sign in sign up
<<
Home , Dendrite, Synapse

© 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052

SHORT REPORT Regulation of morphology and excitatory formation by zDHHC15 Bhavin S. Shah*, Jordan J. Shimell* and Shernaz X. Bamji‡

ABSTRACT pathology (Charollais and Van Der Goot, 2009; Fukata and Fukata, Protein is the most common post-translational lipid 2010; Rocks et al., 2010). modification in the and is mediated by a family of 24 zDHHC Although zDHHC15 is highly expressed in many cell types in the enzymes. There has been growing interest in zDHHCs due to brain (Fukata et al., 2004; Mansouri et al., 2005; Wang et al., 2015; mounting evidence that these enzymes play key roles in the Zhang et al., 2014), little is known about its function. Known development and function of neuronal connections, and the fact that substrates of zDHHC15 include PSD-95 (officially known as DLG4), γ anumberofzDHHCshavebeenassociatedwithneurodevelopmental GAP43, SNAP25b, CSP (officially known as DNAJC5), GABAR 2 and neurodegenerative diseases. Loss-of-function variants in several (officially known as GABRG2) , Fyn, BACE1, CD151, CIMPR zDHHCs, including zDHHC15, have been identified in patients with (officially known as IGF2R) and SORT1 (Fang et al., 2006; Fukata intellectual disabilities; however, the function of zDHHC15 in the brain et al., 2004; Greaves et al., 2010, 2008; Mill et al., 2009; Sharma has not been well studied. Here, we demonstrate that knocking down et al., 2008; Tsutsumi et al., 2009; Vetrivel et al., 2009; Yokoi et al., zDHHC15 in primary rat hippocampal cultures reduces dendritic 2016), proteins that have been shown to play an important role in the outgrowth and arborization, as well as spine maturation. Moreover, development and function of neuronal connections. ZDHHC15 is one knockdown of zDHHC15 reduces palmitoylation of PSD-95 and its of a number of genes on the X chromosome that is duplicated in trafficking into , resulting in an overall decrease in the density patients with intellectual disability (Linhares et al., 2016; Martinez of excitatory being formed onto mutant cells. et al., 2014), and one report has identified the loss of a ZDHHC15 transcript in a female patient with non-syndromic X-linked KEY WORDS: zDHHC15, Palmitoyl , Palmitoylation, intellectual disability (Mansouri et al., 2005). Excitatory synapses, PSD-95, DLG4, Dendrite morphology Our study characterizes the role of zDHHC15 in the development of neuronal connectivity. zDHHC15 is highly expressed at embryonic INTRODUCTION stages and reduced in adult . Knockdown of zDHHC15 in Post-translational modification of cellular proteins by S-acylation hippocampal cultures reduces dendritic arborization and spine involves the reversible attachment of fatty acids to cysteine residues, maturation. Notably, zDHHC15 knockdown results in a marked and is important for the trafficking of proteins towards cell reduction in the density of excitatory synapses, resulting from reduced membranes and the regulation of cellular signaling (Fukata and palmitoylation of PSD-95 and its trafficking into dendrites. Fukata, 2010; Ko and Dixon, 2018). Palmitoylation is the reversible attachment of the fatty acid palmitic acid, and is the most common RESULTS AND DISCUSSION post-translational lipid modification in the brain (Fukata and Fukata, zDHHC15 is expressed during early stages of brain 2010). Enzymes that mediate palmitoylation consist of a family of development, and in cultured excitatory and inhibitory 23 proteins containing a conserved Asp-His-His-Cys (DHHC) hippocampal motif that is required for enzymatic activity (Fukata and Fukata, ZDHHC15 mRNA is abundantly expressed in the brain compared to 2010). Nine of the 23 genes zinc finger DHHC-type other tissues (Fukata et al., 2004). After validating the specificity of (zDHHC) enzymes have been associated with brain disorders our zDHHC15 antibody (Fig. S1A-C), we determined that zDHHC15 and ∼41% of all identified synaptic proteins are substrates for is highly expressed during early stages of development – i.e. at palmitoylation (Sanders et al., 2015), underscoring the importance embryonic day 17 (E17) and postnatal day 10 (P10) – and significantly of palmitoylation in the development and function of the brain and, reduced in the adult (P90) brain (Fig. 1A,B). specifically, in synapse . Despite their implied importance, To further examine the cellular and subcellular distribution of little is known about the role of zDHHC enzymes in the brain and zDHHC15, we immunostained primary hippocampal cultures at whether disrupting their enzymatic activity contributes to brain 13 days in vitro (DIV). zDHHC15 was observed in all neurons (identified by using anti-MAP2 antibody) – including GAD65- positive inhibitory neurons, demonstrating that zDHHC15 is Department of Cellular & Physiological Sciences & the Brain Research Centre, University of British Columbia, 2350 Health Sciences Mall, Vancouver, B.C., expressed in both excitatory and inhibitory neurons. In contrast, in V6T-1Z3, Canada. these young cultures, zDHHC15 was not expressed in GFAP- *These authors contributed equally to this work expressing glial cells (Fig. 1C). ‡Author for correspondence ([email protected]) zDHHC enzymes have been shown to localize to the plasma membrane and/or organelle membranes (Ohno et al., 2006). To B.S.S., 0000-0001-6594-5871; S.X.B., 0000-0003-0102-9297 determine whether zDHHC15 is localized to the plasma membrane, This is an Open Access article distributed under the terms of the Creative Commons Attribution we performed a surface biotinylation assay using neurons at 13 DIV License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed. (Fig. 1D). Unlike zDHHC5 or zDHHC8, which have previously been shown to localize to plasma membranes (Brigidi et al., 2015;

Received 23 January 2019; Accepted 28 May 2019 Ohno et al., 2006), zDHHC15 was not isolated in surface fractions, Journal of Cell Science

1 SHORT REPORT Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052

Fig. 1. zDHHC15 is expressed during early stages of neocortical development and in Golgi compartments of cultured excitatory and inhibitory neurons. (A,B) Western blot and quantification of zDHHC15 protein levels in the (Hc), (C), hindbrain (Hb) or (Cb) of mouse brain at E17, P10 and P90. Levels of zDHHC15 decreased from E17 to P90 in these regions of mouse brain. n=4 tissue samples per time point, *P<0.05, **P<0.001, one-way ANOVA with Tukey’s post-hoc test, means±s.e.m. (C) Representative confocal images of 13 DIV rat hippocampal cultures. All neurons, identified by using anti-MAP2 antibody (white arrows), expressed zDHHC15 (yellow arrows) – including inhibitory GAD65-positive neurons (white arrowheads). GFAP-positive glial cells (green arrows) exhibited weak to no zDHHC15 immunostaining. White arrows denote DAPI-stained nucleithat are positive for zDHHC15, whereas green arrows denote DAPI-stained nuclei that are negative for zDHHC15. (D) Western blot of lysates from biotinylated neurons at 13 DIV probed for zDHHC5, zDHHC8 and zDHHC15; the latter is not localized at the membrane. n=3 cultures. (E) zDHHC15 colocalizes with the cis-medial Golgi marker giantin. (F-H) Microimages (F) showing 13 DIV rat hippocampal neurons stained for zDHHC15 and the synaptic markers PSD-95 and gephyrin. zDHHC15 colocalizes with a small subset of PSD-95 or gephyrin puncta. zDHHC15 and PSD-95 images were masked as per Fig. S2E. μ

n=10 neurons, three cultures. Scale bars: 100 µm (C), 20 µm (E, top) and 10 m (E, bottom; F). Journal of Cell Science

2 SHORT REPORT Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052 suggesting it is restricted to internal membranes. Coimmunostaining altered following changes in synaptic activity. Together, these data with zDHHC15 and the Golgi marker giantin demonstrated that suggest that zDHHC15 mediates its function during early stages of zDHHC15 is highly expressed in the somatic Golgi complex as well neuronal development, and that its primary site of action is at Golgi as in dendrites – with 67±3% of all zDHHC15-positive puncta compartments that are distinct from Golgi satellites associated with localizing with giantin (Fig. 1E,F). The localization of zDHHC15 in excitatory or inhibitory synapses. the somatic Golgi of neurons is in accordance to a previous report demonstrating zDHHC15 localization to the Golgi compartment of zDHHC15 promotes dendritic outgrowth and arborization HEK293 cells (Greaves et al., 2008) and hippocampal neurons In humans, the ZDHHC15 gene is located on the X-chromosome and (Levy et al., 2011). loss of ZDHHC15 transcript has previously shown to be associated As zDHHC15 was distributed in a punctate manner within with intellectual disabilities (Mansouri et al., 2005). Based on this and dendrites, we determined whether zDHHC15 localized to PSD-95 the high expression of zDHHC15 protein during development, we and gephyrin puncta that – as demonstrated by us – are faithful hypothesized that zDHHC15 is important for neuronal connectivity. excitatory and inhibitory markers, respectively (Fig. S2A-D). The To test this, we generated small hairpin RNA targeting zDHHC15 density of colocalized zDHHC15 and PSD-95, and zDHHC15 and (shRNA; validated in Fig. 2A) and examined whether zDHHC15 gephyrin puncta was quantified within eGFP ‘masks’ of neurons knockdown impacts neuronal morphology (see Fig. S3A,B for raw (Fig. S2E). Coimmunostaining demonstrated minimal localization images, masking, tracing and Sholl analysis). Neurons of zDHHC15 at synapses (Fig. 1G). Only 18±2% of zDHHC15- expressing zDHHC15 shRNA exhibited significantly shorter positive puncta colocalized with PSD-95 and 10±2% colocalized dendrites (Fig. 2B,C), decreased branch count (Fig. 2B,D) and with gephyrin (in turn 22±2% of PSD-95-positive and 23±3% of less dendritic complexity (Fig. 2B,E) compared to neurons gephyrin-positive puncta colocalized with zDHHC15) (Fig. 1G,H). transfected with control shRNA. These dendritic defects were Although the modest colocalization of PSD-95 and zDHHC15 may rescued in cells expressing an shRNA-resistant zDHHC15 construct appear surprising – as PSD-95 is a known substrate of zDHHC15 (zDHHC15R) (Fig. 2B-E). To determine whether the palmitoylation (Fukata et al., 2004) – zDHHC15 function is thought to be function of zDHHC15 is important for dendritic outgrowth, cells dependent on synaptic activity (Noritake et al., 2009). It is, were co-transfected with shRNA and palmitoylation-deficient therefore, possible that the subcellular localization of zDHHC15 is zDHHC15, in which the cysteine residue of DHHC had been

Fig. 2. zDHHC15 promotes dendritic growth and arborization. (A) Western blot of rat hippocampal neurons nucleofected at 0 DIV, lysed at 4 DIV and probed with indicated antibodies. n=3 cultures. (B) Rat hippocampal neurons were transfected with the indicated constructs, fixed and imaged at 13 DIV. Images shown have been manually masked to remove background ; raw images are available in Fig. S3A with an example of masking, tracing and Sholl analysis available in Fig. S3B. Scale bar: 100 µm. (C-E) Quantification of dendrite length and counts from 13 DIV rat hippocampal neurons. Knockdown of zDHHC15 (using shRNA targeting zDHHC15, referred to as shRNA) decreases dendritic length and complexity. Statistical significance was calculated for the entire Sholl profile. n=43 (control), 49 (shRNA), 34 (shRNA+zDHHC15), 40 (shRNA+zDHHS15), 36 (zDHHC15) neurons, three cultures. **P<0.01, ***P<0.001, one

way ANOVA and Tukey’s post-hoc test; mean±s.e.m. Journal of Cell Science

3 SHORT REPORT Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052 changed to serine (zDHHS15R). Although expression of post transfection using time-lapse imaging. At 72 h post zDHHS15R was similar to that of zDHHC15R (Fig. 2A), it was transfection, cells expressing zDHHC15 shRNA exhibited an unable to rescue the knockdown phenotype, indicating that the increase of only 13±4.7% in total dendritic length, whereas enzymatic activity of zDHHC15 is essential for zDHHC15- dendrite length of cells expressing control shRNA, mediated regulation of dendritic arbor length and complexity shRNA+zDHHC15R or zDHHC15 alone increased by 33±3.9%, (Fig. 2B-E). Overexpression of zDHHC15 had no effect on dendrite 34±4.0% or 39±6.1%, respectively (Fig. 3A,B, raw images length, number or complexity (Fig. 2B-E). Fig. S3C). These data indicate that zDHHC15 is required for To further investigate whether zDHHC15 promotes dendritic dendritic outgrowth and not stability, because knockdown of outgrowth or stabilization, neurons were imaged every 24 h for 72 h zDHHC15 inhibited further dendritic outgrowth.

Fig. 3. zDHHC15 knockdown to inhibition of dendritic outgrowth and formation of mature spines. (A) Representative, masked, time-lapse confocal images of neurons transfected at 10 DIV with eGFP plus the indicated constructs and imaged 24, 48 and 72 h post transfection. Raw images are available in Fig. S3C. Scale bar: 100 µm. (B) zDHHC15 knockdown inhibits dendrite growth. n=10 neurons, three cultures. (C-E) Hippocampal neurons at 10 DIV transfected with the indicated constructs, fixed, and imaged at 13 DIV to calculate the density (C) and type (D,E) of spiny protrusions. While there was no significant change in the density of overall protrusions (C), zDHHC15 knockdown significantly increased the proportion of filopodia (D) and reduced the proportion of mature, mushroom and stubby spines (E). n=56 (control), 43 (shRNA), 38 (shRNA+zDHHC15), 33 (shRNA+zDHHS15), 31 (zDHHC15) neurons, three cultures. ***P<0.001; ns, not significant; one-way ANOVA and Tukey’s post-hoc test (C-E), mean±s.e.m. Journal of Cell Science

4 SHORT REPORT Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052 zDHHC15 promotes spine maturation and the formation in zDHHC15 knockdown cells. Hippocampal neurons were of excitatory synapses nucleofected with zDHHC15 shRNA resulting in a 58±3.8% We next determined whether zDHHC15 regulates the formation and/ efficiency of transfection (investigated by counting the eGFP- or maturation of spiny protrusions – including filopodia – that exhibit positive transfected cells in each culture before lysis). By using the dynamic motility and are associated with smaller, less-mature acyl-RAC assay, we demonstrated a 62.5±7.54% reduction in synapses, as well as with stubby or mushroom spines, which are PSD-95 palmitoylation in primary neuron cultures transfected with typically associated with large, mature synapses (Casanova et al., zDHHC15 shRNA compared to control shRNA, with no change in 2012; Marin-Padilla, 1972). Although knockdown of zDHHC15 did total PSD-95 levels (Fig. 4I,J). not impact the total number of spiny protrusions at 13–14 DIV Previous work has demonstrated that the N-terminal (Fig. 3C), it resulted in a significant increase in the proportion of thin, palmitoylation motif of PSD-95 is necessary for targeting of immature protrusions, and a decrease in the proportion of mature, PSD-95 into dendrites (El-Husseini Ael et al., 2001), as well as its stubby and mushroom spines (Fig. 3D,E). Although zDHHC15R association with vesiculotubular structures that traffic PSD-95 to rescued this knockdown phenotype, palmitoylation-defective synapses (El-Husseini et al., 2000). To determine whether zDHHC15 zDHHS15R did not, indicating that zDHHC15 regulates spine is specifically involved in the targeting and trafficking of PSD-95, morphology and maturation through its palmitoylation function. hippocampal neurons were transfected with PSD-95-RFP plus the As the excitatory postsynaptic protein PSD-95 can be constructs indicated in Fig. 4K. All PSD-95 puncta within an entire palmitoylated by zDHHC15 (as well as by zDHHC2, zDHHC3 dendrite were photobleached, and fluorescent recovery within the and zDHHC7) (Fukata et al., 2004), and because knockdown of photobleached dendrite was measured 9 h after photobleaching zDHHC15 decreases the proportion of mature spines (Fig. 3D,E), we (Fig. 4K,L). While neurons transfected with control shRNA exhibited next investigated whether zDHHC15 regulates the formation and/or 73±7% recovery of PSD-95-RFP fluorescence, neurons transfected maintenance of synaptic connections. At 10 DIV, cultures were with zDHHC15 shRNA exhibited only 35±6% recovery. This transfected with eGFP plus the constructs indicated in Fig. 4A, masks knockdown phenotype was rescued by co-transfecting neurons were generated as previously described (Fig. S2E) (Brigidi et al., with zDHHC15R (80±8% recovery) (Fig. 4K,L). In support of the 2015), and cells immunostained for PSD-95 and gephyrin. fact that zDHHC15 regulates trafficking of PSD-95 into dendrites, zDHHC15 knockdown led to a significant reduction in the density PSD-95-RFP levels were significantly higher in the of neurons of puncta positive for PSD-95 but not gephyrin (Fig. 4A,B), causing expressing shRNA targeting zDHHC15 (referred to in the figure as an overall decrease in the ratio of excitatory to inhibitory (E:I) shRNA) (Fig. 4K). synapses (Fig. 4C). Of note, zDHHC15 knockdown also resulted in a Our data suggest that the decrease in density decrease in the density of colocalized PSD-95 and/or VGlut1 within zDHHC15 knockdown neurons is due to decreased PSD-95 (vesicular 1, an excitatory presynaptic marker) trafficking into dendrites. While the synapse density phenotype in demonstrating a reduction in excitatory synapse number, and not just knockdown cells could be rescued by zDHHC15, zDHHC3 and PSD-95 density (Fig. 4D, Fig. S2F). While expression of wild-type zDHHC2, all of which mediate PSD-95 palmitoylation (Fukata zDHHC15R rescued the knockdown phenotype, zDHHS15R did not, et al., 2004), the rescue with either zDHHC3 or zDHHC15 was indicating that the enzymatic activity of zDHHC15 is important for its significantly more robust than the rescue with zDHHC2. As regulation of excitatory synapse density (Fig. 4A-C). zDHHC3 and zDHHC15 are both localized to the somatic Golgi As PSD-95 is also palmitoylated by zDHHC2, zDHHC3 and (Greaves et al., 2011; Noritake et al., 2009), it is likely that these two zDHHC7 (Fukata et al., 2004), we determined whether overexpression enzymes regulate excitatory synapse density by palmitoylating of these enzymes can rescue the zDHHC15 knockdown phenotype PSD-95 and promoting the trafficking of PSD-95 into dendrites. In (we did not use zDHHC7 as its levels are low in the hippocampus) contrast, zDHHC2 is localized to dendritic compartments (Greaves (https://www.proteinatlas.org/ENSG00000153786-ZDHHC7/tissue) et al., 2011; Noritake et al., 2009), and has been shown to mediate and proved difficult to express (validation of zDHHC2 and zDHHC3 PSD-95 palmitoylation and to promote its clustering at synapses expression, Fig. S4). The zDHHC15 shRNA-mediated decrease in (Noritake et al., 2009). PSD-95 density was rescued by zDHHC3 and zDHHC15 and, to a Together, our data demonstrate a role for zDHHC15 in the lesser extent, zDHHC2 (Fig. 4D). Moreover, while zDHHC15 regulation of dendritic outgrowth, and the formation and maturation knockdown did not impact PSD-95 puncta size, coexpression of of glutamatergic synapses. This is of particular interest, given the zDHHC15 shRNA with zDHHC2 enhanced the area of PSD-95 association between zDHHC15 and X-linked intellectual disability clusters by around 10%, suggesting a different mechanism of action (Mansouri et al., 2005; Piton et al., 2013), and the fact that (Fig. 4E). In concordance with zDHHC2 and zDHHC3’s ability to disruptions in dendrite outgrowth and synapse function are one of rescue PSD-95 density, expression of these proteins rescued spine the most-consistent hallmarks of intellectual disability, observed in maturation (Fig. 4F,G). However, in contrast to the ability of zDHHC2 both postmortem brain sections and mouse models of intellectual and zDHHC3 to rescue synapse density and spine maturation, neither disability (Casanova et al., 2012; Huttenlocher, 1974; Jiang et al., zDHHC2 nor zDHHC3 rescued zDHHC15 knockdown-mediated 1998; Marin-Padilla, 1972; Purpura, 1974; Swann et al., 2000). changes regarding the dendritic length (Fig. 4H). These results demonstrate that zDHHC15 knockdown decreases excitatory synapse MATERIALS AND METHODS density and outgrowth, and that the pathway regulating excitatory Contact for reagent and resource sharing synapse density is independent of the pathway involved in dendritic Further information and requests for reagents may be directed to and will be length and complexity. fulfilled by the corresponding author S.X.B. Antibodies zDHHC15 promotes the trafficking of PSD-95 into dendrites Primary antibodies used were: anti-zDHHC15 (Abcam, Cambridge, MA, As zDHHC15 is known to palmitoylate PSD-95, and because #ab121203, 1:250, western blot), anti-zDHHC15 (Thermo Scientific, excitatory synapse density is reduced following zDHHC15 Waltham, MA, #PA39327, immunofluorescence, 1:100), anti-Flag knockdown, we tested whether PSD-95 palmitoylation is decreased (Sigma Aldrich, St Louis, MO, #F3165, 1:1000), anti-Myc (Origene, Journal of Cell Science

5 SHORT REPORT Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052

Rockville, MD, #TA150121, 1:1000), anti-β- (Novus Biologicals, Franklin Lakes, NJ, #610822, 1:200). Secondary antibodies from Life Centennial, CO, #NB600-503, 1:1000), anti-PSD-95 (Abcam, Technologies (Carlsbad, CA,) used: (1:500), anti-mouse AF568 IgG2a Cambridge, MA, #ab2723, 1:500), anti-gephyrin (Synaptic Systems, (#A21134), anti-mouse AF647 IgG1 (#21240), anti-rabbit AF488 Göttingen, Germany #147011, 1:500), anti-GAD65 (Synaptic (#A11008), anti-rabbit AF568 (#A11011), anti-guinea pig AF633 Systems, Göttingen, Germany #198104, 1:500), anti-GFAP (Synaptic (#A21105). HRP conjugated secondary antibodies were obtained from Systems, Göttingen, Germany #173004, 1:400), anti-MAP2 (Millipore, Bio-Rad (Hercules, CA): goat anti-mouse #170-6516 and goat anti-rabbit Burlington, MA, MB3418, 1:2000), anti-giantin (Synaptic Systems, (#170-6515, 1:300). DAPI was used for nuclear staining (Life Göttingen, Germany, #263004, 1:500), anti-GM130 (BD Biosciences, Technologies, Carlsbad, CA, #D1306, 1:1000).

Fig. 4. See next page for legend. Journal of Cell Science

6 SHORT REPORT Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052

Fig. 4. zDHHC15 knockdown decreases excitatory synapse density in was carried out by using the following forward and reverse primers: Forward hippocampal neurons and disrupts PSD-95 trafficking into dendrites. 5′-CAGAGAAAAATGGGTTTAATCTAGGATTCATAAAGAATATTC- (A) Representative confocal images of rat hippocampal neurons at 13 DIV AG-3′ and Reverse 5′-CTGAATATTCTTTATGAATCCTAGATTAAAC- expressing eGFP plus the indicated constructs. Control shRNA is a scrambled CCATTTTTCTCTG-3′ (underlined residues indicate amino acid form of the shRNA targeting zDHHC15 (zDHHC15 shRNA, shortened to codons where nucleotide bases were mutated). zDHHS15R was made by R shRNA) to ensure there are no off-target effects of the shRNA. zDHHC15 is a using the zDHHC15R template with the following forward and reverse form of zDHHC15 that has had mutations introduced to modify the sequence ′ ′ R primers: Forward 5 -AAATGGACCATCATTCCCCATGGGTTA-AT-3 recognized by the targeting shRNA to make it shRNA resistant. zDHHS15 is and Reverse 5′-ATTAACCCATGGG-GAATGATGGTCCATTT-3′. a construct wherein the catalytic cysteine has been modified to serine to reduce palmitoylation activity and is also resistant to the targeting shRNA. Immunostaining was for the excitatory post-synaptic marker, PSD-95 and the Experimental model and subject details inhibitory post-synaptic marker gephyrin (masked as per Fig. S2E). Scale bar: Animals 10 µm. (B) The density of PSD-95-positive puncta is significantly decreased in All experimental procedures and housing conditions were approved by the zDHHC15 knockdown neurons, while the density of gephyrin-positive puncta UBC Animal Care Committee and were in accordance with the Canadian remains unchanged. (C) This alters the ratio of excitatory:inhibitory synapse Council on Animal Care (CCAC) guidelines. density being formed onto zDHHC15 mutant neurons. n=51 (control), 43 (shRNA), 33 (shRNA+zDHHC15), 34 (shRNA+zDHHS15), 33 (zDHHC15) Primary culture from Sprague-Dawley rats neurons, three cultures. (D) The zDHHC15 shRNA-mediated reduction in Hippocampi from embryonic day 18 (E18) Sprague-Dawley rats excitatory synapse density (density of colocalized PSD-95 and excitatory pre- (Rattus norvegicus) of either sex were prepared and plated on 18 mm synaptic marker VGlut1 puncta) is rescued by coexpression of zDHHC15, Marienfeld (Lauda-Königshofen, Germany) coverslips for 12-well plates or zDHHC2 or zDHHC3. (E) The area of PSD-95 puncta is unchanged in cells directly onto the plastic of 6-well plates at a density of 130 cells/mm2. expressing zDHHC15 shRNA but significantly increased compared to controls Coverslips had previously been treated with concentrated nitric acid in cells expressing zDHHC15 shRNA plus zDHHC2. (F,G) zDHHC15, (Sigma Aldrich, St Louis, MO) overnight, rinsed several times with milliQ zDHHC2 and zDHHC3 rescue zDHCH15 shRNA-mediated changes in the water, then sterilized with high heat (>250°C overnight). Coverslips were proportion of filopodia (F) and mature spines (G). (H) By contrast, zDHHC2 and then placed in the 12-well plate, UV sterilized for 30 min, and coated with zDHHC3 are unable to rescue zDHHC15-mediated decreases in dendritic 0.5 mg/mL poly-L-lysine hydrobromide mixed with borate buffer. The length. n=25 neurons, three cultures. (I) Acyl-RAC assay from cultured neurons plates were covered with aluminium foil and left in a biosafety cabinet at 7 DIV that were nucleofected with control or zDHHC15 shRNA. Left panel overnight. The following day, coverslips were rinsed 3× with autoclaved (input levels): zDHHC15 was reduced by 66.25±6% in neurons that had been milliQ water and plating medium (84.75 ml MEM with Earle’s BSS, 10 ml transfected with zDHHC15 shRNA, reflecting the efficiency of transfection. No changes in PSD-95 levels were observed. Right panel (Acyl-RAC fractions): FBS, 2.25 ml of 20% glucose, 1 ml sodium pyruvate, 1 ml 100×GlutaMax, Results from the same blot; PSD-95 palmitoylation is decreased in cultures 1 ml 100×Pen/Strep) was added (1 ml per 12 well, 2 ml per 6 well). Plates transfected with zDHHC15 shRNA (cleaved bound fraction, cBF), low levels of were then placed in the 5% CO2 incubator at 37°C overnight. non-palmitoylated PSD-95 (cUF, cleaved unbound fraction), and minimal non- For dissection, timed-pregnant Sprague-Dawley rats (Rattus norvegicus, specific binding to the resin (pBF, preserved bound fraction). The pUF Jackson Laboratories, Sacramento, CA) were euthanized using CO2 and cervical (preserved unbound fraction) represents samples that have not been cleaved. dislocation. Pups were harvested into 150-mm Petri dishes and decapitated, and (J) PSD-95 palmitoylation is decreased in zDHHC15 knockdown neurons. n=3 the brains were then dissected out and placed in pre-chilled HBSS on ice. cultures. ***P<0.001, Student’s t-test, mean±s.e.m. (K) Hippocampal neurons Hippocampi were dissected and placed in a 15 ml conical tube with 10 ml of at 10 DIV were transfected with the indicated constructs plus PSD-95-RFP. fresh pre-warmed (37°C) HBSS. Once hippocampi settled, supernatant was Puncta of PSD-95-RFP within an entire primary dendrite branch (white outline) removed and replaced with 10 ml of fresh pre-warmed HBSS for a total of three were photobleached at 13 DIV and fluorescence recovery was analysed 9 h rinses. After the final rinse, 4.5 ml of fresh, pre-warmed HBSS was added to the after bleaching. Fluorescence recovery was decreased in cells expressing hippocampi with 0.5 ml of 2.5% trypsin and incubated in a 37°C water bath for zDHHC15 shRNA (PSD-95 puncta pseudo-colored for fluorescence 20minwithgentleagitationevery5min.Inthefinal3min,1%DNasewas intensity). Magnified area of interest shown below. Scale bar: 10 µm. added and gently agitated to ensure mixture. Hippocampi were then rinsed 3× (L) Quantification of fluorescence recovery. n=10 neurons, three cultures. with fresh, prewarmed HBSS and, after the final wash, ∼1 ml of HBSS was used /### /## ’ *** P<0.001, ** P<0.01, *P<0.05, one-way ANOVA and Tukey s post-hoc to transfer hippocampi to a 60-mm dish for trituration. The total volume test, mean±s.e.m. following trituration was brought up to 5 ml and cell density was determined using a hemocytometer to plate at the desired density. At 3-4 h after plating, Plasmids and primers plating medium was aspirated and replaced with pre-warmed (37°C) The rat Myc-DDK tagged zDHHC15 ORF construct was obtained maintenance media (97 ml Neurobasal medium, 2 ml 50× B-27 supplement, from Origene (Rockville, MD, #RR212342). The shRNA target sequence 1 ml 100×GlutaMax, 1 ml 100× Pen/Strep). Maintenance medium was renewed that gave maxium knockdown efficiency of zDHHC15 was 5′- with fresh maintenance medium 2–3 days following plating. GGTTCAATCTTGGCTTCATCA-3′ and was cloned into the pLL3.7 vector (a gift from Luk Parijs; Addgene plasmid #11795) using the Method details following and anti-sense sequences based on previous cloning Transfection (primary hippocampal cultures/HEK293T cells) experiments in pLL3.7 using XhoI and HpaI sites (Rubinson et al., 2003): Primary hippocampal cultures were transfected at 9–11 DIV by using Sense: 5′-TGGTTCAATCTTGGCTTCATCATTCAAGAGATGATGAA- Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the GCCAAGATTGAACCTTTTTTC-3′ and antisense: 5′-TCGAGAAAAA- manufacturer’s recommendations. Briefly, for 12-well-plates, two aliquots AGGTTCAATCTTGGCTTCATCATCTCTTGAATGATGAAGCCAAG- of 25 μl Opti-Mem (Gibco, Thermo Fisher Scientific, Waltham, MA) were ATTGAACCA-3′. This plasmid is referred to as shRNA in all figures. To prepared. To one aliquot, 1–3 μg of total plasmid DNA was added. To the generate a scrambled shRNA construct to control for potential off-target other aliquot, 1 μl of Lipofectamine 2000 was added and allowed to mix for effects of shRNA (control shRNA), we used the following sense and anti- 5 min. After this period, aliquots were combined and incubated for 20 min, sense sequence: Sense: 5′-TGAAGTTCGTACTTATCTCCGTTTCAAG- then added drop by drop to the 12-well plates. Cells were then live imaged AGAACGGAGATAAGTACGAACTTCTTTTTTC-3′ and antisense: 5′- (10–13 DIV) or fixed (13 DIV) for subsequent experiments. HEK293T cells TCGAGAAAAAAGAAGTTCGT-ACTTATCTCCGTTCTCTTGAAAC- were transfected with Lipofectamine 2000 (Invitrogen) at 70% confluency at GGAGATAAGTACGAACTTCA-3′. To generate an shRNA-resistant form a ratio of 3:1 (shRNA or scrambled shRNA to target plasmid) and incubated of zDHHC15 (zDHHC15R), site-directed mutagenesis (Agilent for 48–72 h before harvesting for biochemical analysis. For HEK293T cells, Technologies, Santa Clara, CA: QuikChange II XL Site-Directed 150 µl Opti-Mem were used with 6 µl Lipofectamine 2000. Mutagenesis Kit, 200521) of the zDHHC15 ORF sequence Nucleofections for 6-well plate biochemical assays were performed

GGTTCAATCTTGGCTTCATCA into GGTTTAATCTAGGATTCATAA immediately before plating at 0 DIV by using an Amaxa Nucleofection Kit Journal of Cell Science

7 SHORT REPORT Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052

(Lonza, Basel, Switzerland, VPG-1003) according to the manufacturer’s Western blot analysis optimized protocol (Number 101, program G-13), and were used for Western blotting was performed as previously described (Sun and Bamji, experiments at either 4 DIV (Fig. 2A) or 7 DIV (Fig. 4I). Briefly, 2011). Primary hippocampal neurons from Sprague-Dawley rats, HEK293T hippocampi were dissociated as above and ∼500,000 neurons isolated for cells, or brain regions from mouse (i.e. cortex or cerebellum) were lysed at nucleofection. Neurons were mixed with 100 μl Ingenio electroporation the time points indicated in figures (Fig. 1A, mouse brain regions, E17, P10, solution (Mirus Bio, Madison, WI) and cDNA constructs (∼3 μg in total) P90; Fig. 1D, hippocampal neurons, 13 DIV; Fig. 2A, Fig. S4, hippocampal were added to the solution. The solution was transferred to an Amaxa neurons, 4 DIV; Fig. 4I, hippocampal neurons, 7 DIV; Fig. S1A, HEK293T Nucleofection cuvette and inserted into the Amaxa Nucleofector with cells, 95–100% confluency) in ice-cold RIPA buffer or lysis buffer (1% program G-013. Following electroporation, the solution was plated into a 6- IGEPAL CA-630, 50 mM Tris-HCl-pH 7.5, 150 mM NaCl, 10% glycerol) well dish for future biochemical experiments. supplemented with protease inhibitor cocktail solution at 4°C on a nutator (VWR Nutating Mixer) for 2 h at 20° fixed tilt and 24 rpm. Lysates were Immunocytochemistry cleared by benchtop centrifugation (16,000 g) for 30 min at 4°C and the Immunocytochemistry experiments were performed as previously reported supernatant was mixed with 5×SDS dye for SDS-PAGE. Proteins were (Sun and Bamji, 2011). Briefly, cells were fixed for 10 min in a pre-warmed separated on either a 10% resolving gel or a 4–20% gradient gel, transferred (37°C) 4% paraformaldehyde–sucrose solution. Cells were then washed in onto a PVDF membrane, blocked in 3% BSA (in TBST) and were then phosphate buffered saline (PBS) and treated with 0.1% Triton X-100 in PBS immunoblotted for were then immunoblotted for zDHHC15 (Fig. 1A,D, for 10 min at room temperature, washed in PBS, and blocked for 1 h at room Fig. 2A, Fig. 4I; Fig. S1A), β-actin (Fig. 1A, Fig. 2A, Fig. 4I; Fig. S1A, temperature with 10% goat serum in PBS. Cells were then incubated in 1% Fig. S4), zDHHC5 (Fig. 1D), zDHHC8 (Fig. 1D), PSD-95 (Fig. 4I) or Myc goat serum in PBS with primary antibodies overnight at 4°C. Subsequently, (Fig. S1A, Fig. S4) (prepared in 0.3% BSA in TBST) and visualized using cells were washed 3× in PBS for 10 min each, incubated in secondary enhanced chemiluminiscence reagent (Merck Millipore, #WBKLS0500) on antibodies in 1% goat serum in PBS for 1 h at RT, washed again 3× in PBS a Li-Cor C-Digit Blot Scanner (LI-COR, Lincoln, NE). Blots were and mounted on microscope slides by using Prolong Gold (Molecular quantified using ImageJ software (NIH, Bethesda, Maryland). Probes, Thermo Fisher Scientific, Waltham, MA). For DAPI staining, a 1:100 dilution from a 5 mg/ml stock was applied after all other staining Imaging procedures for 5 min. Cells were then washed 3× in PBS and then mounted Fixed and live neurons were imaged by using an inverted Olympus (Richmond as above. Hill, ONT, Canada) Fluoview 1000 (FV1000) confocal microscope. Imaging of synapses and colocalization studies utilized the 60×/1.42 Oil Plan- Biotinylation Apochromat objective while dendritic length measurements utilized the 20×/ For surface biotinylation assays, neurons in 6-well plates were washed with 0.75 Oil Plan-Apochromat objective. MatTek glass-bottomed culture dishes ice-cold PBS pH 8 supplemented with 0.1 mM CaCl2 and 1 mM MgCl2 (P35G-1.5-14-C, MatTek Corporation, Ashland, MA) were used to perform (PBS-CM) and then incubated for 30 min with 0.5 mg/ml NHS-SS-Biotin live imaging of dendrite growth of neurons in a chamber maintained at 37°C. (Thermo Fisher Scientific, Waltham, MA) in ice-cold PBS-CM at 4°C with eGFP-transfected cells with different experimental conditions were imaged in gentle rocking. After incubation, cells were washed once with PBS-CM; the HEPES buffer (140 mM NaCl, 1.3 mM CaCl2, 1.3 mM MgCl2, 2.4 mM unbound biotin was then quenched during two 8 min incubations with K2HPO4, 25 mM HEPES pH 7.4) every 24 h post transfection up to 72 h to quenching buffer (20 mM glycine in PBS-CM). Lysis was performed by ensure cell viability. Levels and contrast of confocal images were moderately mechanical scraping in lysis buffer (1% IGEPAL-CA630 and 1 mM PMSF adjusted in Photoshop CS6 software (Adobe Systems, San Jose, CA) by using with Roche complete protease inhibitor tablet) and followed by centrifugation scientifically acceptable procedures. at 500 g for 5 min at 4°C. Samples were then vortexed, run 3–4 times through a 26½ gauge syringe, and nutated at 4°C (VWR Nutating Mixer, 20° fixed tilt Fluorescence recovery after photobleaching angle with a mixing speed of 24 rpm) for 30 min. After nutation, samples Fluorescence recovery after photobleaching (FRAP) experiments were were centrifuged at 16,100 g for 30 min at 4°C to clear the lysate. Protein performed as previously described (Brigidi et al., 2014, 2015) but updated content in the cell lysate was then quantified using a BCA Assay Kit (Thermo for use on an Olympus (Richmond Hill, ONT, Canada) FV3000 Fisher Scientific, Waltham, MA) as per the manufacturer’s instructions. microscope. Briefly, cells transfected with eGFP and PSD-95 were Whole-cell lysate (10 µg) was then combined with SDS-sample buffer identified and up to four dendritic branches of the cell that were clear of (50 mM Tris-HCl, 2% SDS, 10% glycerol, 14.5 mM EDTA and 0.02% other obstructions and relatively unbranched were photobleached from the Bromophenol Blue with 1% β-mercaptoethanol), boiled for 5 min at 95°C soma to the end of the dendrite. Cell positions were recorded using the and stored at −20°C as the input sample. Of the remaining protein sample, motorized stage and ‘positions’ function of the FV3000, and re-imaged 9 h 100–200 µg was added to 50 µl of a 50% slurry of NeutrAvidin-conjugated after bleaching. Fluorescence recovery was quantified using processing agarose beads (Thermo Fisher Scientific, Waltham, MA) that had been pre- software within the Olympus FV3000 and then analyzed in Prism software washed three times in lysis buffer. Each sample was then brought to a total (Graphpad, La Jolla, CA). volume of 500 µl with lysis buffer and nutated (VWR Nutating Mixer, 20° fixed tilt angle with a mixing speed of 24 rpm) overnight at 4°C. The following day, beads were pelleted and washed seven times by centrifugation Image analysis and quantification at 500 g for 3 min, each time discarding the supernatant. Beads were eluted Dendrite length and Sholl analysis using 40 µl of SDS-sample buffer supplemented with 100 mM DTT and Neurons at 10–11 DIV were transfected and fixed at DIV 13–14. To measure samples were boiled at 90°C for 5 min followed by western blotting with dendrite lengths, neurons were identified through eGFP fluorescence and whole-cell lysates. imaged at a magnification of 20×. Images were processed using Adobe Photoshop to remove axons. Images were converted to 8-bit and then exported Acyl-RAC (palmitoylation) assay into the ImageJ tool-NeuronJ (Meijering et al., 2004) to trace the dendritic For Acyl-RAC assays, we followed the manufacturer’s protocol from the length. Sholl analysis (dendritic complexity analysis) was performed on the CAPTUREome S-palmitoylated protein kit (Badrilla, Leeds, UK), with same 20× images that were first thresholded and then processed using the minor changes. We optimized the protocol for our experiments by adding ‘Sholl analysis’ plugin from ImageJ (Ferreira et al., 2014) with settings to DNase to the lysed-cell solution. Additionally, we measured protein create a step size of 2 µm and an ending radius entered as 'NaN' (not a number) concentration (BCA Assay, Thermo Fisher Scientific, Waltham, MA) after to enable sampling of the entire image to ensure the entire dendritic tree was dissolving the precipitated protein and prior to separating the lysate into captured; see Fig. S3B. Data were imported into Microsoft Excel to create an experimental (Thioester Cleavage Reagent) and negative control (Acyl average Sholl profile for each condition. For all images, the scale for ImageJ Preservation Reagent) samples to ensure accurate loading of equal protein was set using the raw data from the Olympus FV1000/FV3000 dimensions to concentrations. determine µm per pixel. Journal of Cell Science

8 SHORT REPORT Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052

Spine analysis References Dendritic spines were classified by using the default values and analysis Brigidi, G. S., Santyr, B., Shimell, J., Jovellar, B. and Bamji, S. X. (2015). Activity- from NeuronStudio (version 0.9.92) adapted from Rodriguez et al. (2006), regulated trafficking of the palmitoyl-acyl DHHC5. Nat. Commun. 6, 8200. doi:10.1038/ncomms9200 which uses a classification scheme based on the head to neck diameter Brigidi, G. S., Sun, Y., Beccano-Kelly, D., Pitman, K., Mobasser, M., Borgland, ratio, length to head diameter ratio and the head diameter. For data S. L., Milnerwood, A. J., and Bamji, S. X. (2014). Palmitoylation of δ-catenin by analysis, stubby and mushroom-type spines were classified as mature DHHC5 mediates activity-induced synapse plasticity. Nat. Neurosci. 17, 522-532. spines, whereas filopodial and/or thin protrusions were considered as doi:10.1038/nn.3657 immature spines. Casanova, J. R., Nishimura, M., Owens, J. W. and Swann, J. W. (2012). Impact of on developing dendrites: implications for intellectual developmental disabilities. Epilepsia 53 Suppl. 1, 116-124. doi:10.1111/j.1528-1167.2012. Synapse density, puncta size analysis and colocalization 03482.x Transfected neurons were immunostained for PSD-95 (as a marker of Charollais, J. and Van Der Goot, F. G. (2009). Palmitoylation of membrane proteins (Review). Mol. Membr. Biol. 26, 55-66. doi:10.1080/09687680802620369 excitatory synapses) and gephyrin (as a marker for inhibitory synapses). El-Husseini, A. E., Craven, S. E., Chetkovich, D. M., Firestein, B. L., Schnell, E., Synapses within eGFP-transfected neurons were identified by making a Aoki, C. and Bredt, D. S. (2000). Dual palmitoylation of PSD-95 mediates its neuronal ‘mask’ created from the GFP-cell fill, imaged at 60× vesiculotubular sorting, postsynaptic targeting, and clustering. J. Cell magnification, in Adobe Photoshop CS6 or CC2017 (Adobe Systems, Biol. 148, 159-172. doi:10.1083/jcb.148.1.159 San Jose, CA). The mask was devoid of cell soma and . We used a El-Husseini Ael, D., Craven, S. E., Brock, S. C. and Bredt, D. S. (2001). Polarized magic wand tool (non-contiguous, tolerance 30) to select a black targeting of peripheral membrane proteins in neurons. J. Biol. Chem. 276, 44984-44992. doi:10.1074/jbc.M103049200 background and this cell-fill GFP mask was applied onto PSD-95-positive Fang, C., Deng, L., Keller, C. A., Fukata, M., Fukata, Y., Chen, G. and Luscher, B. and/or gephyrin-positive synapse marker channels to exclude synapses from (2006). GODZ-mediated palmitoylation of GABA(A) receptors is required for other untransfected neurons and only examine synapses that had formed on normal assembly and function of GABAergic inhibitory synapses. J. Neurosci. 26, mutant cells. These masks from synapse channels were then manually 12758-12768. doi:10.1523/JNEUROSCI.4214-06.2006 thresholded to make binary images and the total number of synaptic puncta Ferreira, T., Ou, Y., Li, S., Giniger, E. and van Meyel, D. J. (2014). Dendrite was quantified using a macro in order to define synaptic puncta as having a architecture organized by transcriptional control of the F-actin nucleator Spire. 2 2 Development 141, 650-660. doi:10.1242/dev.099655 size between 0.05 µm and 3 µm . To obtain synapse density, the total Fukata, Y. and Fukata, M. (2010). Protein palmitoylation in neuronal development number of puncta was divided by the length of the masked dendrite (see Fig. and . Nat. Rev. Neurosci. 11, 161-175. doi:10.1038/nrn2788 S1B). For the puncta size measurements, masked images were subjectively Fukata, M., Fukata, Y., Adesnik, H., Nicoll, R. A. and Bredt, D. S. (2004). thresholded and PSD-95-positive puncta were measured for Feret’s Identification of PSD-95 palmitoylating enzymes. Neuron 44, 987-996. doi:10. diameter, and then averaged for each image under each condition. Masked 1016/j.neuron.2004.12.005 ‘ ’ Greaves, J., Salaun, C., Fukata, Y., Fukata, M. and Chamberlain, L. H. (2008). images were then thresholded, and the Colocalization plugin (https:// Palmitoylation and membrane interactions of the neuroprotective chaperone imagej.nih.gov/ij/plugins/colocalization.html) was used in a custom macro cysteine-string protein. J. Biol. Chem. 283, 25014-25026. doi:10.1074/jbc. when applying the ‘Analyze Particles’ function of ImageJ (NIH, Bethesda, M802140200 MA) to determine colocalized points from separate channels. Greaves, J., Gorleku, O. A., Salaun, C. and Chamberlain, L. H. (2010). Palmitoylation of the SNAP25 protein family: specificity and regulation by DHHC palmitoyl transferases. J. Biol. Chem. 285, 24629-24638. doi:10.1074/ Statistical analysis jbc.M110.119289 For all experiments, data represent the mean±s.e.m. Statistical significance Greaves, J., Carmichael, J. A. and Chamberlain, L. H. (2011). The palmitoyl was measured using ANOVA with Tukey’s multiple comparison analysis transferase DHHC2 targets a dynamic membrane cycling pathway: regulation by a in Graphpad Prism v6.01 (Graphpad, La Jolla, CA). For all imaging C-terminal domain. Mol. Biol. Cell 22, 1887-1895. doi:10.1091/mbc.e10-11-0924 Huttenlocher, P. R. (1974). Dendritic development in of children with experiments, the n value is the number of cells used per condition, for at least mental defect and infantile spasms. 24, 203-210. doi:10.1212/WNL. three independent cultures. Statistical significance is assumed when α<0.05, 24.3.203 unless mentioned otherwise (Figs 3E,F and 4F,G, where the α-value is made Jiang, M., Lee, C. L., Smith, K. L. and Swann, J. W. (1998). Spine loss and other more-stringent to 0.001). Significance is indicated when */#P<0.05, persistent alterations of hippocampal dendrites in a model of early- **/##P<0.01 or ***/###P<0.001 using one-way ANOVA, Tukey’s multiple onset epilepsy. J. Neurosci. 18, 8356-8368. doi:10.1523/JNEUROSCI.18-20- comparison test with mean ±s.e.m., and determined by Prism software. All 08356.1998 Ko, P. J. and Dixon, S. J. (2018). Protein palmitoylation and cancer. EMBO Rep. 19, figures were generated by using Adobe Illustrator CS6 or CC2018 software e466666. doi:10.15252/embr.201846666 in conjunction with Adobe Photoshop CS6 or CC2017 (Adobe Systems, Levy, A. D., Devignot, V., Fukata, Y., Fukata, M., Sobel, A. and Chauvin, S. San Jose, CA). Statistical significances (*) indicate significant differences (2011). Subcellular Golgi localization of stathmin family proteins is promoted by a compared with the control; significance within different rescue constructs is specific set of DHHC palmitoyl transferases. Mol. Biol. Cell 22, 1930-1942. doi:10. indicated by #. 1091/mbc.e10-10-0824 Linhares, N. D., Valadares, E. R., da Costa, S. S., Arantes, R. R., de Oliveira, L. R., Rosenberg, C., Vianna-Morgante, A. M. and Svartman, M. (2016). Acknowledgements Inherited Xq13.2-q21.31 duplication in a boy with recurrent seizures and pubertal The authors thank all members of the Bamji lab for critical review of the manuscript. gynecomastia: Clinical, chromosomal and aCGH characterization. Meta Gene 9, 185-190. doi:10.1016/j.mgene.2016.07.004 Competing interests Mansouri, M. R., Marklund, L., Gustavsson, P., Davey, E., Carlsson, B., The authors declare no competing or financial interests. Larsson, C., White, I., Gustavson, K. H. and Dahl, N. (2005). Loss of ZDHHC15 expression in a woman with a balanced translocation t(X;15)(q13.3;cen) and severe mental retardation. Eur. J. Hum. Genet. 13, 970-977. doi:10.1038/sj.ejhg. Author contributions 5201445 Conceptualization: S.X.B.; Formal analysis: B.S.S., J.J.S.; Investigation: B.S.S., Marin-Padilla, M. (1972). Structural abnormalities of the cerebral cortex in human J.J.S.; Data curation: B.S.S., J.J.S.; Writing - original draft: B.S.S., J.J.S., S.X.B.; chromosomal aberrations: a Golgi study. Brain Res. 44, 625-629. doi:10.1016/ Writing - review & editing: B.S.S., J.J.S., S.X.B.; Visualization: B.S.S., J.J.S.; 0006-8993(72)90324-1 Supervision: S.X.B.; Project administration: S.X.B.; Funding acquisition: S.X.B. Martinez, F., Rosello, M., Mayo, S., Monfort, S., Oltra, S. and Orellana, C. (2014). Duplication at Xq13.3-q21.1 with syndromic intellectual disability, a probable role Funding for the ATRX gene. Am. J. Med. Genet. 164A, 918-923. doi:10.1002/ajmg.a. The work was supported by the Canadian Institutes of Health Research 36371 (MOP-142721 and PJT-148938) to S.X.B. Deposited in PMC for immediate release. Meijering, E., Jacob, M., Sarria, J. C., Steiner, P., Hirling, H. and Unser, M. (2004). Design and validation of a tool for tracing and analysis in fluorescence microscopy images. Cytometry A 58, 167-176. doi:10.1002/cyto.a. Supplementary information 20022 Supplementary information available online at Mill, P., Lee, A. W., Fukata, Y., Tsutsumi, R., Fukata, M., Keighren, M., Porter, http://jcs.biologists.org/lookup/doi/10.1242/jcs.230052.supplemental R. M., McKie, L., Smyth, I. and Jackson, I. J. (2009). Palmitoylation regulates Journal of Cell Science

9 SHORT REPORT Journal of Cell Science (2019) 132, jcs230052. doi:10.1242/jcs.230052

epidermal and hair follicle differentiation. PLoS Genet. 5, e1000748. of the and cancers. PLoS Comput. Biol. 11, e1004405. doi:10. doi:10.1371/journal.pgen.1000748 1371/journal.pcbi.1004405 Noritake, J., Fukata, Y., Iwanaga, T., Hosomi, N., Tsutsumi, R., Matsuda, N., Sharma, C., Yang, X. H. and Hemler, M. E. (2008). DHHC2 affects palmitoylation, Tani, H., Iwanari, H., Mochizuki, Y., Kodama, T. et al. (2009). Mobile DHHC stability, and functions of tetraspanins CD9 and CD151. Mol. Biol. Cell 19, palmitoylating enzyme mediates activity-sensitive synaptic targeting of PSD-95. 3415-3425. doi:10.1091/mbc.e07-11-1164 J. Cell Biol. 186, 147-160. doi:10.1083/jcb.200903101 Sun, Y. and Bamji, S. X. (2011). beta-Pix modulates actin-mediated recruitment of Ohno, Y., Kihara, A., Sano, T. and Igarashi, Y. (2006). Intracellular localization and synaptic vesicles to synapses. J. Neurosci. 31, 17123-17133. doi:10.1523/ tissue-specific distribution of human and yeast DHHC cysteine-rich domain- JNEUROSCI.2359-11.2011 containing proteins. Biochim. Biophys. Acta 1761, 474-483. doi:10.1016/j.bbalip. Swann, J. W., Al-Noori, S., Jiang, M. and Lee, C. L. (2000). Spine loss and other 2006.03.010 dendritic abnormalities in epilepsy. Hippocampus 10, 617-625. doi:10.1002/1098- Piton, A., Redin, C. and Mandel, J.-L. (2013). XLID-causing mutations and 1063(2000)10:5<617::AID-HIPO13>3.0.CO;2-R associated genes challenged in light of data from large-scale human exome Tsutsumi, R., Fukata, Y., Noritake, J., Iwanaga, T., Perez, F. and Fukata, M. sequencing. Am. J. Hum. Genet. 93, 368-383. doi:10.1016/j.ajhg.2013.06.013 (2009). Identification of alpha subunit-palmitoylating enzyme. Mol. Cell. Purpura, D. P. (1974). “dysgenesis” and mental retardation. Science Biol. 29, 435-447. doi:10.1128/MCB.01144-08 186, 1126-1128. doi:10.1126/science.186.4169.1126 Vetrivel, K. S., Meckler, X., Chen, Y., Nguyen, P. D., Seidah, N. G., Vassar, R., Rocks, O., Gerauer, M., Vartak, N., Koch, S., Huang, Z.-P., Pechlivanis, M., Wong, P. C., Fukata, M., Kounnas, M. Z. and Thinakaran, G. (2009). Alzheimer Kuhlmann, J., Brunsveld, L., Chandra, A., Ellinger, B. et al. (2010). The disease Abeta production in the absence of S-palmitoylation-dependent palmitoylation machinery is a spatially organizing system for peripheral membrane targeting of BACE1 to lipid rafts. J. Biol. Chem. 284, 3793-3803. doi:10.1074/jbc. proteins. Cell 141, 458-471. doi:10.1016/j.cell.2010.04.007 Rodriguez, A., Ehlenberger, D. B., Hof, P. R. and Wearne, S. L. (2006). Rayburst M808920200 sampling, an algorithm for automated three-dimensional shape analysis from Wang, F., Chen, X., Shi, W., Yao, L., Gao, M., Yang, Y. and Hao, A. (2015). laser scanning microscopy images. Nat. Protoc. 1, 2152-2161. doi:10.1038/nprot. Zdhhc15b regulates differentiation of diencephalic neurons in 2006.313 zebrafish. J. Cell. Biochem. 116, 2980-2991. doi:10.1002/jcb.25256 Rubinson, D. A., Dillon, C. P., Kwiatkowski, A. V., Sievers, C., Yang, L., Kopinja, Yokoi, N., Fukata, Y., Sekiya, A., Murakami, T., Kobayashi, K. and Fukata, M. J., Rooney, D. L., Zhang, M., Ihrig, M. M., McManus, M. T. et al. (2003). A (2016). Identification of PSD-95 depalmitoylating enzymes. J. Neurosci. 36, lentivirus-based system to functionally silence genes in primary mammalian cells, 6431-6444. doi:10.1523/JNEUROSCI.0419-16.2016 stem cells and transgenic mice by RNA interference. Nat. Genet. 33, 401-406. Zhang, Y., Chen, K., Sloan, S. A., Bennett, M. L., Scholze, A. R., O’Keeffe, S., doi:10.1038/ng1117 Phatnani, H. P., Guarnieri, P., Caneda, C., Ruderisch, N. et al. (2014). An RNA- Sanders, S. S., Martin, D. D., Butland, S. L., Lavallée-Adam, M., Calzolari, D., sequencing transcriptome and splicing database of , neurons, and vascular Kay, C., Yates, J. R., III and Hayden, M. R. (2015). Curation of the mammalian cells of the cerebral cortex. J. Neurosci. 34, 11929-11947. doi:10.1523/ palmitoylome indicates a pivotal role for palmitoylation in diseases and disorders JNEUROSCI.1860-14.2014 Journal of Cell Science

10