Ursolic Acid Suppresses Hepatitis B Virus X Protein-Mediated

Total Page:16

File Type:pdf, Size:1020Kb

Load more

ANTICANCER RESEARCH 36 : 5097-5108 (2016) doi:10.21873/anticanres.11079 Ursolic Acid Suppresses Hepatitis B Virus X Protein-mediated Autophagy and Chemotherapeutic Drug Resistance CHING-DONG CHANG 1* , PING-YUAN LIN 2* , JUE-LIANG HSU 3 and WEN-LING SHIH 3 Departments of 1Veterinary Medicine and 3Biological Science and Technology, National Pingtung University of Science and Technology, Pingtung, Taiwan, R.O.C.; 2Research and Development Department, Golden Dapu Biotech Corp., Chiayi, Taiwan, R.O.C. Abstract. Hepatitis B virus X (HBx) protein is a multi- (1). Large population studies in Taiwan (2) and China (3) also functional oncoprotein that affects diverse cell activities via showed that individuals with HCC have significantly higher regulation of various host cell signaling pathways. The current seropositive results for hepatitis B surface antigen (HBsAg), investigation demonstrated that ursolic acid (UA), a indicating that chronic HBV infection is the key cause of HCC pentacyclic triterpenoid, protected hepatoma cells and reduced complications in these areas. HBV belongs to the HBx-mediated autophagy through modulation of Ras homolog Hepadnaviridae family and contains small, mostly double- gene family member A (RhoA). Low-level ectopic HBx stranded, circular DNA. HBV infection is initiated by the expression in Huh7 cells induced more significant attachment and entry of virus particles into susceptible autophagosome formation than high-level HBx expression. hepatocytes via cell surface receptors and endocytosis. HBx activated beclin-1 promoter and enhanced the beclin-1 Multiple host cell surface proteins are required for attachment protein expression under low HBx expression. Transcription and entry of HBV, although the mechanisms are not fully factor AP-1 played an essential function in HBx-mediated understood (4). In the treatment of patients with advanced beclin-1 promoter activation. Inhibition of RhoA and its HCC, systemic chemotherapy is the mainstay of therapy. The downstream effector Rho-associated coiled-coil-containing most active drugs for use in chemotherapy include protein kinase 1 (ROCK1) alleviated HBx-mediated autophagy doxorubicin, cisplatin and fluorouracil. Unfortunately, the significantly. Transiently-expressed HBx elicited an increased positive response rate is only approximately 20% and these RhoA-GTP level, as well as phospho-ROCK1 transient treatments have no significant effect on overall survival (5, 6). accumulation. Utilization of transactivation-deficient HBx The HBV-encoded X (HBx) protein modulates various demonstrated that the transactivation activity of HBx is cellular responses, including gene transcriptional control, required for autophagy induction. Furthermore, UA suppressed signal transduction crosstalk, cell growth and programmed HBx-mediated RhoA activation, beclin-1 promoter activation cell death, thus leading to genetic instability and and subsequent autophagy induction, while, most importantly, carcinogenesis. Although still controversial, generally, in reversed HBx-induced anti-cancer drug resistance. HBx-expressing hepatoma cells, cells confer anti-apoptosis and drug resistance in response to chemotherapeutic drugs Hepatitis B virus (HBV) and hepatitis C virus (HCV) are (7). However, some reports have indicated that the expression predominant risk factors for primary liver cancers, as almost level of HBx is correlated with the dual effects of HBx (8). 80% of cases of hepatocellular carcinoma (HCC) are Autophagy, also called type II programmed cell death, is correlated with underlying chronic HBV and HCV infection a cellular mechanism critical for homeostasis. More than 30 autophagy-related proteins (ATGs) have been identified from studies of yeast (9), with most being highly conserved from yeast to mammals. Beclin-1, the mammalian orthologue of *These Authors contributed equally to this work. yeast Atg6, plays a key role in autophagy. It also is a major component of the phosphatidylinositide 3-kinase (PI3K) Correspondence to: Wen-Ling Shih, Department of Biological class III lipid-kinase complex that induces autophagy and a Science and Technology, National Pingtung University of Science substrate of Rho-associated coiled-coil-containing protein and Technology, 1, Shuefu Rd., Neipu, Pingtung 91201, Taiwan. Tel: +886 87703202 (Ext. 5192), Fax: +886 87740550, e-mail: kinase 1 (ROCK1) that is phosphorylated during metabolic [email protected] stress (10). Recent studies have shown that autophagy is a critical mechanism involved in liver disease. In some Key Words: HBx, ursolic acid, autophagy, RhoA, ROCK1. circumstances, autophagy suppresses tumorigenesis, while, 0250-7005/2016 $2.00+.40 5097 ANTICANCER RESEARCH 36 : 5097-5108 (2016) in most cases, autophagy facilitates tumor progression (11). 91 GFP (amino acid 90; Pro changed to Val and amino acid 91; Lys In several liver-derived cell lines, in a transgenic mouse changed to Leu), were co-transfected with reverse tetracycline- model in addition to in the liver of HBV-infected patients, controlled transactivator (rtTA) expression plasmid, pTRE-rtTA, and these recombinant plasmids generated doxycycline-inducible GFP HBV induces autophagic flux and accumulates autophagic fusion protein expression. pLC3-GFP (provided by Dr. Jen-Wei Lee, vacuoles. HBx has been shown to play a critical role in Tzu-Chi University, Hualien, Taiwan) expressed a fusion protein that HBV-mediated autophagy. The possible mechanisms of the allowed observation of autophagosome formation in cultured live cells. effects of HBx might be due to binding to type III PI3K and/or transactivation of the beclin-1 gene (12). Western blotting analysis. RhoA activation assay and ROCK The search for naturally-existing compounds beneficial to activation assay. The procedures of Western blotting analysis and health has continued in recent years, with a major focus on the RhoA activity assay were as described in the literature (17, 18). the constituents of plants being investigated for their anti- Beclin-1 promoter controlled luciferase reporter plasmids and cancer activities (13). Ursolic acid (UA) and oleanolic acid luciferase assay. A luciferase reporter controlled by a full-length (OA) are natural triterpenoid compounds that exist widely promoter (-644/+197) and two deleted promoters (-277/+197) and (- and can be enriched in herbs and plants. It is known that UA 528/+197) was kindly provided Dr. Mujun Zhao (19). Analysis of the possesses multiple health-improving activities, including transcription factor binding site of the full-length (-644/+197) beclin- anti-oxidation, anti-inflammation, anti-cancer and 1 promoter using an online system (20) revealed that there were three hepatoprotective characteristics (14). Various combination activator protein-1 (AP-1) binding sites in total and only one AP-1 chemotherapy regimens have also been studied. However, binding site in a deleted beclin-1 promoter (-277/+197); however, no AP-1 binding site was present in the other deleted promoter the precise mechanism underlying the hepatoprotective (-58/+197). Site-directed mutagenesis on certain AP-1 binding sites activity of UA still remains unclear. was performed by Protech Technology Enterprise Co., Ltd. (Taipei, Following a literature review, we investigated the relationship Taiwan). First, the consensus AP-1 binding sequence TGAC on a between autophagy and drug sensitivity response in HBx- deleted promoter (-277/+197) was mutated to GTCG using sense expressing cells and evaluated the efficacy of UA treatment on primer 5’-AGATTACAGGCGGTCTCCACCGCGCCCGCCT-3’ and HBx-expressing multidrug-resistant hepatoma cells; the cell antisense primer 5’-AGGCGGGCGCGGTGGAGACCGCCTGT signaling pathways involved were also elucidated. AATCT-3’. This plasmid was named ΔAP-1 (-277/+197). Two AP-1 binding sites on the full-length beclin-1 promoter (-644/+197) were mutated and 2 mutated plasmids were obtained. On the full-length Materials and Methods beclin-1 promoter, the second AP-1 binding site located at -232/-237 was mutated using sense primer 5’-AGGTTCAAGCGATTCTCC Reagents and antibodies. Inhibitors, including Go66976 (PKC GTAAGACGCCTCCCGAGTAGCTGG-3’ and antisense primer 5’- inhibitor), C3 exoenzyme (Rho inhibitor), Y27632 (ROCK CCAGCTACTCGGGAGGCGTCTTACGGAGAATCGCTTGAACC inhibitor), LY294002 and wortmannin (PI3K inhibitors), PD98059 T-3’, and the plasmid was named ΔAP-1-mt2 (-644/+197). The third (ERK MAPK inhibitor), SP600125 (JNK inhibitor) and SB203580 AP-1 binding site of the full-length promoter located at -232/-237 was (p38 MAPK inhibitor), were purchased from Calbiochem (San mutated using sense primer 5’-CTGAGATTACAGGCGGTCTAAC Diego, CA, USA). Autophagy inhibitor 3-methyladenine (3-MA) CCGCGCCCGCCTCCC-3’ and antisense primer 5’-GGGAGGGG was also obtained from Calbiochem. Transfection was performed GCGCGGGTTAGACCGCCTGTAATCTCAG-3’, with the resulting using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) plasmid being named ΔAP-1-mt3(-644/+197). The three mutated according to the user’s manual. Rabbit polyclonal antibody against nucleotides on the promoter were confirmed by direct DNA HBx was provided by Dr. Shin-Lian Doong (National Taiwan sequencing. Luciferase assay was performed according to the University, Taipei, Taiwan) (15). Antibodies, including GAPDH, previous literature (18). beclin-1, ROCK1 and phospho-ROCK1 were purchased from Cell Signaling Technology (Beverly, MA, USA). UA and OA were Inhibitor treatment of cells . Huh7 cells (kindly provided by Dr. purchased from Sigma (St.
Recommended publications
  • Calcium and Covid-19 1 Conflicts Over Calcium and the Treatment of Covid

    Calcium and Covid-19 1 Conflicts Over Calcium and the Treatment of Covid

    Calcium and Covid-19 1 Conflicts over calcium and the treatment of Covid-19 Bernard Crespi 1 and Joe Alcock 2 1 Department of Biological Sciences, 8888 University Drive, Simon Fraser University, Burnaby V5A1S6, British Columbia, Canada 2 Department of Emergency Medicine, University of New Mexico, Albuquerque, New Mexico 87131, USA Word counts: Abstract 147, Main Text 2966 © The Author(s) 2020. Published by Oxford University Press on behalf of the Foundation for Evolution, Medicine, and Public Health. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Calcium and Covid-19 2 Abstract Several recent studies have provided evidence that use of calcium channel blockers, especially amlodipine and nifedipine, can reduce mortality from Covid-19. Moreover, hypocalcemia (a reduced level of serum ionized calcium) has been shown to be strongly positively associated with Covid-19 severity. Both effectiveness of CCBs as antiviral therapy, and positive associations of hypocalcemia with mortality, have been demonstrated for many other viruses as well. We evaluate these findings in the contexts of virus-host evolutionary conflicts over calcium metabolism, and hypocalcemia as either pathology, viral manipulation, or host defence against pathogens. Considerable evidence supports the hypothesis that hypocalcemia represents a host defence. Indeed, hypocalcemia may exert antiviral effects in a similar manner as do CCBs, through interference with calcium metabolism in virus-infected cells. Prospective clinical studies that address the efficacy of CCBs and hypocalcemia should provide novel insights into the pathogenicity and treatment of Covid-19 and other viruses.
  • Hemagglutinin Stalk- and Neuraminidase-Specific

    Hemagglutinin Stalk- and Neuraminidase-Specific

    crossmark Hemagglutinin Stalk- and Neuraminidase-Specific Monoclonal Antibodies Protect against Lethal H10N8 Influenza Virus Infection in Mice Teddy John Wohlbold,a,b Veronika Chromikova,a Gene S. Tan,a Philip Meade,a,b Fatima Amanat,a Phillip Comella,a,b Ariana Hirsh,a Florian Krammera Department of Microbiology, Icahn School of Medicine at Mount Sinai, New York, New York, USAa; Graduate School of Biomedical Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USAb ABSTRACT Downloaded from Between November 2013 and February 2014, China reported three human cases of H10N8 influenza virus infection in the Jiangxi province, two of which were fatal. Using hybridoma technology, we isolated a panel of H10- and N8-directed monoclonal anti- bodies (MAbs) and further characterized the binding reactivity of these antibodies (via enzyme-linked immunosorbent assay) to a range of purified virus and recombinant protein substrates. The H10-directed MAbs displayed functional hemagglutination inhibition (HI) and neutralization activity, and the N8-directed antibodies displayed functional neuraminidase inhibition (NI) activity against H10N8. Surprisingly, the HI-reactive H10 antibodies, as well as a previously generated, group 2 hemagglutinin (HA) stalk-reactive antibody, demonstrated NI activity against H10N8 and an H10N7 strain; this phenomenon was absent when virus was treated with detergent, suggesting the anti-HA antibodies inhibited neuraminidase enzymatic activity through steric hindrance. We tested the prophylactic efficacy of one representative H10-reactive, N8-reactive, and group 2 HA stalk-reactive http://jvi.asm.org/ antibody in vivo using a BALB/c challenge model. All three antibodies were protective at a high dose (5 mg/kg).
  • Hepatitis B Virus X Protein Inhibits P53 Sequence-Specific DNA Binding

    Hepatitis B Virus X Protein Inhibits P53 Sequence-Specific DNA Binding

    Proc. Nati. Acad. Sci. USA Vol. 91, pp. 2230-2234, March 1994 Medical Sciences Hepatitis B virus X protein inhibits p53 sequence-specific DNA binding, transcriptional activity, and association with transcription factor ERCC3 XIN WEI WANG*, KATHLEEN FORRESTER*, HEIDI YEH*, MARK A. FEITELSONt, JEN-REN GUI, AND CURTIS C. HARRIS*§ *Laboratory of Human Carcinogenesis, Division of Cancer Etiology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; tDepartment of Pathology and Cell Biology, Jefferson Medical College, Philadelphia, PA 19107; and tDepartment of Molecular Biology and Biochemistry, Shanghai Cancer Institute, Shanghai, People's Republic of China. Communicated by Bert Vogelstein, December 27, 1993 (receivedfor review December 9, 1993) ABSTRACT Chronic active hepatitis caused by infection about the role of HBX in HCC development. In this report, with hepatitis B virus, a DNA virus, is a major risk factor for we present results consistent with the hypothesis that HBX human hepatocellular carcinoma. Since the oncogenicity of binds to p53 and abrogates its normal cellular functions. several DNA viruses is dependent on the interaction of their viral oncoproteins with cellular tumor-suppressor gene prod- MATERIAL AND METHODS ucts, we investigated the interaction between hepatitis B virus X protein (HBX) and human wild-type p53 protein. HBX Plasmids. Plasmid constructs encoding GST-p53-WT, con- complexes with the wild-type p53 protein and inhibits its taining glutathione S-transferase (GST) fused to human wild- sequence-specific DNA binding in vitro. HBX expresslin also type p53, and GST-p53-135Y, containing GST fused to the inhibits p53-mediated transcrptional activation in vivo and the mutant p53 containing a His -* Tyr mutation at codon 135, in vitro asoition of p53 and ERCC3, a general transcription were provided by Jon Huibregtse (National Cancer Institute) factor involved in nucleotide excision repair.
  • The Role of F-Box Proteins During Viral Infection

    The Role of F-Box Proteins During Viral Infection

    Int. J. Mol. Sci. 2013, 14, 4030-4049; doi:10.3390/ijms14024030 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Review The Role of F-Box Proteins during Viral Infection Régis Lopes Correa 1, Fernanda Prieto Bruckner 2, Renan de Souza Cascardo 1,2 and Poliane Alfenas-Zerbini 2,* 1 Department of Genetics, Federal University of Rio de Janeiro, Rio de Janeiro, RJ 21944-970, Brazil; E-Mails: [email protected] (R.L.C.); [email protected] (R.S.C.) 2 Department of Microbiology/BIOAGRO, Federal University of Viçosa, Viçosa, MG 36570-000, Brazil; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +55-31-3899-2955; Fax: +55-31-3899-2864. Received: 23 October 2012; in revised form: 14 December 2012 / Accepted: 17 January 2013 / Published: 18 February 2013 Abstract: The F-box domain is a protein structural motif of about 50 amino acids that mediates protein–protein interactions. The F-box protein is one of the four components of the SCF (SKp1, Cullin, F-box protein) complex, which mediates ubiquitination of proteins targeted for degradation by the proteasome, playing an essential role in many cellular processes. Several discoveries have been made on the use of the ubiquitin–proteasome system by viruses of several families to complete their infection cycle. On the other hand, F-box proteins can be used in the defense response by the host. This review describes the role of F-box proteins and the use of the ubiquitin–proteasome system in virus–host interactions.
  • Modulation of NF-Κb Signalling by Microbial Pathogens

    Modulation of NF-Κb Signalling by Microbial Pathogens

    REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm.
  • Cyclic Peptide Mimotopes for the Detection of Serum Anti–ATIC Autoantibody Biomarker in Hepato-Cellular Carcinoma

    Cyclic Peptide Mimotopes for the Detection of Serum Anti–ATIC Autoantibody Biomarker in Hepato-Cellular Carcinoma

    International Journal of Molecular Sciences Article Cyclic Peptide Mimotopes for the Detection of Serum Anti–ATIC Autoantibody Biomarker in Hepato-Cellular Carcinoma Chang-Kyu Heo 1, Hai-Min Hwang 1, Won-Hee Lim 1,2, Hye-Jung Lee 3, Jong-Shin Yoo 4, Kook-Jin Lim 3 and Eun-Wie Cho 1,2,* 1 Rare Disease Research Center, Korea Research Institute of Bioscience and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejeon 34141, Korea; [email protected] (C.-K.H.); [email protected] (H.-M.H.); [email protected] (W.-H.L.) 2 Department of Functional Genomics, University of Science and Technology, 125 Gwahak-ro, Yuseong-gu, Daejeon 34141, Korea 3 ProteomeTech Inc. 401, Yangcheon-ro, Gangseo-gu, Seoul 07528, Korea; [email protected] (H.-J.L.); [email protected] (K.-J.L.) 4 Biomedical Omics Group, Korea Basic Science Institute, 162 YeonGuDanji-Ro, Ochang-eup, Cheongju, Chungbuk 28119, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-42-860-4155 Received: 12 November 2020; Accepted: 16 December 2020; Published: 19 December 2020 Abstract: Tumor-associated (TA) autoantibodies have been identified at the early tumor stage before developing clinical symptoms, which holds hope for early cancer diagnosis. We identified a TA autoantibody from HBx-transgenic (HBx-tg) hepatocellular carcinoma (HCC) model mouse, characterized its target antigen, and examined its relationship to human HCC. The mimotopes corresponding to the antigenic epitope of TA autoantibody were screened from a random cyclic peptide library and used for the detection of serum TA autoantibody. The target antigen of the TA autoantibody was identified as an oncogenic bi-functional purine biosynthesis protein, ATIC.
  • Expression of Hbx and COX-2 in Chronic Hepatitis B, Cirrhosis and Hepatocellular Carcinoma: Implication of Hbx in Upregulation of COX-2

    Expression of Hbx and COX-2 in Chronic Hepatitis B, Cirrhosis and Hepatocellular Carcinoma: Implication of Hbx in Upregulation of COX-2

    Modern Pathology (2004) 17, 1169–1179 & 2004 USCAP, Inc All rights reserved 0893-3952/04 $30.00 www.modernpathology.org Expression of HBx and COX-2 in chronic hepatitis B, cirrhosis and hepatocellular carcinoma: implication of HBx in upregulation of COX-2 Alfred S-L Cheng1, Henry L-Y Chan1, Wai K Leung1,KaFTo2, Minnie Y-Y Go1, John Y-H Chan3, Choong T Liew2 and Joseph J-Y Sung1 1Department of Medicine & Therapeutics; 2Department of Anatomical & Cellular Pathology and 3Department of Clinical Oncology, The Chinese University of Hong Kong, Hong Kong Hepatitis B virus is a major etiological factor of hepatocellular carcinoma, but the underlying mechanisms remain unclear. We have previously demonstrated that upregulation of cyclooxygenase (COX)-2 in chronic hepatitis B persisted despite successful antiviral therapy. In this study, we investigated the relationship between the transactivator HBx and COX-2 in hepatitis B virus-associated chronic liver diseases. Expressions of HBx and COX-2 in tissue specimens were determined by single and double immunohistochemistry. The effects of HBx on COX-2 and prostaglandin E2 production were studied by transfection. HBx was expressed in 11/11 (100%) of chronic hepatitis B, 23/23 (100%) of cirrhosis, and 18/23 (78%) of hepatocellular carcinoma, whereas no immunoreactivity was found in four nonalcoholic steato-hepatitis controls. COX-2 expression was also detected in all specimens of liver lesions except in only 29% of poorly differentiated hepatocellular carcinoma. Significant correlation between HBx and COX-2 immunoreactivity scores was found in different types of chronic liver diseases (chronic hepatitis B, rs ¼ 0.68; cirrhosis, rs ¼ 0.57; hepatocellular carcinoma, rs ¼ 0.45).
  • Influenza Hemagglutinin-Specific Iga Fc-Effector Functionality Is Restricted to Stalk Epitopes

    Influenza Hemagglutinin-Specific Iga Fc-Effector Functionality Is Restricted to Stalk Epitopes

    Influenza hemagglutinin-specific IgA Fc-effector functionality is restricted to stalk epitopes Alec W. Freyna,b,1, Julianna Hanc, Jenna J. Guthmillerd, Mark J. Baileya,b, Karlynn Neud, Hannah L. Turnerc, Victoria C. Rosadoa, Veronika Chromikovaa, Min Huangd,e, Shirin Strohmeiera,f, Sean T. H. Liua, Viviana Simona, Florian Krammera, Andrew B. Wardc, Peter Palesea,g,2, Patrick C. Wilsond,e, and Raffael Nachbagauera,1,2 aDepartment of Microbiology, Icahn School of Medicine at Mount Sinai, New York, NY 10029; bGraduate School of Biomedical Sciences, Icahn School of Medicine at Mount Sinai, New York, NY 10029; cDepartment of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037; dDepartment of Medicine, Section of Rheumatology, Gwen Knapp Center for Lupus and Immunology Research, The University of Chicago, Chicago, IL 60637; eCommittee on Immunology, The University of Chicago, Chicago, IL 60637; fDepartment of Biotechnology, University of Natural Resources and Life Sciences, 1190 Vienna, Austria; and gDepartment of Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 Edited by Thomas Shenk, Princeton University, Princeton, NJ, and approved December 31, 2020 (received for review August 27, 2020) In this study, we utilized a panel of human immunoglobulin (Ig) IgA (11). Influenza virus-specific IgA antibodies have been shown to monoclonal antibodies isolated from the plasmablasts of eight neutralize similarly to their IgG counterparts, and the ability of donors after 2014/2015 influenza virus vaccination (Fluarix) to study these antibodies to interact with Fc receptors to elicit Fc-mediated the binding and functional specificities of this isotype. In this cohort, effector functions has been examined (12–15).
  • Nuku, a Family of Primate Retrogenes Derived from KU70

    Nuku, a Family of Primate Retrogenes Derived from KU70

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.408492; this version posted December 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 2 3 4 5 6 Nuku, a family of primate retrogenes derived from KU70 7 8 9 10 Paul A. Rowley1#, Aisha Ellahi2, Kyudong Han3,4, Jagdish Suresh Patel1,5, Sara L. Sawyer6 11 12 1 Department of Biological Sciences, University of Idaho, Moscow, USA, 83843 13 2 Department of Molecular Biosciences, University of Texas at Austin, Austin, TX, 78751 14 3 Department of Microbiology, College of Science & Technology, Dankook University, Cheonan 15 31116, Republic of Korea 16 4 Center for Bio‑Medical Engineering Core Facility, Dankook University, Cheonan 31116, 17 Republic of Korea 18 5 Center for Modeling Complex Interactions, University of Idaho, Moscow, USA. 19 6 Department of Molecular, Cellular, and Developmental Biology, University of Colorado 20 Boulder, Boulder, CO, USA. 21 22 23 Contact: 24 # Corresponding author. [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.408492; this version posted December 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 25 Abstract 26 The ubiquitous DNA repair protein, Ku70p, has undergone extensive copy number expansion 27 during primate evolution.
  • 1 Smc5/6-Antagonism by Hbx Is an Evolutionary-Conserved Function of Hepatitis B Virus

    1 Smc5/6-Antagonism by Hbx Is an Evolutionary-Conserved Function of Hepatitis B Virus

    bioRxiv preprint doi: https://doi.org/10.1101/202671; this version posted December 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Filleton, Abdul, et al. 1 Smc5/6-antagonism by HBx is an evolutionary-conserved function of hepatitis B virus 2 infection in mammals 3 4 Fabien Filleton1*, Fabien Abdul2*, Laetitia Gerossier3, Alexia Paturel3, Janet Hall3, Michel 5 Strubin2, Lucie Etienne1§ 6 7 1 CIRI – International Center for Infectiology Research, Inserm, U1111, Université Claude 8 Bernard Lyon 1, CNRS, UMR5308, Ecole Normale Supérieure de Lyon, Univ Lyon, F- 9 69007, Lyon, France ; 2 Department of Microbiology and Molecular Medicine, University 10 Medical Centre (C.M.U.) / University of Geneva, Rue Michel-Servet 1, 1211 Geneva 4, 11 Switzerland ; 3 CRCL- UMR Inserm 1052 - CNRS 5286, 151 cours Albert Thomas, 69300 12 Lyon, France. 13 14 * Contributed equally to this work 15 §: Correspondence: Lucie Etienne, CIRI, ENS-Lyon, 46 Allée d’Italie, 69364 Lyon, France. 16 E-mail: [email protected] 17 18 Keywords: Smc5/6 complex, evolution of SMC genes, Hepatitis B virus, HBx, restriction 19 factor, antagonist, positive selection, virus-host interaction, genetic conflict 20 1 bioRxiv preprint doi: https://doi.org/10.1101/202671; this version posted December 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
  • Mitophagy in Antiviral Immunity

    Mitophagy in Antiviral Immunity

    fcell-09-723108 September 1, 2021 Time: 10:49 # 1 REVIEW published: 03 September 2021 doi: 10.3389/fcell.2021.723108 Mitophagy in Antiviral Immunity Hongna Wang1,2,3*, Yongfeng Zheng1,2, Jieru Huang1,2 and Jin Li1,2* 1 Affiliated Cancer Hospital and Institute of Guangzhou Medical University, Guangzhou, China, 2 Key Laboratory of Cell Homeostasis and Cancer Research of Guangdong Higher Education Institutes, Guangzhou, China, 3 GMU-GIBH Joint School of Life Sciences, Guangzhou Medical University, Guangzhou, China Mitochondria are important organelles whose primary function is energy production; in addition, they serve as signaling platforms for apoptosis and antiviral immunity. The central role of mitochondria in oxidative phosphorylation and apoptosis requires their quality to be tightly regulated. Mitophagy is the main cellular process responsible for mitochondrial quality control. It selectively sends damaged or excess mitochondria to the lysosomes for degradation and plays a critical role in maintaining cellular homeostasis. However, increasing evidence shows that viruses utilize mitophagy to promote their survival. Viruses use various strategies to manipulate mitophagy to Edited by: eliminate critical, mitochondria-localized immune molecules in order to escape host Shou-Long Deng, immune attacks. In this article, we will review the scientific advances in mitophagy in Peking Union Medical College, China viral infections and summarize how the host immune system responds to viral infection Reviewed by: and how viruses manipulate host mitophagy
  • The Actin Cytoskeleton Is Important for Rotavirus Internalization and RNA Genome Replication T

    The Actin Cytoskeleton Is Important for Rotavirus Internalization and RNA Genome Replication T

    Virus Research 263 (2019) 27–33 Contents lists available at ScienceDirect Virus Research journal homepage: www.elsevier.com/locate/virusres The actin cytoskeleton is important for rotavirus internalization and RNA genome replication T Oscar Trejo-Cerro, Nayeli Aguilar-Hernández, Daniela Silva-Ayala1, Susana López, ⁎ Carlos F. Arias Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca, Morelos, 62210, Mexico ARTICLE INFO ABSTRACT Keywords: Numerous host factors are required for the efficient replication of rotavirus, including the activation and in- Rotavirus activation of several cell signaling pathways. One of the cellular structures that are reorganized during rotavirus Actin cytoskeleton infection is the actin cytoskeleton. In this work, we report that the dynamics of the actin microfilaments are Rotavirus internalization important at different stages of the virus life cycle, specifically, during virus internalization and viral RNA Rotavirus genome replication synthesis at 6 h post-infection. Our results show that the actin-binding proteins alpha-actinin 4 and Diaph, as well as the Rho-family small GTPase Cdc42 are necessary for an efficient virus entry, while GTPase Rac1 is required for maximal viral RNA synthesis. 1. Introduction (Carlier et al., 1997; DesMarais et al., 2004; Goode and Eck, 2007; Weisswange et al., 2009). Profilin, another member of the formins fa- The actin cytoskeleton is a highly dynamic structure that allows mily, promotes both processes, contributing to the assembly and dis- important cellular processes, such as cell division, movement, dis- assembly of the actin filament, enhancing its turnover (Didry et al., tribution of organelles, endo- and exocytosis and intercellular com- 1998). Besides, the actin filaments can form networks through proteins munication (Pollard and Cooper, 2009).