DOCSLIB.ORG

Antiviral Response Independent of IFN Regulatory Factor 3, IFN-Β Promoter Stimulator 1, and IFN This Information Is Current As of September 27, 2021

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Antiviral Response Independent of IFN Regulatory Factor 3, IFN-Β Promoter Stimulator 1, and IFN This Information Is Current As of September 27, 2021 Long Double-Stranded RNA Induces an Antiviral Response Independent of IFN Regulatory Factor 3, IFN-β Promoter Stimulator 1, and IFN This information is current as of September 27, 2021. Stephanie J. DeWitte-Orr, Devangi R. Mehta, Susan E. Collins, Mehul S. Suthar, Michael Gale, Jr. and Karen L. Mossman J Immunol 2009; 183:6545-6553; Prepublished online 28 October 2009; Downloaded from doi: 10.4049/jimmunol.0900867 http://www.jimmunol.org/content/183/10/6545 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2009/10/28/jimmunol.090086 Material 7.DC1 References This article cites 39 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/183/10/6545.full#ref-list-1 Why The JI? Submit online. by guest on September 27, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Long Double-Stranded RNA Induces an Antiviral Response Independent of IFN Regulatory Factor 3, IFN-␤ Promoter Stimulator 1, and IFN1 Stephanie J. DeWitte-Orr,* Devangi R. Mehta,* Susan E. Collins,* Mehul S. Suthar,† Michael Gale, Jr.,† and Karen L. Mossman2* Virus infection elicits a robust innate antiviral response dominated by the production of type 1 IFN. In nonprofessional innate immune cells such as fibroblasts, type 1 IFN is rapidly produced following the recognition of viral dsRNA and the subsequent activation of the constitutively expressed transcription factor IFN regulatory factor 3 (IRF3). Although origin, localization, and length are factors in mediating dsRNA recognition and binding by cellular dsRNA-binding proteins, the biological significance of differential dsRNA binding is unclear, since the subsequent signaling pathways converge on IRF3. In this study, we show a dsRNA Downloaded from length-dependent activation of IRFs, IFNs, and IFN-stimulated genes in mouse fibroblasts. The length dependence was exacer- bated in fibroblasts deficient in the mitochondria-associated adaptor IFN-␤ promoter stimulator 1 and IRF3, suggesting that antiviral gene induction mediated by short and long dsRNA molecules is predominantly IFN-␤ promoter stimulator 1 and IRF3 dependent and independent, respectively. Furthermore, we provide evidence of an innate antiviral response in fibroblasts in the absence of both IRF3 and type 1 IFN induction. Even with these key modulators missing, a 60–90% inhibition of virus replication was observed following 24-h treatment with short or long dsRNA molecules, respectively. These data provide evidence of a novel http://www.jimmunol.org/ antiviral pathway that is dependent on dsRNA length, but independent of the type 1 IFN system. The Journal of Immunology, 2009, 183: 6545–6553. iral infection of susceptible cells leads to the induction melanoma differentiation-associated gene 5 (MDA-5) bind dsRNA of a cellular antiviral response aimed at limiting virus and mediate antiviral signaling through the adaptors Toll/IL-1R V replication and spread. dsRNA, a byproduct in the rep- domain-containing adaptor inducing IFN-␤ (TRIF) and IFN-␤ pro- lication cycle of virtually all viruses (1), is a potent inducer of moter stimulator 1(IPS-1), respectively (2). Both adaptors subse- innate and adaptive immune responses. Three different families of quently activate the cellular transcription factors NF-␬B and IFN by guest on September 27, 2021 pattern recognition receptors, the TLRs, the retinoic acid-inducible regulatory factor (IRF) 3, leading to IFN-␤ and cytokine produc- 3 gene I (RIG-I) -like receptors (RLRs) and the nucleotide oli- tion. Similar to the cytoplasmic RLRs, protein kinase regulated by gomerization domain-like receptors (NLRs) bind dsRNA and ini- RNA (PKR) also binds dsRNA and activates IRF3 through IPS-1 tiate cellular signaling pathways (2). The TLRs and RLRs elicit (3). IFN-␤ signaling through the JAK-STAT pathway, which in- ␤ type 1 IFN and cytokine production while NLRs promote IL-1 cludes IRF9 as an essential component, leads to the induction of maturation through caspase 1 activation. In nonprofessional innate IRF7 and amplification of the cellular antiviral response through immune cells such as fibroblasts, TLR3 and the RLRs RIG-I and the induction of IFN-␣ species and IFN-stimulated genes (ISGs) (4). *Department of Pathology & Molecular Medicine, Michael DeGroote Institute for Recent studies have begun to characterize the dsRNA-binding Infectious Disease Research, McMaster University, Hamilton, Ontario, Canada; properties of TLR3, PKR, MDA-5, and RIG-I. Binding of dsRNA and †Department of Immunology, School of Medicine, University of Washington, Seattle, WA 98195 to TLR3 depends strongly on pH and dsRNA length, suggesting that TLR3 signaling initiates within an endosome through a pH- Received for publication March 18, 2009. Accepted for publication September 8, 2009. dependent binding mechanism and that sufficient dsRNA length The costs of publication of this article were defrayed in part by the payment of page (ϳ45 bp) is required to bind to both the N-terminal and C-terminal charges. This article must therefore be hereby marked advertisement in accordance regions of the TLR3 ectodomain (5–8). A similar minimal length with 18 U.S.C. Section 1734 solely to indicate this fact. dependence was observed for dsRNA to bind two PKR monomers 1 This study was funded by the National Institutes of Health and the Canadian Insti- tute for Health Research (MOP-57669). and elicit PKR autophosphorylation and activation (9, 10). With the cytosolic RLRs RIG-I and MDA-5, both dsRNA origin and 2 Address correspondence and reprint requests to Dr. Karen L. Mossman, Department of Pathology & Molecular Medicine, McMaster University, 1200 Main Street West, length influence recognition and binding. RIG-I preferentially rec- MDCL 5026, Hamilton, Ontario, Canada, L8N 3Z5. E-mail address: mossk@ ognizes RNA from a variety of RNA viruses while MDA-5 binds mcmaster.ca the dsRNA mimic polyinosinic:polycytidylic acid (poly (I:C)) and 3 Abbreviations used in this paper: RIG-I, retinoic acid-inducible gene I; IPS-1, IFN-␤ promoter stimulator 1; IRF, IFN regulatory factor; ISG, IFN-stimulated gene; picornavirus RNA (11). Furthermore, RIG-I and MDA-5 were MDA-5, melanoma differentiation-associated gene 5; MEF, mouse embryo fibroblast; shown to preferentially bind to short and long dsRNA molecules, NLR, nucleotide oligomerization domain-like receptor; poly(I:C), polyinosinic:poly- respectively (12). Regardless of which cellular protein senses the cytidylic acid; PKR, protein kinase regulated by RNA; TRIF, Toll/IL-1 receptor do- main-containing adaptor inducing IFN-␤; VSV, vesicular stomatitis virus; VSVgfp, dsRNA, current models suggest that activation of all sensors leads VSV expressing GFP; HSV-1gfp, HSV-1 expressing GFP; WNv, West Nile virus; to IRF3 activation and subsequent ISG and type 1 IFN induction. WT, wild type; MOI, multiplicity of infection; C , threshold cycle. t The importance of IRF3 in the early and late phases of type 1 Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 IFN expression and antiviral immunity was demonstrated through www.jimmunol.org/cgi/doi/10.4049/jimmunol.0900867 6546 dsRNA LENGTH-DEPENDENT, IFN-INDEPENDENT ANTIVIRAL RESPONSE Table I. Details of in vitro transcribed dsRNA generation from the cloned WNv genomea dsRNA Source Gene Length (bp) Primersb v200 WNv E 200 Sense: TCCTCCAACTGCGAGAAACGTG Antisense: AAAGGAGCGCAGAGACTAGCCG v500 WNv E 500 Sense: TCCTCCAACTGCGAGAAACGTG Antisense: TGGCACGGATGGACCTTG v1000 WNv E 1000 Sense: TCCTCCAACTGCGAGAAACGTG Antisense: ACACATGCGCCAAATTTGCC v3000 NS3-NS4B 3000 Sense: CATGACAACCAACCCCCACGCATGATG Antisense: GCGGGCGTGATGGTTGAAGGTGT a Primer sequences used for amplifying PCR product templates for dsRNA in vitro transcription. b All primers included a T7 sequence tag (5Ј-taatacgactcactataggg-3Ј) used by the T7 polymerase during dsRNA synthesis. the generation of IRF3Ϫ/Ϫ and IRF3Ϫ/Ϫ9Ϫ/Ϫ mice (4). Mice de- viral dsRNA is length dependent in WT mouse fibroblasts and that ficient for IRF3 were more vulnerable to viral infection and IFN the length dependence is exacerbated in the absence of IRF3. Fur- production was reduced 20- to 50-fold. In the absence of both IRF3 thermore, we provide evidence of an IRF3- and type 1 IFN- inde- and IRF9, type 1 IFN production was completely ablated (4). Since pendent antiviral response that is more robustly activated by longer IRF7 gene expression is dependent on type 1 IFN signaling, levels dsRNA molecules. Downloaded from of this transcription factor were significantly diminished in cells lacking IRF3 and absent in cells lacking IRF3 and IRF9 following Materials and Methods viral infection. These studies led to a model in which constitutive Cells and viruses expression of low levels of type 1 IFN in uninfected cells supports Ϫ Ϫ Ϫ Ϫ basal expression of equally low levels of IRF7. Upon viral infec- MEFs were derived from WT C57BL/6, IRF3 / (4), IRF3 / and IRF9Ϫ/Ϫ (4), IPS-1Ϫ/Ϫ and IPS-1ϩ/ϩ littermate control mice and were tion, activation of IRF3 initiates a positive feedback loop resulting http://www.jimmunol.org/ maintained in ␣-MEM supplemented with 10% FBS, 100 U ⅐ mlϪ1 peni- ␤ ␣ Ϫ1 in robust IFN- , IRF7, IFN- , and ISG induction (13). Subsequent cillin, 100 ␮g ⅐ ml streptomycin, and 2 mM L-glutamine. Experiments Ϫ/Ϫ Ϫ/Ϫ Ϫ/Ϫ studies in IRF7 and IRF3 7 mice confirmed the require- were performed with cells at passages three to eight.
Load more

Recommended publications
  • Targeting TSLP-Induced Tyrosine Kinase Signaling Pathways in CRLF2-Rearranged Ph-Like ALL Keith C.S
    Published OnlineFirst August 14, 2020; DOI: 10.1158/1541-7786.MCR-19-1098 MOLECULAR CANCER RESEARCH | CANCER GENES AND NETWORKS Targeting TSLP-Induced Tyrosine Kinase Signaling Pathways in CRLF2-Rearranged Ph-like ALL Keith C.S. Sia1, Ling Zhong2, Chelsea Mayoh1, Murray D. Norris1,3, Michelle Haber1, Glenn M. Marshall1,4, Mark J. Raftery2, and Richard B. Lock1,3 ABSTRACT ◥ Philadelphia (Ph)-like acute lymphoblastic leukemia (ALL) is combination cytotoxicity assays using the tyrosine kinase inhi- characterized by aberrant activation of signaling pathways and bitors BMS-754807 and ponatinib that target IGF1R and FGFR1, high risk of relapse. Approximately 50% of Ph-like ALL cases respectively, revealed strong synergy against both cell line and overexpress cytokine receptor-like factor 2 (CRLF2) associated patient-derived xenograft (PDX) models of CRLF2r Ph-like ALL. with gene rearrangement. Activated by its ligand thymic stromal Further analyses also indicated off-target effects of ponatinib in lymphopoietin (TSLP), CRLF2 signaling is critical for the devel- the synergy, and novel association of the Ras-associated protein- opment, proliferation, and survival of normal lymphocytes. To 1 (Rap1) signaling pathway with TSLP signaling in CRLF2r Ph- examine activation of tyrosine kinases regulated by TSLP/CRLF2, like ALL. When tested in vivo, the BMS-754807/ponatinib com- phosphotyrosine (P-Tyr) profiling coupled with stable isotope bination exerted minimal efficacy against 2 Ph-like ALL PDXs, labeling of amino acids in cell culture (SILAC) was conducted associated with low achievable plasma drug concentrations. using two CRLF2-rearranged (CRLF2r) Ph-like ALL cell lines Although this study identified potential new targets in CRLF2r stimulated with TSLP.
    [Show full text]
  • Dux4r, Znf384r and PAX5-P80R Mutated B-Cell Precursor Acute
    Acute Lymphoblastic Leukemia SUPPLEMENTARY APPENDIX DUX4r , ZNF384r and PAX5 -P80R mutated B-cell precursor acute lymphoblastic leukemia frequently undergo monocytic switch Michaela Novakova, 1,2,3* Marketa Zaliova, 1,2,3* Karel Fiser, 1,2* Barbora Vakrmanova, 1,2 Lucie Slamova, 1,2,3 Alena Musilova, 1,2 Monika Brüggemann, 4 Matthias Ritgen, 4 Eva Fronkova, 1,2,3 Tomas Kalina, 1,2,3 Jan Stary, 2,3 Lucie Winkowska, 1,2 Peter Svec, 5 Alexandra Kolenova, 5 Jan Stuchly, 1,2 Jan Zuna, 1,2,3 Jan Trka, 1,2,3 Ondrej Hrusak 1,2,3# and Ester Mejstrikova 1,2,3# 1CLIP - Childhood Leukemia Investigation Praguerague, Czech Republic; 2Department of Paediatric Hematology and Oncology, Second Faculty of Medicine, Charles University, Prague, Czech Republic; 3University Hospital Motol, Prague, Czech Republic; 4Department of In - ternal Medicine II, University Hospital Schleswig-Holstein, Kiel, Germany and 5Comenius University, National Institute of Children’s Dis - eases, Bratislava, Slovakia *MN, MZ and KF contributed equally as co-first authors. #OH and EM contributed equally as co-senior authors. ©2021 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2020.250423 Received: February 18, 2020. Accepted: June 25, 2020. Pre-published: July 9, 2020. Correspondence: ESTER MEJSTRIKOVA - [email protected] Table S1. S1a. List of antibodies used for diagnostic immunophenotyping. Antibody Fluorochrome Clone Catalogue number Manufacturer CD2 PE 39C1.5 A07744 Beckman Coulter CD3 FITC UCHT1 1F-202-T100 Exbio CD4 PE-Cy7
    [Show full text]
  • Most Variable Genes and Transcription Factors in Acute Lymphoblastic Leukemia Patients
    Interdisciplinary Sciences: Computational Life Sciences https://doi.org/10.1007/s12539-019-00325-y ORIGINAL RESEARCH ARTICLE Most Variable Genes and Transcription Factors in Acute Lymphoblastic Leukemia Patients Anil Kumar Tomar1 · Rahul Agarwal2 · Bishwajit Kundu1 Received: 24 September 2018 / Revised: 21 January 2019 / Accepted: 26 February 2019 © International Association of Scientists in the Interdisciplinary Areas 2019 Abstract Acute lymphoblastic leukemia (ALL) is a hematologic tumor caused by cell cycle aberrations due to accumulating genetic disturbances in the expression of transcription factors (TFs), signaling oncogenes and tumor suppressors. Though survival rate in childhood ALL patients is increased up to 80% with recent medical advances, treatment of adults and childhood relapse cases still remains challenging. Here, we have performed bioinformatics analysis of 207 ALL patients’ mRNA expression data retrieved from the ICGC data portal with an objective to mark out the decisive genes and pathways responsible for ALL pathogenesis and aggression. For analysis, 3361 most variable genes, including 276 transcription factors (out of 16,807 genes) were sorted based on the coefcient of variance. Silhouette width analysis classifed 207 ALL patients into 6 subtypes and heat map analysis suggests a need of large and multicenter dataset for non-overlapping subtype classifcation. Overall, 265 GO terms and 32 KEGG pathways were enriched. The lists were dominated by cancer-associated entries and highlight crucial genes and pathways that can be targeted for designing more specifc ALL therapeutics. Diferential gene expression analysis identifed upregulation of two important genes, JCHAIN and CRLF2 in dead patients’ cohort suggesting their pos- sible involvement in diferent clinical outcomes in ALL patients undergoing the same treatment.
    [Show full text]
  • WO 2015/007520 Al 22 January 2015 (22.01.2015) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2015/007520 Al 22 January 2015 (22.01.2015) P O P C T (51) International Patent Classification: lon, F-34095 Montpellier (FR). GARCIN, Genevieve; Rue C07K 16/46 (2006.01) C07K 19/00 (2006.01) de Tyr 89, Montpellier, 34090 (FR). (21) International Application Number: (74) Common Representative: VIB VZW; Rijvisschestraat PCT/EP2014/063976 120, B-9052 Gent (BE). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 1 July 2014 (01 .07.2014) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, (25) Filing Language: English BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, (26) Publication Language: English DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 13306045.9 19 July 2013 (19.07.2013) EP MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, (71) Applicants: VIB VZW [BE/BE]; Rijvisschestraat 120, B- OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, 9052 Gent (BE). UNIVERSITEIT GENT [BE/BE]; Sint- SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, Pietersnieuwstraat 25, B-9000 Gent (BE). CENTRE NA¬ TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, TIONAL DE LA RECHERCHE SCIENTIFIQUE ZW.
    [Show full text]
  • Genetic Alterations in High-Risk B-Progenitor Acute Lymphoblastic Leukemia
    SECTION A Genetic Alterations in High-Risk B-Progenitor Acute Lymphoblastic Leukemia Charles G. Mullighan Abstract adulthood, cure rates for ALL fall sharply, and the genetic and biologic determinants of Recent studies profiling genetic alterations in treatment failure remain incompletely B-progenitor acute lymphoblastic leukemia understood (8,9). (B-ALL) at high resolution have identified multiple recurring submicroscopic genetic alterations ALL has long been exceptionally well targeting key cellular pathways in lymphoid cell characterized at the cytogenetic level, and growth, differentiation and tumor suppression. approximately three quarters of childhood ALL A key finding has been that genetic alterations cases harbor recurring gross genetic alterations, disrupting normal lymphoid growth and including chromosomal aneuploidy (high differentiation and are associated with treatment hyperdiploidy and hypodiploidy), and outcome. Notably, genetic alterations targeting rearrangements that dysregulate hematopoietic lymphoid development are present in over two- regulators, transcription factors, and tyrosine thirds of B-ALL cases, including deletions, kinases. These include rearrangements resulting translocations and sequence mutations of the in (e.g. ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, transcriptional regulators PAX5, IKZF1, and EBF1. rearrangement of MLL, and rearrangements of Deletion or mutation of the early lymphoid T cell receptor genes to hematopoietic regulators transcription factor gene IKZF1 is hallmark of and transcription factors in T-lineage ALL) multiple subtypes of ALL with poor prognosis, (10,11). While alterations associated with including BCR-ABL1 positive (Ph+) lymphoid favorable outcome (e.g. high hyperdiploidy and leukemia and a novel subset of BCR-ABL1-like ETV6-RUNX1) are characteristic of childhood ALL cases that have a gene expression profile ALL, and the frequency of BCR-ABL1 similar to that of Ph+ B-ALL, but lack expression (Philadelphia chromosome positive, or Ph+) ALL of BCR-ABL1.
    [Show full text]
  • Down Syndrome Acute Lymphoblastic Leukemia, a Highly Heterogeneous
    Hertzberg, L; Vendramini, E; Ganmore, I; Cazzaniga, G; Schmitz, M; Chalker, J; Shiloh, R; Iacobucci, I; Shochat, C; Zeligson, S; Cario, G; Stanulla, M; Strehl, S; Russell, L J; Harrison, C J; Bornhauser, B; Yoda, A; Rechavi, G; Bercovich, D; Borkhardt, A; Kempski, H; te Kronnie, G; Bourquin, J P; Domany, E; Izraeli, S (2010). Down syndrome acute lymphoblastic leukemia, a highly heterogeneous disease in which aberrant expression of CRLF2 is associated with mutated JAK2: a report from the International BFM Study Group. Blood, 115(5):1006-1017. University of Zurich Postprint available at: Zurich Open Repository and Archive http://www.zora.uzh.ch Posted at the Zurich Open Repository and Archive, University of Zurich. http://www.zora.uzh.ch Winterthurerstr. 190 Originally published at: CH-8057 Zurich Blood 2010, 115(5):1006-1017. http://www.zora.uzh.ch Year: 2010 Down syndrome acute lymphoblastic leukemia, a highly heterogeneous disease in which aberrant expression of CRLF2 is associated with mutated JAK2: a report from the International BFM Study Group Hertzberg, L; Vendramini, E; Ganmore, I; Cazzaniga, G; Schmitz, M; Chalker, J; Shiloh, R; Iacobucci, I; Shochat, C; Zeligson, S; Cario, G; Stanulla, M; Strehl, S; Russell, L J; Harrison, C J; Bornhauser, B; Yoda, A; Rechavi, G; Bercovich, D; Borkhardt, A; Kempski, H; te Kronnie, G; Bourquin, J P; Domany, E; Izraeli, S Hertzberg, L; Vendramini, E; Ganmore, I; Cazzaniga, G; Schmitz, M; Chalker, J; Shiloh, R; Iacobucci, I; Shochat, C; Zeligson, S; Cario, G; Stanulla, M; Strehl, S; Russell, L J; Harrison, C J; Bornhauser, B; Yoda, A; Rechavi, G; Bercovich, D; Borkhardt, A; Kempski, H; te Kronnie, G; Bourquin, J P; Domany, E; Izraeli, S (2010).
    [Show full text]
  • Functional Screening Identifies CRLF2 in Precursor B-Cell Acute
    Functional screening identifies CRLF2 in precursor B-cell acute lymphoblastic leukemia Akinori Yodaa, Yuka Yodaa, Sabina Chiarettib, Michal Bar-Natana, Kartik Mania, Scott J. Rodigc, Nathan Westa, Yun Xiaoc, Jennifer R. Browna, Constantine Mitsiadesa, Martin Sattlera, Jeffrey L. Kutokc, Daniel J. DeAngeloa, Martha Wadleigha, Alfonso Piciocchid, Paola Dal Cinc, James E. Bradnera, James D. Griffina, Kenneth C. Andersona, Richard M. Stonea, Jerome Ritza, Robin Foàb, Jon C. Asterc, David A. Franka, and David M. Weinstocka,1 aDepartment of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115; bDivision of Hematology, Department of Cellular Biotechnologies and Hematology, “Sapienza” University of Rome, 00185 Rome, Italy; cDepartment of Pathology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and dGruppo Malattie Ematologiche dell’Adulto Data Center, 00161 Rome, Italy Edited by Ross Levine, Memorial Sloan-Kettering Cancer Center, and accepted by the Editorial Board November 12, 2009 (received for review October 9, 2009) The prognosis for adults with precursor B-cell acute lymphoblastic which is believed to serve as a scaffold. As a consequence, JAK leukemia (B-ALL) remains poor, in part from a lack of therapeutic gain-of-function mutants do not confer a transformed phenotype targets. We identified the type I cytokine receptor subunit CRLF2 in the absence of a compatible cytokine receptor (16). in a functional screen for B-ALL–derived mRNA transcripts that can We performed a retroviral cDNA library screen to identify substitute for IL3 signaling. We demonstrate that CRLF2 is overex- gain-of-function mutations from primary B-ALL specimens. We pressed in approximately 15% of adult and high-risk pediatric B- made several improvements to older approaches that increase ALL that lack MLL, TCF3, TEL, and BCR/ABL rearrangements, but the efficiency of library construction and cDNA representation.
    [Show full text]
  • Thymic Stromal Lymphopoietin Interferes with the Apoptosis of Human Skin Mast Cells by a Dual Strategy Involving STAT5/Mcl-1 and JNK/Bcl-Xl
    cells Article Thymic Stromal Lymphopoietin Interferes with the Apoptosis of Human Skin Mast Cells by a Dual Strategy Involving STAT5/Mcl-1 and JNK/Bcl-xL Tarek Hazzan, Jürgen Eberle, Margitta Worm * and Magda Babina * Department of Dermatology, Venerology and Allergy, Charité—Universitätsmedizin Berlin, Charitéplatz 1, 10117 Berlin, Germany * Correspondence: [email protected] (M.W.); [email protected] (M.B.); Tel.: +49-30-450518238 (M.B.); Fax: +49-30-450518900 (M.B.) Received: 10 July 2019; Accepted: 1 August 2019; Published: 5 August 2019 Abstract: Mast cells (MCs) play critical roles in allergic and inflammatory reactions and contribute to multiple pathologies in the skin, in which they show increased numbers, which frequently correlates with severity. It remains ill-defined how MC accumulation is established by the cutaneous microenvironment, in part because research on human MCs rarely employs MCs matured in the tissue, and extrapolations from other MC subsets have limitations, considering the high level of MC heterogeneity. Thymic stromal lymphopoietin (TSLP)—released by epithelial cells, like keratinocytes, following disturbed homeostasis and inflammation—has attracted much attention, but its impact on skin MCs remains undefined, despite the vast expression of the TSLP receptor by these cells. Using several methods, each detecting a distinct component of the apoptotic process (membrane alterations, DNA degradation, and caspase-3 activity), our study pinpoints TSLP as a novel survival factor of dermal MCs. TSLP confers apoptosis resistance via concomitant activation of the TSLP/ signal transducer and activator of transcription (STAT)-5 / myeloid cell leukemia (Mcl)-1 route and a newly uncovered TSLP/ c-Jun-N-terminal kinase (JNK)/ B-cell lymphoma (Bcl)-xL axis, as evidenced by RNA interference and pharmacological inhibition.
    [Show full text]
  • Janus Kinases in Leukemia
    cancers Review Janus Kinases in Leukemia Juuli Raivola 1, Teemu Haikarainen 1, Bobin George Abraham 1 and Olli Silvennoinen 1,2,3,* 1 Faculty of Medicine and Health Technology, Tampere University, 33014 Tampere, Finland; juuli.raivola@tuni.fi (J.R.); teemu.haikarainen@tuni.fi (T.H.); bobin.george.abraham@tuni.fi (B.G.A.) 2 Institute of Biotechnology, Helsinki Institute of Life Science HiLIFE, University of Helsinki, 00014 Helsinki, Finland 3 Fimlab Laboratories, Fimlab, 33520 Tampere, Finland * Correspondence: olli.silvennoinen@tuni.fi Simple Summary: Janus kinase/signal transducers and activators of transcription (JAK/STAT) path- way is a crucial cell signaling pathway that drives the development, differentiation, and function of immune cells and has an important role in blood cell formation. Mutations targeting this path- way can lead to overproduction of these cell types, giving rise to various hematological diseases. This review summarizes pathogenic JAK/STAT activation mechanisms and links known mutations and translocations to different leukemia. In addition, the review discusses the current therapeutic approaches used to inhibit constitutive, cytokine-independent activation of the pathway and the prospects of developing more specific potent JAK inhibitors. Abstract: Janus kinases (JAKs) transduce signals from dozens of extracellular cytokines and function as critical regulators of cell growth, differentiation, gene expression, and immune responses. Deregu- lation of JAK/STAT signaling is a central component in several human diseases including various types of leukemia and other malignancies and autoimmune diseases. Different types of leukemia harbor genomic aberrations in all four JAKs (JAK1, JAK2, JAK3, and TYK2), most of which are Citation: Raivola, J.; Haikarainen, T.; activating somatic mutations and less frequently translocations resulting in constitutively active JAK Abraham, B.G.; Silvennoinen, O.
    [Show full text]
  • TSLP-Induced Mechanisms and Potential Therapies for CRLF2 B-Cell Acute Lymphoblastic Leukemia Olivia L
    Loma Linda University TheScholarsRepository@LLU: Digital Archive of Research, Scholarship & Creative Works Loma Linda University Electronic Theses, Dissertations & Projects 6-2015 TSLP-induced Mechanisms and Potential Therapies for CRLF2 B-cell Acute Lymphoblastic Leukemia Olivia L. Francis Follow this and additional works at: http://scholarsrepository.llu.edu/etd Part of the Anatomy Commons, Genetic Phenomena Commons, Hemic and Lymphatic Diseases Commons, and the Medical Anatomy Commons Recommended Citation Francis, Olivia L., "TSLP-induced Mechanisms and Potential Therapies for CRLF2 B-cell Acute Lymphoblastic Leukemia" (2015). Loma Linda University Electronic Theses, Dissertations & Projects. 282. http://scholarsrepository.llu.edu/etd/282 This Dissertation is brought to you for free and open access by TheScholarsRepository@LLU: Digital Archive of Research, Scholarship & Creative Works. It has been accepted for inclusion in Loma Linda University Electronic Theses, Dissertations & Projects by an authorized administrator of TheScholarsRepository@LLU: Digital Archive of Research, Scholarship & Creative Works. For more information, please contact [email protected]. LOMA LINDA UNIVERSITY School of Medicine in conjunction with the Faculty of Graduate Studies ____________________ TSLP-induced Mechanisms and Potential Therapies for CRLF2 B-cell Acute Lymphoblastic Leukemia by Olivia L Francis ____________________ A Dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Anatomy ____________________
    [Show full text]
  • CRLF2 Break Apart FISH Probe Kit
    ENGLISH For Professional Use Only CRLF2 Break Apart FISH Probe Kit Introduction The CRLF2 Break Apart FISH Probe Kit is designed to detect rearrangements in the human CRLF2 gene located on chromosome bands Xp22.23 and Yp11.23. In addition to revealing breaks, which can lead to translocation of parts of the gene, inversion, or its fusion to other genes, the probe set can also be used to identify other CRLF2 aberrations such as deletions or amplifications. Rearrangements and abnormal expression of the CRLF2 gene – also known as CRL2, TSLPR or CRLF2Y – have been observed in adult and pediatric acute lymphoblastic leukemia (ALL) and various other malignancies. Intended Use Cont. Color To detect rearrangements in the human CRLF2 LSP CRLF2 5' FISHLSP CRLF2Probe 5' CytoOrange gene located on chromosome bands Xp22.33 LSP CRLF2 3' FISHLSP Probe CRLF2 3' CytoGreen and Yp11.23. Probe Design The human CRLF2 gene locates on both chromosome X and Y. LSP CRLF2 5’ FISH Probe covers some genomic sequences adjacent to the 5’ end of the CRLF2 gene. LSP CRLF2 3‘ FISH Probe covers the 3’ part as well as sequences downstream of the gene. The two probes are flanking sequences across the CRLF2 gene in which variable breakpoints have been observed. Not to Scale Cat. No. Volume Signal Pattern Interpretation Normal Patterns Abnormal Patterns 2F* Other Patterns CT-PAC114-10-OG 10 Tests (100 µL) *Overlapping orange and green signals can appear as yellow. 1) O'Connor C. Nature Education. 1(1):171 (2008). 2) Tsuchiya KD. Clin Lab Med. 31(4):525-42, vii-viii (2011).
    [Show full text]
  • Therapeutic Potential of Ruxolitinib and Ponatinib in Patients with EPOR-Rearranged Philadelphia Chromosome-Like Acute Lymphoblastic Leukemia by Lisa M
    Therapeutic potential of ruxolitinib and ponatinib in patients with EPOR-rearranged Philadelphia chromosome-like acute lymphoblastic leukemia by Lisa M. Niswander, Joseph P. Loftus, Élodie Lainey, Aurélie Caye-Eude, Morgane Pondrom, David A. Hottman, Ilaria Iacobucci, Charles G Mullighan, Nitin Jain, Marina Konopleva, Hélène Cavé, André Baruchel, Pierre S. Rohrlich, and Sarah K. Tasian Haematologica 2021 [Epub ahead of print] Citation: Lisa M. Niswander, Joseph P. Loftus, Élodie Lainey, Aurélie Caye-Eude, Morgane Pondrom, David A. Hottman, Ilaria Iacobucci, Charles G Mullighan, Nitin Jain, Marina Konopleva, Hélène Cavé, André Baruchel, Pierre S. Rohrlich, and Sarah K. Tasian . Therapeutic potential of ruxolitinib and ponatinib in patients with EPOR-rearranged Philadelphia chromosome-like acute lymphoblastic leukemia. Haematologica.2021; 106:xxx doi:10.3324/haematol.2021.278697 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal
    [Show full text]