DOCSLIB.ORG

A Survey of Morphological Variation in Adult Meristogenys Amoropalamus (Amphibia, Anura, Ranidae), with a Description of a New Cryptic Species

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Survey of Morphological Variation in Adult Meristogenys Amoropalamus (Amphibia, Anura, Ranidae), with a Description of a New Cryptic Species Zootaxa 2905: 33–56 (2011) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2011 · Magnolia Press ISSN 1175-5334 (online edition) A survey of morphological variation in adult Meristogenys amoropalamus (Amphibia, Anura, Ranidae), with a description of a new cryptic species TOMOHIKO SHIMADA1, 2, MASAFUMI MATSUI2,5, PAUL YAMBUN3 & AHMAD SUDIN4 1Department of Science, Faculty of Education, Aichi University of Education, Kariya, Aichi 448-8542, Japan 2Graduate School of Human and Environmental Studies, Kyoto University, Sakyo, Kyoto 606-8501, Japan 3Research and Education Division, Sabah Parks, P. O. Box 10626, Kota Kinabalu 88806, Sabah, Malaysia 4Institute for Tropical Biology and Conservation, University Malaysia Sabah, Kota Kinabalu 88999, Sabah, Malaysia 5Corresponding author. E-mail: [email protected] Abstract Previous analyses of molecular and larval morphology have suggested that Meristogenys amoropalamus is composed of two cryptic species, but no diagnostic characters of their adult morphology have been reported. Here, we compared adult characters of these two species and found that they differed in iris colour (yellowish-green and sandy brown), tympanum size and relative limb length. Based on the results of analysis of DNA sequences of the type specimens and a discriminant analysis using 18 morphological variables, we conclude that the lineage with green irises is the true M. amoropalamus, and that the lineage with sandy brown irises is a new species, M. dyscritus sp. nov. In northern Sabah, M. dyscritus is dis- tributed in altitudes lower than those of M. amoropalamus, but the distributional ranges of their larvae overlap in some streams. Meristogenys amoropalamus has larger and lighter-coloured ova, smaller clutch sizes and a more interstitial lar- val life than M. dyscritus. These differences suggest that M. amoropalamus has a more cryptic life during its larval period than M. dyscritus. Key words: trade-off of reproductive traits, iris color, Borneo, cryptic species, Meristogenys Introduction In many phylogenetically related species of frogs, tadpoles are more difficult to separate than adults (Inger & Stue- bing, 2005), but the reverse is true in some species such as Bufo japonicus and B. torrenticola (Matsui, 1976). The Bornean endemic ranid genus Meristogenys represents one such unusual case (Inger & Stuebing, 2005). Larvae of this genus are specialised for a life in strong currents, with a large mouth on the underside of the snout and a large abdominal sucker covering the abdomen. In contrast to adults, which usually have few notable inter-specific differ- ences in external morphology, these larvae possess many taxonomically useful characters, such as their labial tooth raw formula (LTRF), jaw sheath shape, and presence or absence of surface projections and dermal glands (Shimada et al., 2007a). This tendency is obvious in the two cryptic forms found in Meristogenys amoropalamus sensu lato. Shimada et al. (2007a, 2008) found two larval forms (morphotypes 1 and 3-a) in M. amoropalamus sensu lato that were differ- entiated by mitochondrial (mt) and nuclear DNA (nuDNA) sequence characters. These two forms were considered to represent distinct species, but no taxonomic decision was made because they were not easily differentiated by adult morphology and no evidence existed to determine which of the two forms is the true M. amoropalamus. To resolve this taxonomic problem, we searched for diagnostic morphological characters that distinguish adult specimens. We also studied sequences of DNA fragments from the type specimens of M. amoropalamus and com- pared them with the larval sequences. Based on our results, we describe a new species and discuss the distribution and reproductive traits of the new form compared to those of M. amoropalamus. Accepted by M. Vences: 11 May 2011; published: 3 Jun. 2011 33 Material and methods Specimen sampling. Following Matsui’s (1986) description, we used 97 adult specimens (68 males and 29 females) morphologically identified as M. amoropalamus. However, not all specimens strictly fit Matsui’s key (Matsui, 1986). For example, even when a specimen had more highly developed toe webbing than that described by Matsui (1986), it was identified as M. amoropalamus based on all the other characters diagnostic for this spe- cies. We followed the procedure of Shimada et al. (2007a) to fix and preserve specimens and to determine sex and maturity. Specimens were collected from five localities in Sabah (Kamborangah, Liwagu, Mahua, Mesilau, and Wario) and one locality in Sarawak (Bario) (Fig. 1). We also examined three type specimens of M. amoropalamus collected from the type locality [Sg. (Sungai, meaning “river”) Pa Riman, Gn. (Gunung, meaning “mountain”) Tapai Sia, Krayan County, East Kalimantan, Indonesia; alt. 1300 m] and Liwagu (Liwagu River, 1500 m, head- quarters of Kinabalu National Park) (Matsui, 1986). For the larval description, we examined specimens from Bundu Tuhan, Liwagu, Mahua, Mesilau, Poring and Wario (Fig. 1). A part of these specimens had been molecu- larly identified to either of the two lineages of M. amoropalamus sensu lato by Shimada et al. (2008), based on DNA sequences extracted from tissue samples collected before formalin fixation. Molecular identification. For all samples except for the type specimens, we extracted DNA, amplified approximately 440 base pair (bp) fragments of mitochondrial 12S rRNA using the primers L1091 and Hnew (Shi- mada et al., 2011) and determined the sequences following the protocol of Shimada et al. (2008). Although a variety of methods has been proposed for the extraction of DNA from formalin-fixed specimens, some of them are known to have no effects, or even a harmful effects for the quality of extracted DNA (Gilbert et al., 2007). We adopt the phenol-chloroform extraction after the digestion with optimal temperature and long (48 h) duration, because this method was most similar to our original protocol among the methods which Gilbert et al. (2007) had confirmed the effectiveness. Under the allowance of the curator of Osaka Museum of Natural History (OMNH), we cut a small piece (3 mm x 10 mm) of muscle from the abdominal wall, and ground it with a plastic pestle in 600 µl of STE buffer (0.1M NaCl; 0.05M Tris-HCl, pH 7.5; 0.001M EDTA) in a 1.5 ml tube. After the addition of 60 µl of 10% SDS and 15 µl of 10 mg/ml proteinase K solution, we kept it in an incubator at 55 °C for 36–72 hours (we continued the digestion until the visible tissue completely disappears). During the digestion, we sometimes tapped the tube calmly, and added 15 µl of proteinase K solution twice. After the digestion, we added TE saturated phenol with the same amount of the sample solution, mixed it with a electric shaker for 10 min, and centrifuged them (7500 rpm, 10 min, room temperature). The upper layer (water layer) was washed once in phenol- chloroform-isoamylalcohol (PCI) and once in chloroform-isoamylalcohol (CIA) in the same way as the phenol. After the phenol-chloroform washes, we obtained a pellet of DNA through the ordinary ethanol precipitation (addi- tion of 45 µl of 5M NaCl solution and 900 µl of 99.5% ethoanol; 10 min incubation; centrifuge with 14,000 rpm, 20 min, and 4 °C). The pellet was dissolved in 100 µl of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0). We added two drops of sterile mineral oil to prevent the solution from evaporation. To examine the quality of extracted DNA, we applied 2 µl of the solution to an agarose gel, and compare the result of electrophoresis with others. As we found that the DNA extracted from formalin fixed specimens was shorter than others (data not shown), we divided the mtDNA region into four fragments, and prepared two primers for each of them (L1091, Hnew, L1173: AACCCAAAGGACTTGACGGT, L1264: TCAGTCTGTATACCTCCGTCG, L1371: AAGAAATGGGCTA- CAATTTCTA, H1243: GAGGTATACAGACTGATTAGG, H1352: TAGAAATTGTAGCCCATTTCTT, and H1471: TGACGGGCGGTGTGTACGCG). The polymerase chain reaction (PCR) cycle included an initial dena- turation for 1 min at 94°C, 60 cycles of denaturation for 20 s at 94°C, primer annealing for 20 s at 45°C, extension for 40 s at 72°C and a last extension for 3 min at 72°C. As the PCR buffer, we used Ampdirect (Shimadzu Co.) for unpurified DNA. To avoid contamination, we separated all reagents, tubes, and extracted samples from those of other experiments, and conducted negative-control experiments for all procedures involving the type specimens. The sequences used in this paper were deposited in GenBank (AB359966–AB360009, AB360012–AB360018, AB360020–AB360043 and AB617705–AB617726). We compared the adult sequences with those of known sequences of the larval morphotypes 1 and 3-a (AB262538 for morphotype 1 and AB262541 and AB262542 for morphotype 3-a). The genetic distances between these two morphotypes were 4.5%–4.7% [Kimura’s two-parameter (K2p) distances] (Kimura, 1980) in this region of 12S rRNA (Shimada et al., 2007a). The larval morphotype 3-a is known to contain two distantly separate mtDNA lineages, but we treated them as a single taxon because no morphological or nuDNA differences between 34 · Zootaxa 2905 © 2011 Magnolia Press SHIMADA ET AL. them have been found (Shimada et al., 2008). We called adults of larval morphotype 1 “Group A” and those of morphotype 3-a “Group B”. We considered a genetic (K2p) distance less than 1.1% as intra-specific because Shi- mada et al. (2007a) reported intra-specific genetic distances of Meristogenys to range from 0% to 1.1% in this frag- ment. FIGURE 1. Map of Borneo showing the localities discussed in this study. 1, Wario; 2, Bundu Tuhan; 3, Liwagu; 4, Kamboran- gah; 5, Mesilau; 6, Poring; 7, Mahua; 8, Bario; 9, Gunung Tapai Sia. KNP and CRNP indicate Kinabalu National Park and Crocker Range National Park, respectively. Closed and open dots indicates the sampling localities of Group A (Meristogenys amoropalamus) and Group B (M.
Load more

Recommended publications
  • A New Species of Amolops from Thailand (Amphibia, Anura, Ranidae)
    ZOOLOGICAL SCIENCE 23: 727–732 (2006) 2006 Zoological Society of Japan A New Species of Amolops from Thailand (Amphibia, Anura, Ranidae) Masafumi Matsui1* and Jarujin Nabhitabhata2 1Graduate School of Human and Environmental Studies, Kyoto University, Sakyo-ku, Kyoto 606-8501, Japan 2National Science Museum, Technopolis, Klong 5, Klongluang District, Pathun thani 12120, Thailand We describe a new species of torrent-dwelling ranid frog of the genus Amolops from western to peninsular Thailand. Amolops panhai, new species, differs from its congeners by the combination of: small body, males 31–34 mm, females 48–58 mm in snout-vent length; head narrower than long; tympanum distinct; vomerine teeth in short, oblique patches; first finger subequal to second; disc of first finger smaller than that of second, with circummarginal groove; no wide fringe of skin on third finger; toes fully webbed; outer metatarsal tubercle present; supratympanic fold present; dor- solateral fold indistinct; axillary gland present; horny spines on back, side of head and body, and chest absent; large tubercles on side of anus absent; glandular fold on ventral surface of tarsus absent; nuptial pad and paired gular pouches present in male; white band along the upper jaw extending to shoulder absent; larval dental formula 7(4-7)/3(1). This new species is the second anu- ran discovered which has a disjunct distribution around the Isthmus of Kra. Key words: Amolops, new species, Southeast Asia, tadpole, taxonomy, zoogeography Ranong), which we describe below as a new species. INTRODUCTION Oriental ranid frogs related to Amolops Cope, 1865 MATERIALS AND METHODS (sensu lato) are characterized by their peculiar larvae, which A field survey was conducted in western and peninsular Thai- inhabit mountain torrents using an abdominal, suctorial disk land between December 1995 and January 1997.
    [Show full text]
  • Larval Description and Developmental Staging of Amolops Tadpoles from Nepal, Including Ultrastructure of the Oral Disc and Sucker
    SALAMANDRA 56(4): 317–328 Larval description and developmental staging of Amolops tadpoles from NepalSALAMANDRA 30 October 2020 ISSN 0036–3375 German Journal of Herpetology Larval description and developmental staging of Amolops tadpoles from Nepal, including ultrastructure of the oral disc and sucker Mohsen Nokhbatolfoghahai1, Kevin W. Conway2, Liam Atherton1, Prem B. Budha3, Michael J. Jowers4 & J. Roger Downie1 1) School of Life Sciences, Graham Kerr Building, University of Glasgow, Glasgow, UK 2) Department of Ecology and Conservation Biology, Biodiversity Research and Teaching Collections, Texas A & M University, College Station, Texas 77843, USA 3) Central Department of Zoology, Tribhuvan University, Kirtipur, Kathmandu, Nepal 4) CIBIO/InBIO, Research Centre in Biodiversity and Genetic Resources, Porto University, Campo de Vairão, Vairão, Portugal Corresponding author: Michael J. Jowers, e-mail: [email protected] Manuscript received: 23 December 2019 Accepted: 21 July 2020 by Jörn Köhler Abstract. Tadpoles of the Asiatic torrent frog genus Amolops possess large abdominal suckers and a complex oral appa- ratus which allow them to adhere tightly to and also to move over wet rock surfaces, a morphology termed gastromyzo- phorous. Accounts of larval development, and overall sucker morphology and microstructure are patchy in this genus. Here, from a large sample (n = 90) of Amolops tadpoles collected from two sites in Nepal, we give a detailed description of the tadpoles’ external morphology, including pigment pattern variation, and their development from soon after hatch- ing to the approach of metamorphosis, including new features of their oral apparatus (tooth rows and labia). Using SEM, we describe ultrastructural details of the sucker’s surface, especially microvillated cells of the friction areas.
    [Show full text]
  • ANALISIS FILOGENETIK DAN ESTIMASI WAKTU DIVERGENSI Amolops Cope, 1865 SENSU LATO PAPARAN SUNDA SECARA INSILICO
    ANALISIS FILOGENETIK DAN ESTIMASI WAKTU DIVERGENSI Amolops Cope, 1865 SENSU LATO PAPARAN SUNDA SECARA INSILICO SKRIPSI Oleh : LUHUR SEPTIADI NIM. 15620102 JURUSAN BIOLOGI FAKULTAS SAINS DAN TEKNOLOGI UNIVERSITAS ISLAM NEGERI MAULANA MALIK IBRAHIM MALANG 2019 ANALISIS FILOGENETIK DAN ESTIMASI WAKTU DIVERGENSI Amolops Cope, 1865 SENSU LATO PAPARAN SUNDA SECARA INSILICO SKRIPSI Oleh : LUHUR SEPTIADI NIM. 15620102 Diajukan Kepada: Fakultas Sains dan Teknologi Universitas Islam Negeri (UIN) Maulana Malik Ibrahim Malang Untuk Memenuhi Salah Satu Persyaratan dalam Memperoleh Gelar Sarjana Sains (S.Si) JURUSAN BIOLOGI FAKULTAS SAINS DAN TEKNOLOGI UNIVERSITAS ISLAM NEGERI MAULANA MALIK IBRAHIM MALANG 2019 i ANALISIS FILOGENETIK DAN ESTIMASI WAKTU DIVERGENSI Amolops Cope, 1865 SENSU LATO PAPARAN SUNDA SECARA INSILICO SKRIPSI Oleh : LUHUR SEPTIADI NIM. 15620102 Telah diperiksa dan disetujui untuk diuji Tanggal : 13 Juni 2019 Pembimbing I Pembimbing II Berry Fakhry Hanifa, M.Sc Oky Bagas Prasetyo, M.Pd.I NIDT. 19871217 20160801 1 066 NIDT. 19890113 20180201 1 244 Mengetahui, Ketua Jurusan Biologi Romaidi, M.Si., D.Sc NIP. 19810201 200901 1 019 ii ANALISIS FILOGENETIK DAN ESTIMASI WAKTU DIVERGENSI Amolops Cope, 1865 SENSU LATO PAPARAN SUNDA SECARA INSILICO SKRIPSI Oleh : LUHUR SEPTIADI NIM. 15620102 telah dipertahankan Di depan Dewan Penguji Skripsi dan dinyatakan diterima sebagai salah satu persyaratan untuk memperoleh gelar Sarjana Sains (S.Si) Tanggal: 13 Juni 2019 Penguji Utama Kholifah Holil, M.Si NIP. 19751106 200912 2 002 Ketua Penguji Fitriyah, M.Si NIP. 19860725 201903 2 013 Sekretaris Penguji Berry Fakhry Hanifa, M.Sc NIDT. 19871217 20160801 1 066 Anggota Penguji Oky Bagas Prasetyo, M.Pd.I NIDT. 19890113 20180201 1 244 Mengetahui, Ketua Jurusan Biologi Romaidi, M.Si., D.Sc NIP.
    [Show full text]
  • Diet of Tadpoles at Three Localities in Sarawa!{
    DIET OF TADPOLES AT THREE LOCALITIES IN SARAWA!{ Sandra James Tinggom Bachelor of Science with Honours (J. (Animal Resource Science and Management) 668 E2 2005 5194 2005 P.KHIDMAT MAKLUMAT AKADEMIK UNIMAS ~usal Khidmal MaklUmal Akaoerr UNIVERSITI MALAYSIA SARAWA 1111111111111111111 111111111 Q4)no KOla Samarahan 1000143775 DIET OF TADPOLES AT THREE LOCALITIES IN SARA W AK SANDRA JAMES TINGGOM This project is submitted in partial fulfillment ofthe requirements for the degree of Bachelor ofScience with Honours (Animal Resource Science and Management Program) Faculty of Resource Sciences and Technology UNIVERSITI MALAYSIA SARA W AK 2005 QL I DECLARATION No portion of the work referred to in this dissertation has been submitted in support of an application for another degree of qualification of this or any other university or institution of higher learning. Sandra James Tinggom Program of Animal Resource Science and Management Faculty of Resource Sciences and Technology University Malaysia Sarawak LIST OF FIGURES FIGURE 1: Study site in Kubah National Park. 7 FIGURE 2: Study site in Gunung Gading National Park. 8 FIGURE 3: Cluster analysis based on overlap data on diet of representative tadpole from all the three sites (Gunung Gading, Kubah and Desa Ilmu). 24 FIGURE 4: Cluster analysis based on overlap data on diet of representative tadpoles in Gunung Gading National Park. 29 FIGURE 5: Cluster analysis based on overlap data on diet of representative tadpoles in Kubah National Park. 31 FIGURE 6: Cluster analysis based on overlap data on diet of representative species of tadpoles in Desa Ilmu. 33 LIST OF TABLES TABLE 1: Raw collection data of tadpoles and their localities.
    [Show full text]
  • (Amphibia: Ranidae) on Sumatra, Indonesia
    Phylogenetic systematics, diversity, and biogeography of the frogs with gastromyzophorous tadpoles (Amphibia: Ranidae) on Sumatra, Indonesia Dissertation zur Erlangung des Doktorgrades Fachbereich Biologie An der Fakultät für Mathematik, Informatik und Naturwissenschaften der Universität Hamburg Vorgelegt von Umilaela Arifin Hamburg, 2018 Tag der Disputation: 25 January 2019 Folgende Gutachter empfehlen die Annahme der Dissertation: 1. Prof. Dr. Alexander Haas 2. Prof. Dr. Bernhard Hausdorf “To reach the same destination, some people might only need one step but some other people might need two, three, a hundred, or a thousand steps. Never give up! Some are successful because they work harder than other people, not because they are smart.” –dti- Preface Preface It is such a relief to have finally finished writing this dissertation entitled “Phylogenetic systematics, diversity, and biogeography of the frogs with gastromyzophorous tadpoles (Amphibia: Ranidae) on Sumatra, Indonesia”. Thank to Allah, who has always embraced me in any situation, especially during my doctoral studies. The work I have done over the past five years is dedicated not only to myself, but also to all the people, who came into my life for various reasons. Also, this thesis is my small contribution to Indonesia (the “Ibu Pertiwi”) and its fascinating biodiversity. I hope to continue actively contributing to the field of herpetology in the future, simply because it is my greatest passion! During my childhood, especially through my high school years, it never crossed my mind that I would end up becoming a scientist. Coming from an ordinary Indonesian family and living in a small town made my parents worry about the education their children would need, in order to have a better life in the future.
    [Show full text]
  • INDEX to GENERA and SPECIES Genera and Species Listed in Appendices Are Not Indexed
    INDEX TO GENERA AND SPECIES Genera and species listed in appendices are not indexed Abarema filamentosa . 483 minuta ........................ 444 Abrophyllum . .. 223 Arenga undulatifolia .................. 444 Abryna regispetri .................... 94 Argyrodendron peralatum . 373 Acacia. .. 11 Arhopala buddTia .................... 292 Acalypha stipulacea .................. 327 metamuta ....................... 292 Acantho/epsls ...................... 120 Armigeres ....................... 89, 97 Acanthomyrmex ..................... 120 dolichocephalus . .. 93 Acer saccharum ..................... 219 flavus .. .. 93 Acmena acuminatissima ................ 327 Artocarpus ovatus .................... 328 Acronychia vestita ................... 219 Asyndetus . 185 Acropsilus . 185 Athertonia diversifolia .. .. 224, 225 Acropyga ......................... 120 Atta ............................ 10 Actyolepis puspa .................... 292 Attalea acaulis . 479 Acylophorus ................... 88-91, 93 funifera .................. 477-479, 483 Adinandra ...................... .. 223 humilis ........................ 483 Aedes gombakensis . .. 93 Baccaurea kunst/eri . 155 Aenictus . 120 Bactris . 483 Afromomum ..................... .. 219 Baptista ................. 88-90, 93, 96, 97 Agelaea bomeensis ................... 441 Barbodes collingwoodi .... 309-312, 380, 381, 384 Aglaia ditfusa ...................... 327 Barringtonia . 429 iloilo ......................... 328 Basilia hispida . .. 91 llanosiana ...................... 327 Batraxis . .. 93 longipes
    [Show full text]
  • Vocal Apparatus Structure of the Sarawak Frogs (Amphibia: Anura: Ranidae) (Struktur Alat Vokal Katak Sarawak (Amfibia: Anura: Ranidae))
    Sains Malaysiana 44(9)(2015): 1289–1299 Vocal Apparatus Structure of the Sarawak Frogs (Amphibia: Anura: Ranidae) (Struktur Alat Vokal Katak Sarawak (Amfibia: Anura: Ranidae)) ELVY QUATRIN DEKA, LELA SU’UT, HASNIZAM ABDUL WAHID & RAMLAH ZAINUDIN* ABSTRACT Studies have shown that some characters, such as morphological, biochemical and behavioural characteristics were shared among con-specifics of closely related frog species. It is hypothesized that closely related frogs would have similar vocal apparatus structure to produce similar call characteristics, in order to be recognized by con-specifics. The vocal apparatus structures of the frogs from Ranidae were, thus, investigated and calls were recorded from various locations in Sarawak, Borneo. The vocal apparatus was sliced and stained using haematoxylin and eosin staining method. The prepared slides were scanned using Dotslide System Olympus BX51. Captured images were further measured using Microscope Olympus BX51. The results showed that the vocal apparatus structure of ranids in Sarawak differed in length between pulvinar vocale and posterior margin (pvpm) or known as vocal cord stricter. This character was deemed to be the most significant character to discriminate the Sarawak ranids. It is suggested that histological analysis is also a good method for study of phenotypic variation of frog species, as shown by the vocal apparatus structure of the anurans. This study provides an alternative method to differentiate taxonomic identity among frog species. Keywords: Advertisement call; histological method; Ranidae; variations; vocal apparatus ABSTRAK Kajian terdahulu telah menunjukkan sesetengah ciri seperti morfologi, biokimia dan kelakuan dikongsi bersama antara spesies yang berkait rapat. Hipotesis menyatakan spesies katak yang berkait rapat akan mempunyai struktur alat vokal yang sama untuk menghasilkan bunyi panggilan yang sama untuk dikenali oleh individu daripada spesies berkenaan.
    [Show full text]
  • Title a Taxonomic Study of Whitehead's Torrent Frog, Meristogenys Whiteheadi, with Descriptions of Two New Species
    A taxonomic study of Whitehead's torrent frog, Meristogenys Title whiteheadi, with descriptions of two new species (Amphibia: Ranidae) SHIMADA, TOMOHIKO; MATSUI, MASAFUMI; Author(s) YAMBUN, PAUL; SUDIN, AHMAD Zoological Journal of the Linnean Society (2011), 161(1): 157- Citation 183 Issue Date 2011-01-13 URL http://hdl.handle.net/2433/197182 This is the peer reviewed version of the following article: SHIMADA, T., MATSUI, M., YAMBUN, P. and SUDIN, A. (2011), A taxonomic study of Whitehead's torrent frog, Right Meristogenys whiteheadi, with descriptions of two new species (Amphibia: Ranidae). Zoological Journal of the Linnean Society, 161: 157‒183, which has been published in final form at http://dx.doi.org/10.1111/j.1096-3642.2010.00641.x Type Journal Article Textversion author Kyoto University A taxonomic study of Whitehead’s torrent frog, Meristogenys whiteheadi, with descriptions of two new species (Amphibia: Ranidae) TOMOHIKO SHIMADA1, 2, MASAFUMI MATSUI2, PAUL YAMBUN3, and AHMAD SUDIN4 1Faculty of Bioenvironmental Science, Kyoto Gakuen University, Kameoka, Kyoto 621-8555, Japan 2Graduate School of Human and Environmental Studies, Kyoto University, Sakyo, Kyoto 606-8501, Japan 3Research and Education Division, Sabah Parks, P. O. Box 10626, Kota Kinabalu 88806, Sabah, Malaysia 4Institute for Tropical Biology and Conservation, University Malaysia Sabah, Kota Kinabalu 88999, Sabah, Malaysia short running title: A taxonomic study of Meristogenys whiteheadi (Amphibia: Ranidae) Number of text pages: 33 Number of figures: 8 Number of tables:
    [Show full text]
  • MORPHOLOGICAL VARIATIONS of the GENUS Huia Yang, 1991 in REGION of JAVA, KALIMANTAN and SUMATRA
    Jurnal Biodjati 6(1):1-10, May 2021 e-ISSN : 2541-4208 p-ISSN : 2548-1606 http://journal.uinsgd.ac.id/index.php/biodjati MORPHOLOGICAL VARIATIONS OF THE GENUS Huia Yang, 1991 IN REGION OF JAVA, KALIMANTAN AND SUMATRA Meilinda Rodhiya Idrus1*, Ahmad Nauval Arroyyan2, Saiful Bahri3, Amir Hamidy4 Selected paper from the 5th Seminar Abstract. Huia is a frog belonging to the family Ranidae which has a Nasional Biologi (SEMABIO), wide distribution in the world, including in Indonesia. Huia in Indo- Bandung-Indonesia, October 8, 2020 nesia consists of 4 species spread from Sumatra, Java and Kalimantan, (conference.bio.uinsgd.ac.id) namely Huia masonii, Huia cavitympanum, Huia modligianii, and Huia Received : January 06, 2021 sumatrana. Huia was originally incorporated into the genus Amolops Accepted : April 27, 2021 and divided into 3 different sub-genus. The method used was quanti- DOI: 10.15575/biodjati.v6i1.10771 tative descriptive as the data obtained in the form of descriptions of the morphometric and meristic characters PAST 3 analyzed software 1,2,3Department of Biology, Faculty of Science and Technology UIN of wet specimens from the Museum Zoologicum Bogoriense. The Sunan Ampel, Surabaya 60237, (031) aims were to determine the morphological variations in Huia cha- 8410298 racters due to the interesting distribution patterns of species, that were 4Herpetology Laboratory, Zoology scattered on each island. The results obtained show that there were Division, Museum Zoologicum morphological variations but have not shown significant grouping Bogoriense, LIPI Cibinong, Bogor with the dominant character of each population of the entire genus 16912, (021) 87907604 Huia in Indonesia.
    [Show full text]
  • Response to the Point of View of Gregory B. Pauly, David M
    Herpetologica, 65(2), 2009, 136–153 E 2009 by The Herpetologists’ League, Inc. RESPONSE TO THE POINT OF VIEW OF GREGORY B. PAULY, DAVID M. HILLIS, AND DAVID C. CANNATELLA, BY THE ANURAN SUBCOMMITTEE OF THE SSAR/HL/ASIH SCIENTIFIC AND STANDARD ENGLISH NAMES LIST 1,4 2 3 DARREL R. FROST ,ROY W. MCDIARMID , AND JOSEPH R. MENDELSON, III 1Division of Vertebrate Zoology (Herpetology), American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024, USA 2US Geological Survey, Patuxent Wildlife Research Center, National Museum of Natural History, MRC 111, P.O. Box 37012, Washington, DC 20013-7012, USA 3Zoo Atlanta, 800 Cherokee Avenue Southeast, Atlanta, GA 30315, USA ‘‘Stultum facit Fortuna quem vult perdere’’—Publilius Syrus, Maxim 911 ABSTRACT: The Point of View by Gregory Pauly, David Hillis, and David Cannatella misrepresents the motives and activities of the anuran subcommittee of the Scientific and Standard English Names Committee, contains a number of misleading statements, omits evidence and references to critical literature that have already rejected or superseded their positions, and cloaks the limitations of their nomenclatural approach in ambiguous language. Their Point of View is not about promoting transparency in the process of constructing the English Names list, assuring that its taxonomy is adequately reviewed, or promoting nomenclatural stability in any global sense. Rather, their Point of View focuses in large part on a single publication, The Amphibian Tree of Life, which is formally unrelated to the Standard English Names List, and promotes an approach to nomenclature mistakenly asserted by them to be compatible with both the International Code of Zoological Nomenclature and one of its competitors, the PhyloCode.
    [Show full text]
  • Title a New Species of Meristogenys (Amphibia, Anura, Ranidae)
    A New Species of Meristogenys (Amphibia, Anura, Ranidae) Title from Sabah, Borneo Author(s) Matsui, Masafumi; Shimada, Tomohiko; Sudin, Ahmad Citation Zoological Science (2010), 27(1): 61-66 Issue Date 2010-01 URL http://hdl.handle.net/2433/216892 Right © 2010 Zoological Society of Japan Type Journal Article Textversion publisher Kyoto University ZOOLOGICAL SCIENCE 27: 61–66 (2010) ¤ 2010 Zoological Society of Japan A New Species of Meristogenys (Amphibia, Anura, Ranidae) from Sabah, Borneo Masafumi Matsui1*, Tomohiko Shimada1,2 and Ahmad Sudin3 1Graduate School of Human and Environmental Studies, Kyoto University, Sakyo-ku, Kyoto 606-8501, Japan 2Faculty of Bioenvironmental Science, Kyoto Gakuen University, Kameoka 621-8555, Japan 3Institute for Tropical Biology and Conservation, University Malaysia Sabah, Teluk Sepanggar, Locked Bag 2073, 88999 Kota Kinabalu, Sabah, Malaysia We describe a new species of torrent-dwelling ranid frog of the genus Meristogenys from the Crocker Range, western Sabah, northern Borneo. The new species, Meristogenys maryatiae, differs from congeners by the combination of: small body, males 31–37 mm and females 65–66 mm in snout-vent length; head narrower than long; eyes moderate, diameter subequal to snout; iris uni- colored; legs long; ventral surface of tibia without heavy pigmentation; rear of thigh blotched dark brown and cream; toes fully webbed; outer metatarsal tubercle present; larval dental formula 7(4- 7)/6(1). Key words: Meristogenys, new species, Southeast Asia, tadpole, taxonomy, zoogeography morphosed specimens were fixed in 10% formalin and later pre- INTRODUCTION served in 70% ethanol. Larvae were fixed and preserved in 5% for- Meristogenys Yang, 1991 was split from Amolops Cope, malin.
    [Show full text]
  • Taxonomic Checklist of Amphibian Species Listed Unilaterally in The
    Taxonomic Checklist of Amphibian Species listed unilaterally in the Annexes of EC Regulation 338/97, not included in the CITES Appendices Species information extracted from FROST, D. R. (2013) “Amphibian Species of the World, an online Reference” V. 5.6 (9 January 2013) Copyright © 1998-2013, Darrel Frost and The American Museum of Natural History. All Rights Reserved. Reproduction for commercial purposes prohibited. 1 Species included ANURA Conrauidae Conraua goliath Annex B Dicroglossidae Limnonectes macrodon Annex D Hylidae Phyllomedusa sauvagii Annex D Leptodactylidae Leptodactylus laticeps Annex D Ranidae Lithobates catesbeianus Annex B Pelophylax shqipericus Annex D CAUDATA Hynobiidae Ranodon sibiricus Annex D Plethodontidae Bolitoglossa dofleini Annex D Salamandridae Cynops ensicauda Annex D Echinotriton andersoni Annex D Laotriton laoensis1 Annex D Paramesotriton caudopunctatus Annex D Paramesotriton chinensis Annex D Paramesotriton deloustali Annex D Paramesotriton fuzhongensis Annex D Paramesotriton guanxiensis Annex D Paramesotriton hongkongensis Annex D Paramesotriton labiatus Annex D Paramesotriton longliensis Annex D Paramesotriton maolanensis Annex D Paramesotriton yunwuensis Annex D Paramesotriton zhijinensis Annex D Salamandra algira Annex D Tylototriton asperrimus Annex D Tylototriton broadoridgus Annex D Tylototriton dabienicus Annex D Tylototriton hainanensis Annex D Tylototriton kweichowensis Annex D Tylototriton lizhengchangi Annex D Tylototriton notialis Annex D Tylototriton pseudoverrucosus Annex D Tylototriton taliangensis Annex D Tylototriton verrucosus Annex D Tylototriton vietnamensis Annex D Tylototriton wenxianensis Annex D Tylototriton yangi Annex D 1 Formerly known as Paramesotriton laoensis STUART & PAPENFUSS, 2002 2 ANURA 3 Conrauidae Genera and species assigned to family Conrauidae Genus: Conraua Nieden, 1908 . Species: Conraua alleni (Barbour and Loveridge, 1927) . Species: Conraua beccarii (Boulenger, 1911) . Species: Conraua crassipes (Buchholz and Peters, 1875) .
    [Show full text]