DOCSLIB.ORG

The Human Pregnancy-Specific Glycoprotein Genes Are Tightly Linked on the Long Arm of Chromosome 19 and Are Coordinately Expressed

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Human Pregnancy-Specific Glycoprotein Genes Are Tightly Linked on the Long Arm of Chromosome 19 and Are Coordinately Expressed CORE Metadata, citation and similar papers at core.ac.uk Provided by Open Access LMU Vol. 167, No. 2, 1990 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS March 16, 1990 Pages 848-859 THE HUMAN PREGNANCY-SPECIFIC GLYCOPROTEIN GENES ARE TIGHTLY LINKED ON THE LONG ARM OF CHROMOSOME 19 AND ARE COORDINATELY EXPRESSED John Thompson, Rosa Koumari, Klaus Wagner, Sabine Barnert, Cathrin Schleussner, Heinrich Schrewe, Wolfgang Zimmermann, Gaby Miiller’, Werner Schempp’, Daniela Zaninetta*, Domenico Ammaturo”, and Norman Hardmad Institute of Immunobiology, University of Freiburg, Stefan-Meier-Str. 8, D-7800 Freiburg, FRG ‘Institute of Human Genetics, University of Freiburg, Albertstr. 11, D-7800 Freiburg, FRG *Department of Molecular Biology, Biotechnology Section, Ciba-Geigy AG, CH-4002 Basel, Switzerland Received January 22, 1990 The pregnancy-specificglycoprotein (PSG) genesencode a group of proteins which are found in large amounts in placenta and maternal serum. In situ hybridization analyses of metaphase chromosomesreveal that all the human pregnancy-specificglycoprotein (PSG) genesare located on the long arm of chromosome 19 (19q13.2-13.3), overlapping the region containing the closely-relatedcarcinoembryonic antigen (CEA) genesubgroup. Higher resolution analysesindicate that the PSG genesare closely linked within an 800kb Sac11restriction endonucleasefragment. This has been confirmed through restriction endonucleasemapping and DNA sequenceanalyses of isolated genomicclones, which showthat at least someof thesegenes are located in very close proximity. Further, these studies have helped to identify a new member of the PSG gene sub- family (PSG7). DNA/RNA hybridization analyses,using gene-specific oligonucleotide probes based on published sequences,showed that five from six PSG genestested are coordinately transcribed in the placenta. Due to the closeproximity of thesegenes and their coordinated expressionpattern, common transcriptional regulatory elementsmay exist. 0 1990Academic Press, Inc. The pregnancy-specific81 glycoproteins (PSG) consist of a heterogenousgroup of molecules(1) which are expressedin the placenta during pregnancy and in tumors of trophoblastic origin (2). At term pregnancy, the PSG moleculesrepresent someof the major placental proteins (3). Their presence in choriocarcinomashas indicated their potential utility as tumor markers (2). Until recently, little was known about the structure and complexity of this protein family, and their function still remains unknown. At least three immunologically-crossreactingPSG specieswith differing molecular sizes have been isolated from human placenta (4). Through molecular ana- lyses of genomic and cDNA clones,ten separatePSG geneshave been identified so far, and their coding regions could be deduced(4-14). Differential splicingof at least one gene has been report- ed, whereby four mRNA variants have been found, encodingproteins which differ only in their short C-terminal domain regions (4,5,9,11,14).This increasesthe potential number of PSG pro- teins to thirteen, assumingthat all the transcripts are translated. Sequencecomparisons reveal that these genesare homologousto those encoding the carcinoembryonicantigen (CEA) and related 0006-291W90 $1.50 Copyright 0 1990 by Academic Press. Inc. All rights of reproduction in any form reserved. 848 Vol. 167, No. 2, 1990 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS molecules (15). The PSG/CEA gene family belongs to the immunoglobulin (Ig) superfamily (15,16). Basically, as derived from DNA sequence data, the proteins consist of one N-terminal Ig variable (IgV)-like, and a differing number of immunoglobulin constant (IgC)-like domains (17). Differ- ences can be found in the C-terminal domain regions, whereby the CEA-related proteins appear to be membrane-bound, either after post-translational modification through processing and the addition of a glycosyl phosphatidylinositol tail (l&22), or as an integral membrane protein (23,24). Most of the PSG molecules apparently lack a transmembrane region and their deduced primary structures indicate that they are secreted (4,5,8,9,11). The CEA-related genes are clustered on the long arm of chromosome 19 (25-27). In this paper we have determined the fine chromosomal location of the PSG genes. DNA/RNA hybridization investigations using presumed gene-specific oligonucleotides have been applied to study the transcriptional activity of individual genes. These basic studies should help us to learn more about the regulation of PSG gene expression, and pave the way for functional analyses of this important group of pregnancy-specific glycoproteins. MATERIALS AND METHODS In situ hybridization: Preparation of chromosomes and in situ hybridizations were carried out as described previously (27) using a 1026bp EcoRI/SstI restriction endonuclease fragment from XhsCGM3-1 (10) which contains the N-terminal domain exon, as a probe. After 3 weeks exposure at 4”C, the chromosomes were RBG-banded by the method of Perry and Wolff (29). Isolation of high molecular weight genomic DNA and pulsed field gel electrophoresis analyses: High molecular weight DNA was isolated from an Epstein Barr virus-immortalized, human lymphoblast cell line, L1164 (gift from G. Scherer, Institute of Human Genetics, Freiburg University, FRG) in agarose blocks according to the European Molecular Biology Laboratory (EMBL, Heidelberg, FRG) protocol. Pulsed field gel electrophore- sis of large restriction endonuclease fragments was carried out on a CHEF-type model (EMBL, Heidelberg, FRG), at 4 V/cm and a pulse time of 90s in a 0.8% agarose gel for 43h at 15°C as described by the manu- facturers, and the DNA was transferred to a charged nylon membrane (GeneScreen-Plus, DuPont, Bad Homburg, FRG) according to the manufacturer’s protocol. The membrane was hybridized with a probe con- taining the total coding region minus the 3’untranslated portion of the PSGla cDNA clone described else- where (11). The hybridization was carried out overnight at 42°C in 40% deionized formamide, 1M NaCl, 10% dextran sulphate, 1% SDS, lOO/.rg/ml denatured salmon sperm DNA. Final washes were performed at 62°C in 0.1x SSPE (lx SSPE: 180mM NaCl, 1OmM NaH,PO,, 1mM EDTA pH 7.4), 0.1% SDS. Bacterial strains, human genomic libraries and cloning vectors: All work with recombinant DNA was carried out according to the German and Swiss safety regulations. A human leucocyte genomic library in XEMBL3 (HL1006; Clontech, Palo Alto, USA) was amplified in E. coli 803. A human cosmid genomic library (gift from W. Lindenmaier, Gesellschaft filr Biotechnologische Forschung, Braunschweig, FRG), inserted in the vector pHC79-2cos/TK, was amplified in the ret A- E. coli strain ED8767. For subcloning of the insert DNA frag- ments, either Bluescript phagemid (Stratagene, San Diego, USA) was used in E. coli strains JM109 and RRlbMlS, or M13mp18/19 phage, which was amplified in E. coli strain JM107. Screening of the human genomic libraries: Various DNA fragments were radiolabelled (28), and used to screen the human genomic libraries (30). For the lambda library, recombinant bacteriophages were amplified and transferred to nitrocellulose filters (Schleicher and Schuell, Dassel, FRG) as described (31). Screening and plaque purification was carried out by using the radioactively-labelled cDNA insert of pSP,-i (8). Hybridization was carried out at 65°C in a solution containing 5x Denhardt’s, SOC(g/ml denatured salmon sperm DNA, 0.05% SDS and 6x SSC (lx SSC = 0.15M NaCl, 0.017M Na-citrate pH 7.0). Final washes were performed at 65°C using 0.1x SSC. For the cosmid library, the original screening was carried out using a 1.4kb EcoRI restriction endonuclease fragment, covering the 3’untranslated region of the NCA cDNA clone 9 (32). Colony hybridiz- ation on nitrocellulose filters (30) was used to identify the cosmid clones. Pre-hybridization was carried out at 42°C in 40% deionized formamide, 6x SSPE, Ix Denhardt’s, 0.5% SDS, lOO~g/ml denatured salmon sperm DNA for 2h. Hybridization was under the same conditions but in the absence of SDS. Final washes were performed at 65°C in 2x SSPE, 0.5% SDS. 849 Vol. 167, No. 2, 1990 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS Restriction endonuclease mapping: Lambda clones were mapped by restriction endonuclease digests aided by hybridization with the pSP,-i cDNA insert (8). Detailed mapping of clone XPSG6/7-1 was carried out using DNA fragments subcloned in Bluescript plasmids. The cosmid clones were mapped by linearizing with the restriction endonucleases, PvuI or NheI, which cut in the vector at a short distance to the left and right of the cloning site, respectively. The resulting fragments were then partially digested with different restriction endonucleases (EcoRI, SstI and BamHI), separated by gel electrophoresis in 0.5% agarose overnight at 1 V/cm (4°C) and transferred to charged nylon membranes prior to hybridization with oligonucleotide probes whose complementary sequences are located in the vector between the PvuI site (oligo cosl), or the NheI site (oligo cos2) and the cloning site. The oligonucleotides were as follows: oligo cosl 5’ TAGGCGTATCACGAGGCCCCG 3 oligo cos2 5’ GGCGATGCTGTCGGAATGGACG 3 Hybridization was carried out in 30% deionized formamide, 1M NaCl, 1% SDS, 10% dextran sulphate, lOO~g/ml denatured salmon sperm DNA at 10-1X below the theoretical melting temperature (33). Final washes were carried out in 2x SSPE, 0.5% SDS at 3-5°C below the theoretical melting temperatures. Size determination of the fragments hybridizing
Load more

Recommended publications
  • Supplementary Information
    doi: 10.1038/nature08795 SUPPLEMENTARY INFORMATION Supplementary Discussion Population naming In some contexts, the indigenous hunter-gatherer and pastoralist peoples of southern Africa are referred to collectively as the Khoisan (Khoi-San) or more recently Khoesan (Khoe-San) people. This grouping is based on the unique linguistic use of click-consonants1. Many names, often country-specific, have been used by Bantu pastoralists and European settlers to describe the hunter-gatherers, including San, Saan, Sonqua, Soaqua, Souqua, Sanqua, Kwankhala, Basarwa, Batwa, Abathwa, Baroa, Bushmen, Bossiesmans, Bosjemans, or Bosquimanos. In addition, group-specific names such as !Kung and Khwe are often used for the broader population. The two most commonly used names, “San” and “Bushmen”, have both been associated with much controversy due to derogatory connotations2. “San” has become the more popular term used in Western literature, although “Bushmen” is arguably the more commonly recognized term within the communities. Since they have no collective name for themselves, the term Bushmen was selected for use in this paper as the term most familiar to the participants themselves. Regarding identification of individuals The five men identified in this study have all elected to have their identity made public knowledge. Thus we present two complete personal genomes (KB1 and ABT), a low-coverage personal genome (NB1), and personal exomes for all five men. On a scientific level, identification allows for current and future correlation of genetic data with demographic and medical histories. On a social level, identification allows for maximizing community benefit. For !Gubi, G/aq’o, D#kgao and !Aî, their name represents not only themselves, but importantly their extended family unit and a way of life severely under threat.
    [Show full text]
  • Androgen Receptor Expression Predicts Breast Cancer Survival: The
    Peters et al. BMC Cancer 2012, 12:132 http://www.biomedcentral.com/1471-2407/12/132 RESEARCHARTICLE Open Access Androgen receptor expression predicts breast cancer survival: the role of genetic and epigenetic events Kate M Peters1, Stacey L Edwards1, Shalima S Nair2, Juliet D French1, Peter J Bailey1, Kathryn Salkield1, Sandra Stein3, Sarah Wagner3, Glenn D Francis3, Susan J Clark2 and Melissa A Brown1* Abstract Background: Breast cancer outcome, including response to therapy, risk of metastasis and survival, is difficult to predict using currently available methods, highlighting the urgent need for more informative biomarkers. Androgen receptor (AR) has been implicated in breast carcinogenesis however its potential to be an informative biomarker has yet to be fully explored. In this study, AR protein levels were determined in a cohort of 73 Grade III invasive breast ductal adenocarcinomas. Methods: The levels of Androgen receptor protein in a cohort of breast tumour samples was determined by immunohistochemistry and the results were compared with clinical characteristics, including survival. The role of defects in the regulation of Androgen receptor gene expression were examined by mutation and methylation screening of the 5’ end of the gene, reporter assays of the 5’ and 3’ end of the AR gene, and searching for miRNAs that may regulate AR gene expression. Results: AR was expressed in 56% of tumours and expression was significantly inversely associated with 10-year survival (P = 0.004). An investigation into the mechanisms responsible for the loss of AR expression revealed that hypermethylation of the AR promoter is associated with loss of AR expression in breast cancer cells but not in primary breast tumours.
    [Show full text]
  • Pnas.201413825SI.Pdf
    Supporting Information Impens et al. 10.1073/pnas.1413825111 13 15 13 15 SI Methods beling) (Silantes Gmbh), or C6 N2 L-lysine HCl and C6 N4 L- Plasmids. pSG5-His6-SUMO1 plasmid encodes the N-terminal arginine HCl (heavy labeling) (Silantes Gmbh). L-Lysine HCl was His6-tagged mature Small ubiquitin modifier 1 (SUMO1) isoform added at its normal concentration in DMEM (146 mg/L), but the (kind gift of A. Dejean, Institut Pasteur, Paris). The pSG5-His6- concentration of L-arginine HCl was reduced to 25 mg/L (30% of SUMO1 T95R mutat was derived from this plasmid using PCR the normal concentration in DMEM) to prevent metabolic con- mutagenesis. pSG5-His6-SUMO2 was obtained by inserting the version of arginine to proline (4). Cells were kept for at least six cDNA corresponding to the human mature SUMO2 isoform population doublings to ensure complete incorporation of the la- with an N-terminal His6 tag in the pSG5 vector (Stratagene). beled lysine and arginine. 2 The pSG5-His6-SUMO2 T91R mutant was derived from this For transfections, cells were seeded in 75-cm flasks or in 6- or plasmid by PCR mutagenesis. N-terminally HA-tagged human 24-well plates at a density of 2.7 × 106 cells per flask or 3 × 105 or cDNA of ZBTB20 (Zinc finger and BTB domain containing 0.5 × 105 cells per well, respectively. The next day cells were 20) isoform 2 (UniProt identifier Q9HC78-2), HMBOX1 (Ho- transfected with Lipofectamine LTX reagents (Invitrogen) (20 μg meobox containing protein 1) isoform 1 (HMBOX1A) (UniProt of DNA per flask, 3.5 μg per well in the six-well plates, or 0.75 μg identifier Q6NT76-1), NACC1 (Nucleus accumbens-associated per well in the 24-well plates) for 48 h.
    [Show full text]
  • Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2
    Supplementary Table 3 Complete list of RNA-Sequencing analysis of gene expression changed by ≥ tenfold between xenograft and cells cultured in 10%O2 Expr Log2 Ratio Symbol Entrez Gene Name (culture/xenograft) -7.182 PGM5 phosphoglucomutase 5 -6.883 GPBAR1 G protein-coupled bile acid receptor 1 -6.683 CPVL carboxypeptidase, vitellogenic like -6.398 MTMR9LP myotubularin related protein 9-like, pseudogene -6.131 SCN7A sodium voltage-gated channel alpha subunit 7 -6.115 POPDC2 popeye domain containing 2 -6.014 LGI1 leucine rich glioma inactivated 1 -5.86 SCN1A sodium voltage-gated channel alpha subunit 1 -5.713 C6 complement C6 -5.365 ANGPTL1 angiopoietin like 1 -5.327 TNN tenascin N -5.228 DHRS2 dehydrogenase/reductase 2 leucine rich repeat and fibronectin type III domain -5.115 LRFN2 containing 2 -5.076 FOXO6 forkhead box O6 -5.035 ETNPPL ethanolamine-phosphate phospho-lyase -4.993 MYO15A myosin XVA -4.972 IGF1 insulin like growth factor 1 -4.956 DLG2 discs large MAGUK scaffold protein 2 -4.86 SCML4 sex comb on midleg like 4 (Drosophila) Src homology 2 domain containing transforming -4.816 SHD protein D -4.764 PLP1 proteolipid protein 1 -4.764 TSPAN32 tetraspanin 32 -4.713 N4BP3 NEDD4 binding protein 3 -4.705 MYOC myocilin -4.646 CLEC3B C-type lectin domain family 3 member B -4.646 C7 complement C7 -4.62 TGM2 transglutaminase 2 -4.562 COL9A1 collagen type IX alpha 1 chain -4.55 SOSTDC1 sclerostin domain containing 1 -4.55 OGN osteoglycin -4.505 DAPL1 death associated protein like 1 -4.491 C10orf105 chromosome 10 open reading frame 105 -4.491
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • The Role of Pregnancy-Specific Glycoproteins on Trophoblast Motility in Three-Dimensional Gelatin Hydrogels
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.25.314195; this version posted September 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The role of pregnancy-specific glycoproteins on trophoblast motility in three-dimensional gelatin hydrogels Samantha G. Zambuto1, Shemona Rattila2, Gabriela Dveksler2, Brendan A.C. Harley3,4,* 1 Dept. of Bioengineering University of Illinois at Urbana-Champaign Urbana, IL, USA 61801 2 Dept. of Pathology UniformeD Services University of Health Sciences BethesDa, MD, USA 20814 3 Dept. Chemical anD Biomolecular Engineering 4 Carl R. Woese Institute for Genomic Biology University of Illinois at Urbana-Champaign Urbana, IL, USA 61801 *Correspondence: B.A.C. Harley Dept. of Chemical anD Biomolecular Engineering Carl R. Woese Institute for Genomic Biology University of Illinois at Urbana-Champaign 110 Roger Adams Laboratory 600 S. Mathews Ave. Urbana, IL 61801 Phone: (217) 244-7112 Fax: (217) 333-5052 e-mail: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.09.25.314195; this version posted September 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SUMMARY Trophoblast invasion is a complex biological process necessary for establishment of pregnancy; however, much remains unknown regarding what signaling factors coordinate the extent of invasion. Pregnancy-specific glycoproteins (PSGs) are some of the most abundant circulating trophoblastic proteins in maternal blooD during human pregnancy, with maternal serum concentrations rising to as high as 200-400 μg/mL at term.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2004/0023207 A1 Polansky (43) Pub
    US 20040023207A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2004/0023207 A1 Polansky (43) Pub. Date: Feb. 5, 2004 (54) ASSAYS FOR DRUG DISCOVERY BASED ON Publication Classification MICROCOMPETITION WITH A FOREIGN POLYNUCLEOTIDE (51) Int. Cl." .............................. C12O 1/70; C12O 1/68; C12N 15/85; C12N 15/86 (52) U.S. Cl. .................. 435/5; 435/6; 435/455; 435/456 (76) Inventor: Hanan Polansky, Rochester, NY (US) (57) ABSTRACT Correspondence Address: A recent discovery showed that microcompetition between a Hanan Polansky foreign polynucleotide and a cellular polynucleotide is a risk 3159 S. Winton Rd. factor for Some of the major chronic diseases. The invention Rochester, NY 14623 (US) uses this novel discovery to present assays for Screening compounds based on their effectiveness in modulating Such microcompetition. The effective compounds can be used in (21) Appl. No.: 10/211,295 treatment of these chronic diseases. The invention also presents assays for Screening compounds that can be used in treatment of chronic diseaseS resulting from other foreign (22) Filed: Aug. 1, 2002 polynucleotide-type disruptions. Patent Application Publication Feb. 5, 2004 Sheet 1 of 6 US 2004/0023207 A1 s e 2 9 s H c 2 4 competitor plasmid/test plasmid Figure 1 1 O 09% 1 2 3 4 competitor plasmid/test plasmid -H Ltk- (pSV2Neo) -A-ML (pSV2neo) . A- - - Ltk- (pA1 Oneo) - - - - - - Mill (pA1 Oneo) Figure 2 Patent Application Publication Feb. 5, 2004 Sheet 2 of 6 US 2004/0023207 A1 e 2 r U H c O s S 2 3. Molar ratio (pSV2NeolhMT-ilA-CAT) Figure 3 Patent Application Publication Feb.
    [Show full text]
  • Fabbri Et Al. Whole Genome Analysis and Micrornas Regulation in Hepg2 Cells Exposed to Cadmium Supplementary Data
    Fabbri et al. Whole Genome Analysis and MicroRNAs Regulation in HepG2 Cells Exposed to Cadmium Supplementary Data Tab. S1: KEGG enrichment for downregulated genes Genes identified in Figure 1 were analyzed by DAVID for associations with particular KEGG pathways. KEGG Entry is KEGG identifier, Name is name of the KEGG pathway, Genes shows the number of genes associated with the specific pathway, the PValue refers to how significant an association a particular KEGG pathway has with the gene list. KEGG Entry Name Genes PValue hsa04610 Complement and coagulation cascades 22 1.11E-14 hsa00260 Glycine, serine and threonine metabolism 11 8.50E-08 hsa00071 Fatty acid metabolism 11 9.41E-07 hsa00650 Butanoate metabolism 9 1.89E-05 hsa00100 Steroid biosynthesis 7 2.09E-05 hsa00280 Valine, leucine and isoleucine degradation 10 2.47E-05 hsa00380 Tryptophan metabolism 9 8.40E-05 hsa00330 Arginine and proline metabolism 10 1.16E-04 hsa00900 Terpenoid backbone biosynthesis 6 1.46E-04 hsa00980 Metabolism of xenobiotics by cytochrome P450 10 2.71E-04 hsa00010 Glycolysis / Gluconeogenesis 10 2.71E-04 hsa00982 Drug metabolism 10 3.98E-04 hsa03320 PPAR signaling pathway 10 7.98E-04 hsa00620 Pyruvate metabolism 7 0.003185725 hsa00561 Glycerolipid metabolism 7 0.005184764 hsa00640 Propanoate metabolism 6 0.005876295 hsa00910 Nitrogen metabolism 5 0.009266837 hsa00480 Glutathione metabolism 7 0.009722623 hsa04950 Maturity onset diabetes of the young 5 0.012498995 hsa00903 Limonene and pinene degradation 4 0.013441968 hsa00680 Methane metabolism 3 0.018538005 hsa00120 Primary bile acid biosynthesis 4 0.01958794 hsa00340 Histidine metabolism 5 0.020928876 hsa00310 Lysine degradation 6 0.022199526 hsa00250 Alanine, aspartate and glutamate metabolism 5 0.026189764 hsa00410 beta-Alanine metabolism 4 0.04583419 hsa01040 Biosynthesis of unsaturated fatty acids 4 0.04583419 ALTEX, 2/12 SUPPL., 1 FABBRI ET AL .
    [Show full text]
  • Human PSG6 / PSG10 Protein (His Tag)
    Human PSG6 / PSG10 Protein (His Tag) Catalog Number: 13808-H08B General Information SDS-PAGE: Gene Name Synonym: CGM3; PSBG-10; PSBG-12; PSBG-6; PSG10; PSG12; PSG6; PSGGB Protein Construction: A DNA sequence encoding the human PSG6 (Met 1-His 424) (NP_001027020) was expressed, with a C-terminal polyhistidine tag. Source: Human Expression Host: Baculovirus-Insect Cells QC Testing Purity: > 87 % as determined by SDS-PAGE Endotoxin: Protein Description < 1.0 EU per μg of the protein as determined by the LAL method PSG6 is a pregnancy-specific glycoprotein(PSG). PSGs are secreted Stability: proteins which are produced by the rodent and primate placenta and play a critical role in pregnancy success. The levels of PSGs are highest during Samples are stable for up to twelve months from date of receipt at -70 ℃ the third trimester of pregnancy, a time marked by the most profound suppression of MS disease attacks. PSGs regulate T-cell function. The Predicted N terminal: Gln 35 regulation of T-cell function during pregnancy is likely the result of Molecular Mass: significant hormonal changes and may well involve immunoregulatory proteins derived from the placenta. Pregnancy specific glycoproteins The secreted recombinant human PSG6 consists of 400 amino acids and (PSGs) are the most abundant placentally derived glycoproteins in the predicts a molecular mass of 45.2 KDa. The apparent molecular mass of maternal serum. PSG1, PSG6, PSG6N, and PSG11 induce dose- the protein is approximately 58 Kda in SDS-PAGE under reducing dependent secretion of anti-inflammatory cytokines by human monocytes. conditions due to glycosylation. Human and murine PSGs exhibit cross-species activity.
    [Show full text]
  • Receptor for Mouse Hepatitis Virus Is a Member of the Carcinoembryonic Antigen Family of Glycoproteins
    Proc. Natl. Acad. Sci. USA Vol. 88, pp. 5533-5536, July 1991 Medical Sciences Receptor for mouse hepatitis virus is a member of the carcinoembryonic antigen family of glycoproteins (coronavirus/immunoglobulin superfamily/host resistance to virus/virus tissue tropism/virus receptor) RICHARD K. WILLIAMS, GUI-SEN JIANG, AND KATHRYN V. HOLMES* Department of Pathology, Uniformed Services University of the Health Sciences, 4301 Jones Bridge Road, Bethesda, MD 20814 Communicated by Dorothy M. Horstmann, April 1, 1991 (receivedfor review February 28, 1991) ABSTRACT The receptor for mouse hepatitis virus binds neither MHV-A59 virus nor anti-receptor mAb CC1, (MHV), a murine coronavirus, is a 110- to 120-kDa glycopro- we postulated that it has a mutation affecting the domain of tein on intestinal brush border membranes and hepatocyte the glycoprotein that normally would bind MHV and mAb membranes. The N-terminal 25-amino acid sequence of immu- CC1 (4). In this communication we demonstrate that the noaffinity-purified MHV receptor was identical to the pre- MHV receptor glycoprotein of BALB/c and Swiss Webster dicted mature N termini of two mouse genes related to human mice and its SJL/J homolog are members of the carcinoem- carcinoembryonic antigen (CEA) and was strongly homologous bryonic antigen (CEA) family of glycoproteins in the immu- to the N termini of members of the CEA family in humans and noglobulin superfamily. rats. Polyclonal antibodies to human CEA recognized the immunoaffinity-purified MHV receptor and the MHV receptor in liver membranes and intestinal brush border membranes MATERIALS AND METHODS from MHV-susceptible mouse strains. In membranes from Tissue Preparations and Tissue-Binding Assay.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]