)*39.9>=.3=).*9&7>=8&251*8_= 41*(:1&7= (414,> =+- `=+-+-:+-,,_= )&72&3= `= #&1*8= '`= 8.*73*>=
`= #.11= %`= 11.499= '= ,**,= = :78'&8*)= 2*9-4)= +47= .)*39.+.(&9.43= 4+= 07.11= 85*(.*8= &3)= .98= &551.(&9.43= 94= &3&1>8.3,= 9-*= ).*9= 4+= 2&7.3*= ;*79*'7&9*=57*)&9478_= 41*(:1&7=(414,> =++ `=,013:,03*_= )&72&3= `= 9*))= +`= #.1*8= '= ,**0= 574:5885*(.+.(= 57.2*78= +47= &251.+>.3,= :7= 8*6:*3(*8= 9-&9= .)*39.+>= 25-.54)&`= *5-&1454)&`= (-.34)*72&9&`= 5&897454)&`= 8454)&`=897&(4)&=&3)=-47&(.(&_= 41*(:1&7=(414,>=49*8 =0`=,02:,1+_= )&72&3= `= F.1843= = ,**.= :78'&8*)= 85*(.*8= .)*39.+.(&9.43= 4+= 07.11= (438:2*)= '>= <-&1*=8-&708_= 14:73&1=4+='.8-=&.414,> =0/ `=/20:/3+_= )*30.38=#% =,**.=-*=*(48>89*2=*++*(98=4+=&'&143*=+.8-.3,a=&=7*;.*<_= &7='7*8-<&9*7= )*8 =// `=/./8//,_= )*33.3,8= =,**+=@&99*738=&3)=57*).(9.43=4+=545:1&9.43=7*(4;*7>=.3=2&7.3*=7*8*7;*8_= )*;='.8-=&.41='.8-*7.*8 =+* `=,*38,-+_= )*33.3,8=`=+&.8*7=
)= +332=-*=*++*(98=4+=+.8-.3,=43=2&7.3*=*(48>89*28_= );= &7= &.41 =-. `=,*+8-/,_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,,/ = =

)*33.3,8= `= +&.8*7`= 9*>341)8= )& = ,**+= &7.3*= '.8-*7.*8= (414,> _= /1&(0<*11= (.*3(*= )9)`==+47)_= )*73&04++ = %`= %-.11.58= >(`=
&11*7`= 9 = +321= = 6:&39.9&9.;*= 89:)>= 4+= 34(9:73&1= +47&,.3,=).89&3(*8=4+=9-*=<*89*73=74(0=14'89*7= &3:1.7:8=(>,3:8 =5*47,*_= 14:73&1=4+= =5*7.2*39&1= &7.3*=&.414,>=&3)=(414,> =++- +`=38,+_= )*73&04++=%`=%-.11.58=>(`=(.9?5&97.(0=)) =+33-=-*=).*9=4+=548985:*7:1:8=<*89*73=74(0= 14'89*7`= &3:1.7:8=(>,3:8 =5*47,*`=&9=*;*3=.1*=/*&(-`=&*89*73=:897&1.&_= :89=1= &7='7*8-<&9=)*8 =.. `=0.380//_= )*73&04++ `= %= +321= 47&,.3,= 5&99*738= 4+= /:;*3.1*= <*89*73= 74(0= 14'89*78= &3:1.7:8= (>,3:8 =5*47,*_= 14:73&1=4+==5*7.2*39&1= &7.3*=&.414,>=&3)=(414,> =++- `=+,/8+.._= )4-38= 9>`= '.(-418= %&`= %*77>= #) = +313= &99>= &(.)= (42548.9.43= 4+= 9*3= 2&7.3*= &1,&*= +742=:897&1.&3=<&9*78_= ->94(-*2.897> =+2 `=13382*,_= )4-3843=?`=G.3,=`=9488=)`=-*5-*7)=`=
.11*7=+ =,**/= 89&'1.8-2*39=4+=9-*=143,885.3*)= 8*&=:7(-.3= *397489*5-&3:8=74),*78.. =.3=*&82&3.&a=+.789=&88*882*39=4+=9-*=549*39.&1= 9-7*&98= 94= +.8-*7.*8 _= *5479= 74_= := ,**+2*..`= .8-*7.*8= *8*&7(-= &3)= :*;*1452*39=47547&9.43`=4'&79`=:897&1.&_= )4-3843= ?)`=
&33= +* = +33-= &5.)= 8:((*88.43= .3= 8:'9.)&1= :3)*78947*>= 8*&<**)8= ):7.3,=7*(4;*7>=+742=4;*7,7&?.3,='>=8*&=:7(-.38=.3=*&89*73=&3&)&_= &49= &7 =-0 `= 0-811_= )4-3843= ?9`=
&33= +*= +320= -*= (7:8948*= (47&11.3*= &1,&`= ->2&941.9-43 = 481.*`= .3-.'.98=9-*=4;*7,74<9-=4+=8*&<**)8=<.9-4:9=7*1>.3,=43=-*7'.;47*8= 1==5= &7=&.41= (41 =30 `=+,18+.0_== )4-3843= ?9`= E&1*39.3*= )%`= %*)*7843= *# = ,**.= = 2489= :3:8:&1= '&77*38a= (4251*== .39*7&(9.438='*9<**3=14'89*78`=8*&=:7(-.38=&3)=&1,&*=+&(.1.9&9*8=857*&)=4+=&3=*=49.(= 0*15= .3= *&89*73= &82&3.&_= 3a= (-.34)*728a= 33(-*3= 74(**).3,8= 4+= 9-*= ++9-= :39*73&9.43&1=(-.34)*72=%43+*7*3(* =*)='>=*.3?*11*7=`=7*'*18.(0=E`=/&10*2&`= )*.)*3`=55=,+-8,,*_= )4-3843= G`= 97&9-2&33= 99= +323= *991.3,= '&73&(1*= 1&7;&*= &;4.)= 8:'897&9&= 57*;.4:81>=4((:5.*)='>=&=24'.1*=57*)&947_= 1==5= &7=&.41=(41 =+,2 `=218+*-_= )4-38943= &) = ,**-= 394,*3*9.(= (-&3,*8= .3= ).,*89.;*= *3?>2*= &(9.;.9>= 4+= 9-*= 85.3>= 14'89*7`= 1&8:8=*)<&7)8.. =:*(&54)&b=@&1.3:7.)&*_= &7=&.41 =+.-`=+*1+8+*2,_= )4-38943= &)`= ?&1;*79= +`= ?7*&7= >)`= ?&79*7= ?# = ,**-= :.*9&7>= (&7'4->)7&9*21.5.)= 7&9.48=&3)=3:97.9.43&1=(43).9.43=.3=/:;*3.1*=84:9-*73=74(0=14'89*7`= 1&8:8=*)<&7)8.. _= 6:&(:19:7* =,,* `=001802,_= )411= G`= %-.11.58`= > = +32.= 7&9:7&1= ).*9= &3)= ,74<9-= 4+= /:;*3.1*= <*89*73= 74(0= 14'89*78= &3:1.7:8=(>,3:8 =5*47,*_= 14:73&1=4+==5*7.2*39&1= &7.3*=&.414,>=&3)=(414,> =1/ `=+./: +03_= )47)&3=`=G&<1*7=
`=*&11*>=E`=>&77*99=' =,**/&=*&'*)=-&'.9&9=2&55.3,=.3=9-*==*39= 574:5= 4+= .81&3)8= &3)= .98= 741*= .3= 2&7.3*= 5749*(9*)= &7*&= 51&33.3,_= 6:&9.(= %438*7;&9.43a &7.3*=&3)='7*8-<&9*7=(48>89*28= +/ `=/+81*_=

,,0 = %74/*(9=34_=,**.2*+- = =

)47)&3=`=G:(.**7=E`=G&<1*7=
=,**/'=
.30.3,=-&'.9&9=2&55.3,=<.9-=+.8-*7.*8=&88*882*39= .3= 0*>= (422*7(.&1= +.8-.3,= ,74:3)8 _= .8-*7.*8= *8*&7(-= &3)= :*;*1452*39= 47547&9.43=:=.3&1=*5479=,**-2*/*`=`=4'&79`=&82&3.&_== ):*3=`=87&:,499=
= ,**/=:*9*(9.3,=57*)&9.43=&3)=8(&;*3,.3,='>=:7=,:98(439*39= &3&1>8.8a=&=(&8*=89:)>=:8.3,=&=84.1=.38*(9=57*)&947857*>=8>89*2_= >*(414,.& =+., `=-..: -/,_= +&754;=+`=*&&0*7=%G`=8&3.,:(-.=2+`=94,*788>*33*99=G=,***=*7.&1=)*51*9.43=&3)= 9-*=(411&58*=4+=9-*=&1.+473.&=&'&143*= &1.49.8=855_ =+.8-*7>_= %&3_="5*(_=:'1_='.8-_= 6:&9_="(._ =+-* `=++8,._= +&754;= +`= 8*,3*7=
)`= 94,*788>*33*99= G`= +&1;&88= %`= 8&3,:(-.= 2+ = ,**+= 39*7&(9.438= &243,= 7*)= &'&143*8= &3)= 8*&= :7(-.38= .3=+.8-*)= &3)= 7*8*7;*= 8.9*8= 4+= 3479-*73= &1.+473.&a= .251.(&9.438= 4+= (425*9.9.43= 94= 2&3&,*2*39_= 1= "-*11+.8-= )*8 = ,* `=1.-81/-_= +&85*7=
`=9**843=`=?445*7=`=%*77>=+`=:89.3== ,**.=88*882*39=4+=57*>=4;*71&5= '*9<**3= &= 3&9.;*=  41.89*8= -:2.1.8 = &3)= &3= .3974):(*)=  ?*85:1&= ,*72&3.(& = 84(.&1= <&85=:8.3,=2475-414,>=&3)=5->14,*3*9.(=&3&1>8.8=4+=+08=7:7_= 41*(:1&7=(414,> = +- `=,*-1:,*.3_= +**8.3,=)+`=>&0*7=)G= +332=-*='*3*+.98=4+=(&9(-=&3)=*++479=)&9&=&9=&=+.3*=85&9.&1=8(&1*= .3=9-*=4:9-=:897&1.&3=&'&143*= &1.49.8=1&*;.,&9& =&3)= &1.49.8=7:'7& =+.8-*7>_=3a= 74(**).3,8= 4+= 9-*= 479-= &(.+.(= ">2548.:2= 43= :3;*79*'7&9*= "94(0= 88*882*39= &3)= &3&,*2*39 =*)='>=E&2.*843=5=&3)=&25'*11=`=;41_=+,/`=&3=5*(=@:'1=.8-= 6:&9=(._=55_=+138+20_= +*11>= =+333=&7.3*=7*8*7;*8=&3)=9-*=85.3>=14'89*7= 1&8:8=*)<&7)8.. _=@-:=).88*79&9.43`= 3.;*78.9>=4+=:(01&3)`=:(01&3)`=7\_= +*11>=`=(499=&`=
&(&.&72.)=>`=>&'(4(0=9? =,***=5.3>=14'89*7`= 1&8:8=*)<&7)8.. `= 7*(4;*7>=.3=7*<=\*&1&3)=2&7.3*=7*8*7;*8_= &.41=%438*7;= 3, `=-/38-03_= +*3)7.(0=#`=G&;*7>=%`=%-.11.58=)? =+333_=3+1:*3(*=4+= (0143.&=7&).&9& =0*15=(&345>= 43=897:(9:7*=4+=2&(748&1,&1=&88*2'1&,*8=.3=&72.43=)&,443`=&*89*73=:897&1.&_= >)74'.414,.& =-33 `=,1/8,2-_= +*33*11>`=) =+321=@->8.(&1=).89:7'&3(*8=.3=&3=:897&1.&3=0*15=(422:3.9>_=_=++*(98= 43=:3)*78947*>=):*=94=).++*7*3(*8=.3=0*15=(4;*7_= &7=(41=74,="*7 =.* `=+//8+0/_= +.2=
`=?-4.=)`=+&3,=`=?-4=)`=).3=*`=?-:3=>`=*43,=K=,**.=:19.51*=&11*145&9-.(= &(9.;.9>= 4+= 9-*= (7:8948*= (47&11.3*= &1,&=
.9-45->11:2 = >*884*38* = &,&.389= 8*991*2*39= &3)=,*72.3&9.43=4+=8*&<**)=8547*8_= 1=551=->(41 =+0 `=+1/8+13_== +1.21*>= %`= G*= >4*:+= >)`= ?&39&7&= +
`= 9.(-*79= )`= &&;.8= (`= E&3= 422*7&3=  = ,**+=&).48&(4:89.(=548.9.43.3,=&8=&=9441=+47=89:)>.3,=8.9*885*(.+.(='*-&;.4:7=4+= 9-*=<-.9*=8-&70=&3)=49-*7=1&7,*=2&7.3*=85*(.*8_= &7.3*=&.414,> =+-2 `=.,38..0_= +41&04<80&= `= D11*>= )`= &:389&3= # = ,**-= .8-= 1.5.)8_= 3a= %-*2.(&1= &3)= +:3(9.43&1= 5745*79.*8=4+=+44)=1.5.)8 =*)='>=\.04780.=\=&3)==41&04<80&=_==@7*88=))`= /4(&=&943`=)`=,,+8,0._=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,,1 = =

+499= %= +331= :3.(&9*8= :'5->1:2= :3.(&9&_= 3a= &7.3*= .3;*79*'7&9*8= 4+= 84:9-*73= :897&1.&_=&79=::: =*)='>=-*5-*7)=`=:&;.*8=_=4:9-=:897&1.&3=*8*&7(-=&3)= :*;*1452*39=389.9:9*`=)*1&.)*`=+*3,8+,//_= +7&2*7= G+`= **(0= +G = ,**1= 458)4<3= 9745-.(= 8-.+98= .3= 147.)&= =*>8= 5&9(-= 7**+= 2&7.3*=5749*(9*)=&7*&8_= &7=(41=74,="*7 =-.3 `=+++8+,-_= G&3,14.8=8)`=3)*7843=
)`=>&'(4(0=9?`=+&94= =,**0&=&7.3*=7*8*7;*=)*243897&9*= 9745-.(=.39*7&(9.438=&(7488=-&'.9&98_=*(414,.&= +.1 `=+-.8+.*_= G&3,14.8=8)`=3)*7843=
)`=>74(0=
`=
:72&3=# =,**0'=25479&3(*=4+=74(0=14'89*7= 8.?*8897:(9:7*=+47=9745-.(=.39*7&(9.438a=(-4.(*=4+=84+988*).2*39='.;&1;*=57*>_= &7= &.41 =+.3 `=..18./._= G&38)*11=
) = ,**0= 4;*2*39= 4+= '1&(01.5= &'&143*=  &1.49.8= 7:'7& = )*&(-= &9= 82&11= 9*2547&1= &3)= 85&9.&1= 8(&1*8= := .251.(&9.438= +47= +.8-*7.*8= 2&3&,*2*39= 434:78= -*8.8_= 3.;*78.9>=4+=&82&3.&`=:897&1.&_= G*.,-943= &`= >441449.&3= 9 = +30-= :.*9= &3)= ,74<9-= .3= 9-*= '1&(0= &'&143*= &1.49.8= (7&(*74).. _= (414,> =.. `=,,18,-2_= G*<.8= 8`= '.(-418= %&`=
(
**0.3= 8 = ,***= ;&1:&9.43= 4+= *=97&(9.43= 2*9-4)8= +47= 7*(4;*7>= 4+= +&99>= &(.)8= +742= 1.5.)8574):(.3,= 2.(74-*9*749745-8_= 1= .(74'.41= *9-4)8 =.- `=+*18++0_= G.3)'*7,=&9 =+33,=;41:9.43`=).897.':9.43=&3)=8>89*2&9.(8=4+=&1.49.)&*_=3a= '&143*= 4+=9-*=<471) =*)='>=-*5-*7)==`=*,3*7=E`=5:?2&3=:*1=@744=_=.8-.3,=7*<8= /4408`=&71943`=P.(947.&`=:897&1.&_=55=+038+2+_= G4<7>= G(`= %*&78*= )= +31-= '&143*8= &3)= 8*&= :7(-.38= .3= &3= &7*&= .3-&'.9*)= '>= 8*&= 499*78_= &7=&.41 =,- `=,+-8,+3_=
&(&.&72.)= > = +33+= *&843&1= (-&3,*8= .3= )*59-= ).897.':9.43`= 8*== 7&9.4= &3)= 8.?*= +7*6:*3(>= 4+= 85.3>= 14'89*7= 1&8:8= *)<&7)8.. = 43= &= (4&89&1= 7**+= .3= 3479-*73= 7*<= \*&1&3)_= &7=(41=74,="*7 =1* `=+,38+.+_=
&79.38=#
`=*&<0.38=)`=8-425843=9?`=)*30.38=9 =,**1=422:3.9>=897:(9:7*= &3)=+:3(9.43.3,=.3=.39*79.)&1=74(0=54418a=*++*(98=4+=5441=8.?*=&3)=8-47*=-*.,-9=&9= ).++*7*39=8:((*88.43&1=89&,*8_= &7=(41=74,="*7 =-,3 `=.-8//_=
&>+.*1)=`=90.3843=G)`=>7&3(-=#
`=?4(0(74+9=? =,***&=:.*9=4+=9-*=&*89=4&89= 74(0= 14'89*7= 1&8:8= 1&1&3).. a= .3+1:*3(*= 4+= 14'89*7= 8.?*`= 8*=`= (&59:7*= )*59-`= 1&9.9:)*= &3)=24:19=89&,*_= "=+7=1= &7="(. =,, `=/1803_=
&>+.*1)= `= >7&3(-= #`= ?4(0(74+9= = ,***'=*1&9.438-.58=&243,=).*9`=,74<9-=7&9*`= &3)=+44)=&;&.1&'.1.9>=+47=9-*=4:9-=+7.(&3=74(0=14'89*7`= 1&8:8=1&1&3).. =:*(&54)&`= @&1.3:7.)*&_= %7:89&(*&3& =1- `=2+/:2-._=
&>+.*1)= `= >7&3(-= #
= ,***= 39*77*1&9.438= &243,= 74(0= 14'89*78`= 8*&= :7(-.38`= &3)= /:;*3.1*=&'&143*a=.251.(&9.438=+47=(422:3.9>=2&3&,*2*39_= %&3=1='.8-=6:&9="(. = /1 `=,+1/8,+2/_=
&>+.*1)=`=>7&3(-=#
`=?4(0(74+9=? =+333=:*9*72.3.3,=57*>=&;&.1&'.1.9>=+47=74(0= 14'89*78`= 1&8:8= 1&1&3).. a= ).;*788&251.3,= ;*78:8= 2434(-742*= ;.)*4= 5-494,7&5->_= &7=&.41 =+-/ `=-.18-/,_=

,,2 = %74/*(9=34_=,**.2*+- = =

&>+.*1)=`=)*=>**7=`=>7&3(-=#
=,**+=@7*>=57*+*7*3(*=&3)=9-*=(438:259.43=4+=8*&= :7(-.38= &3)= /:;*3.1*= &'&143*= '>= (&59.;*= 74(0= 14'89*78=  1&8:8= 1&1&3).. _= &7= '7*8-<&9=)*8 =/, `=11-812*_=
&>+.*1)= `= G45&9&= `= >7&3(-= #= ,***(= ).2.9&9.43= &3)= +&.1:7*= 4+= .22:3414,.(&1= 9*(-3.6:*= )= .3= 7*841;.3,= 9-*= ).*9= 4+= 9-*= 4:9-= +7.(&3= 74(0= 14'89*7= 1&8:8= 1&1&3).. _= &7.3*=&.414,> =+-1 `=/3/:0*._=
(?1&3&-&3= 89`= 79-:7= 9 = ,**+= -*= *++*(9= 4+= 2&7.3*= 7*8*7;*8= &3)= -&'.9&9= 43= 545:1&9.438=4+=*&89=+7.(&3=(47&1=7**+=+.8-*8_= (41=551 =++ `=//38/03_=
(?1&3&-&3= 89`=
:9-.,&= ' = +323= @&99*738= 4+= 57*)&9.43= 43= &= 8*&= :7(-.3`= (-.342*97&=2&9-&*. =)*=/1&.3;.11*`=43==*3>&3=(47&1=7**+8_= 1==5= &7=&.41=(41 =+,0 `= 1183._=
(?:9(-&3=)*`=G*<.8=F
`=+*3)&11=?`=
(#7&9-=?? =,**-=P&7.&9.43=.3=9745-.(=8-.+9= +47=89&'1*=.84945*=7&9.48=4+=(&7'43`=3.974,*3`=&3)=8:1+:7_= >.048 =+*, `=-128-3*_=
(-&3*= %= +33.= 89.2&9.3,= 9-*= &':3)&3(*= 4+= &'&143*=  &1.49.8 = 855_= 894(08= := *=&251*8=+742=P.(947.&=&3)=84:9-*73=7*<=\*&1&3)_= '.8-_=)*8_ =+3 `=-138-3._=
(-&3*=%= +333=/1&(01.5=&'&143*_=3a= 43)*7=84:9-*73=8*&8_=*-*=*(414,>=4+=:897&1.&8= 74(0>=7**+8 =*)='>=3)7*<=7)_= 7&=@7*88`=>)3*>`=1,811_=
(-&3*= %`= >1&(0= +%`= 2.9-=
# = +322= *(7:.92*39= 574(*88*8= .3= &1.49.8= 7:'7& = 411:8(&`= 5&897454)&= &3)= 7*,.43&1= ->)74)>3&2.(8= .3= 84:9-*&89*73= :897&1.&= .251>= 14(&1.?*)= ).85*78&1= 4+= 1&7;&*_= 14:73&1= 4+= =5*7.2*39&1= &7.3*= &.414,>= &3)= (414,> =+,. `=+1/8,*-_=
(-&3*= %`= #47+.3*= *+`= +3:(0*>= 2 = +33.= &(9478= .3+1:*3(.3,= +44)= 8*1*(9.43= .3= 9-*=&'&143*= &1.49.8=7:'7& =411:8(&a=5&897454)&_= 1==5= &7=&.41=(41 =+10 `=,18-1_=
(-&3*= %`= 2.9-=
# = +322= *&8:7.3,= &':3)&3(*= 4+= /:;*3.1*= &'&143*`= &1.49.8= 7:'7& = )*&(-= 5&897454)&`= &1.49.)&*= &3)= (425&7.843= 4+= &= 34;*1= 2*9-4)= <.9-= 9<4=49-*7=2*9-4)8_= :897&1.&3=14:73&1=4+= &7.3*=&3)='7*8-<&9*7=)*8*&7(-=-3 `=--+8 --0_=
*1;.11*= )`= ?433*11= & = ,**+= =5*7.2*39&1= *++*(98= 4+= 0*15= (&345.*8= 43= 8:'9.)&1= (47&11.3*=&1,&*_= :897&1=(41 =,0 `=+*,8+*2_=
*1;.11*=)`=?433411>=9
=,**-=5&9.&1=&3&1>8.8=4+=89&'1*=.84945*=)&9&=94=)*9*72.3*= 57.2&7>=84:7(*8=4+=3:97.9.43=+47=+.8-_= >*(414,.& =+-0 `=.338/*1_=
.11*7= G%`= #&>147)= > = ,**1= /&77.*78= 94= +14= 8:'9.)&1= &3)= .39*79.)&1= *3;.7432*398_= 1==5= &7=&.41 =(41 =-.. `=,+/8,,2_=
.118= &)`= E*7)4:<= #`= (7:8-*7= & = ,**/= *249*= 2:19.8(&2*7&= 8>89*2= +47= .3= 8.9:= 4'8*7;&9.438= 4+= '*-&;.4:7= &3)= 57*)&947257*>= .39*7&(9.438= 4+= 2&7.3*= '*39-.(= 2&(74+&:3&_= =7=1= &7='7*8-<=)*8 =-3 `=-.18-/,_=
.3*7=?
`=1989&99=)
`=9&.243).=%8`=
.3(-.3943=8 =,**0=*(7:.92*39=+&.1:7*=&3)= 8-.+98=.3=(422:3.9>=897:(9:7*=+4114<.3,=2&88=2479&1.9>=1.2.9=7*(4;*7>=57485*(98= 4+='1&(0=&'&143*_= &7=(41=74,="*7 =-,1 `=+*18++1_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,,3 = =

:3)>= ?`= +&714;= 8`= *&))43=
= ,**0_= ).30.3,= +.8-*7>8)*5*3)*39= &3)= +.8-*7>8 .3)*5*3)*39= &88*882*398= 4+= &'&143*= +.8-*7.*8_= ')#%= '.3&1= )*5479 `= ,**+2*1._= 3.;*78.9>=4+=&82&3.&`=4'&79`=:897&1.&_=5=,+._= '&8-=F)= +33,=3=*;&1:&9.43=4+=*,,85*787*(7:.9=&3&1>8.8=&8=&=2*&38=4+=&88*88.3,=8.?*= 1.2.98= +47='1&(01.5= &'&143*=  &1.49.8= 7:'7& = .3= &82&3.&_= 3a= '&143*= 4+= 9-*= <471)a= '.414,>`= +.8-*7.*8= &3)= (:19:7* = *)= '>= -*5-*7)= `= *,3*7= E`= 5:?2@3= )*1= @74= _=/1&(0<*11=(.*39.+.(`==+47)_=55_=-+28-.*_= '*/89,&&7)=)`=(7.8(-*7=
`=9&:1*=?`=#7:*'*1=9`=+4-1'*7,=+`=E*7.9>=%= ,**-=41*(:1&7= )*9*(9.43= 4+= &1,&1= 57*>= .3= (45*54)= ,:98= &3)= +*(&1= 5*11*98_=
.23414,>= &3)= >(*&34,7&5->a= *9-4)8 =+`=,3:-2_= '*1843=

`=?7*&7=>)`='.(-418=%&`=9.9?=& =,**.=574<9-=&3)=1.5.)=(42548.9.43=4+= 5->114842&9&=4+=9-*=84:9-*73=74(0=14'89*7`= 1&8:8=*)<&7)8.. `=+*)=*37.(-*)=79*2.&_= 6:&(:19=:97 =+* `=,-18,.0_= '*1843=

`= G*.,-943= &G`= %-1*,*7= ?(`= '.(-418= %& = ,**,= 425&7.843= 4+= ,74<9-= &3)= 1.5.)= (42548.9.43= .3= 9-*= ,7**3= &'&143*`= &1.49.8= +:1,*38 `= 574;.)*)= 85*(.+.(= 2&(74&1,&1=).*98_= %425=&.4(-*2=->8.41 =+-+> `=03/81+,_= '*1843=

`=D11*>=)`=?7*&7=>)`=G*<.8=8`='.(-418=%& =,**/=425&7.843=4+=<.1)=&3)= (:19:7*)= &):19= 84:9-*73= 74(0= 14'89*7`= 1&8:8= *)<&7)8.. a= 574<9-`= 8*3847>= &3&1>8.8= &3)=4.1=(42548.9.43_= '44)=:897&1.& =/1 `=.338/*3_= '479-= F)`= %*&78*= ) = +31*= *&= :7(-.3= 545:1&9.43= *=5148.43= .3= 84:9-*73= &1.+473.&= (4&89&1=<&9*78_= "(.*3(* =+01 `=,*3_= D&47=9+`=3)7&)*=K`=F*''*7=&
`=&:*7=F**`=94'*798=
)`=2&1*=
)`=E4*,*1.= (
= +332= 551.(&9.438= &3)= 5*7+472&3(*4+= 7&).48&(4:89.(= 548.9.43.3,= &3)= 9*1*2*97>=@=8>89*28_= >)74'.414,.& =-1+2-1, `=+82_= D++.(*7=9`=*&))43=
`=#47+.3*=*+ =,**+=:.89&3(*8'&8*)=&':3)&3(*=*89.2&9.43=+47= &'&143*_ =1="-*11+.8-=)*8 =,* `=12+8120_= %&78438=+`=%.*793*>=`=
.))1*2&8=`=*&2243)=%`=7289743,=)= ,**/=:78'&8*)= .)*39.+.(&9.43=4+=8&1243.)=57*>=85*(.*8= .3=8*&1=+&*(*8_= 14:73&1=4+=74414,> =,00 `=,1/: ,2+_= %*)*7843=*#`=>&77*99='`=(7:8-*7=&`=>:=943 =:=.3=57*88=++*(9=4+=57*)&947857*>= &3)= (425*9.9.;*= .39*7&(9.438= 43= 8.?*= &9= *2*7,*3(*= .3= 9-*= '1&(081.5= &'&143*= &1.49.8=7:'7& =.3=&=&82&3.&3=@_= &7=(41=74,="*7 =1/,+_= %*)*7843= *#`= )4-3843= ?9 = ,**0= @7*)&9.43= 4+= 9-*= 8*&= :7(-.3= *1.4(.)&7.8= *7>9-74,7&22&= '>=74(0=14'89*78= 1&8:8=*)<&7)8.. =.3=3489&0*=2&7.3*=7*8*7;*8_= 1==5= &7=&.41=(41 =--0 `=+,*8+-._= %*9*7843= >) = +333= 9&'1*= .84945*8= &8= 97&(*78= 4+= 47,&3.(= 2&99*7= .35:9= &3)= 97&38+*7= .3= '*39-.(=+44)=<*'8a=&=7*;.*<_= (9&=>*(414,.(& =,* `=.138.21_= %*9*7843=>)`=(7>=> =+321=9&'1*=.84945*8=.3=*(48>89*2=89:).*8_= 33=)*;=(41=">89 =+2 `= ,3-8-,*_= %*9*7843= ?*`= >1&(0= 9 = +33.= 3= *=5*7.2*39&1.898= (-&11*3,*a= <-*3= &79*+&(98= 4+= .39*7;*39.43=.39*7&(9=<.9-=97*&92*398_= &7=(41=74,="*7 =+++ `=,238,31_=

,-* = %74/*(9=34_=,**.2*+- = =

%-.11.58=&G`=#7*,,=)F=,**+= 3(*79&.39>=.3=84:7(*=5&79.9.43.3,=:8.3,=89&'1*=.84945*8_= >*(414,.& =+,1 `=+1+8+13=8**=&184=*77&9:2= >*(414,.& =+,2`=,*._= %-.11.58=&G`=#7*,,=)F=,**-=4:7(*=5&79.9.43.3,=:8.3,=89&'1*=.84945*8a=(45.3,=<.9-= 944=2&3>=84:7(*8_= >*(414,.& =+-0 `=,0+8,03_= %-.11.58=+G`='.(-418=%&`=)&(0843=#& =,**-&=*2547&1=;&7.&9.438=.3=9-*=).*9=4+=9-*= 86:.)= 4749*:9-.8= .3,*38= &9= &(6:&7.*= 81&3)a= 8942&(-= (439*398= &3)= +&99>= &(.)= &3&1>8*8_= &7=(41=74,="*7 =,/0 `=+-/8+.3_= %-.11.58=+G`='.(-418=%&`=)&(0843=#& =,**-'=.?*87*1&9*)=).*9&7>=(-&3,*8=4'8*7;*)= .3= 9-*= 86:.)= 4749*:9-.8= .3,*38= &9= &101&3)= 81&3)8a= 8942&(-= (439*398= &3)= +&99>= &(.)=&3&1>8*8_= 41&7=&.41 =,0 `=.1.8.2/_= %-1*,*7=?(`='*1843=
'`=#74(*=2`=?&7>`=?`=?4>3*=+)`= #.'843= )`= '.(-418= %& = ,**/&=).5.)=(42548.9.43=4+=)**5=8*&=->)749-*72&1=;*39=541>(-&*9*8= 1;*3*11&= 5425*/&3& `= _=(&:)&9* `= &7&1;.3*11&=,7&881*.= &3) =*8.41>7&='*7,.. _=:**5=*&=*8*&7(-== /, `=,---8,-/,_= %-1*,*7=?(`='*1843=
'`=#74(*=2`=?&7>`=?`=?4>3*=+)`='.(-418=%& =,**/'=).5.)= (42548.9.43= 4+= )**5= 8*&= ->)749-*72&1= ;*39= 9:'*<4728= ).+9.&= 5&(->59.1& `= (7&'8= :3.)458.8= 8:'86:&248& = &3)= &>9-4,7&*&= 9-*72>)743 `= 2:88*18= &&9->24).41:8 = 85_= &3)=1.25*98=
*5*94)7.1:8 =855_= %425=&.4(-*2=->8.41 =+.+> `=+308,+*_= %.0.9(-= +`= &3947&= ?`= >&'(4(0= `= >&0:3= `= >43+.1= 9`= ?434;*7= &D`= &&>943= %`= &4:0&0.8= %`= (1:-&79>= &`= **3*2&3= >`= *4:)*= &`= G.30= )`= G.;.3,8943= %`=
&3,*1=
`=
(11.89*7=
+`= %45*= )`= &.38':7>= +) = ,**.= (48>89*28'&8*)= +.8-*7>=2&3&,*2*39_= "(.*3(* =-*/ `=-.08-.1_= %.33*,&7= )+`= %41:3.3= 'E?`= (7&3(4:7= %`= >&)&1&2*39.= (`= ?-*2*114= 9`= *&72*1.38 E.;.*3=
G`= **7*:= >`=
.1&??4=
`= H&'&1&=
`= &33&= #`= %.5.943*= ? = ,***= 745-.(= (&8(&)*8= .3= '*39-.(= 2&7.3*= *(48>89*28a= 1*88438= +47= +.8-*7.*8= &3)= 5749*(9*)8&7*&=2&3&,*2*39_= 3;.743=%438 =,1 `=+138,**_= %4114(0 =& =+313=@7*)&947857*>=7*1&9.438-.58='*9<**3=9-*=74(0=14'89*7= 1&8:8=1&3&3).. = &3)= 9-*= 2:88*1= :1&(42>&= &9*7 = &9= 4''*3= 81&3)= 43= 9-*= &5*= &*89= (4&89= 4+= +7.(&_= &7=&.41 =/, `=-.18-/0_= %7.3(*=) =+323= *-*=+.8-*7.*8='.414,>=4+=9-*=*&82&3.&3=894(08=4+= &1.49.8=7:'7&_=@-:=-*8.8`= 3.;*78.9>=4+=&82&3.&`=55=0*81*_= %7.3(*=)&= +33,= 8.3,=&=85&9.&1=24)*1=94=*=5147*=9-*=)>3&2.(8=4+=&3=*=514.9*)=894(0= 4+=9-*=&'&143*= &1.49.8=7:'7& _=3a= '&143*=4+=9-*=<471)a='.414,>`=+.8-*7.*8=&3)=(:19:7*= *)='>=-*5-*7)=`=*,3*7=E`=5:?2@3=)*1=@74=`==+47)`=/1&(0<*11_=55_= -*/8-+1_= %7.3(*`=)&`=*11*78=8G`=(47)=F>`=8&1'49=9 =+321==5*7.2*39&1=*;.)*3(*=+47=1.2.9*)= ).85*78&1= 4+= &1.49.) = 1&7;&*= ,*3:8= &1.49.8 a= 411:8(&a= 5&897454)&_= 14:73&1= 4+= =5*7.2*39&1= &7.3*=&.414,>=&3)=(414,> =+*0 `=,.-8,0-_= I:.33=#%`=+*4:,-=
) =,**,==5*7.2*39&1=)*8.,3=&3)=)&9&=&3&1>8.8=+47='.414,.898_= &2'7.),*= 3.;*78.9>=@7*88`=&2'7.),*_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,-+ = =

9&4= %E = +332= "9&9.89.(&1= 7*8*&7(-= 2*9-4)8= .3= 9-*= 1.+*= 8(.*3(*8 _= ::=':7>= @7*88`= @&(.+.(= 574;*`= _= 9&;*3=)`=)4-38943=
`=+:'1*7=)`=+47'=9`=
(2374>=#`=*&3)1*>=GG`=(7.2,*4:7= ?
`= F&10*7= &2`= >*&7)&11= )`= E&3)*701.+9=
`= (7*)7.08*3= `= &:3943= +* = ,**,= *(-&3.89.(= .39*757*9&9.43= 4+= (&7'43= .84945*= ).8(7.2.3&9.43= '>= 2&7.3*= 2&(74&1,&*=&3)=8*&,7&88*8_= ':3(9=1&39=&.41 =,3 `=-//8-12_= 9.(*= G`= +*3(-.3,943= 8) = +33*= 5&9.&1= ;&7.&9.43= 5&99*738= .3= 9-*= 2&7.3*= 2&(74&1,&= A.5-45-47&=,1&).&9&= 855_=,1&).&9&=@-&*45->9&_=_=475-414,.(&1=;&7.&9.43=4;*7= 1&7,*=85&9.&1=8(&1*8_= 1=->(41= ,0 `=/,,8/-/_== 94'*798= ?
`= %41:3.3= 'E? = +33+= 7*= 2&7.3*= 7*8*7;*8= *++*(9.;*= .3= 2&3&,*2*39= 4+= 7**+=+.8-*7.*8
= )*;='.8-=&.41='.8-*7.*8 =+`=0/83+_= 94'1*8=?`=<**93&2=&`=2.3.0*=) =+33*=)4'89*7=57*)&9.43=43=2:88*18a=8-47*81*;*1= ).++*7*3(*8=.3=57*>=;:13*7&'.1.9>=&3)=57*)&947=57*+*7*3(*_= (414,> =1+ `=+/0.8+/11_= 94,*788>*33*99= G`= %*&78*= ) = ,**+= 3).7*(9= '*3*+.98= 4+= 2&7.3*= 5749*(9*)= &7*&8= +47= /:;*3.1*=&'&143*_= %438*7;=&.41 =+/ `=0.,80.1_= 948*1=%`=+4(-*7=8 =,**,=:78'&8*)=.)*39.+.(&9.43=4+=1&7;&1=(4)=.3=8942&(-=(439*398= 4+=57*)&947>=+.8-*8_= 14:73&1=4+==5*7.2*39&1= &7.3*=&.414,>=&3)=(414,> =,01 `=1/:22_= 9:88= #9`= 1(&1&= ? = ,**-= &7.3*= 7*8*7;*8a= 7&9*8= &3)= 5&99*738= 4+= 7*(4;*7>= &3)= )*(1.3*=4+=57*)&947>=+.8-`=+32-8,***_= (41=551 =+- `=+//-8+/0/_= &.94=+ =+32+=-*=&55*&7&3(*=&3)=,74<9-=4+=*8>*&7841)=?4='&143*_= &:11=1&5&3="4(= "(.='.8- =.1 `=+-3-8+.**_= &1&= `= H&'&1& = = +330= .8-= 57*)&9.43= &3)= 9-*= 897:(9:7*= 4+= 9-*= 8*&= :7(-.3= &7&(*39749:8= 1.;.):8= 545:1&9.438= .3= 9-*= 7&= *).9*77&3*&3_= &7= (41= 74,= "*7 = +.* `=1+82+_= (-*++*7=
`=?&75*39*7=`=)*=K4:3,=> =,**/=&8(&).3,=*++*(98=4+=4;*7+.8-.3,=2&7.3*= 8>89*28_= *)= ,* `=/138/2+_= (-*.'1.3,= 9= +33.= 411:8(&3= ,7&?.3,= &3)= 2&(74&1,&1= ?43&9.43= 43= &= 74(0>= .39*79.)&1=51&9+472=&9=@*79-`=&*89*73=:897&1.&_= :89=1=(41= +3 `=+.+8+.3_= (-*.'1.3,= 9`= **33.,&7= F`= >&1(-= 8= +333= :*897:(9.;*= ,7&?.3,`= *5.5->9.82`= &3)= ).8*&8*a=9-*=)>3&2.(8=4+=8*&=:7(-.3=:=0*15=.39*7&(9.438=.3=74;&=(49.&_= %&3=1='.8-= 6:&9="(. =/0 `=,-**8,-+._= (-74*9*7= ?`= 9**)= &?`= +:8-3*7= &)`= 89*8= )`= D34 = & = ,**+= -*= :8*= 4+= 2&7.3*= 7*8*7;*8=.3=*;&1:&9.3,=9-*=).;*7=+.8-*7>=+47=9-*=<&79>=8*&=(:(2'*7= &7&89.(-45:8= 5&7;.2*38.8 =.3=&1.+43.&`= _=&3=E=.8-= 6:&9="(. =/2 `=+11-8+112_= *&2&3= &`= %4<*11= 9 = +330= 3= *;&1:&9.43= 4+= 9-*= &((:7&(>= 4+= 0*73*1= )*38.9>= *89.2&9478=+47=-42*=7&3,*=&3&1>8.8_= (414,> =11 1`=,*1/8,*2/_= *&7(>8>*73&1= 9`= &1&88#&7?&= `= (147*88,:.1&7= 9`= *.34/48&89.;*7&= %9= +33,= .2:19&3*4:8= (425&7.843= 4+= 2*9-4)8= +47= 8*991*2*39= &3)= 2*9&2475-48.8= .3):(9.43=.3=9-*=7*)=&'&143*= &1.49.8=7:+*8(*38 _= 6:&(:19:7* =+*/ `=,.+8,/*_= -*&78= '8`= >&'(4(0= 9? = ,**,= &7.3*= 7*8*7;*8= )*243897&9*= 9458)4<3= (439741= 4+= (422:3.9>=897:(9:7*=43=9*25*7&9*=7**+8_= >*(414,.& =+-, `=+-+8+.,_=

,-, = %74/*(9=34_=,**.2*+- = =

-*&78='8`=>&'(4(0=9? =,**-=439.3:.3,=9745-.(=(&8(&)*=*++*(98=&+9*7=,/=>*&78=4+=348 9&0*=2&7.3*=5749*(9.43_= &7=(41=74,="*7 =,.0 `=+8+0_= -*&78='8`=#7&(*=9E`==82&7='9`=+*77=E`=>&'(4(0=9? =,**0=)43,89*72=97*3)8=.3= 14'89*7=545:1&9.438=.3=&=5&79.&11>=5749*(9*)=;8_=3489&0*=2&7.3*=5&70_= &.41=%438*7; = +-, `=,,,8,-+_= -*5-*7)= =+31-&=425*9.9.43='*9<**3=8*&=:7(-.38=&3)=&'&143*_= :89='.8- =-, `=.81_= -*5-*7)=  = +31-'= 9:).*8= 43= 84:9-*73= :897&1.&3= &'&143*= ,*3:8= &1.49.8 _= +_= (414,>=4+=+.;*=8>25&97.(=85*(.*8_= :89=1= &7='7*8<&9=)*8 =,. `=,+18,/1_= -*5-*7)= =+31/=:.897.':9.43`=-&'.9&9=&3)=+**).3,=-&'.98=4+=&'&143*_=:89=.8-= -. `= +,8+/_= -*5-*7)= =+332=9:).*8=43= 84:9-*73=:897&1.&3=&'&143*=,*3:8=&1.49.8=:=MMa= )43,89*72=/:;*3.1*=2479&1.9>=)>3&2.(8_= 1="-*11+.8-=)*8 =+1 `=2+-82,/_= -*5-*7)= `= >&0*7= )G= +332= /.414,.(&1= 7*+*7*3(*= 54.398= .3= &3= &'&143*=  &1.49.8= 1&*;.,&9& = +.8-*7>_= 3a= %&3&).&3= 85*(.&1= 5:'1.(&9.43= .3= +.8-*7.*8= &3)= &6:&9.(= 8(.*3(*8 `= ;41_= +,/= *)= '>= E&2.*843= 5`= &25'*11= = @74(**).3,8= 4+= 9-*= 7479-= @&(.+.(= >2548.:2= 43= 3;*79*'7&9*= 94(0= 88*882*39= &3)= &3&,*2*39`= 7&3&.24`= &3&)&_=55_=,-/8,./_= -*5-*7)=`=?1&70843=% =,**+=:.*9`=+**).3,='*-&;.4:7`=&(9.;.9>=&3)=57*)&9.43=4+= 9-*=9*25*7&9*='1:*89-74&9*)=<7&88*`= 4941&'7:8=9*97.(:8 _= &7='7*8-<=)*8 =/, `=-++8 -,,_= -*5-*7)= `= %&79.3,943= & = +33/= 9:).*8= 43= 84:9-*73= :897&1.&3= &'&143*= ,*3:8= &1.49.8 = MP_= *(7:.92*39`= -&'.9&9= &3)= 894(0= 7*1&9.438_= &7.3*= &3)= '7*8-<&9*7= )*8*&7(- =.0 `=003802*_= -*5-*7)=`=%7**(*=%`=F-.9*=9# =,***=.7*)=3&9:7*8=8<**9=7*8947*7
=(414,>=4+= &'&143*= &1.49.8 =855_=894(0=*3-&3(*2*39=.3=:897&1.&_=3a= 64708-45=43=7*':.1).3,= &'&143*=894(08=.3=&7.9.8-=%41:2'.& =*)='>=&25'*11==7=&3&)&`=7&3&.24`=/_= 55_=2.831_= -*5-*7)=`=94))&=+9`=E&7,&8=+
=,**+==(-743.(1*=4+=(411&58*=.3=9<4=&'&143*= 894(08=<.9-=574548&18=+47=57*(&:9.43&7>=2&3&,*2*39_=14:73&1=4+="-*11+.8-=)*8*&7(- = ,* `=2.-82/0_= -*5-*7)= `= 8:73*7 = )= +32/= 9:).*8= 43= 84:9-*73= :897&1.&3= &'&143*= ,*3:8= &1.49.8 =P_=&'.9&9=57*+*7*3(*`=&':3)&3(*=&3)=57*)&9478=4+=/:;*3.1*8_= 1==5= &7= &.41=(41 =3- `=,2/8,32_= -*5-*7)= +`= 9*.3'*7,= %& = +33,= 44)= 57*+*7*3(*8= 4+= 9-7**= :897&1.&3= &'&143*= 85*(.*8=<.9-=&=7*;.*<=4+=9-*=&1,&1=+44)=4+=&'&143*_=3a= '&143*=4+=9-*=<471) =*)='> = -*5-*7)==`=*,3*7=E`=5:?2&3=:*1=@744=_=.8-.3,=7*<8=/4408`=&71943`= P.(947.&`=:897&1.&_=55=+038+2+_= -*55&7)= `= **33*2&3= )`=
*22499= )`= >243)843= F= ,**.= 3+.197&9.43= '>= &1.*3= 57*)&9478=.394=.3;*79*'7&9*=+44)=<*'8=.3=&<&..a=&=241*(:1&7=&5574&(-_= 41*(:1&7= (414,> =+- `=,*11:,*23_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,-- = =

-*55&7)= +`= *&7<44)= )& = ,**/= );&3(*8= .3= 241*(:1&7= *(414,>a= 97&(0.3,= 9745-.(= 1.308=9-74:,-=57*)&947857*>=+44)8<*'8_= ':3(9.43&1=(414,> =+3 `=1/+810,_= .2*389&)=?`=89*8=)`=+*3>43=+F=+312=1*:98`=8*&=499*78`=&3)=&19*73&9*=89&'1*8 89&9*=(422:3.9.*8_= "(.*3(* =,** `=.*-8.++_= 1:(?&34<80.=%9 =+320==).8&,,7*,&9*=24)*1=+47=8*)*39&7>=894(08a=9-*=(&8*=4+=4:9-= :897&1.&3= &'&143*_= %&3&).&3= "5*(.&1= :'1.(&9.43= .3='.8-*7.*8= &3)= 6:&9.(= "(.*3(*8 = 3, `=-3-8.*+_= 433*3-41?3*7= )2`= G&)&-= G>`= G&++*79>= +& = ,**1= &8(&).3,= *++*(98= 4+= +.8-.3,= 43= 5&1&5&,48=74(0>=7**+=(422:3.9.*8_= &7=(41=74,="*7 =-.- `=1182/_== 5*3(*7= 9`= ?&2*743= #'`= <.-&79= 9+ = +33*= 5*7&9.43&11>= )*+.3.3,= -42*= 7&3,*a= 9*2547&1=)*5*3)*3(*=*=-.'.9*)='>=-.85.)=(49943=7&98_= (414,> =1+ /`=+2+18+2,,_= 9*.3'*7,= %& = +323= /.4,*4,7&5-.(&1= ;&7.&9.43= .3= '74<3= &1,&1= 541>5-*341.(8= &3)= 49-*7= 8*(43)&7>= 2*9&'41.9*8a= (425&7.843= '*9<**3= 9*25*7&9*= :897&1&8.&= &3)= 7479-=2*7.(&_= >*(414,.& =12 `=-1-8-12_= 9*3*(0= 9 = +320= -*= *(414,>= 4+= (47&11.3*= &1,&1= (7:898a= (43;*7,*39= 5&99*738= &3)= &)&59.;*=897&9*,.*8_= 33:=)*;=(41=">89*2 =+1 `=,1-8-*-_= 9*5-*3843=9G`=8&3=(?`=
&33=+* =+32.=9&'1*=(&7'43=.84945*=;&7.&'.1.9>=.3=2&7.3*= 2&(745->9*8=&3)=.98=.251.(&9.438=+47=+44)=<*'=89:).*8_= &7=&.41 =2+ `=,,-8,-*_= 9*5-*3843= 9G`= 8&3= (?`=
&33 = == +320= 8*= 4+= 89&'1*= (&7'43= .84945*= 7&9.48= 94= (425&7*= 51&39= 2&9*7.&1= &3)= 549*39.&1= (438:2*78= .3= &=8*&,7&88= '*)=&3)=&=0*15= '*)=.3=74;&=(49.&`=&3&)&_= &7=&.41 =-* `=+81_= 949?= F>`= #43?&1*?=`= ?&.11&:== G`= ':794= ) = ,**-=O:&39.9&9.;*= *;&1:&9.43= 4+=9-*= ).*9=&3)=+**).3,='*-&;.4:7=4+=9-*=(&73.;474:8=,&897454)`= %43(-41*5&8=(43(-41*5&8 = /7&,:.*7*`= +123= :7.(.)&*= .3= 8:'9.)&1= -&'.9&98= .3= 9-*= 84:9-*&89*73= @&(.+.(= :5<*11.3,=8>89*2_= 1="-*11+.8-=)*8 =,, `=+.18+0._= := MI`= 3943&8= +'`= G.= & = ,**0= 425&7.843= 4+= 38-= 541>:38&9:7&9*)= +&99>= &(.)= (439*398=4+=<.1)=&3)=(:19:7*)=:897&1.&3=&'&143*_= :39=1='44)="(.=:97 =// `=+.38+/._= >243)843= F= ,**,= 41*(:1&7= .)*39.+.(&9.43= 4+= 57*>= .3= 57*)&947= ).*98_= 41*(:1&7= (414,> =++ `=0,1:0.+_= 8&7'&9-= &>`= *&))43=
`=
:3)>= ? = ,**+= &89= (4&89= &'&143*= &88*882*39a= ,**+_= &82&3.&3=6:&(:19:7*=&3)=.8-*7.*8=389.9:9*`=4'&79`=:897&1.&_=5=,/_= 8&7'&9-=&>`=
:3)>=?`=*&))43=
=,**1= *&82&3.&3=&'&143*=+.8-*7>=,**0 _=&82&3.&3= 6:&(:19:7*=&3)=.8-*7.*8=389.9:9*`=4'&79`=:897&1.&_=5=11_= 8&7'&9-=&>`=
:3)>=?'`=*&))43=
= ,**-= *&82&3.&3=&'&143*=+.8-*7>=,**- _=&82&3.&3= 6:&(:19:7*= &3)= .8-*7.*8= 389.9:9*= *(-3.(&1= *5479= *7.*8`= `= 4'&79`= :897&1.&_=55_=+8+*2_= 8&77=9)I`=F.11.&28=%E#`=
&(0*3?.*=) =+330='&143*`=8*&=:7(-.38=&3)=74(0=14'89*7a= =5488.'1*=*(414,.(&1=8-.+9=9-&9=2&>=&++*(9=97&).9.43&1=+.8-*7.*8_= "=+7=1= &7="(. =+1 `= -+38-,-_=

,-. = %74/*(9=34_=,**.2*+- = =

8*,3*7=
)`=&&>943=%+ =+32+=@45:1&9.43=897:(9:7*`=7*(7:.92*39=&3)=2479&1.9>=4+=9<4= 8*&= :7(-.38=  "9743,>14(*39749:8= +7&3(.8(&3:8= &3)= "_= 5:75:7&9:8 = .3= &= 0*15= +47*89_= &7=(41=74,="*7 =/`=,//8,02_= 8*,3*7=
)`=&&>943=%+ =,***=(48>89*2=*++*(98=4+=+.8-.3,=.3=0*15=+47*89=(422:3.9.*8_= :%"=14:73&1=4+= &7.3*="(.*3(* =/1 `=/128/23_= 8*,3*7=
)`=G*;.3=G =+32,=:4=8*&=:7(-.38=&3)=&'&143*=(425*9*=.3=&1.+473.&=0*15= +47*89=(422:3.9.*8
=3a= :39*73&9.43&1=(-.34)*728=%43+*7*3(* =*)='>=)&<7*3(*=E_= /&10*2&`=499*7)&2_= 8*,3*7=
)`= G*;.3= G = +32-= 5.3>= 14'89*78= &3)= 8*&= :7(-.38a= &3&1>8.8= 4+= &= 57*)&9478 57*>=.39*7&(9.43_= 1==5= &7=&.41=(41 =1- `=+,/8+/*_= 8-425843=)&`=F*.'1*3=#`=8-425843=>`=1+&74=`=G*,*3)7*=%= +330= 39&3,1.3,= 2:19.51*= +&(9478= .3= 85&9.&1= ).897.':9.438a= 1.1.*8`= ,45-*78`= &3)= 74(08_= (414,> = 11 `= +032 8+1+/_= 8:>&= (`= >4>7&= `= &3(-*?8)*7*?= %`= >&7'*7&= ?`= *&74:3= 9= ,**.= &3= 43*= 85*(.*8= )*9*72.3*= 9-*= 897:(9:7*= 4+= 9-*= '*39-.(= (422:3.9>= 43= &= 9*25*7&9*= 74(0>= 7**+
= -*= (&8*= 4+= 9-*= 143,885.3*)= 8*&8:7(-.3= #.&)*2&= &39.11&7:2 = (-.34)*72&9&a= (-.34.)*&=.3=9-*=*&89*73=91&39.(_= >)74'.414,.& =/+3 `=,++8,+._= =3)*7<44)= )`= +.3,8+47)=
)`= 3)7*<= 'G = +33+= @&99*738= .3= 8-&114<= 8:'9.)&1= 2&7.3*=&88*2'1&,*8=&143,=9-*=(4&89=4+=7*<=4:9-=&&1*8_= :89=1=(41 =0`=,-+8,.3_= E&)&8= 9G`= 9*3*(0= 9 = +33/= ;*7+.8-.3,= &3)= .3+*7*3(*8= .3= 0*1588*&= :7(-.3= .39*7&(9.438_=3a= (414,>=4+=+/47)8=&3)=(4&89&1=<&9*78 =*)='>=0/4)&1=`=450.38=`= 7.(089&)==`=)*.3&&8=_=18*;.*7`=289*7)&2_= E&251*<=F=+321=:897&1.&3=-.8947.(&1=89&9.89.(8_=&.7+&=`=>2*=&3)=&*1)43=884(`= >)3*>_= E&3)*701.+9=
 =,**,= :39*7&(9.438='*9<**3=8*&=:7(-.38=&3)=2&(74&1,&*=.3=84:9-8<*89*73= :897&1.&a= 9*89.3,= ,*3*7&1= 57*).(9.438= .3= &= 14(&1= (439*=9 _= @-:= -*8.8_= 3.;*78.9>= 4+= &*89*73=:897&1.&`=@*79-_= E&3)*701.+9=
`=+*3)7.(0=#`=2.9=) =,**0=:.++*7*3(*8=.3=9745-.(=548.9.43=&243,= 8>25&97.(=8*&=:7(-.3=85*(.*8_= 89:&7=%4&89="-*1+="(. =00 `=,3+8,31_= E*89-*.2= *`= );&7)8*3= >`= +&&79;*)9= = ,**/= 88*88.3,= +**).3,= 4+= &= (&73.;474:8= (45*54)=:8.3,=85*(.*8885*(.+.(=@_= &7.3*=&.414,> =+.1 `=-2+:-2/_= E.79:*=%`='.(-418=%&`='.(-41=`=
(
.33=`=.0*8=G =+33-=-*=1.5.)=(42548.9.43=4+= :5-&:8.&=8:5*7'& =:&3&=.3=7*1&9.43=94=9-*=3:97.9.43&1=;&1:*=4+= -&*4(>89.8=54:(-*9.. = &7.49=)&,*7-*.2_= 39&7(9="(.= /`=+038+11_== E4102&3= )+ = +320= = 7*;.*<= 4+= 89*741= 2&70*78= +47= 2&7.3*= &3)= 9*77.,*34:8= 47,&3.(= 2&99*7_= >7,=9*4(-*2 =3`=2-833_= E4102&3=)+`=)4-38=9>`=#.11&3=(8`=%*77>=#)`=>&;47=*)=)7 =+32*=.(74'.&1=1.5.)8=4+=&3= .39*79.)&1=8*).2*39_==&99>=&(.)8=&3)=->)74(&7'438_= 9*4(-*2=%4824(-.2=(9& =.. `= ++-8++.-_=

:19.885*(.*8=2&3&,*2*39=4+==7**+=+.8-*7.*8 = ,-/ = =

F&)).3,943=+`=
&(79-:7=G =,**2=:.*9=6:&1.9>=&3)=2:8(1*=9.88:*=14(&9.43=.3+1:*3(*= (438:2*78).*9= ).8(7.2.3&9.43= .3= (&59.;*87*&7*)= 74(0= 14'89*78=  &3:1.7:8= (>,3:8 _= &7=&.41 =+/. `=/038/10_= F&7)= G9`= ?&79*7= ?#`= ?7*&7= >)`= 2.9-= &
= ,**-= 59.2&1= ).*9&7>= 5749*.3= 1*;*1= +47= /:;*3.1*= 84:9-*73= 74(0= 14'89*7`= 1&8:8= *)<&7)8.. `= &9= 9<4= 1.5.)= 1*;*18_= 6:&(:19:7* = ,+1 `=.2-8/**_= F&7)= 8`= **.3*2&33= &`= ;&38= ' = ,**+= -*= 741*= 4+= 2&7.3*= 7*8*7;*8= &8= +.8-*7.*8= 2&3&,*2*39= 94418a= &= 7*;.*<= 4+= (43(*598`= *;.)*3(*= &3)= .39*73&9.43&1= *=5*7.*3(*_= .3&1=*5479=74;*2'*7=,***_=+3,=55_= .3 =/_4__=(.*3(*8= ) _ =&3'*77&`=:897&1.&`= :*5&792*39=4+=,7.(:19:7*`=.8-*7.*8=&3)=47*897>_= F*118= (`= +**8.3,= )+ = +323= *574):(9.43= &3)= +**).3,= .3= 9-*= &'&143*= &1.49.8= 74*. = 57&>_= :89=1= &7='7*8-<&9=)*8 =.* `=+218+31_= F.11.&28=
= +32+= *9-4)8= +47= 3&1>8.8= 4+= 7&9:7&1= :.*9= .3= @479:3.)= 7&'8= 7:89&(*&a:*(&54)&a@479:3.)&*_= 14:73&1= 4+= =5*7.2*39&1= &7.3*= &.414,>= &3)= (414,> =/, `=+*-:++-_= F.11.8=8)`=3)*7843=
) =,**-=97:(9:7*=4+=(7>59.(=7**+=+.8-=&88*2'1&,*8a=7*1&9.438-.58= <.9-=-&'.9&9=(-&7&(9*7.89.(8=&3)=57*)&947=)*38.9>_= &7=(41=74,="*7= ,/1 `= ,*38,,+_= F.11.8= 8)`=
.11&7= 9>`= >&'(4(0= 9? = ,**-= @749*(9.43= 4+= *=514.9*)= +.8-= .3= 9*25*7&9*= 7*,.438a= -.,-= )*38.9>= &3)= '.42&88= 4+= 83&55*7= &,7:8= &:7&9:8 = 5&7.)&*= .3= 3479-*73=7*<=\*&1&3)=2&7.3*=7*8*7;*8_= 1=551=(41 =.* `=,+.8,,1_= F.39*7= (?`= 89*8= ) = +33,= =5*7.2*39&1= *;.)*3(*= +47= 9-*= *++*(98= 4+= 541>5-*341.(= (4254:3)8= +742= #.(9>43*:7:2= (&1.+473.(:2 = :57*(-9= @-&*45->9&a= )&2.3&7.&1*8=43=9-*=+**).3,=7&9*=&3)=,74<9-=.3=9-*=7*)=&'&143*= &1.49.8=7:+*8(*38 = <&.3843_= 1==5= &7=&.41=(41 =+// a=,0-8,11_= F.9-*785443='> =+31/=.?*8=.3=9-*=&82&3.&3=(422*7(.&1=(&9(-=4+='1&(01.5=&'&143*= &1.49.8= 7:'*7 a= @488.'1*= *++*(98= 4+= (-&3,.3,= -&'.9&9= ):7.3,= ,74<9-_= *&82&3.&3= '.8-*7.*8=)*8*&7(- =3`=+/8,,_= F44)= ) `= +330= *-*= ,*42475-414,.(&1= (-&7&(9*7.8&9.43= 4+= ).,.9&1= *1*;&9.43= 24)*18 _= @-:= 9-*8.8`= 3.;*78.9>=4+=)*.(*89*7_= F47943=>) =+323==*73*1=2*9-4)8=+47=*89.2&9.3,=9-*=:9.1.?&9.43=).897.':9.43=.3=-42*8 7&3,*=89:).*8_= (414,> =1* +`=+0.8+02_=

,-0 = %74/*(9=34_=,**.2*+- =