DOCSLIB.ORG

Oreochromis Niloticus) Associated with Bacterial Infections Hadeer Youssuf, Eman A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Oreochromis Niloticus) Associated with Bacterial Infections Hadeer Youssuf, Eman A Benha Veterinary Medical Journal 39 (2020) 111-118 Benha Veterinary Medical Journal Official Journal Issued by Journal homepage: https://bvmj.journals.ekb.eg/ Faculty of Veterinary Medicine Since 1990 Original Paper Insight into summer mortalities syndrome in farmed Nile tilapia (Oreochromis niloticus) associated with bacterial infections Hadeer Youssuf, Eman A. Abdel Gawad, Amel M. El Asely*, Hiam Elabd, Aya F. Matter, Adel A. Shaheen, Amany A. Abbass** Department of Aquatic Animals Diseases and Management, Faculty of Veterinary Medicine, Benha University, Egypt ARTICLE INFO ABSTRACT Keywords The current investigation was undertaken to determine the potential causes of summer mass mortalities among farmed Nile tilapia (Oreochromis niloticus). Pure bacterial colonies were Bacterial infection. isolated from moribund O. niloticus from 13 different fish farms suffered from high mortalities Gene sequencing ranged from (50-80%), during the period from April to October 2018. Fish showed external Mass mortalities hemorrhagic spots, skin darkening, abdominal distension and exophthalmia. Internally, congestion and enlargement of internal organs with serous or hemorrhagic fluid was the most O. Niloticus obvious picture. The phenotypic and biochemical characterization using API20E identified the bacterial isolates as (A. veronii, A. hydrophila, A. caviae and A. sobria; Aeromonads), (Ps. Received 27/08/2020 Fluorescence; Pseudomonas spp), (E. sakazakii and E. cloacae; Enterobacter spp), (C. Accepted 14/09/2020 freundii; Citrobacter spp), (S. odorifera, S. liquefaciens, and S. marcescens; Serratia spp), (S. Available On-Line lutiensis, S. equine; Streptococcus spp), Lactococcus lactis and Proteus vulgaris, with the most 01/10/2020 prevalence to aeromonads. Most isolates were accurately identified by PCR and gene sequencing. Water physicochemical parameters were measured at the farm sites showed an increase in the pH and ammonia levels. In order to confirm the pathogenicity of the bacterial isolates, an experimental infection was conducted using different doses. The results revealed that A. veronii (HY2) at dose of 9×108 cells/ml was the most pathogenic with mortality rate 100 %. This study concludes that A. veronii, C. freundii, P. vulgaris and P. fluorescens are implicated in Nile tilapia summer mortalities, without neglecting the role of water quality in worsening the problem. 1. INTRODUCTION sores, exophthalmia, erythro-dermatitis and erected scale (Austin and Austin, 2007; Baumgartner et al., 2017; Matter Globally, estimated aquaculture disease losses reached 3 et al., 2018). Postmortem lesions associated with bacterial billion USD (Tan et al., 2006). The major constraint of infection were listed by Abdel-Latif and Sedeek (2017) as tilapia production in Egypt during the last five years could noticeable focal hemorrhages and areas of necrosis in the be summer mass mortalities, precisely the bacterial liver and congestion in gills and spleen. In contrast to pathogens that have been incriminated as the most important distinguishing phenotypic proof, 16S rDNA sequencing common cause (Algammal et al., 2020). gives specific detailed information even to uncommon Tilapia under stress conditions is susceptible to a wide range isolates (Hossain, 2008). of pathogenic bacteria (Shaheen 2013; Eissa et al., 2015). This work aimed to characterize bacterial pathogens isolated Outbreaks of bacterial diseases cause severe economic from diseased Nile tilapia, determine their prevalence and losses to fish farms due to high mortalities, especially during molecular identification, concerning the role of water quality the summer period (Elsheshtawy et al., 2019). The capability in disease severity and pathogenicity of some retrieved of a bacterial infection to cause mass mortality in fish is a bacterial isolates. multi-factorial condition, and variable elements identified with the host, environment, and the microbe may work in 2. MATERIAL AND METHODS show to characterize the course of the disease (Harvell et al., 1999). Also, environmental-related factors e.g. oxygen 2.1. Naturally infected fish samples level, temperature, salinity and pH may be engaged in A total of 120 clinically diseased Nile tilapia (Oreochromis triggering disease outbreaks, particularly in intensive niloticus) with an average weight ranged from 30 ±10 to 200 aquaculture systems (Eissa et al., 2013). Fish suffering from ±50 g, were collected at the period from April to October bacterial infection show comparable clinical signs range 2018 from 13 different fish. These farms suffered from mass from stop eating, swim slowly and aimlessly near the mortalities ranged from 50-80%. Freshly dead and moribund surface, in addition to different pathologic conditions e.g. fish were packed in an ice box and transported to the dermal ulceration, tail rot, hemorrhagic fins and skin, red laboratory of Aquatic Animal Diseases and Management, * Corresponding author: * [email protected]; ** [email protected] 111 Youssuf et al. (2020) BVMJ 39 (2): 111-118 Faculty of Veterinary Medicine, Moshtohor, Benha sampling bottles (1.5-liter capacity) were immersed about 50 University, as quickly as possible, where clinical and cm below the water surface, and 500 mL of water were taken bacteriological examinations were carried out as described at each sampling site. Measuring of water parameters by Austin and Austin (2007). including pH (pH meter, HANNA), dissolved oxygen and water temperature (DO/Temp Meter (PDO-408) and 2.2. Bacteriological examination ammonia (ammonia checker, HANNA) were carried out A loopful from gills, liver, kidneys, and spleen of the immediately in all water samples. The remaining of the clinically diseased fish were inoculated into Tryptic soy samples was transported to the laboratory in an icebox and broth (TSB, Oxoid, UK) then streaked over Tryptic soy agar prepared for analysis of heavy metals. (TSA, Oxoid, UK), incubated for 24 hrs at 28 °C (Austin and Austin, 2007). 2.5. Determination of heavy metals Phenotypic identification (motility, Gram staining and The collected water samples were analyzed for the morphology) of the most dominant colonies in the determination of cadmium, lead, copper, iron, and zinc subculture was determined as described by Quinn et al. levels according to APHA (1995). All measurements were (2002) and Panangala et al. (2007). carried out according to the international standards. Pure colonies were sub-cultured on Rimler-Shotts (RS, Oxoid, UK) medium, Thiosulphate citrate bile salt sucrose 2.6. Pathogenicity of the retrieved bacterial isolates agar (TCBS, Oxoid, UK ), Pseudomonas Cetrimide agar 2.6.1. The experimental condition base medium supplemented with CFC (Cetrimide, Fucidin, A total number of 250 apparently healthy Nile tilapia with and Cephaloridine supplement and 1.5% (w/v) NaCl), an average body weight of 20 ± 5 g were transported alive MacConkey agar (Oxoid, UK) (for detection the from a fish farm at Kafr El-Sheik to the wet laboratory of fermentation activity) and Bile esculin Azide agar (Techno Aquatic Animal Diseases and Management, Faculty of Pharmchem. Company) and incubated at 25 °C for 18-48 Veterinary Medicine, Benha University. Fish were kept in hrs. Pure colonies were stored at -80 °C in TSB containing well-prepared fiberglass tanks (750 L capacity) for two 20% glycerol for further studies following Hollander (1954). weeks to be acclimated for laboratory conditions. Each tank All isolates were identified biochemically by streaking was supplied with an air pump and dechlorinated tap water. bacterial colonies over TSA and incubated at 28 °C for 24 The water parameters were adjusted as following; water hrs then identified at the genus level using API20E strips, temperature 26±2 °C, dissolved oxygen 6.0±0.5 mg/L, according to Buller (2004). ammonia concentration 0.53±0.07 mg/L, and pH 7.0±0.2. Fish were fed with a 4% body weight basal diet (30% 2.3. Molecular identification of bacterial isolates protein) twice daily. Random samples of fish were sacrificed Bacterial colonies’ DNA was extracted using a bacterial and examined for parasites, mycotic, and bacterial pathogens genomic DNA extraction kit (QIAamp DNA mini kit, as described by Austin and Austin (2007) to ensure their Catalogue no. 51304, USA) following the manufacturer’s normal healthy status. Fish were then distributed in well- instructions. prepared glass aquaria (100 × 100 × 50 cm) for experimental PCR assay targeting the 16S rRNA gene was carried out to laboratory studies. Each aquarium was supplied with air confirm the bacterial isolates using universal primers pumps for continuous aeration (Sicalls, Pietes, Italy) and (Lagacé et al., 2004) dechlorinated tap water. 16S-F (5′- AGAGTTTGATCTGGCTCAG-3′) 2.6.2. Preparation of the isolates 16S-R (5′ TACGGTACCTTGTTACGACTT -3′) The identified isolates, including five strains of Aeromonas in a DNA thermal cycler (T3 Thermal cycler, Biometra). veronii (A. veronii) (A/HY1, A/HY2, A/HY3), A/HY4) and Reactions were performed in a final volume of 25 μl, and A/HY6), Citrobacter freundii, Pseudomonas fluorescence, conditions were as follows: 94 °C for 15 min, 35cycles at 94 and Proteus vulgaris were chosen, since they were the most °C for 30 sec, 56 °C for 1 min, 72 °C for 1 min, followed by prevalent isolated species. The preserved isolates at -80 °C a final elongation at 72 °C for 10 min. The PCR products (20 were inoculated into TSB media and incubated at 28 °C for μl) were analyzed by electrophoresis on 1.5% agarose gels, 24 hrs.
Load more

Recommended publications
  • Enterobacter Massiliensis Sp. Nov
    Standards in Genomic Sciences (2013) 7:399-412 DOI:10.4056/sigs.3396830 Non contiguous-finished genome sequence and descrip- tion of Enterobacter massiliensis sp. nov. Jean-Christophe Lagier1, Khalid El Karkouri1, Ajay Kumar Mishra1, Catherine Robert1, Didier Raoult1 and Pierre-Edouard Fournier1* 1Aix-Marseille Université, Faculté de médecine, Marseille, France *Corresponding author: Pierre-Edouard Fournier ([email protected]) Keywords: Enterobacter massiliensis, genome Enterobacter massiliensis strain JC163T sp. nov. is the type strain of E. massiliensis sp. nov., a new species within the genus Enterobacter. This strain, whose genome is described here, was isolated from the fecal flora of a healthy Senegalese patient. E. massiliensis is an aerobic rod. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,922,247 bp long genome (1 chromosome but no plasmid) exhibits a G+C content of 55.1% and contains 4,644 protein-coding and 80 RNA genes, including 5 rRNA genes. Introduction Enterobacter massiliensis strain JC163T (= CSUR Enterobacter spp. were isolated from the normal P161 = DSM 26120) is the type strain of E. fecal flora. massiliensis sp. nov. This bacterium is a Gram- negative, aerobic, flagellate, indole-positive bacil- Classification and features lus that was isolated from the feces of a healthy A stool sample was collected from a healthy 16- Senegalese patient in a study aiming at cultivating year-old male Senegalese volunteer patient living all bacterial species in human feces [1]. The cur- in Dielmo (rural village in the Guinean-Sudanian rent classification of prokaryotes, known as zone in Senegal), who was included in a research polyphasic taxonomy, relies on a combination of protocol.
    [Show full text]
  • Description of Gabonibacter Massiliensis Gen. Nov., Sp. Nov., a New Member of the Family Porphyromonadaceae Isolated from the Human Gut Microbiota
    Curr Microbiol DOI 10.1007/s00284-016-1137-2 Description of Gabonibacter massiliensis gen. nov., sp. nov., a New Member of the Family Porphyromonadaceae Isolated from the Human Gut Microbiota 1,2 1 3,4 Gae¨l Mourembou • Jaishriram Rathored • Jean Bernard Lekana-Douki • 5 1 1 Ange´lique Ndjoyi-Mbiguino • Saber Khelaifia • Catherine Robert • 1 1,6 1 Nicholas Armstrong • Didier Raoult • Pierre-Edouard Fournier Received: 9 June 2016 / Accepted: 8 September 2016 Ó Springer Science+Business Media New York 2016 Abstract The identification of human-associated bacteria Gabonibacter gen. nov. and the new species G. mas- is very important to control infectious diseases. In recent siliensis gen. nov., sp. nov. years, we diversified culture conditions in a strategy named culturomics, and isolated more than 100 new bacterial Keywords Gabonibacter massiliensis Á Taxonogenomics Á species and/or genera. Using this strategy, strain GM7, a Culturomics Á Gabon Á Gut microbiota strictly anaerobic gram-negative bacterium was recently isolated from a stool specimen of a healthy Gabonese Abbreviations patient. It is a motile coccobacillus without catalase and CSUR Collection de Souches de l’Unite´ des oxidase activities. The genome of Gabonibacter mas- Rickettsies siliensis is 3,397,022 bp long with 2880 ORFs and a G?C DSM Deutsche Sammlung von content of 42.09 %. Of the predicted genes, 2,819 are Mikroorganismen protein-coding genes, and 61 are RNAs. Strain GM7 differs MALDI-TOF Matrix-assisted laser desorption/ from the closest genera within the family Porphyromon- MS ionization time-of-flight mass adaceae both genotypically and in shape and motility.
    [Show full text]
  • Diapositive 1
    29.04.2013 ESCMID-BERLIN «Culturomics» © by author ESCMID Online Lecture Library Didier Raoult Marseille - France [email protected] www.mediterranee-infection.com As samples in 2012 We received -220,000 samples for culture (bactéria, fungi, viruses) - 200,000 PCR were performed - 115,000 serological testing were tested © by author Real-time laboratory surveillance of sexually-transmissible infections in Marseille University hospitals reveals rise of gonorrhea, syphilis and HIV seroconversions in 2012. PhilippeESCMID Colson1,2 , Frédérique Online Gouriet1,2 Lecture , Sékéné Badiaga 2,3Library, Catherine Tamalet 1,2, Andreas Stein2,4, Didier Raoult1,2 *. Eurosurveillance 2013 2 Culture has been negleted in clinical microbiology, very few new media have been recently very few introduced but it is still central for: Causality Suceptibility testing Genome sequencing© by author ESCMID Online Lecture Library Pathophysiology 3 NEW IDENTIFICATIONS Helicobacter pylori • Peptic ulcer disease • Cancer of the stomach, grown in 1983 © by author ESCMIDSeen sinceOnline the Lecture 19th century Library 4 © by author ESCMID Online Lecture Library 5 PROGRESSES MADE IN MICROBIOLOGY FROM 1979 TO 2012 THANKS TO THE DEVELOPMENT OF NEW TECHNOLOGIES © by author a) the ESCMIDleft ordinate axis refers toOnline the cumulative numbers Lecture of bacterial species Library with validly published names (green curve); the right ordinate axis refers to the cumulative numbers of sequenced bacterial genomes (purple) and sequenced viral genomes (blue); 6 © by author b) the left ordinate axis refers to the numbers of articles containing “metagenome” as keyword (red) and of articles containing “microbiota” as keyword (grey); the right ordinate axisESCMID refers to the numbers Online of articles containing Lecture “MALDI-TOF” andLibrary “clinical microbiology” as keywords (orange).
    [Show full text]
  • Data of Read Analyses for All 20 Fecal Samples of the Egyptian Mongoose
    Supplementary Table S1 – Data of read analyses for all 20 fecal samples of the Egyptian mongoose Number of Good's No-target Chimeric reads ID at ID Total reads Low-quality amplicons Min length Average length Max length Valid reads coverage of amplicons amplicons the species library (%) level 383 2083 33 0 281 1302 1407.0 1442 1769 1722 99.72 466 2373 50 1 212 1310 1409.2 1478 2110 1882 99.53 467 1856 53 3 187 1308 1404.2 1453 1613 1555 99.19 516 2397 36 0 147 1316 1412.2 1476 2214 2161 99.10 460 2657 297 0 246 1302 1416.4 1485 2114 1169 98.77 463 2023 34 0 189 1339 1411.4 1561 1800 1677 99.44 471 2290 41 0 359 1325 1430.1 1490 1890 1833 97.57 502 2565 31 0 227 1315 1411.4 1481 2307 2240 99.31 509 2664 62 0 325 1316 1414.5 1463 2277 2073 99.56 674 2130 34 0 197 1311 1436.3 1463 1899 1095 99.21 396 2246 38 0 106 1332 1407.0 1462 2102 1953 99.05 399 2317 45 1 47 1323 1420.0 1465 2224 2120 98.65 462 2349 47 0 394 1312 1417.5 1478 1908 1794 99.27 501 2246 22 0 253 1328 1442.9 1491 1971 1949 99.04 519 2062 51 0 297 1323 1414.5 1534 1714 1632 99.71 636 2402 35 0 100 1313 1409.7 1478 2267 2206 99.07 388 2454 78 1 78 1326 1406.6 1464 2297 1929 99.26 504 2312 29 0 284 1335 1409.3 1446 1999 1945 99.60 505 2702 45 0 48 1331 1415.2 1475 2609 2497 99.46 508 2380 30 1 210 1329 1436.5 1478 2139 2133 99.02 1 Supplementary Table S2 – PERMANOVA test results of the microbial community of Egyptian mongoose comparison between female and male and between non-adult and adult.
    [Show full text]
  • Genome Sequence of Kurthia Type Species Kurthia Zopfii Strain ATCC 33403T
    University of New Hampshire University of New Hampshire Scholars' Repository Life Sciences Faculty Scholarship Life Sciences 7-12-2018 Genome Sequence of Kurthia Type Species Kurthia zopfii Strain ATCC 33403T Abigail E. Goen University of New Hampshire, Manchester Kyle S. MacLea University of New Hampshire, Manchester, [email protected] Follow this and additional works at: https://scholars.unh.edu/unhmbiology_facpub Recommended Citation Goen AE, MacLea KS. 2018. Genome sequence of Kurthia type species Kurthia zopfii strain ATCC 33403T. Microbiol Resour Announc 7:e00833-18. https://doi.org/10.1128/MRA.00833-18. This Article is brought to you for free and open access by the Life Sciences at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Life Sciences Faculty Scholarship by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. GENOME SEQUENCES crossm Genome Sequence of Kurthia Type Species Kurthia zopfii Strain ATCC 33403T Abigail E. Goen,a Kyle S. MacLeaa,b,c aBiology Program, University of New Hampshire, Manchester, New Hampshire, USA Downloaded from bBiotechnology Program, University of New Hampshire, Manchester, New Hampshire, USA cDepartment of Life Sciences, University of New Hampshire, Manchester, New Hampshire, USA ABSTRACT The genome of the type strain of the Kurthia genus, Kurthia zopfii ATCC 33403, was sequenced. Nonpathogenic K. zopfii has been isolated from intestinal contents, fecal material, meats, meat products, milk, water, and air, including air at high altitudes. The predicted genome size is 2,878,279 bp, with 37.05% GϩC con- tent. http://mra.asm.org haracteristically, the phylum Firmicutes consists of Gram-positive bacteria with low CGϩC content.
    [Show full text]
  • Genome Diversity of Spore-Forming Firmicutes MICHAEL Y
    Genome Diversity of Spore-Forming Firmicutes MICHAEL Y. GALPERIN National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD 20894 ABSTRACT Formation of heat-resistant endospores is a specific Vibrio subtilis (and also Vibrio bacillus), Ferdinand Cohn property of the members of the phylum Firmicutes (low-G+C assigned it to the genus Bacillus and family Bacillaceae, Gram-positive bacteria). It is found in representatives of four specifically noting the existence of heat-sensitive vegeta- different classes of Firmicutes, Bacilli, Clostridia, Erysipelotrichia, tive cells and heat-resistant endospores (see reference 1). and Negativicutes, which all encode similar sets of core sporulation fi proteins. Each of these classes also includes non-spore-forming Soon after that, Robert Koch identi ed Bacillus anthracis organisms that sometimes belong to the same genus or even as the causative agent of anthrax in cattle and the species as their spore-forming relatives. This chapter reviews the endospores as a means of the propagation of this orga- diversity of the members of phylum Firmicutes, its current taxon- nism among its hosts. In subsequent studies, the ability to omy, and the status of genome-sequencing projects for various form endospores, the specific purple staining by crystal subgroups within the phylum. It also discusses the evolution of the violet-iodine (Gram-positive staining, reflecting the pres- Firmicutes from their apparently spore-forming common ancestor ence of a thick peptidoglycan layer and the absence of and the independent loss of sporulation genes in several different lineages (staphylococci, streptococci, listeria, lactobacilli, an outer membrane), and the relatively low (typically ruminococci) in the course of their adaptation to the saprophytic less than 50%) molar fraction of guanine and cytosine lifestyle in a nutrient-rich environment.
    [Show full text]
  • Patent ( 10 ) Patent No
    US010363308B2 (12 ) United States Patent ( 10 ) Patent No. : US 10 , 363, 308 B2 Clube et al. ( 45 ) Date of Patent: * Jul. 30 , 2019 ( 54 ) SELECTIVELY ALTERING MICROBIOTA (58 ) Field of Classification Search FOR IMMUNE MODULATION CPC . .. A61K 39 /3955 ; A61K 39 /0011 ; A61K 31/ 7105 ; A61K 2039 /505 ; A61P 37 /00 ; A61P 35 /00 ; A61N 1 /360002 (71 ) Applicant: SNIPR Technologies Limited , London See application file for complete search history . (GB ) ( 56 ) References Cited (72 ) Inventors : Jasper Clube , London (GB ); Morten U . S . PATENT DOCUMENTS Sommer , Copenhagen Ø ( DK ) ; 4 ,626 , 504 A 12 / 1986 Puhler et al. Christian Grøndahl, Copenhagen Ø 5 ,633 , 154 A 5 / 1997 Schaefer et al. 8 , 241, 498 B2 8 / 2012 Summer et al . ( DK ) 8 , 252 , 576 B2 8 / 2012 Campbell et al. 8 , 906 ,682 B2 12 /2014 June et al. ( 73 ) Assignee : SNIPR Technologies Limited , London 8 , 911 , 993 B2 12 / 2014 June et al . 8 ,916 ,381 B1 12 /2014 June et al . (GB ) 8 ,975 ,071 B1 3 /2015 June et al . 9 , 101, 584 B2 8 / 2015 June et al . 9 , 102 ,760 B2 8 / 2015 June et al . ( * ) Notice : Subject to any disclaimer, the term of this 9 , 102 ,761 B2 8 / 2015 June et al. patent is extended or adjusted under 35 9 , 113 ,616 B2 8 / 2015 MacDonald et al. U . S . C . 154 ( b ) by 0 days. 9 , 328 , 156 B2 5 / 2016 June et al . 9 ,464 , 140 B2 10 /2016 June et al . 9 ,481 , 728 B2 11/ 2016 June et al.
    [Show full text]
  • Reorganising the Order Bacillales Through Phylogenomics
    Systematic and Applied Microbiology 42 (2019) 178–189 Contents lists available at ScienceDirect Systematic and Applied Microbiology jou rnal homepage: http://www.elsevier.com/locate/syapm Reorganising the order Bacillales through phylogenomics a,∗ b c Pieter De Maayer , Habibu Aliyu , Don A. Cowan a School of Molecular & Cell Biology, Faculty of Science, University of the Witwatersrand, South Africa b Technical Biology, Institute of Process Engineering in Life Sciences, Karlsruhe Institute of Technology, Germany c Centre for Microbial Ecology and Genomics, University of Pretoria, South Africa a r t i c l e i n f o a b s t r a c t Article history: Bacterial classification at higher taxonomic ranks such as the order and family levels is currently reliant Received 7 August 2018 on phylogenetic analysis of 16S rRNA and the presence of shared phenotypic characteristics. However, Received in revised form these may not be reflective of the true genotypic and phenotypic relationships of taxa. This is evident in 21 September 2018 the order Bacillales, members of which are defined as aerobic, spore-forming and rod-shaped bacteria. Accepted 18 October 2018 However, some taxa are anaerobic, asporogenic and coccoid. 16S rRNA gene phylogeny is also unable to elucidate the taxonomic positions of several families incertae sedis within this order. Whole genome- Keywords: based phylogenetic approaches may provide a more accurate means to resolve higher taxonomic levels. A Bacillales Lactobacillales suite of phylogenomic approaches were applied to re-evaluate the taxonomy of 80 representative taxa of Bacillaceae eight families (and six family incertae sedis taxa) within the order Bacillales.
    [Show full text]
  • Literature Review
    ABSTRACT DEVINE, ANTHONY ANDREW. Examining Complex Microbial Communities Using the Terminal Restriction Fragment Length Polymorphism Method and Dedicated TRFLP Analysis Software. (Under the direction of Amy Michele Grunden). The purpose of this research was to develop a robust methodology that could be used to determine the composition of complex microbial communities found in a variety of environments. In an effort to profile these communities, a 16S rDNA directed, sequencing independent method, Terminal Restriction Fragment Length Polymorphism (TRFLP) was used to generate fragment profiles from genomic DNA isolated from each sample. A custom designed software package, In Silico©, was then used to match these terminal restriction fragments in the sample to patterns of 16S rDNA fragments in a custom database of reference patterns. Identifying these patterns allowed for inferences to be made about the structure of the microbial populations in the environments sampled. TRFLP was chosen as the method of identification since it is a high throughput, cost effective method for community profiling. A combination of this method and the In Silico© software was used to examine microbial communities associated with open air swine waste lagoon systems, the large intestine of the Trichechus manatus latirostrus, Florida manatee, and the microbial populations found in rumen fed fermentors. The community analysis methodology we developed and employed was able to not only detect large and diverse microbial populations within each sample, but was also
    [Show full text]
  • Privatization of a Breeding Resource by the Burying Beetle Nicrophorus Vespilloides Is
    bioRxiv preprint doi: https://doi.org/10.1101/065326; this version posted July 22, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Privatization of a breeding resource by the burying beetle Nicrophorus vespilloides is 2 associated with shifts in bacterial communities 3 4 Ana Duarte1, Martin Welch2, Josef Wagner3 and Rebecca M. Kilner1 5 1Department of Zoology, University of Cambridge, Cambridge, CB2 3EJ, UK 6 2Department of Biochemistry, University of Cambridge, Cambridge, CB2 1QW, UK 7 3Pathogen Genetics Programme, Wellcome Trust Sanger Institute, Hinxton, CB10 1SA, UK 8 9 Corresponding author: 10 Ana Duarte 11 Department of Zoology, University of Cambridge, Cambridge, CB2 3EJ, UK 12 Phone: +44 (0) 1223 334466 13 Fax: +44 (0) 1223 336676 14 E-mail: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/065326; this version posted July 22, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 15 Abstract 16 It is still poorly understood how animal behaviour shapes bacterial communities and their evolution. 17 We use burying beetles, Nicrophorus vespilloides, to investigate how animal behaviour impacts the 18 assembly of bacterial communities. Burying beetles use small vertebrate carcasses as breeding 19 resources, which they roll into a ball, smear with antimicrobial exudates and bury.
    [Show full text]
  • Assessing Community Dynamics and Colonization Patterns Of
    University of Vermont ScholarWorks @ UVM Graduate College Dissertations and Theses Dissertations and Theses 2017 Assessing Community Dynamics and Colonization Patterns of Tritatoma dimidiata and Other Biotic Factors Associated with Chagas Disease Prevalence in Central America Lucia Consuelo Orantes University of Vermont Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Genetics and Genomics Commons, and the Public Health Commons Recommended Citation Orantes, Lucia Consuelo, "Assessing Community Dynamics and Colonization Patterns of Tritatoma dimidiata and Other Biotic Factors Associated with Chagas Disease Prevalence in Central America" (2017). Graduate College Dissertations and Theses. 769. https://scholarworks.uvm.edu/graddis/769 This Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected]. ASSESSING COMMUNITY DYNAMICS AND COLONIZATION PATTERNS OF TRIATOMA DIMIDIATA AND OTHER BIOTIC FACTORS ASSOCIATED WITH CHAGAS DISEASE PREVALENCE IN CENTRAL AMERICA A Dissertation Presented by Lucia C. Orantes to The Faculty of the Graduate College of The University of Vermont In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Specializing in Natural Resources October, 2017 Defense Date: April 19, 2017 Dissertation Examination Committee: Kimberly Wallin, Ph.D., Advisor Sara Helms Cahan Ph.D., Advisor Donna Rizzo, Ph.D., Chairperson Leslie Morrissey, Ph.D. Gillian Galford, Ph.D. Cynthia J. Forehand, Ph.D., Dean of the Graduate Colleg ABSTRACT Chagas disease is caused by the parasite Trypanosoma cruzi and transmitted by multiple triatomine vectors across the Americas.
    [Show full text]
  • Non-Contiguous Finished Genome Sequence and Description of Kurthia Senegalensis Sp
    Standards in Genomic Sciences (2014) 9:1319-1230 DOI: 10.4056/sigs.5078947 Non-contiguous finished genome sequence and description of Kurthia senegalensis sp. nov. Véronique Roux1*, Jean-Christophe Lagier1, Aurore Gorlas1, Catherine Robert 1 and Didier Raoult1. 1 Aix Marseille Université, URMITE, Faculté de médecine, Aix-Marseille Université, Marseille, France *Correspondence: Véronique Roux ([email protected]) Keywords: Kurthia senegalensis, Firmicutes, capsule, flagella, culturomics. Kurthia senegalensis strain JC8ET sp. nov. is the type strain of K. senegalensis sp. nov., a new species within the genus Kurthia. This strain, whose genome is described here, was isolated from the fecal flora of a healthy patient. K. senegalensis is an aerobic rod. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,975,103 bp long genome contains 2,889 protein-coding genes and 83 RNA genes, including between 4 and 6 rRNA genes. Abbreviations: EMBL- European Molecular Biology Laboratory, DDBJ- DNA Data Bank of Japan Introduction Kurthia senegalensis strain JC8ET (CSUR P138T = genome comparison have been proposed to DSM 24641T) is the type strain of K. senegalensis replace the DDH approach [5]. sp. nov. This bacterium is a Gram-positive strictly Here we present a summary classification and a set aerobic rod, capsulated, motile by peritrichous of features for K. senegalensis sp. nov. strain JC8ET flagella and was isolated from the stool of a healthy together with the description of the complete Senegalese patient as part of a "culturomics" study genomic sequencing and annotation. These aiming at cultivating individually all species within characteristics support the circumscription of the human feces [1].
    [Show full text]