CORE Metadata, citation and similar papers at core.ac.uk Provided by Open Access LMU Vol. 167, No. 2, 1990 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS March 16, 1990 Pages 848-859 THE HUMAN PREGNANCY-SPECIFIC GLYCOPROTEIN GENES ARE TIGHTLY LINKED ON THE LONG ARM OF CHROMOSOME 19 AND ARE COORDINATELY EXPRESSED John Thompson, Rosa Koumari, Klaus Wagner, Sabine Barnert, Cathrin Schleussner, Heinrich Schrewe, Wolfgang Zimmermann, Gaby Miiller’, Werner Schempp’, Daniela Zaninetta*, Domenico Ammaturo”, and Norman Hardmad Institute of Immunobiology, University of Freiburg, Stefan-Meier-Str. 8, D-7800 Freiburg, FRG ‘Institute of Human Genetics, University of Freiburg, Albertstr. 11, D-7800 Freiburg, FRG *Department of Molecular Biology, Biotechnology Section, Ciba-Geigy AG, CH-4002 Basel, Switzerland Received January 22, 1990 The pregnancy-specificglycoprotein (PSG) genesencode a group of proteins which are found in large amounts in placenta and maternal serum. In situ hybridization analyses of metaphase chromosomesreveal that all the human pregnancy-specificglycoprotein (PSG) genesare located on the long arm of chromosome 19 (19q13.2-13.3), overlapping the region containing the closely-relatedcarcinoembryonic antigen (CEA) genesubgroup. Higher resolution analysesindicate that the PSG genesare closely linked within an 800kb Sac11restriction endonucleasefragment. This has been confirmed through restriction endonucleasemapping and DNA sequenceanalyses of isolated genomicclones, which showthat at least someof thesegenes are located in very close proximity. Further, these studies have helped to identify a new member of the PSG gene sub- family (PSG7). DNA/RNA hybridization analyses,using gene-specific oligonucleotide probes based on published sequences,showed that five from six PSG genestested are coordinately transcribed in the placenta. Due to the closeproximity of thesegenes and their coordinated expressionpattern, common transcriptional regulatory elementsmay exist. 0 1990Academic Press, Inc. The pregnancy-specific81 glycoproteins (PSG) consist of a heterogenousgroup of molecules(1) which are expressedin the placenta during pregnancy and in tumors of trophoblastic origin (2). At term pregnancy, the PSG moleculesrepresent someof the major placental proteins (3). Their presence in choriocarcinomashas indicated their potential utility as tumor markers (2). Until recently, little was known about the structure and complexity of this protein family, and their function still remains unknown. At least three immunologically-crossreactingPSG specieswith differing molecular sizes have been isolated from human placenta (4). Through molecular ana- lyses of genomic and cDNA clones,ten separatePSG geneshave been identified so far, and their coding regions could be deduced(4-14). Differential splicingof at least one gene has been report- ed, whereby four mRNA variants have been found, encodingproteins which differ only in their short C-terminal domain regions (4,5,9,11,14).This increasesthe potential number of PSG pro- teins to thirteen, assumingthat all the transcripts are translated. Sequencecomparisons reveal that these genesare homologousto those encoding the carcinoembryonicantigen (CEA) and related 0006-291W90 $1.50 Copyright 0 1990 by Academic Press. Inc. All rights of reproduction in any form reserved. 848 Vol. 167, No. 2, 1990 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS molecules (15). The PSG/CEA gene family belongs to the immunoglobulin (Ig) superfamily (15,16). Basically, as derived from DNA sequence data, the proteins consist of one N-terminal Ig variable (IgV)-like, and a differing number of immunoglobulin constant (IgC)-like domains (17). Differ- ences can be found in the C-terminal domain regions, whereby the CEA-related proteins appear to be membrane-bound, either after post-translational modification through processing and the addition of a glycosyl phosphatidylinositol tail (l&22), or as an integral membrane protein (23,24). Most of the PSG molecules apparently lack a transmembrane region and their deduced primary structures indicate that they are secreted (4,5,8,9,11). The CEA-related genes are clustered on the long arm of chromosome 19 (25-27). In this paper we have determined the fine chromosomal location of the PSG genes. DNA/RNA hybridization investigations using presumed gene-specific oligonucleotides have been applied to study the transcriptional activity of individual genes. These basic studies should help us to learn more about the regulation of PSG gene expression, and pave the way for functional analyses of this important group of pregnancy-specific glycoproteins. MATERIALS AND METHODS In situ hybridization: Preparation of chromosomes and in situ hybridizations were carried out as described previously (27) using a 1026bp EcoRI/SstI restriction endonuclease fragment from XhsCGM3-1 (10) which contains the N-terminal domain exon, as a probe. After 3 weeks exposure at 4”C, the chromosomes were RBG-banded by the method of Perry and Wolff (29). Isolation of high molecular weight genomic DNA and pulsed field gel electrophoresis analyses: High molecular weight DNA was isolated from an Epstein Barr virus-immortalized, human lymphoblast cell line, L1164 (gift from G. Scherer, Institute of Human Genetics, Freiburg University, FRG) in agarose blocks according to the European Molecular Biology Laboratory (EMBL, Heidelberg, FRG) protocol. Pulsed field gel electrophore- sis of large restriction endonuclease fragments was carried out on a CHEF-type model (EMBL, Heidelberg, FRG), at 4 V/cm and a pulse time of 90s in a 0.8% agarose gel for 43h at 15°C as described by the manu- facturers, and the DNA was transferred to a charged nylon membrane (GeneScreen-Plus, DuPont, Bad Homburg, FRG) according to the manufacturer’s protocol. The membrane was hybridized with a probe con- taining the total coding region minus the 3’untranslated portion of the PSGla cDNA clone described else- where (11). The hybridization was carried out overnight at 42°C in 40% deionized formamide, 1M NaCl, 10% dextran sulphate, 1% SDS, lOO/.rg/ml denatured salmon sperm DNA. Final washes were performed at 62°C in 0.1x SSPE (lx SSPE: 180mM NaCl, 1OmM NaH,PO,, 1mM EDTA pH 7.4), 0.1% SDS. Bacterial strains, human genomic libraries and cloning vectors: All work with recombinant DNA was carried out according to the German and Swiss safety regulations. A human leucocyte genomic library in XEMBL3 (HL1006; Clontech, Palo Alto, USA) was amplified in E. coli 803. A human cosmid genomic library (gift from W. Lindenmaier, Gesellschaft filr Biotechnologische Forschung, Braunschweig, FRG), inserted in the vector pHC79-2cos/TK, was amplified in the ret A- E. coli strain ED8767. For subcloning of the insert DNA frag- ments, either Bluescript phagemid (Stratagene, San Diego, USA) was used in E. coli strains JM109 and RRlbMlS, or M13mp18/19 phage, which was amplified in E. coli strain JM107. Screening of the human genomic libraries: Various DNA fragments were radiolabelled (28), and used to screen the human genomic libraries (30). For the lambda library, recombinant bacteriophages were amplified and transferred to nitrocellulose filters (Schleicher and Schuell, Dassel, FRG) as described (31). Screening and plaque purification was carried out by using the radioactively-labelled cDNA insert of pSP,-i (8). Hybridization was carried out at 65°C in a solution containing 5x Denhardt’s, SOC(g/ml denatured salmon sperm DNA, 0.05% SDS and 6x SSC (lx SSC = 0.15M NaCl, 0.017M Na-citrate pH 7.0). Final washes were performed at 65°C using 0.1x SSC. For the cosmid library, the original screening was carried out using a 1.4kb EcoRI restriction endonuclease fragment, covering the 3’untranslated region of the NCA cDNA clone 9 (32). Colony hybridiz- ation on nitrocellulose filters (30) was used to identify the cosmid clones. Pre-hybridization was carried out at 42°C in 40% deionized formamide, 6x SSPE, Ix Denhardt’s, 0.5% SDS, lOO~g/ml denatured salmon sperm DNA for 2h. Hybridization was under the same conditions but in the absence of SDS. Final washes were performed at 65°C in 2x SSPE, 0.5% SDS. 849 Vol. 167, No. 2, 1990 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS Restriction endonuclease mapping: Lambda clones were mapped by restriction endonuclease digests aided by hybridization with the pSP,-i cDNA insert (8). Detailed mapping of clone XPSG6/7-1 was carried out using DNA fragments subcloned in Bluescript plasmids. The cosmid clones were mapped by linearizing with the restriction endonucleases, PvuI or NheI, which cut in the vector at a short distance to the left and right of the cloning site, respectively. The resulting fragments were then partially digested with different restriction endonucleases (EcoRI, SstI and BamHI), separated by gel electrophoresis in 0.5% agarose overnight at 1 V/cm (4°C) and transferred to charged nylon membranes prior to hybridization with oligonucleotide probes whose complementary sequences are located in the vector between the PvuI site (oligo cosl), or the NheI site (oligo cos2) and the cloning site. The oligonucleotides were as follows: oligo cosl 5’ TAGGCGTATCACGAGGCCCCG 3 oligo cos2 5’ GGCGATGCTGTCGGAATGGACG 3 Hybridization was carried out in 30% deionized formamide, 1M NaCl, 1% SDS, 10% dextran sulphate, lOO~g/ml denatured salmon sperm DNA at 10-1X below the theoretical melting temperature (33). Final washes were carried out in 2x SSPE, 0.5% SDS at 3-5°C below the theoretical melting temperatures. Size determination of the fragments hybridizing