![Ursolic Acid Suppresses Hepatitis B Virus X Protein-Mediated](https://data.docslib.org/img/3a60ab92a6e30910dab9bd827208bcff-1.webp)
ANTICANCER RESEARCH 36 : 5097-5108 (2016) doi:10.21873/anticanres.11079 Ursolic Acid Suppresses Hepatitis B Virus X Protein-mediated Autophagy and Chemotherapeutic Drug Resistance CHING-DONG CHANG 1* , PING-YUAN LIN 2* , JUE-LIANG HSU 3 and WEN-LING SHIH 3 Departments of 1Veterinary Medicine and 3Biological Science and Technology, National Pingtung University of Science and Technology, Pingtung, Taiwan, R.O.C.; 2Research and Development Department, Golden Dapu Biotech Corp., Chiayi, Taiwan, R.O.C. Abstract. Hepatitis B virus X (HBx) protein is a multi- (1). Large population studies in Taiwan (2) and China (3) also functional oncoprotein that affects diverse cell activities via showed that individuals with HCC have significantly higher regulation of various host cell signaling pathways. The current seropositive results for hepatitis B surface antigen (HBsAg), investigation demonstrated that ursolic acid (UA), a indicating that chronic HBV infection is the key cause of HCC pentacyclic triterpenoid, protected hepatoma cells and reduced complications in these areas. HBV belongs to the HBx-mediated autophagy through modulation of Ras homolog Hepadnaviridae family and contains small, mostly double- gene family member A (RhoA). Low-level ectopic HBx stranded, circular DNA. HBV infection is initiated by the expression in Huh7 cells induced more significant attachment and entry of virus particles into susceptible autophagosome formation than high-level HBx expression. hepatocytes via cell surface receptors and endocytosis. HBx activated beclin-1 promoter and enhanced the beclin-1 Multiple host cell surface proteins are required for attachment protein expression under low HBx expression. Transcription and entry of HBV, although the mechanisms are not fully factor AP-1 played an essential function in HBx-mediated understood (4). In the treatment of patients with advanced beclin-1 promoter activation. Inhibition of RhoA and its HCC, systemic chemotherapy is the mainstay of therapy. The downstream effector Rho-associated coiled-coil-containing most active drugs for use in chemotherapy include protein kinase 1 (ROCK1) alleviated HBx-mediated autophagy doxorubicin, cisplatin and fluorouracil. Unfortunately, the significantly. Transiently-expressed HBx elicited an increased positive response rate is only approximately 20% and these RhoA-GTP level, as well as phospho-ROCK1 transient treatments have no significant effect on overall survival (5, 6). accumulation. Utilization of transactivation-deficient HBx The HBV-encoded X (HBx) protein modulates various demonstrated that the transactivation activity of HBx is cellular responses, including gene transcriptional control, required for autophagy induction. Furthermore, UA suppressed signal transduction crosstalk, cell growth and programmed HBx-mediated RhoA activation, beclin-1 promoter activation cell death, thus leading to genetic instability and and subsequent autophagy induction, while, most importantly, carcinogenesis. Although still controversial, generally, in reversed HBx-induced anti-cancer drug resistance. HBx-expressing hepatoma cells, cells confer anti-apoptosis and drug resistance in response to chemotherapeutic drugs Hepatitis B virus (HBV) and hepatitis C virus (HCV) are (7). However, some reports have indicated that the expression predominant risk factors for primary liver cancers, as almost level of HBx is correlated with the dual effects of HBx (8). 80% of cases of hepatocellular carcinoma (HCC) are Autophagy, also called type II programmed cell death, is correlated with underlying chronic HBV and HCV infection a cellular mechanism critical for homeostasis. More than 30 autophagy-related proteins (ATGs) have been identified from studies of yeast (9), with most being highly conserved from yeast to mammals. Beclin-1, the mammalian orthologue of *These Authors contributed equally to this work. yeast Atg6, plays a key role in autophagy. It also is a major component of the phosphatidylinositide 3-kinase (PI3K) Correspondence to: Wen-Ling Shih, Department of Biological class III lipid-kinase complex that induces autophagy and a Science and Technology, National Pingtung University of Science substrate of Rho-associated coiled-coil-containing protein and Technology, 1, Shuefu Rd., Neipu, Pingtung 91201, Taiwan. Tel: +886 87703202 (Ext. 5192), Fax: +886 87740550, e-mail: kinase 1 (ROCK1) that is phosphorylated during metabolic [email protected] stress (10). Recent studies have shown that autophagy is a critical mechanism involved in liver disease. In some Key Words: HBx, ursolic acid, autophagy, RhoA, ROCK1. circumstances, autophagy suppresses tumorigenesis, while, 0250-7005/2016 $2.00+.40 5097 ANTICANCER RESEARCH 36 : 5097-5108 (2016) in most cases, autophagy facilitates tumor progression (11). 91 GFP (amino acid 90; Pro changed to Val and amino acid 91; Lys In several liver-derived cell lines, in a transgenic mouse changed to Leu), were co-transfected with reverse tetracycline- model in addition to in the liver of HBV-infected patients, controlled transactivator (rtTA) expression plasmid, pTRE-rtTA, and these recombinant plasmids generated doxycycline-inducible GFP HBV induces autophagic flux and accumulates autophagic fusion protein expression. pLC3-GFP (provided by Dr. Jen-Wei Lee, vacuoles. HBx has been shown to play a critical role in Tzu-Chi University, Hualien, Taiwan) expressed a fusion protein that HBV-mediated autophagy. The possible mechanisms of the allowed observation of autophagosome formation in cultured live cells. effects of HBx might be due to binding to type III PI3K and/or transactivation of the beclin-1 gene (12). Western blotting analysis. RhoA activation assay and ROCK The search for naturally-existing compounds beneficial to activation assay. The procedures of Western blotting analysis and health has continued in recent years, with a major focus on the RhoA activity assay were as described in the literature (17, 18). the constituents of plants being investigated for their anti- Beclin-1 promoter controlled luciferase reporter plasmids and cancer activities (13). Ursolic acid (UA) and oleanolic acid luciferase assay. A luciferase reporter controlled by a full-length (OA) are natural triterpenoid compounds that exist widely promoter (-644/+197) and two deleted promoters (-277/+197) and (- and can be enriched in herbs and plants. It is known that UA 528/+197) was kindly provided Dr. Mujun Zhao (19). Analysis of the possesses multiple health-improving activities, including transcription factor binding site of the full-length (-644/+197) beclin- anti-oxidation, anti-inflammation, anti-cancer and 1 promoter using an online system (20) revealed that there were three hepatoprotective characteristics (14). Various combination activator protein-1 (AP-1) binding sites in total and only one AP-1 chemotherapy regimens have also been studied. However, binding site in a deleted beclin-1 promoter (-277/+197); however, no AP-1 binding site was present in the other deleted promoter the precise mechanism underlying the hepatoprotective (-58/+197). Site-directed mutagenesis on certain AP-1 binding sites activity of UA still remains unclear. was performed by Protech Technology Enterprise Co., Ltd. (Taipei, Following a literature review, we investigated the relationship Taiwan). First, the consensus AP-1 binding sequence TGAC on a between autophagy and drug sensitivity response in HBx- deleted promoter (-277/+197) was mutated to GTCG using sense expressing cells and evaluated the efficacy of UA treatment on primer 5’-AGATTACAGGCGGTCTCCACCGCGCCCGCCT-3’ and HBx-expressing multidrug-resistant hepatoma cells; the cell antisense primer 5’-AGGCGGGCGCGGTGGAGACCGCCTGT signaling pathways involved were also elucidated. AATCT-3’. This plasmid was named ΔAP-1 (-277/+197). Two AP-1 binding sites on the full-length beclin-1 promoter (-644/+197) were mutated and 2 mutated plasmids were obtained. On the full-length Materials and Methods beclin-1 promoter, the second AP-1 binding site located at -232/-237 was mutated using sense primer 5’-AGGTTCAAGCGATTCTCC Reagents and antibodies. Inhibitors, including Go66976 (PKC GTAAGACGCCTCCCGAGTAGCTGG-3’ and antisense primer 5’- inhibitor), C3 exoenzyme (Rho inhibitor), Y27632 (ROCK CCAGCTACTCGGGAGGCGTCTTACGGAGAATCGCTTGAACC inhibitor), LY294002 and wortmannin (PI3K inhibitors), PD98059 T-3’, and the plasmid was named ΔAP-1-mt2 (-644/+197). The third (ERK MAPK inhibitor), SP600125 (JNK inhibitor) and SB203580 AP-1 binding site of the full-length promoter located at -232/-237 was (p38 MAPK inhibitor), were purchased from Calbiochem (San mutated using sense primer 5’-CTGAGATTACAGGCGGTCTAAC Diego, CA, USA). Autophagy inhibitor 3-methyladenine (3-MA) CCGCGCCCGCCTCCC-3’ and antisense primer 5’-GGGAGGGG was also obtained from Calbiochem. Transfection was performed GCGCGGGTTAGACCGCCTGTAATCTCAG-3’, with the resulting using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) plasmid being named ΔAP-1-mt3(-644/+197). The three mutated according to the user’s manual. Rabbit polyclonal antibody against nucleotides on the promoter were confirmed by direct DNA HBx was provided by Dr. Shin-Lian Doong (National Taiwan sequencing. Luciferase assay was performed according to the University, Taipei, Taiwan) (15). Antibodies, including GAPDH, previous literature (18). beclin-1, ROCK1 and phospho-ROCK1 were purchased from Cell Signaling Technology (Beverly, MA, USA). UA and OA were Inhibitor treatment of cells . Huh7 cells (kindly provided by Dr. purchased from Sigma (St.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages11 Page
-
File Size-