Antiviral Response Independent of IFN Regulatory Factor 3, IFN-Β Promoter Stimulator 1, and IFN This Information Is Current As of September 27, 2021

Long Double-Stranded RNA Induces an Antiviral Response Independent of IFN Regulatory Factor 3, IFN-β Promoter Stimulator 1, and IFN This information is current as of September 27, 2021. Stephanie J. DeWitte-Orr, Devangi R. Mehta, Susan E. Collins, Mehul S. Suthar, Michael Gale, Jr. and Karen L. Mossman J Immunol 2009; 183:6545-6553; Prepublished online 28 October 2009; Downloaded from doi: 10.4049/jimmunol.0900867 http://www.jimmunol.org/content/183/10/6545 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2009/10/28/jimmunol.090086 Material 7.DC1 References This article cites 39 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/183/10/6545.full#ref-list-1

Why The JI? Submit online. by guest on September 27, 2021

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Long Double-Stranded RNA Induces an Antiviral Response Independent of IFN Regulatory Factor 3, IFN-␤ Promoter Stimulator 1, and IFN1

Stephanie J. DeWitte-Orr,* Devangi R. Mehta,* Susan E. Collins,* Mehul S. Suthar,† Michael Gale, Jr.,† and Karen L. Mossman2*

Virus infection elicits a robust innate antiviral response dominated by the production of type 1 IFN. In nonprofessional innate immune cells such as fibroblasts, type 1 IFN is rapidly produced following the recognition of viral dsRNA and the subsequent activation of the constitutively expressed transcription factor IFN regulatory factor 3 (IRF3). Although origin, localization, and length are factors in mediating dsRNA recognition and binding by cellular dsRNA-binding proteins, the biological significance of differential dsRNA binding is unclear, since the subsequent signaling pathways converge on IRF3. In this study, we show a dsRNA Downloaded from length-dependent activation of IRFs, IFNs, and IFN-stimulated genes in mouse fibroblasts. The length dependence was exacerbated in fibroblasts deficient in the mitochondria-associated adaptor IFN-␤ promoter stimulator 1 and IRF3, suggesting that antiviral gene induction mediated by short and long dsRNA molecules is predominantly IFN-␤ promoter stimulator 1 and IRF3 dependent and independent, respectively. Furthermore, we provide evidence of an innate antiviral response in fibroblasts in the absence of both IRF3 and type 1 IFN induction. Even with these key modulators missing, a 60–90% inhibition of virus replication was observed following 24-h treatment with short or long dsRNA molecules, respectively. These data provide evidence of a novel http://www.jimmunol.org/ antiviral pathway that is dependent on dsRNA length, but independent of the type 1 IFN system. The Journal of Immunology, 2009, 183: 6545–6553.

iral infection of susceptible cells leads to the induction melanoma differentiation-associated gene 5 (MDA-5) bind dsRNA of a cellular antiviral response aimed at limiting virus and mediate antiviral signaling through the adaptors Toll/IL-1R V replication and spread. dsRNA, a byproduct in the rep- domain-containing adaptor inducing IFN-␤ (TRIF) and IFN-␤ pro- lication cycle of virtually all viruses (1), is a potent inducer of moter stimulator 1(IPS-1), respectively (2). Both adaptors subse- innate and adaptive immune responses. Three different families of quently activate the cellular transcription factors NF-␬B and IFN by guest on September 27, 2021 pattern recognition receptors, the TLRs, the retinoic acid-inducible regulatory factor (IRF) 3, leading to IFN-␤ and cytokine produc- 3 gene I (RIG-I) -like receptors (RLRs) and the nucleotide oli- tion. Similar to the cytoplasmic RLRs, protein kinase regulated by gomerization domain-like receptors (NLRs) bind dsRNA and ini- RNA (PKR) also binds dsRNA and activates IRF3 through IPS-1 tiate cellular signaling pathways (2). The TLRs and RLRs elicit (3). IFN-␤ signaling through the JAK-STAT pathway, which in- ␤ type 1 IFN and cytokine production while NLRs promote IL-1 cludes IRF9 as an essential component, leads to the induction of maturation through caspase 1 activation. In nonprofessional innate IRF7 and amplification of the cellular antiviral response through immune cells such as fibroblasts, TLR3 and the RLRs RIG-I and the induction of IFN-␣ species and IFN-stimulated genes (ISGs) (4). *Department of Pathology & Molecular Medicine, Michael DeGroote Institute for Recent studies have begun to characterize the dsRNA-binding Infectious Disease Research, McMaster University, Hamilton, Ontario, Canada; properties of TLR3, PKR, MDA-5, and RIG-I. Binding of dsRNA and †Department of Immunology, School of Medicine, University of Washington, Seattle, WA 98195 to TLR3 depends strongly on pH and dsRNA length, suggesting that TLR3 signaling initiates within an endosome through a pH- Received for publication March 18, 2009. Accepted for publication September 8, 2009. dependent binding mechanism and that sufficient dsRNA length The costs of publication of this article were defrayed in part by the payment of page (ϳ45 bp) is required to bind to both the N-terminal and C-terminal charges. This article must therefore be hereby marked advertisement in accordance regions of the TLR3 ectodomain (5–8). A similar minimal length with 18 U.S.C. Section 1734 solely to indicate this fact. dependence was observed for dsRNA to bind two PKR monomers 1 This study was funded by the National Institutes of Health and the Canadian Insti- tute for Health Research (MOP-57669). and elicit PKR autophosphorylation and activation (9, 10). With the cytosolic RLRs RIG-I and MDA-5, both dsRNA origin and 2 Address correspondence and reprint requests to Dr. Karen L. Mossman, Department of Pathology & Molecular Medicine, McMaster University, 1200 Main Street West, length influence recognition and binding. RIG-I preferentially rec- MDCL 5026, Hamilton, Ontario, Canada, L8N 3Z5. E-mail address: mossk@ ognizes RNA from a variety of RNA viruses while MDA-5 binds mcmaster.ca the dsRNA mimic polyinosinic:polycytidylic acid (poly (I:C)) and 3 Abbreviations used in this paper: RIG-I, retinoic acid-inducible gene I; IPS-1, IFN-␤ promoter stimulator 1; IRF, IFN regulatory factor; ISG, IFN-stimulated gene; picornavirus RNA (11). Furthermore, RIG-I and MDA-5 were MDA-5, melanoma differentiation-associated gene 5; MEF, mouse embryo fibroblast; shown to preferentially bind to short and long dsRNA molecules, NLR, nucleotide oligomerization domain-like receptor; poly(I:C), polyinosinic:poly- respectively (12). Regardless of which cellular protein senses the cytidylic acid; PKR, protein kinase regulated by RNA; TRIF, Toll/IL-1 receptor domain-containing adaptor inducing IFN-␤; VSV, vesicular stomatitis virus; VSVgfp, dsRNA, current models suggest that activation of all sensors leads VSV expressing GFP; HSV-1gfp, HSV-1 expressing GFP; WNv, West Nile virus; to IRF3 activation and subsequent ISG and type 1 IFN induction. WT, wild type; MOI, multiplicity of infection; C , threshold cycle. t The importance of IRF3 in the early and late phases of type 1 Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 IFN expression and antiviral immunity was demonstrated through www.jimmunol.org/cgi/doi/10.4049/jimmunol.0900867 6546 dsRNA LENGTH-DEPENDENT, IFN-INDEPENDENT ANTIVIRAL RESPONSE

Table I. Details of in vitro transcribed dsRNA generation from the cloned WNv genomea

dsRNA Source Gene Length (bp) Primersb

v200 WNv E 200 Sense: TCCTCCAACTGCGAGAAACGTG Antisense: AAAGGAGCGCAGAGACTAGCCG v500 WNv E 500 Sense: TCCTCCAACTGCGAGAAACGTG Antisense: TGGCACGGATGGACCTTG v1000 WNv E 1000 Sense: TCCTCCAACTGCGAGAAACGTG Antisense: ACACATGCGCCAAATTTGCC v3000 NS3-NS4B 3000 Sense: CATGACAACCAACCCCCACGCATGATG Antisense: GCGGGCGTGATGGTTGAAGGTGT

a Primer sequences used for amplifying PCR product templates for dsRNA in vitro transcription. b All primers included a T7 sequence tag (5Ј-taatacgactcactataggg-3Ј) used by the T7 polymerase during dsRNA synthesis. the generation of IRF3Ϫ/Ϫ and IRF3Ϫ/Ϫ9Ϫ/Ϫ mice (4). Mice de- viral dsRNA is length dependent in WT mouse ﬁbroblasts and that ﬁcient for IRF3 were more vulnerable to viral infection and IFN the length dependence is exacerbated in the absence of IRF3. Fur- production was reduced 20- to 50-fold. In the absence of both IRF3 thermore, we provide evidence of an IRF3- and type 1 IFN- inde- and IRF9, type 1 IFN production was completely ablated (4). Since pendent antiviral response that is more robustly activated by longer

IRF7 gene expression is dependent on type 1 IFN signaling, levels dsRNA molecules. Downloaded from of this transcription factor were significantly diminished in cells lacking IRF3 and absent in cells lacking IRF3 and IRF9 following Materials and Methods viral infection. These studies led to a model in which constitutive Cells and viruses expression of low levels of type 1 IFN in uninfected cells supports Ϫ Ϫ Ϫ Ϫ basal expression of equally low levels of IRF7. Upon viral infec- MEFs were derived from WT C57BL/6, IRF3 / (4), IRF3 / and IRF9Ϫ/Ϫ (4), IPS-1Ϫ/Ϫ and IPS-1ϩ/ϩ littermate control mice and were tion, activation of IRF3 initiates a positive feedback loop resulting http://www.jimmunol.org/ maintained in ␣-MEM supplemented with 10% FBS, 100 U ⅐ mlϪ1 peni- ␤ ␣ Ϫ1 in robust IFN- , IRF7, IFN- , and ISG induction (13). Subsequent cillin, 100 ␮g ⅐ ml streptomycin, and 2 mM L-glutamine. Experiments Ϫ/Ϫ Ϫ/Ϫ Ϫ/Ϫ studies in IRF7 and IRF3 7 mice confirmed the require- were performed with cells at passages three to eight. All cells were incu- o ment for IRF3 and IRF7 in virus-mediated IFN-␤ and IFN-␣ pro- bated at 37 C in a humidified 5% CO2 incubator. Vesicular stomatitis virus duction, respectively (14). (VSV) expressing GFP (VSVgfp; provided by B. Lichty, McMaster Uni- Although the prototypic response to viral infection and gener- versity, Hamilton, Ontario), HSV-1 (strain KOS) expressing GFP (HSV- 1gfp) (24), and WNv (Kunjin subtype; provided by M. Diamond, Wash- ation of dsRNA in nonprofessional innate immune cells is the ac- ington University, St. Louis, MO) were propagated on Vero cells tivation of IRF3 and subsequent production of type 1 IFN, induc- (American Type Culture Collection). tion of ISGs or an antiviral response has been observed in the absence of either IRF3 or IFN production. Infection of IRF3Ϫ/Ϫ dsRNA synthesis and treatments by guest on September 27, 2021 mouse embryonic fibroblasts (MEFs) with Newcastle disease virus dsRNA was synthesized by in vitro transcription using a Megascript RNAi induced a panel of IRF3-independent direct response genes, in- kit (Ambion). One microgram of PCR fragments amplified from portions cluding IFN-inducible p200 family proteins p203 and p204 and of the cloned WNv genome was used as a template (Table I). The dsRNA Mx2 (15). Although small interfering RNA-mediated knockdown lengths of 200, 500, and 1000 bp (v200, v500, v1000) were derived from of IRF3 in a human hepatoma cell line dampened ISG induction in the E protein sequence and a 3000-bp dsRNA fragment was derived from the NS3-NS4B sequence (v3000). The average length for the poly(I:C) (GE response to poly(I:C) and Sendai virus infection, it had no effect on Healthcare) used in this study was ϳ4000 bp as determined by marker size ISG56 and MxA induction in response to Sin Nombre virus par- comparison using agarose gel electrophoresis and a 1-kb Plus DNA ladder ticle treatment (16). Similarly, expression of a dominant negative (Fermentas). form of IRF3 in 293 cells failed to impact on the ability of Cells were treated with dsRNA in equal molar amounts to ensure an equal number of molecules per dsRNA length, unless otherwise noted. poly(I:C) to block hepatitis C virus replication (17). Finally, con- dsRNA treatments were performed in serum-free OptiMEM medium (Life Ϫ/Ϫ sistent with previous observations (4), IRF3 mice were more Technologies) in the presence of 50 ␮g/ml DEAE-dextran (Pharmacia) for vulnerable to infection with West Nile virus (WNv) than their 1 h followed by additional indicated amounts of time in full growth me- wild-type (WT) counterparts (18), despite the ability of this virus dium, unless otherwise noted. DEAE-dextran is a cationic polymer that to elicit type 1 IFN production in knockout animals (18, 19). Al- binds negatively charged nucleic acids and enables a closer association between the negatively charged cell membrane and the nucleic acid of though these studies suggest that IRF3 is important, but not es- interest (25). In all experiments, DEAE-dextran was used in dsRNA-un- sential, for virus-mediated type 1 IFN production, IRF3 has been treated controls to ensure that the polymer alone was not influencing sub- shown to play a critical role in the induction of ISGs and an an- sequent cellular responses. tiviral response in the absence of IFN production (20–22). This activity stems from the ability of IRF3 to bind directly to the pro- dsRNA immunofluorescence microscopy moter region of a subset of ISGs (23). WT MEFs were seeded on glass coverslips to ϳ60% confluency and al- Despite recent advancements in characterizing viral dsRNA-me- lowed to attach overnight. Cells were then infected with Kunjin virus at a diated antiviral immunity in nonprofessional innate immune cells, multiplicity of infection (MOI) of 10 for 1.5 h, after which the virus was removed and fresh medium was added to the wells. As a positive control, two issues remain outstanding. First, the biological consequence of Ϫ cells were treated with 100 ␮g ⅐ ml 1 poly(I:C) for 8 h. At specific time differential dsRNA recognition remains unclear, particularly since points, cells were fixed with 4% paraformaldehyde, permeabilized with downstream signaling pathways converge on IRF3. Second, al- 0.1% Triton X-100, and blocked in blocking buffer (3% BSA, 3% goat though both IRF3 and type 1 IFN play central roles in mediating serum, and 0.02% Tween 20 in PBS). Coverslips were incubated with the the antiviral response to dsRNA and can each function in the ab- mouse anti-dsRNA Ab J2 (English and Scientific Consulting) at a 1/200 dilution, followed by an Alexa Fluor 488-labeled anti-mouse secondary sence of the other, it is unclear whether dsRNA can induce anti- Ab, also at 1/200 (Molecular Probes). All Ab dilutions were performed in viral activity in the absence of both IRF3 and type 1 IFN. In this blocking buffer. Nuclei were stained with Hoechst stain. Images were cap- study, we provide evidence that the innate antiviral response to tured using a Leica DM-IRE2 inverted microscope. The Journal of Immunology 6547

FIGURE 1. WNv infection leads to the generation of intracellular dsRNA. A, Immunoﬂuorescence microscopy of WT MEFs infected with WNv strain Kunjin (MOI ϭ 10) or treated with poly(I:C) (100 ␮g/ml) using the J2 anti-dsRNA Ab. B, Immunoblot analysis of Vero cells and WT MEFs infected with Kunjin virus (MOI ϭ 5 and 10, respectively) using the J2 anti-dsRNA Ab. The arrow indicates the running distance of a 3000-bp in vitro-transcribed dsRNA molecule. pi, Postinfection; M, mock.

dsRNA immunoblot hoc test for pairwise comparisons, a Dunnett’s post test for comparisons with control treatments, and an unpaired t test in the case of a comparison RNA was harvested from cells infected with Kunjin virus or treated with between two values. All statistical analyses were performed using Graph- dsRNA as indicated using TRIzol reagent (Invitrogen). Twenty micro- Pad InStat. A value of p Ͻ 0.05 was considered statistically significant. Downloaded from grams of RNA was electrophoresed in a 10% nondenaturing polyacryl- amide gel and transferred onto a nylon membrane (Hybond Nϩ;GE Results Healthcare) using a semidry transfer apparatus. The membranes were blocked with 5% milk in TBS and blotted with the J2 Ab followed by a WNv infection of fibroblasts and epithelial cells produces long, goat anti-mouse IgG secondary Ab. The dsRNA was visualized by the ECL stable dsRNA molecules system. In vitro-transcribed RNA was electrophoresed on the same gel as Although dsRNA was thought to be produced in virtually all vi- a size comparison for samples. rally infected cells, a study using a dsRNA-specific Ab suggested http://www.jimmunol.org/ PCR arrays that dsRNA can be detected following infection with positive- RNA was isolated from dsRNA-treated cells using TRIzol reagent and 2.5 strand RNA, dsRNA, or DNA viruses but not with negative-strand ␮g of RNA was DNase treated using a DNA-free kit (Ambion). RNA RNA viruses (26). However, a recent study showed that VSV, a integrity and quantity were measured using the Agilent 2100 Bio-Analyzer negative-strand RNA virus, is capable of detectable dsRNA pro- (Agilent). Three hundred nanograms of high-quality total RNA was reverse duction (12), suggesting that viruses of all classification likely pro- transcribed using the RT2 First Strand Kit (SABiosciences). The cDNA was applied to the Mouse IFNs and Receptors RT2 Profiler PCR Array duce detectable amounts of dsRNA of various lengths. WNv (SABiosciences) as per the manufacturer’s instructions. The arrays were (strain Kunjin) is a positive-strand RNA virus that has been shown run on the Applied Biosystems PRISM 7900HT Sequence Detection Sys- by immunofluorescence microscopy to produce dsRNA following tem using Sequence Detector Software version 2.2. Data were analyzed infection of Vero monkey kidney epithelial cells; however, the by guest on September 27, 2021 using the online SABiosiences RT2 Profiler PCR array data analysis tool ⌬⌬ length of the dsRNA produced was not determined (27). In the based on the Ct method. Specifically, gene expression was normalized to five housekeeping genes (Gusb, Hprt, Hspcb, Gapdh, and ␤-actin) and present study, abundant dsRNA was also detected by immunoflu- expressed as fold change over the control group (cells treated with DEAE- orescence microscopy in Kunjin virus-infected WT MEFs by 8 h dextran alone). after infection using the J2 anti-dsRNA Ab (Fig. 1A). As a control, Quantitative RT-PCR poly(I:C) was used. Furthermore, in both MEF and Vero cells, dsRNA of high molecular weight (Ͼ3000 bp) could be detected in Three hundred nanograms of total RNA was reverse transcribed with 0.2 extracts as late as 48 h after infection by immunoblot analysis ng of random 6-mer primer and 50 U of Superscript II (Invitrogen) in a total reaction volume of 20 ␮l. Real-time quantitative PCR was performed using the same Ab (Fig. 1B). These data confirm the production of in triplicate, in a total volume of 25 ␮l, using Universal PCR Master Mix long, stable dsRNA molecules in WNv-infected cells. and gene-specific TaqMan primers (Applied Biosystems). Data were ana- ⌬⌬ lyzed using the Ct method. Specifically, gene expression was normal- In vitro-transcribed dsRNA molecules of different lengths are ized to the housekeeping gene (Gapdh) and expressed as fold change over stable within treated cells the control group (cells treated with DEAE-dextran alone). To assess the biological consequence of dsRNA length, dsRNA Antiviral assays molecules of specific lengths (200, 500, 1000, and 3000 bp) were Cells were seeded in 12-well dishes and treated with serial dilutions of nM in vitro-transcribed from cloned fragments of the WNv genome. quantities of dsRNA for specified lengths of time. Cells were subsequently These particular lengths were chosen because similar-sized infected with 0.1 PFU/cell VSVgfp for1hinserum-free medium. This dsRNA molecules have been observed in virally infected cells, amount of virus was determined to be the maximal dose for which signal such as those infected with reovirus, VSV, encephalomyocarditis saturation in untreated cells did not occur. The viral inoculum was then removed and replaced with DMEM containing 1% methylcellulose. GFP virus (12), and WNv, as determined from the present study. Dis- fluorescence intensity was measured 24 h later on a Typhoon Trio (GE crete bands of the appropriate size were detected on a 1% agarose Healthcare) and quantified using ImageQuant TL software. A dose-re- gel (Fig. 2A). The 3000 bp molecule consistently separated into sponse curve was generated for each dsRNA molecule and an EC50 value two fragments. In contrast, poly(I:C) ranged in length from 500 to was calculated using GraphPad PRISM software. No differences in VS- ϳ Vgfp infection rates in untreated cells were observed (supplemental 5000 bp, with the average length determined to be 4000 bp. To Fig. 1).4 ensure that the in vitro transcribed dsRNA molecules were stable within treated cells, similar to that observed with viral infection, Statistical analysis immunoblot analysis using the J2 Ab was performed on extracts Data are expressed as means Ϯ SEM (unless otherwise indicated). Statis- harvested 6 h after dsRNA treatment. Intracellular dsRNA was tical analysis was performed using a one-way ANOVA with Tukey’s post relatively stable, particularly the 200, 500, and 1000 bp species (Fig. 2B). Although degradation of the 3000 bp species was evi- 4 The online version of this article contains supplemental material. dent at this time point, the predominant species observed were 6548 dsRNA LENGTH-DEPENDENT, IFN-INDEPENDENT ANTIVIRAL RESPONSE

FIGURE 2. In vitro-transcribed dsRNA of speciﬁc lengths derived from cloned fragments of the WNv genome is relatively stable within transfected cells. A, dsRNA of 200 (lane 1), 500 (lane 2), 1000 (lane 3), and 3000 (lane 4) bp lengths was generated using the WNv genome as a template.

Approximately 500 ng of each dsRNA was separated on a 1% agarose gel and visualized by ethidium bromide staining. Because dsRNA runs slower than Downloaded from DNA, all dsRNA appear to be of the appropriate length when compared with a 1-kb DNA marker (lane M). Four micrograms of poly(I:C) was also run on the gel (lane 5), with the average length determined to be ϳ4000 bp. B, WT MEFs were mock treated (M) or treated with 1 ␮g/ml poly(I:C) (pIC) or in vitro- transcribed dsRNA of four lengths (v200, v500, v1000, or v3000) for 6 h, after which RNA was extracted. A dsRNA immunoblot was performed using 20 ␮g of RNA and dsRNA was detected using the J2 anti-dsRNA Ab. A ladder of 25 ng of in vitro-transcribed dsRNA was included to determine size (L). http://www.jimmunol.org/ ϳ2000–3000 bp. Thus, in vitro-transcribed dsRNA is relatively length eliciting a modest induction and poly(I:C) demonstrating stable within treated cells, over a range of dsRNA lengths. Fur- the most robust induction (Fig. 3A). When IRF3Ϫ/Ϫ MEFs were thermore, dsRNA of all lengths entered into cells with equal efﬁ- treated with 3 nM poly(I:C) or dsRNA of various lengths (the ciency (supplemental Fig. 2 and data not shown) and by 1 h after concentration of dsRNA required to elicit a complete antiviral re- treatment, all cell-associated dsRNA had internalized (data not sponse in IRF3Ϫ/Ϫ MEFs; Fig. 4), the same subset of ISG, IRF, shown). and IFN transcripts were induced (Fig. 3B), also in a length-dependent fashion. However, dsRNA of the 200 bp length was uni- Induction of IRFs, IFNs, and ISGs are length dependent but formly diminished in its capacity to stimulate transcription of most

IRF3 independent by guest on September 27, 2021 genes represented on the array, while treatment with poly(I:C) and Recent evidence suggests that recognition of dsRNA by PKR, dsRNA of the 3000 bp length dsRNA stimulated gene transcription TLR3, RIG-I, and MDA-5 is length dependent (9, 12, 28). How- to a similar capacity. Of note, IRF7 and IFN-␤ levels remained ever, in fibroblasts, signaling pathways activated by these proteins elevated in IRF3Ϫ/Ϫ MEFs, consistent with previous observations converge on IRF3 to mediate IFN and ISG induction. Little is (4, 13). understood regarding the biological significance of differential rec- When IRF3Ϫ/Ϫ9Ϫ/Ϫ MEFs were treated with 8.5 nM poly(I:C) ognition of dsRNA molecules, particularly given that recognition or dsRNA of various lengths (the highest concentration of dsRNA of dsRNA by these four proteins leads to IRF3 activation. To spe- possible under these experimental conditions), ISG, IRF, or IFN cifically address this issue, we used equal molar amounts of transcript accumulation was not observed, even after 24 h of treat- dsRNA of various lengths to ensure that the only variable was the ment (Fig. 3C). The levels of housekeeping genes in mock-treated dsRNA length and not the number of dsRNA molecules. However, cells were similar in all cell types (Fig. 3D), confirming the integ- when equal concentrations (by weight) of dsRNA were tested, rity of the RNA. Furthermore, the levels of the remaining IRF length- dependent gene induction as described below was still ob- family members were similar in all cell types (Fig. 3E). These data served (data not shown). WT MEFs were treated with 1.5 nM suggest that although IRF3 is not essential for dsRNA-mediated poly(I:C) or dsRNA of 200, 1000, or 3000 bp lengths. This amount ISG, IRF, and IFN induction per se, there appears to be a length- of dsRNA was determined to elicit a complete antiviral response in WT MEFs (see Fig. 4). RNA harvested 6 h after treatment was dependent requirement for IRF3, particularly with smaller lengths reverse transcribed and the cDNAs were assayed using mouse of dsRNA. Furthermore, IFN signaling (via IRF9-associated path- IFNs and receptors RT2 Profiler PCR Arrays (supplemental Fig. ways) is required for dsRNA-mediated ISG, IRF, and IFN induc- 3). In addition to housekeeping controls, this array contains 84 tion in the absence of IRF3. genes whose expression is controlled by or involved in signal To confirm that the expression of ISGs, IRFs, and IFNs was transduction mediated by IFN ligands and receptors. Included on more dependent on IRF3 following stimulation with short dsRNA the array are 21 IFN and cytokine species, 35 IFN and cytokine molecules as opposed to long dsRNA molecules, we performed receptors, 8 IRFs, 2 IRF-binding proteins, and 18 ISGs. Shown in quantitative RT-PCR analysis of Cxcl10, Ifit1, IRF7, and IFN-␤1 Ϫ/Ϫ Fig. 3 are ISGs whose expression profile changed with treatment in WT and IRF3 MEFs following treatment with short (200 bp) (with Adar serving as a representative of an ISG whose expression and long (3000 bp) dsRNA molecules. As shown in Fig. 4A, in- Ϫ Ϫ profile did not change), all IRFs, all type 1 IFN species, and cy- duction of all four transcripts was significantly reduced in IRF3 / tokines whose expression profile changed with treatment. No re- MEFs relative to WT MEFs following stimulation with short ceptors are reported since none showed changes in expression pro- dsRNA molecules. In contrast, a similar level of induction was file with treatment. A length- dependent induction of a subset of observed following stimulation with long dsRNA molecules in ISGs, IRFs, and IFNs was observed, with dsRNA of the 200 bp both cell types (Fig. 4B). The Journal of Immunology 6549 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 3. ISG, IRF and IFN genes are induced in a dsRNA length-dependent fashion. A, WT, B, IRF3Ϫ/Ϫ, and C, IRF3Ϫ/Ϫ9Ϫ/Ϫ MEFs were treated with in vitro-transcribed dsRNA of different lengths (v200, v1000, v3000) or poly(I:C) using concentrations shown to induce a maximal antiviral response (1.5, 3, and 8.5 nM dsRNA for WT, IRF3Ϫ/Ϫ, and IRF3Ϫ/Ϫ9Ϫ/Ϫ MEFs, respectively) for 6 h (WT and IRF3Ϫ/Ϫ MEFs) or for 24 h (IRF3Ϫ/Ϫ9Ϫ/Ϫ). The fold change in transcript expression levels compared with levels in mock-treated cells were measured using real-time PCR arrays. These results are representative of two independent experiments. Transcript levels for the PCR array housekeeping genes (D) and IRF family members (E) were compared Ϫ/Ϫ Ϫ/Ϫ Ϫ/Ϫ ␤ between mock-treated WT, IRF3 and IRF3 9 MEFs. Differences in Ct values were not statistically signiﬁcant, with the exception of -actin in IRF3Ϫ/Ϫ9Ϫ/Ϫ MEFs, which was found to be expressed at lower levels when compared with WT, but not IRF3Ϫ/Ϫ, MEFs. For each gene, a one-way .p Ͻ 0.05 ,ء ;ANOVA was performed with a Tukey post test

The dependence on dsRNA length is exacerbated in the absence equally susceptible to VSVgfp infection (supplemental Fig. 1). of IRF3 A statistically significant difference in the EC50 values for To confirm the dsRNA length-dependent nature of ISG and IFN dsRNA molecules of different lengths was observed in both WT Ϫ/Ϫ induction and to determine the biological outcome in the pres- and IRF3 MEFs (Fig. 5, A and B). A length-dependent an- Ϫ/Ϫ ence and absence of IRF3, we performed standard antiviral as- tiviral response was also observed in both WT and IRF3 says to ascertain the effective concentration of dsRNA that pre- MEFs when induced by equal weights of dsRNA (data not Ϫ/Ϫ vents viral replication by 50% (EC ). WT and IRF3 MEFs shown). When the EC50 values for a given length of dsRNA 50 Ϫ Ϫ were treated with serially diluted nM concentrations of in vitro- were compared between WT and IRF3 / MEFs, there was a transcribed dsRNA of specific lengths or poly(I:C) for 6 h, fol- statistically significant difference in the ability of dsRNA of 200 lowed by challenge with VSVgfp under the viral promoter. GFP and 500 bp to elicit an antiviral response, whereas dsRNA of

ﬂuorescence was monitored 24 h after infection and the EC50 1000 and 3000 bp and poly(I:C) elicited a similar antiviral re- values were determined. VSVgfp replication was similar in un- sponse in the two cell types (Fig. 5C). Furthermore, poly(I:C) treated WT and IRF3Ϫ/Ϫ cells, indicating that these cells are was able to limit the replication of HSV-1, a large DNA virus, 6550 dsRNA LENGTH-DEPENDENT, IFN-INDEPENDENT ANTIVIRAL RESPONSE

FIGURE 4. Induction of Cxcl10, Iﬁt1, IRF7, and IFN-␤1 are more dependent on IRF3 following stimulation with short dsRNA molecules. WT and IRF3Ϫ/Ϫ MEFs were treated with v200 (A)orv3000 (B) for 6 h. Quantitative RT- PCR was performed in triplicate with gene expression being normalized to the housekeeping gene (Gapdh) and expressed as fold change relative to mock- treated cells. Results were analyzed using a one-way ANOVA with a Tukey post .p Ͻ 0.001 ,ءءء p Ͻ 0.01 and ,ءء ;test indicating that this antiviral response is not unique to VSV cules, we tested whether IPS-1 is necessary under similar condi- (supplemental Fig. 4). These data support what was observed at tions. Similar to results observed in IRF3Ϫ/Ϫ9Ϫ/Ϫ MEFs, dsRNA the transcript level; the antiviral response to dsRNA is length of any length failed to elicit a signiﬁcant antiviral response fol- dependent and the antiviral response to shorter dsRNA mole- lowing a 6-h treatment (data not shown). However, following a

cules is more reliant on IRF3, whereas the antiviral response to 24-h treatment, dsRNA of 3000 bp and poly(I:C) induced an Downloaded from Ϯ larger dsRNA molecules is predominantly IRF3 independent. antiviral response with EC50 values of 0.51 nM 0.16 and 0.23 nM Ϯ 0.04, respectively; Fig. 7). Short dsRNA molecules of Length-dependent induction of an antiviral response in the 200 bp lengths failed to induce an antiviral response in the absence of IRF3 and type I IFN absence of IPS-1. Conversely, dsRNA of 200 and 3000 bp We failed to detect signiﬁcant IRF, ISG, or IFN induction in lengths and poly(I:C) all induced an antiviral response in IPS- Ϫ/Ϫ Ϫ/Ϫ ϩ/ϩ Ϯ response to dsRNA or poly(I:C) in IRF3 9 MEFs (Fig. 1 littermate controls with EC50 values of 0.64 0.23 nM, http://www.jimmunol.org/ 3C), consistent with previous reports (4, 13). To determine 0.22 Ϯ 0.05 nM, and 0.17 Ϯ 0.04 nM, respectively (Fig. 7). ϩ ϩ Ϫ Ϫ whether these cells were capable of eliciting an antiviral re- dsRNA entry was similar between IPS-1 / and IPS-1 / sponse in the absence of IFN or ISG induction, we performed a MEFs (data not shown) as was VSVgfp infectivity in untreated standard antiviral assay using VSVgfp following treatment with cells (supplemental Fig. 1). dsRNA and poly(I:C). Although we were unable to determine

EC50 values for each length of dsRNA, given that a complete Discussion antiviral response was not observed at the highest concentration It is well established that type 1 IFNs produced early following of dsRNA permissible, we did observe a significant reduction in virus infection play a critical role in the immune defense against the ability of VSVgfp to replicate in cells treated for 24 h (Fig. most viruses by limiting virus replication and spread (30). Al- by guest on September 27, 2021 6). No significant antiviral activity was observed following a though various structural components of a virus can elicit type 1 6-h treatment (data not shown). At dsRNA lengths of 200, 500, IFN production, the most potent viral inducer is dsRNA, particu- and 1000 bp, VSVgfp replication was reduced by ϳ60% larly in nonprofessional innate immune cells such as fibroblasts. (56.7 Ϯ 2.2%, 58.0 Ϯ 1.7%, and 60.8 Ϯ 1.1%, respectively), Although it is recognized that the majority of viral dsRNA is whereas dsRNA of the 3000 bp length and poly(I:C) reduced bound by viral proteins, suggesting that little “free” viral dsRNA VSVgfp replication by ϳ70 and 90% (67.4 Ϯ 3.4% and 85.7 Ϯ exists within a cell, the characterization of multiple cellular 1.3%, respectively), respectively. A statistically significant dif- dsRNA-binding proteins predicts that either entire dsRNA mole- ference was observed with the latter two treatments. These data cules, or portions of these molecules, are available for recognition suggest that dsRNA can elicit an antiviral response in the ab- and binding by cellular proteins. At least four cellular proteins sence of the type I IFN system, including IRF3. As observed in recognize viral dsRNA and mediate type 1 IFN production: TLR3, Ϫ Ϫ IRF3 / MEFs, treatment with poly(I:C) significantly inhibited PKR, RIG-I, and MDA-5. Although these proteins preferentially the replication of HSV-1 (supplemental Fig. 4). Since dsRNA bind dsRNA based on its cellular localization, viral origin, and/or also activates NF-␬B and elicits the induction of cytokines and length, the outcome of dsRNA binding is signaling through the chemokines, we assessed induction of cytokines and chemo- adaptors TRIF (TLR3) or IPS-1 (PKR, RIG-I, and MDA-5) to kines using pathway-specific PCR arrays. However, we did not activate IRF3. Activated IRF3 can induce ISGs directly, in the detect significant induction of any genes under conditions that absence of IFN production, or cooperate with additional transcrip- elicit an antiviral response (data not shown). The nature of this tion factors such as IRF1, IRF7, and NF-␬B to elicit type 1 IFN cellular response is unknown, but is currently under investiga- production. tion. Although dsRNA length dependence was observed, this Although length plays a role in determining which cellular pro- dependence was not as robust as observed for the cellular an- teins preferentially bind a given dsRNA molecule, the biological tiviral response mediated by IRF3 and type 1 IFNs. significance of dsRNA length is unclear, particularly given that IRF3 activation ensues regardless of the dsRNA-binding protein. The mitochondria-associated adaptor IPS-1 is dispensable for To investigate this issue, we produced dsRNA of various lengths the antiviral response mediated by long dsRNA molecules from the WNv genome, as the antiviral response to WNv involves Previous studies in MEFs harvested from IPS-1 null mice demon- TLR3, PKR, RIG-I, and MDA-5 (31–33) and WNv produces sta- strated that IPS-1 is essential for IFN-␤ production following treat- ble dsRNA in fibroblasts following infection, thus confirming the ment with virus or dsRNA (29). The lack of IFN-␤ production was biological relevance of dsRNA species from this viral origin. In attributed to impaired IRF3 and NF-␬B activation in these cells. this study, we provide evidence that dsRNA induces a length-de- Given that neither IRF3 nor type 1 IFN are necessary for cellular pendent antiviral response, with long dsRNA molecules inducing antiviral activity, particularly in response to long dsRNA mole- significantly higher levels of ISG, IRF, and IFN transcripts than The Journal of Immunology 6551 Downloaded from

FIGURE 6. Evidence of a dsRNA length-dependent antiviral response in the absence of IRF3 and type I IFN. IRF3Ϫ/Ϫ9Ϫ/Ϫ MEFs were treated with 8.5 nM of the indicated dsRNA for 24 h. Cells were then challenged with VSVgfp, and GFP ﬂuorescence intensity was measured at 24 h after http://www.jimmunol.org/ infection. dsRNA length dependence was observed with v3000 and poly(I:C) but not with v500 and v1000 when a one-way ANOVA was performed using Dunnett’s post test, with v200 being the control comparison. Results with poly(I:C) in WT MEFs are shown for comparison pur- .p Ͻ 0.01 ,ءء p Ͻ 0.05 and ,ء .poses

short dsRNA molecules when equal nM amounts were compared.

The length dependence was confirmed upon determination of EC50 values in a standard antiviral assay. by guest on September 27, 2021 Previous studies have shown that activation of TLR3 and PKR requires a minimal length of dsRNA, either to span multiple dsRNA binding sites within a single TLR3 molecule (5–8) or to elicit dimerization of two PKR molecules (9, 10). Although activation of RIG-I and MDA-5 following dsRNA binding does not appear to have similar requirements, it has been established that MDA-5 preferentially binds long dsRNA molecules and poly(I:C) (11, 12). Accordingly, a simple explanation for the data presented in this manuscript is that MEFs express elevated levels of MDA-5 relative to RIG-I and thus long dsRNA molecules induce a greater biological response. However, untreated MEFs express low to un- detectable levels of both MDA-5 and RIG-I, but rapidly up-regu- late the expression of both ISGs following virus or dsRNA treatment (34), similar to what is seen with PKR. Another possible explanation is that MDA-5 binds dsRNA with a higher affinity than RIG-I. To date, comprehensive studies to specifically address this possibility have not been performed. An alternative explanation is that longer dsRNA molecules facilitate better multimerization of FIGURE 5. The dependence on dsRNA length for antiviral state in- MDA-5 compared with shorter dsRNA lengths with RIG-I. There Ϫ/Ϫ duction is exacerbated in the absence of IRF3. A,WTandB, IRF3 is a general precedence with cellular signal transduction that mul- MEFs were treated with serially diluted nM concentrations of in vitro- timerization of pathway components leads to enhanced signal transcribed dsRNA of specific lengths (v200, v500, v1000, and v3000 transduction and downstream biological activity. Regardless, the bp) or poly(I:C) for 6 h. Cells were then challenged with VSVgfp and focus of the current study was not to determine which dsRNA- GFP fluorescence intensity was measured at 24 h postinfection. EC50 values were determined as the dsRNA concentration providing 50% binding protein(s) mediates an antiviral response, but rather to de- protection against VSVgfp. Length-dependent antiviral responses were lineate the biological outcome of differential dsRNA binding, par- determined by performing a one- way ANOVA and Dunnett’s post test, ticularly given that all characterized pathways converge on IRF3. with v200 being the control comparison. C, IRF3 dependence was dem- Indeed, it is likely that per dsRNA molecule, long dsRNA mole- Ϫ Ϫ onstrated by performing an unpaired t test, comparing WT to IRF3 / cules have an increased capacity to activate multiple dsRNA-bind- ءء Ͻ ء EC50 values for each dsRNA length individually. , p 0.05 and , ing proteins (of the same or different species), thus potentiating the Ͻ p 0.01. downstream biological response. 6552 dsRNA LENGTH-DEPENDENT, IFN-INDEPENDENT ANTIVIRAL RESPONSE

FIGURE 7. IPS-1 is dispensable for induction of an antiviral state in response to long dsRNA molecules. IPS-1Ϫ/Ϫ and IPS-1ϩ/ϩ littermate controls were treated with the indicated amounts of dsRNA for 24 h. Cells were then challenged with VS- Vgfp and GFP ﬂuorescence intensity was measured at 24 h after infection.

Of particular interest, the dsRNA length dependence was exac- and chemokines under similar conditions. Although we were un- Downloaded from erbated in the absence of IRF3. When comparing either individual able to elicit a complete antiviral response in IRF3Ϫ/Ϫ9Ϫ/Ϫ MEFs transcript induction or EC50 values for a given length of dsRNA, at the highest concentration of dsRNA permissible within our ex- a signiﬁcant difference was observed between the ability of short, perimental system (8.5 nM), we observed a reduction in virus rep- but not long, dsRNA molecules to induce ISGs, IRFs, and IFNs or lication ranging from ϳ60 to 90%, depending on dsRNA length. to protect WT vs IRF3Ϫ/Ϫ MEFs from viral infection. These re- Consistent with data generated in IRF3Ϫ/Ϫ MEFs, the antiviral

sults confirm that IRF3 is not essential per se for ISG and IFN response was more robust following treatment with long dsRNA http://www.jimmunol.org/ production (4, 13), but suggest that IRF3 plays a more critical role molecules. This antiviral response reduced virus replication of in response to recognition of short dsRNA molecules. Long both a RNA virus (VSV) and a DNA virus (HSV-1), albeit with dsRNA molecules (3000 bp and poly(I:C)) were equally capable of different efficiency. Although a 6-h treatment with dsRNA was preventing virus replication in the presence and absence of IRF3. sufficient to significantly inhibit HSV-1 replication, a 24-h treat- These data suggest that either a novel transcription factor with a ment was required to significantly inhibit VSV replication. These similar activity to IRF3 exists or that in the absence of IRF3, an- data highlight the complex nature of virus-host interactions. other member of the IRF family can compensate for the loss of A similar reduction in virus replication was made in MEFs de- IRF3. Recent biochemical and structural studies of the IFN-␤ pro- ficient for the mitochondria-associated adaptor IPS-1. Although moter show that IRF binding is critical for cooperative association previous studies have shown that IPS-1 is important for activation by guest on September 27, 2021 of the IFN-␤ enhanceosome components and IFN-␤ transcription of IRF3 and NF-␬B and the subsequent induction of IFN-␤,we (35, 36). Although IRF1, IRF5, and IRF7 have been implicated in observed that treatment with long dsRNA molecules was able to type 1 IFN production, it is unlikely that these IRFs are responsible induce an antiviral response capable of controlling VSV infection for the effects seen in IRF3Ϫ/Ϫ MEFs. We failed to detect differ- in the absence of IPS-1. In both IRF3Ϫ/Ϫ9Ϫ/Ϫ and IPS-1Ϫ/Ϫ ences in the basal expression of the IRF mRNA species in the MEFs, however, an extended treatment time (24 h) was required to various MEFs, and previous studies showed that ectopic expres- elicit a biological response. These data suggest that the cellular sion of IRF1 fails to restore type 1 IFN induction in the absence of pathway(s) that functions independently of IPS-1, IRF3, and type IRF3 (4) and that IRF5 activation does not occur in response to 1 IFN preferentially respond to long dsRNA molecules and require treatment with poly(I:C) (37). Furthermore, IRF7 expression in sufficient stimulation to accumulate and/or activate constituent sig- fibroblasts is dependent on type 1 IFN signaling (Ref. 4 and Fig. 3) naling components. It is not clear at this time whether a novel and IRF7 predominantly activates IFN-␣ promoters, while robust dsRNA-binding protein participates in this antiviral response or IFN-␤ expression was observed in the absence of IRF3 following whether the known dsRNA proteins signal through alternative treatment with dsRNA or poly(I:C). Little is known regarding al- pathways to block virus replication. Studies are underway to ad- ternative pathways of dsRNA-mediated type 1 IFN induction in- dress this issue and determine the cellular genes that are induced volving proteins other than IRFs. Although NLRs have been by dsRNA under these conditions. Overall, these findings further shown to bind to dsRNA (38) and are important in mediating an- characterize the requirement (or lack thereof) of IRF3 and the type tiviral immune responses (39), activation of type 1 IFN has not 1 IFN system in the innate antiviral immune response following been observed. Furthermore, it is possible that pattern recognition recognition of dsRNA. receptors capable of binding dsRNA that signal through alternative transcription factors exist. Thus, it remains to be elucidated how Acknowledgments dsRNA, particularly large species, mediate type 1 IFN production We thank A. Thompson and D. Cummings for technical assistance and in the absence of IRF3. B. Lichty and M. Diamond for reagents. A further surprising observation from these data is the ability of Disclosures dsRNA to control virus replication in the absence of IPS-1, IRF3, The authors have no financial conflict of interest. and type 1 IFN production. Although IRF3-dependent, IFN-independent as well as IRF3-independent, IFN-dependent antiviral re- References sponses have been observed, to our knowledge this is the first 1. Jacobs, B. L., and J. O. Langland. 1996. When two strands are better than one: observation of antiviral activity mediated by dsRNA in fibroblasts the mediators and modulators of the cellular responses to double-stranded RNA. Virology 219: 339–349. under conditions where we fail to detect induction of IRFs, IFNs, 2. Takeuchi, O., and S. Akira. 2009. Innate immunity to virus infection. Immunol. or ISGs. Furthermore, we failed to detect induction of cytokines Rev. 227: 75–86. The Journal of Immunology 6553

3. Zhang, P., and C. E. Samuel. 2008. Induction of protein kinase PKR-dependent 20. Noyce, R. S., S. E. Collins, and K. L. Mossman. 2006. Identiﬁcation of a novel activation of interferon regulatory factor 3 by vaccinia virus occurs through pathway essential for the immediate-early, interferon-independent antiviral re- adapter IPS-1 signaling. J. Biol. Chem. 283: 34580–34587. sponse to enveloped virions. J. Virol. 80: 226–235. 4. Sato, M., H. Suemori, N. Hata, M. Asagiri, K. Ogasawara, K. Nakao, T. Nakaya, 21. Guo, J., K. L. Peters, and G. C. Sen. 2000. Induction of the human protein P56 M. Katsuki, S. Noguchi, N. Tanaka, and T. Taniguchi. 2000. Distinct and essen- by interferon, double-stranded RNA, or virus infection. Virology 267: 209–219. tial roles of transcription factors IRF-3 and IRF-7 in response to viruses for 22. Peters, K. L., H. L. Smith, G. R. Stark, and G. C. Sen. 2002. IRF-3-dependent, IFN-␣/␤ gene induction. Immunity 13: 539–548. NF␬B- and JNK-independent activation of the 561 and IFN-␤ genes in response 5. Fukuda, K., T. Watanabe, T. Tokisue, T. Tsujita, S. Nishikawa, T. Hasegawa, to double-stranded RNA. Proc. Natl. Acad. Sci. USA 99: 6322–6327. T. Seya, and M. Matsumoto. 2008. Modulation of double-stranded RNA recog- 23. Grandvaux, N., M. J. Servant, B. tenOever, G. C. Sen, S. Balachandran, nition by the N-terminal histidine-rich region of the human Toll-like receptor 3. G. N. Barber, R. Lin, and J. Hiscott. 2002. Transcriptional proﬁling of interferon J. Biol. Chem. 283: 22787–22794. regulatory factor 3 target genes: direct involvement in the regulation of interfer- 6. Liu, L., I. Botos, Y. Wang, J. N. Leonard, J. Shiloach, D. M. Segal, and on-stimulated genes. J. Virol. 76: 5532–5539. D. R. Davies. 2008. Structural basis of Toll-like receptor 3 signaling with double- 24. Minaker, R. L., K. L. Mossman, and J. R. Smiley. 2005. Functional inaccessi- stranded RNA. Science 320: 379–381. bility of quiescent herpes simplex virus genomes. Virol. J. 2: 85. 25. Minarova, E., V. Spurna, and J. Keprtova. 1972. Interaction of DEAE-dextran 7. Pirher, N., K. Ivicak, J. Pohar, M. Bencina, and R. Jerala. 2008. A second binding with mammalian cells cultivated in vitro. Experientia 28: 333–334. site for double-stranded RNA in TLR3 and consequences for interferon activa- 26. Weber, F., V. Wagner, S. B. Rasmussen, R. Hartmann, and S. R. Paludan. 2006. tion. Nat. Struct. Mol. Biol. 15: 761–763. Double-stranded RNA is produced by positive-strand RNA viruses and DNA 8. de Bouteiller, O., E. Merck, U. A. Hasan, S. Hubac, B. Benguigui, G. Trinchieri, viruses but not in detectable amounts by negative-strand RNA viruses. J. Virol. E. E. M. Bates, and C. Caux. 2005. Recognition of double-stranded RNA by 80: 5059–5064. human Toll-like receptor 3 and downstream receptor signaling requires multim- 27. Mackenzie, J. M., M. T. Kenney, and E. G. Westaway. 2007. West Nile virus erization and an acidic pH. J. Biol. Chem. 280: 38133–38145. strain Kunjin NS5 polymerase is a phosphoprotein localized at the cytoplasmic 9. Lemaire, P. A., E. Anderson, J. Lary, and J. L. Cole. 2008. Mechanism of PKR site of viral RNA synthesis. J. Gen. Virol. 88: 1163–1168. Activation by dsRNA. J. Mol. Biol. 381: 351–360. 28. Liu, L., I. Botos, Y. Wang, J. N. Leonard, J. Shiloach, D. M. Segal, and 10. McAllister, C. S., and C. E. Samuel. 2009. The RNA-activated protein kinase D. R. Davies. 2008. Structural basis of Toll-like receptor 3 signaling with double- enhances the induction of interferon-␤ and apoptosis mediated by cytoplasmic stranded RNA. Science 320: 379–381. Downloaded from RNA sensors. J. Biol. Chem. 284: 1644–1651. 29. Kumar, H., T. Kawai, H. Kato, S. Sato, K. Takahashi, C. Coban, M. Yamamoto, 11. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, K. J. Ishii, O. Takeuchi, and S. Akira. 2006. Essential role of IPS-1 S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, et al. 2006. Differential roles of MDA5 in innate immune responses against RNA viruses. J. Exp. Med. 203: 1795–1803. and RIG-I helicases in the recognition of RNA viruses. Nature 441: 101–105. 30. van den Broek, M. F., U. Muller, S. Huang, R. M. Zinkernagel, and M. Aguet. 12. Kato, H., O. Takeuchi, E. Mikamo-Satoh, R. Hirai, T. Kawai, K. Matsushita, 1995. Immune defence in mice lacking type I and/or type II interferon receptors. A. Hiiragi, T. S. Dermody, T. Fujita, and S. Akira. 2008. Length-dependent Immunol. Rev. 148: 5–18. recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I 31. Fredericksen, B. L., B. C. Keller, J. Fornek, M. G. Katze, and M. Gale, Jr. 2008.

and melanoma differentiation-associated gene 5. J. Exp. Med. 205: 1601–1610. Establishment and maintenance of the innate antiviral response to West Nile virus http://www.jimmunol.org/ 13. Hata, N., M. Sato, A. Takaoka, M. Asagiri, N. Tanaka, and T. Taniguchi. 2001. involves both RIG-I and MDA5 signaling through IPS-1. J. Virol. 82: 609–616. Constitutive IFN-␣/␤ signal for efficient IFN-␣/␤ gene induction by virus. Bio- 32. Daffis, S., M. A. Samuel, M. S. Suthar, M. Gale, Jr., and M. S. Diamond. 2008. chem. Biophys. Res. Commun. 285: 518–525. Toll-like receptor 3 has a protective role against West Nile virus infection. J. Vi- 14. Honda, K., H. Yanai, H. Negishi, M. Asagiri, M. Sato, T. Mizutani, N. Shimada, rol. 82: 10349–10358. Y. Ohba, A. Takaoka, N. Yoshida, and T. Taniguchi. 2005. IRF-7 is the master 33. Samuel, M. A., K. Whitby, B. C. Keller, A. Marri, W. Barchet, B. R. G. Williams, regulator of type-I interferon-dependent immune responses. Nature 434: R. H. Silverman, M. Gale, Jr., and M. S. Diamond. 2006. PKR and RNase L 772–777. contribute to protection against lethal West Nile virus infection by controlling early viral spread in the periphery and replication in neurons. J. Virol. 80: 15. Andersen, J., S. VanScoy, T. F. Cheng, D. Gomez, and N. C. Reich. 2008. 7009–7019. IRF-3-dependent and augmented target genes during viral infection. Genes Im- 34. Loo, Y. M., J. Fornek, N. Crochet, G. Bajwa, O. Perwitasari, L. Martinez- mun. 9: 168–175. Sobrido, S. Akira, M. A. Gill, A. Garcia-Sastre, M. G. Katze, and M. Gale, Jr. 16. Prescott, J. B., P. R. Hall, V. S. Bondu-Hawkins, C. Ye, and B. Hjelle. 2007. 2008. Distinct RIG-I and MDA5 signaling by RNA viruses in innate immunity. by guest on September 27, 2021 Early innate immune responses to Sin Nombre hantavirus occur independently of J. Virol. 82: 335–345. IFN regulatory factor 3, characterized pattern recognition receptors, and viral 35. Dragan, A. I., R. Carrillo, T. I. Gerasimova, and P. L. Privalov. 2008. Assembling entry. J. Immunol. 179: 1796–1802. the human IFN-␤ enhanceosome in solution. J. Mol. Biol. 384: 335–348. 17. Ali, S., and G. Kukolj. 2005. Interferon regulatory factor 3-independent double- 36. Panne, D., T. Maniatis, and S. C. Harrison. 2007. An atomic model of the inter- stranded RNA-induced inhibition of hepatitis C virus replicons in human embry- feron-␤ enhanceosome. Cell 129: 1111–1123. onic kidney 293 cells. J. Virol. 79: 3174–3178. 37. Paun, A., and P. M. Pitha. 2007. The IRF family, revisited. Biochimie 89: 18. Daffis, S., M. A. Samuel, B. C. Keller, M. Gale, Jr., and M. S. Diamond. 2007. 744–753. Cell-specific IRF-3 responses protect against West Nile virus infection by inter- 38. Tattoli, I., L. A. Carneiro, M. Jehanno, J. G. Magalhaes, Y. Shu, D. J. Philpott, feron-dependent and -independent mechanisms. PLoS Pathog. 3: e106. D. Arnoult, and S. E. Girardin. 2008. NLRX1 is a mitochondrial NOD-like re- 19. Bourne, N., F. Scholle, M. C. Silva, S. L. Rossi, N. Dewsbury, B. Judy, ceptor that amplifies NF-␬B and JNK pathways by inducing reactive oxygen J. B. De Aguiar, M. A. Leon, D. M. Estes, R. Fayzulin, and P. W. Mason. 2007. species production. EMBO Rep. 9: 293–300. Early production of type I interferon during West Nile virus infection: role for 39. Ichinohe, T., H. K. Lee, Y. Ogura, R. Flavell, and A. Iwasaki. 2009. Inflamma- lymphoid tissues in IRF3-independent interferon production. J. Virol. 81: some recognition of influenza virus is essential for adaptive immune responses. 9100–9108. J. Exp. Med. 206: 79–87. Supplementary Figure Legends

Supplementary Figure 1. All primary MEFs utilized in this study are equally susceptible to VSVgfp infection. Untreated MEFs were infected with VSVgfp at an moi of 0.1 and raw fluorescence units (RFUs) were measured 24hr post-infection. There were no statistically significant differences in infection rates between cells, as measured by a Oneway ANOVA and a Tukey post hoc test (p=0.0821). These data are an average of at least three independent experiments per cell type.

Supplementary Figure 2. Cell association and entry are not dependent on dsRNA length. WT WEFs were treated with Alexafluor 488 labeled v200 and v1000 (3nM) for 30 minutes, after which total, cell associated and intracellular fluorescence was measured using a fluorescence plate reader. Intracellular fluorescence was determined following 0.025% trypan blue treatment to quench surface bound fluorescent dsRNA. The y-axis represents cell associated and intracellular fluorescence expressed as a percent of the total fluorescence added to each well. These data represent the average of three independent experiments. There was no significant difference (ns) in cell associated and intracellular dsRNA between lengths as determined by one- way ANOVA with a Tukey post test.

Supplementary Figure 3. Induction of IRFs, IFNs and ISGs in response to dsRNA of different lengths. In vitro transcribed dsRNA of various lengths was used to treat WT, IRF3-/- and IRF3/9-/- MEFs using an amount of dsRNA shown to elicit a complete antiviral response in each cell type. RNA harvested 6 hours post treatment was reverse transcribed and the cDNAs were assayed using Mouse Interferons and Receptors RT2ProfilerTM PCR Arrays. For details please refer to Figure 3 of the main text.

Supplementary Figure 4. Treatment of MEFs with polyI:C inhibits replication of HSV-1. WT, IRF3-/- and IRF3/9-/- MEFs were treated with polyI:C (1.5nM, 3 nM and 8.5nM respectively) for 6h, followed by infection with HSV-1gfp (moi 0.1) for 24h. The replication of HSV-1 in untreated cells was set to 100% in each cell type. A statistically significant difference in HSV-1 replication was observed between untreated and polyI:C treated MEFs. All cell types were equally susceptible to infection with HSV-1 (data not shown). *** p<0.001.

Supplementary Materials and Methods

Fluorescence plate reader assay

DsRNA was labeled with Alexafluor 488 using the Ulysis nucleic acid labeling kit (Invitrogen).

Excess labeling reagent was removed using Micro Biospin P-30 columns (BioRad, Hercules,

CA). Cells were seeded into 96 well plates and treated the next day with fluorescently labeled dsRNA for indicated lengths of time as described in the figure legends. Total fluorescence was measured prior to removal of unbound dsRNA. Following incubations, unbound dsRNA was removed, cells were washed with PBS, and read for fluorescence (cell-associated fluorescence) or 0.025% trypan blue was added to the wells to quench extracellular, cell-associated fluorescence to measure only intracellular fluorescence. Results were reported as a % of total fluorescence, or as a % of untreated cells.

WT IRF3-/- IRF3/9-/- replicate #1 replicate #2 replicate #1 replicate #2 replicate #1 replicate #2

Genes v 200 v 1000 v 3000 poly IC Genes v 200 v 1000 v 3000 poly IC Genes v 200 v 1000 v 3000 poly IC Genes v 200 v 1000 v 3000 poly IC Genes v 200 poly IC Genes v 200 poly IC Adar 1.2448994 1.25740151 1.62771449 3.19668222 Adar 2.65766359 4.26667237 4.81216463 4.0084841 Adar 0.47740745 1.0342192 1.12546251 1.1939902 Adar 1.33675382 3.17070136 7.01895084 7.2551518 Adar 0.95575649 1.00709446 Adar 0.76755126 0.67271317 Csf2 1.69051892 13.8983759 2.45988806 8.24312478 Csf2 1.37041467 0.94752396 30.4897412 9.31607174 Csf2 5.37862348 31.3175403 31.1431507 11.5646604 Csf2 19.7728209 155.323466 88.9120715 46.9051621 Csf2 0.74381049 2.5500738 Csf2 1.99785655 6.43767792 Csf2rb1 0.88227858 0.32367916 1.14743439 0.52970731 Csf2rb1 2.73081674 6.04276289 0.54885159 1.00336864 Csf2rb 0.47186171 0.33283706 0.19462366 0.31815088 Csf2rb 0.82921539 0.36130873 1.07191418 1.17590605 Csf2rb 0.3932212 0.61184368 Csf2rb 0.7439528 0.38233108 Csf3 0.51503564 1.57297245 1.33638683 0.80976059 Csf3 9.51712949 6.63371639 0.82941497 0.76057623 Csf3 0.81433821 0.68075567 0.47658815 0.53552581 Csf3 1.146614 2.02701252 0.79296517 0.48646968 Csf3 1.23336431 0.39008597 Csf3 0.39724363 0.26072167 Csf3r 1.69051892 1.45289496 1.89618624 1.95412307 Csf3r 1.03516267 1.06182155 1.00649011 2.59570197 Csf3r 1.04734736 2.89674161 0.97185838 0.3924128 Csf3r 0.1838427 0.14759431 0.88029709 0.50770691 Csf3r 0.35607992 0.55405266 Csf3r 1.99785655 1.02673538 Ctf2 0.54524977 0.826009 1.21078329 0.76410475 Ctf2 0.88026786 0.96070429 0.23127769 0.84251411 Ctf2 0.26325448 0.23111439 0.09388692 0.1155866 Ctf2 0.61208665 0.79579294 0.42637785 0.68833788 Ctf2 0.89673835 0.60822246 Ctf2 0.7602227 0.36916109 Cxcl10 14.3714644 54.9341127 63.0104264 451.064937 Cxcl10 207.994057 1411.88545 1367.22693 7439.10709 Cxcl10 3.18904841 72.7123239 113.196928 119.593154 Cxcl10 13.2848479 284.710522 2054.91272 1758.25646 Cxcl10 2.9209932 0.21325212 Cxcl10 1.99785655 1.02673538 Ebi3 1.54945641 0.81654392 0.54831113 1.74302629 Ebi3 0.5489606 1.99838885 0.84394858 1.40076287 Ebi3 1.79533491 2.04216014 2.42826353 2.1609235 Ebi3 0.89185112 1.34768002 2.48194716 1.80326797 Ebi3 0.70858803 0.22423401 Ebi3 2.81577098 0.48749908 Epor 0.75718628 1.09512792 0.79410829 1.22290415 Epor 0.78324171 0.96025224 0.77195947 1.31964854 Epor 0.3911701 0.61598922 0.5662331 0.37040385 Epor 1.84878415 3.29143567 1.3554796 3.28044788 Epor 0.93424122 0.63241215 Epor 1.08495334 0.88305267 F3 0.67668915 1.09747525 1.07687864 1.28854537 F3 5.85635699 5.02853215 4.33329964 1.75803495 F3 0.52700188 0.62715111 0.61390741 0.62048662 F3 0.97580501 1.89318054 2.64101299 2.21001138 F3 0.84920867 0.65725996 F3 1.08093217 0.99510137 Isg15 4.31856249 14.1360819 13.5055236 61.8971609 Isg15 58.9772848 161.835504 81.1620837 727.351919 Isg15 0.91723544 15.2945865 24.4157637 26.2514026 Isg15 3.98703923 29.5124134 101.279993 77.8202009 Isg15 1.66316004 1.55600748 Isg15 0.66055839 1.30923439 Ghr 0.90012556 0.94910881 1.1284869 1.05297219 Ghr 1.14847265 1.17077053 0.00030896 1.07477432 Ghr 0.55184385 0.55067499 0.00045722 0.42649597 Ghr 1.07917872 0.99962785 1.11384648 1.61827837 Ghr 0.77835543 0.02071651 Ghr 0.9553816 0.03370659 H28 1.69051892 1.45289496 1.89618624 1.95412307 H28 1.03516267 0.94752396 0.94403156 2.59570197 H28 0.57210268 0.4911389 0.43964227 0.46276126 H28 1.08001683 1.50437058 1.76248918 1.45954814 H28 1.18705189 1.51636283 H28 1.91912808 0.98627536 Ifi204 1.61814307 3.24418569 4.70123131 15.5087912 Ifi204 9.25455423 33.2189446 66.8463555 59.3031466 Ifi204 0.4306459 3.05848457 4.07862255 3.96728214 Ifi204 2.69859186 12.5512835 55.4756746 60.2658911 Ifi204 0.81450192 0.73614813 Ifi204 1.0935059 1.11443803 Ifi27 0.94388445 1.18825412 0.98392801 1.91632377 Ifi27 3.54648169 4.93288048 1.68731695 3.67543944 Ifi27 0.70274637 0.53089336 0.41523127 0.40475309 Ifi27 1.24350284 0.84651644 3.57121601 3.10461377 Ifi27 0.49694738 0.70899138 Ifi27 1.00507837 0.98202551 Ifi30 0.85132693 0.91014253 0.95212419 0.88083844 Ifi30 0.86106646 0.81251443 0.92594025 1.25804868 Ifi30 0.51105094 0.54605191 0.53658439 0.59205208 Ifi30 1.2669256 1.13893546 1.05780258 0.9587455 Ifi30 0.72050133 0.76462485 Ifi30 0.85205945 0.85688375 Ifi35 1.0116226 1.52062182 1.23650037 2.91374845 Ifi35 2.10250831 3.93754752 7.30490241 8.91533958 Ifi35 0.65477539 1.40932271 1.71629554 1.5531918 Ifi35 1.55074535 3.91177665 10.9521894 9.09879693 Ifi35 0.94987923 0.70273711 Ifi35 0.98410148 0.73111457 Ifi44 2.47722029 3.24065716 8.54173812 43.1888601 Ifi44 17.2319313 52.9408089 249.434118 154.284867 Ifi44 0.67392502 5.89037303 9.78713093 9.28882427 Ifi44 4.00642592 26.4410763 86.2627856 101.634105 Ifi44 0.11255383 0.12908909 Ifi44 0.7546204 0.38781336 Ifih1 0.78467501 2.26936143 2.26202938 16.1508404 Ifih1 13.579011 52.9176223 92.4331856 391.436574 Ifih1 0.67834119 6.15811155 8.15952404 5.42900194 Ifih1 3.76043563 24.386892 182.657021 193.718214 Ifih1 0.88955456 0.84377661 Ifih1 1.65180227 1.47819992 Ifit1 24.9764437 95.5329427 109.949762 576.857567 Ifit1 197.841805 748.700202 386.390818 3963.8118 Ifit1 1.34646152 51.678812 89.228396 87.733809 Ifit1 12.0077572 144.695074 640.705871 633.739795 Ifit1 0.294515 0.3225836 Ifit1 3.59839859 1.07133851 Ifit2 1.14039069 2.40834888 3.37289093 13.1461854 Ifit2 2.69836311 7.39406811 30.2759012 20.7156581 Ifit2 0.5977429 2.06033224 5.57013001 5.62625367 Ifit2 1.5923912 10.4853274 65.0666512 62.2548271 Ifit2 1.11064288 0.63414735 Ifit2 1.6064733 0.93125063 Ifit3 4.72713205 17.9496325 24.1359159 130.347882 Ifit3 49.9599283 299.931936 575.251887 2038.95716 Ifit3 0.92884965 27.8438345 60.5933263 60.5693742 Ifit3 8.14188475 124.458677 472.33787 535.7755 Ifit3 0.69176456 0.64125319 Ifit3 1.40177131 1.23595601 Ifitm1 0.54728005 0.80092575 1.16633536 1.12465486 Ifitm1 2.995844 3.75183747 1.58864415 1.6078098 Ifitm1 0.84767727 0.92774614 1.07910706 1.21912749 Ifitm1 1.1201103 0.63021194 1.86177586 2.06209071 Ifitm1 0.90785513 1.31893823 Ifitm1 0.79921358 1.08250854 Ifitm2 0.13646758 0.25096053 0.25028169 0.27437926 Ifitm2 1.35007401 2.43492837 1.3147295 1.43782266 Ifitm2 0.48756653 0.64562932 0.45365548 0.40605329 Ifitm2 1.61365124 1.23983145 2.22263708 2.1059655 Ifitm2 1.04571956 1.0945061 Ifitm2 0.87342092 1.1303154 Ifna11 1.69051892 1.45289496 1.89618624 1.95412307 Ifna11 1.03516267 0.94752396 0.15197975 2.24123006 Ifna11 0.15522889 1.15313067 0.40641005 0.38305222 Ifna11 1.38177125 0.45733334 0.5358022 0.44939931 Ifna11 0.89241273 0.36979433 Ifna11 0.42252277 0.35407292 Ifna2 4.00899652 1.09564422 1.1157437 38.1311023 Ifna2 0.93920598 2.60271498 30.9303017 13.9559628 Ifna2 0.45054559 0.80497339 0.19853579 0.11144849 Ifna2 2.91006383 10.7571799 10.1529101 11.3055855 Ifna2 0.40277192 0.75207946 Ifna2 0.84392284 2.58501813 Ifna4 4.89505872 6.75394486 67.2890415 76.3926182 Ifna4 1.9630263 3.09928265 1.62227793 10.0469016 Ifna4 0.30329781 0.4110643 0.31331962 0.30663494 Ifna4 0.90067455 1.57371468 3.39341153 1.42936147 Ifna4 0.86309065 1.28412087 Ifna4 0.94049945 0.54904922 Ifna7 121.339728 16.2186339 28.0421618 6.0537426 Ifna7 2.07999996 1.01701738 0.98201162 5.18968779 Ifna7 0.33133006 0.29741019 0.34359716 0.35417542 Ifna7 0.99087007 1.42855442 3.47832418 1.43524676 Ifna7 1.06754805 0.81271927 Ifna7 1.84647919 0.89241112 Ifna9 1.69051892 1.45289496 1.89618624 1.95412307 Ifna9 1.03516267 0.94752396 3.52770274 2.59570197 Ifna9 0.454933 0.40528116 0.39336677 0.22758257 Ifna9 1.21758189 1.5439093 3.41475578 3.17694871 Ifna9 1.58557487 0.76951374 Ifna9 1.15479519 0.99770167 Ifnar1 1.41997661 1.34849147 1.4537666 1.10467756 Ifnar1 1.17737223 0.91367205 0.94150261 0.68850105 Ifnar1 0.53466198 0.62485528 0.55762262 0.4678098 Ifnar1 0.78705742 0.83808182 0.89842215 1.05570284 Ifnar1 0.73211084 0.67734277 Ifnar1 0.86155392 0.69934895 Ifnar2 1.22944497 0.94143631 1.09504235 1.04918591 Ifnar2 0.96210249 0.80248834 1.24843958 0.69806281 Ifnar2 0.41927973 0.50077242 0.5208959 0.36544672 Ifnar2 1.144628 0.99523008 1.40586825 1.24030145 Ifnar2 1.10315537 0.9789608 Ifnar2 0.95079222 1.1016053 Ifnb1 21.3389335 78.5711842 112.707575 560.630465 Ifnb1 47.2892875 201.518759 1734.78 771.014269 Ifnb1 1.0840122 48.967139 40.0684001 23.8191595 Ifnb1 15.2303987 146.842523 353.128732 301.725496 Ifnb1 0.2494933 0.38820618 Ifnb1 1.17600647 0.60437144 Ifng 1.69051892 1.45289496 1.89618624 1.95412307 Ifng 1.03516267 0.94752396 0.94403156 2.59570197 Ifng 0.20442591 0.44585268 0.47892146 0.21172639 Ifng 1.77094671 2.39463704 1.76248918 1.45954814 Ifng 0.11066815 0.25600626 Ifng 2.84018125 1.32512219 Ifngr1 0.46479877 1.22094093 1.0478438 1.08679236 Ifngr1 1.02136003 1.05344817 0.96647412 1.13743236 Ifngr1 0.43120147 0.64901917 0.66659805 0.36044699 Ifngr1 0.8469706 0.92271243 1.31178056 1.36145547 Ifngr1 1.03809106 0.6429186 Ifngr1 1.19379573 0.80531405 Ifngr2 0.84711525 0.91786597 1.0196766 0.93833328 Ifngr2 1.07152945 1.21208539 0.95707507 1.34894334 Ifngr2 0.42594941 0.43187179 0.44080302 0.42509023 Ifngr2 0.8338396 0.89409498 1.00183464 1.15987135 Ifngr2 0.9734994 0.85536614 Ifngr2 1.03849121 0.86673292 Ifnk 1.07999166 1.06756758 1.21138266 1.24839573 Ifnk 0.62437968 1.91093318 2.68537208 3.27668673 Ifnk 0.91489178 1.61022132 0.34171796 0.74266063 Ifnk 0.81344562 1.16490475 0.89922646 0.46187162 Ifnk 2.79868089 3.36233856 Ifnk 1.0041056 1.26831439 Ifnz 1.36432388 1.96627403 1.25843235 1.97594437 Ifnz 1.49191827 1.35897163 1.17995677 0.99720758 Ifnz 0.48255557 0.72652583 0.72847077 0.48552181 Ifnz 1.41117489 1.64444186 1.83560469 1.46275059 Ifnz 0.81628961 0.83880711 Ifnz 1.36886958 1.07216608 Il10rb 1.22550058 1.16317035 1.07870148 1.01476617 Il10rb 1.23193446 1.13549735 1.03283157 0.82012956 Il10rb 0.41562 0.51810916 0.50353536 0.39329807 Il10rb 0.93809621 0.91865687 1.08495439 0.96439682 Il10rb 0.55529527 0.44017863 Il10rb 0.77278072 0.50865607 Il11ra1 0.79390163 1.03013427 1.08995054 1.01375732 Il11ra1 0.88550877 0.85967802 0.91307736 0.99260715 Il11ra1 0.41918122 0.42647468 0.47708426 0.33169174 Il11ra1 0.87493018 0.72621116 0.88928231 0.80902198 Il11ra1 0.86744308 0.74339609 Il11ra1 0.86877952 0.68646468 Il12b 0.79754519 1.29642559 0.89457396 1.67173171 Il12b 1.03516267 1.05417862 6.03107008 3.08774743 Il12b 1.19211466 117.803533 123.500665 71.1060791 Il12b 10.1524344 298.842805 592.307441 322.35729 Il12b 0.97453979 1.51636283 Il12b 3.07069666 1.02673538 Il12rb1 0.49431897 0.41566449 0.44629937 0.5527892 Il12rb1 0.47576878 0.47221878 0.66995031 0.83406791 Il12rb1 0.35947442 0.56106585 0.50939016 0.39772661 Il12rb1 0.70156165 1.12459302 0.49490873 0.6304054 Il12rb1 0.49148626 0.33831335 Il12rb1 2.53374616 1.2642891 Il12rb2 1.69051892 1.45289496 1.89618624 1.95412307 Il12rb2 1.03516267 0.94752396 0.43274318 2.59570197 Il12rb2 0.43682066 0.54442907 0.48734488 0.51297236 Il12rb2 1.08001683 2.13584359 1.76248918 1.52006688 Il12rb2 0.97453979 1.51636283 Il12rb2 1.99785655 1.02673538 Il13 0.99928019 0.72163359 0.72234536 1.67372364 Il13 0.78056328 1.40525245 1.12482144 0.91239393 Il13 0.24980547 0.45125537 0.34522145 0.26638652 Il13 1.02350475 1.18411812 1.68360115 1.55676135 Il13 0.29759888 0.34173976 Il13 1.2852197 0.96286497 Il13ra1 0.45827934 0.68545716 0.8577854 0.74817846 Il13ra1 1.3141095 3.89858971 1.9319838 2.00963953 Il13ra1 0.43189484 0.54734524 0.50450309 0.50892254 Il13ra1 0.81690193 0.79734058 1.81737155 2.15526879 Il13ra1 0.86248006 0.67461439 Il13ra1 0.68569314 0.68924099 Il13ra2 0.9249339 0.80692663 1.54931089 1.17614288 Il13ra2 0.24486823 0.77263682 2.79482316 2.59570197 Il13ra2 0.29207241 0.10906492 0.52879154 0.16903372 Il13ra2 1.20834029 1.23800488 2.38767653 2.16874255 Il13ra2 0.47861118 0.74470864 Il13ra2 1.99785655 1.02673538 Il15 1.08588639 1.06331821 1.58376871 3.92039313 Il15 0.15881604 1.14227604 21.3167265 35.1383063 Il15 0.53746026 4.31969724 5.19709705 4.7632676 Il15 0.97544187 4.95377726 23.7247569 20.0957122 Il15 0.50035502 0.06867648 Il15 1.20814951 0.19151143 Il20ra 0.66741183 1.0137384 1.16827804 1.37868067 Il20ra 1.24804547 1.89108123 1.99249486 0.96926546 Il20ra 0.54804262 0.5098363 0.40112756 0.39997729 Il20ra 0.83428014 0.3585656 1.30553433 0.82356636 Il20ra 1.12555691 0.61968674 Il20ra 1.03940795 0.50701994 Il21 1.69051892 2.31539029 1.89618624 1.95412307 Il21 1.03516267 0.94752396 0.94403156 2.59570197 Il21 0.43682066 0.54442907 0.48734488 0.51297236 Il21 1.08001683 1.50437058 1.76248918 1.45954814 Il21 0.97453979 1.51636283 Il21 1.99785655 1.02673538 Il21r 5.83551979 0.92272996 1.20426314 41.7012098 Il21r 1.33447983 1.25000194 2.66279802 4.00022112 Il21r 0.53132518 0.43845631 0.33662145 0.23128122 Il21r 0.99876959 1.59638984 3.87837526 4.33249715 Il21r 0.41735617 0.64939717 Il21r 2.22091626 1.02673538 Il22ra2 1.69051892 1.45289496 1.89618624 1.95412307 Il22ra2 1.03516267 0.94752396 0.16631279 2.59570197 Il22ra2 0.12238511 1.28932771 0.34852306 0.11006975 Il22ra2 0.91542449 1.76963399 0.9981077 0.82655046 Il22ra2 0.09540489 0.15616023 Il22ra2 2.66407186 1.05315764 Il28ra 4.72055395 2.65613118 3.11654526 3.53774812 Il28ra 0.29758722 0.65679103 0.59716975 1.92140913 Il28ra 0.40160691 0.97435 0.56626961 0.7356406 Il28ra 0.76225774 0.33506317 1.56261179 0.80780378 Il28ra 0.97453979 3.74676372 Il28ra 1.99785655 2.53694879 Il2rb 3.32203475 1.27161364 1.76864888 1.56375916 Il2rb 0.39749414 1.33199469 0.80623091 0.99375475 Il2rb 0.22034423 0.6635564 0.87448406 0.61130446 Il2rb 2.19702426 0.24501857 0.44612237 3.06725859 Il2rb 0.61101936 1.5486563 Il2rb 0.98832059 1.05496666 Il2rg 1.15130746 1.10270004 1.26080981 1.14951344 Il2rg 0.94601863 0.76435001 1.60770198 1.85439779 Il2rg 0.4623749 0.50580773 0.63059254 0.54723712 Il2rg 1.23022125 1.4530285 2.66823993 2.26306622 Il2rg 1.19040542 1.0980989 Il2rg 0.6076022 1.36017134 Il3ra 1.69506449 1.35718783 1.22873233 1.40825475 Il3ra 0.88199446 0.91534996 1.00137615 1.12232052 Il3ra 0.54009384 0.57640749 0.50301558 0.3916199 Il3ra 1.00592086 0.85875589 1.16546235 1.3471867 Il3ra 0.73491332 0.68029199 Il3ra 0.83132586 0.73706431 Il4 1.69051892 1.45289496 1.89618624 1.95412307 Il4 1.03516267 0.94752396 0.32101976 2.59570197 Il4 0.19301742 0.18951002 0.85310487 0.36153394 Il4 0.36115268 0.40393274 0.95554214 0.42520893 Il4 1.11926837 1.40624211 Il4 0.40572385 0.87858538 Il4ra 1.45778319 1.20161889 1.21265458 1.46986875 Il4ra 0.61150852 0.59656586 1.22438137 1.23213877 Il4ra 0.51353411 0.44924925 0.42188304 0.37827491 Il4ra 0.69533774 0.62464352 0.74586602 0.61910705 Il4ra 1.30538014 0.74481189 Il4ra 0.94846668 0.47997275 Il6 0.88836359 1.19846884 1.24276858 2.4327184 Il6 1.63693326 3.37673821 26.5191568 8.9472092 Il6 0.69147692 3.98182054 3.82039021 3.5482892 Il6 1.42923168 5.42627814 28.0324785 30.5842671 Il6 0.46423365 0.74629762 Il6 0.67461766 1.45294531 Il6ra 1.14711988 1.15163648 1.21683847 1.27137739 Il6ra 1.12057911 1.00280169 1.12673169 0.8837099 Il6ra 0.61227598 0.64838292 0.85784684 0.40876059 Il6ra 0.86774124 0.80744282 0.98806537 0.76422629 Il6ra 1.17549875 0.75387383 Il6ra 0.86464091 0.40067056 Il6st 1.18920808 1.28867673 1.19768429 1.21595373 Il6st 0.90550185 0.85126566 1.06659096 0.93641552 Il6st 0.50661546 0.47112017 0.55216563 0.83343235 Il6st 0.94543541 0.95297944 1.04675253 1.25977388 Il6st 1.3456498 0.81036007 Il6st 1.07600516 0.72407919 Il7 0.24833787 0.47911052 0.5388855 0.415017 Il7 0.72978303 2.89841732 2.463921 1.0962788 Il7 0.54905135 0.50746 0.80828109 0.38413278 Il7 0.53465709 1.22829492 2.08521537 2.41179252 Il7 0.72904916 0.4432993 Il7 0.53242381 0.28205461 Il7r 0.53916104 0.46337509 0.60475499 1.75166068 Il7r 0.42794951 0.46057031 0.29647431 2.59570197 Il7r 0.67898471 0.51425649 0.1936227 0.42728601 Il7r 0.54069271 0.54953528 0.45040458 0.62418509 Il7r 0.71106483 1.10640149 Il7r 1.99785655 1.02673538 Il9 1.69051892 1.45289496 1.89618624 1.95412307 Il9 1.03516267 0.94752396 1.46952204 2.59570197 Il9 0.05000458 0.07532836 0.02613321 0.03557471 Il9 2.68569002 4.15300325 1.76546889 1.15743149 Il9 0.1197102 0.38073075 Il9 5.06272107 1.60207024 Il9r 2.82169326 1.41468946 1.8463239 1.90273722 Il9r 1.06256751 0.94752396 1.20547522 0.53221156 Il9r 0.46036817 0.29182047 0.27391421 0.50640902 Il9r 0.31637397 0.74836656 0.55147883 1.29624354 Il9r 0.2385089 1.04468935 Il9r 3.58067853 3.32952506 Irf1 0.9754509 1.42136827 1.64528746 5.16601679 Irf1 1.5789916 5.45645266 10.5563267 16.5794788 Irf1 0.99321847 3.03468969 4.18742979 2.02324636 Irf1 1.93111864 5.42810264 10.2819814 7.35833725 Irf1 0.79656776 0.73530719 Irf1 0.94736153 1.03334815 Irf2 1.19079178 1.19492859 1.33304702 1.5488048 Irf2 1.44841448 2.0083439 3.58303218 1.75036858 Irf2 0.48215135 0.69184272 1.61728171 2.16951807 Irf2 1.1449954 1.86464114 3.99164218 4.5620106 Irf2 1.37901964 1.22045914 Irf2 1.42722718 1.40238202 Irf2bp1 1.16057131 1.21514157 1.20503802 1.16029072 Irf2bp1 1.22021088 0.86371565 0.77777243 0.90637297 Irf2bp1 0.39807054 0.48649133 1.02175833 0.26159448 Irf2bp1 0.98647323 0.9657877 0.87330796 0.82959598 Irf2bp1 1.19733346 1.10830273 Irf2bp1 1.19768872 0.89704881 Irf2bp2 1.02535051 1.06979725 1.26554575 1.14431507 Irf2bp2 1.00987344 0.87240765 0.93527466 1.06161139 Irf2bp2 0.4833332 0.47563507 1.10534904 0.33519836 Irf2bp2 0.80987873 0.85556478 0.96366085 1.06006138 Irf2bp2 0.90001753 0.7512172 Irf2bp2 0.99348976 0.8100941 Irf3 1.73543841 1.18132621 1.51196387 1.29080523 Irf3 0.73579078 0.67461361 0.65549424 0.3334071 Irf3 0.47020507 0.55769607 0.59055732 0.50464963 Irf3 0.93222545 1.03558287 0.84489525 0.84868424 Irf3 0.83226507 0.39951235 Irf3 1.14119948 0.46626512 Irf4 1.69051892 1.45289496 3.42018809 3.36038221 Irf4 1.03516267 0.94752396 5.21106048 2.59570197 Irf4 1.39800837 0.54442907 1.07215389 0.51297236 Irf4 1.32482683 0.43622761 0.51107517 3.1358788 Irf4 0.20643622 0.18802091 Irf4 1.99785655 1.02673538 Irf5 0.59983939 0.78061084 0.72376722 1.31830879 Irf5 1.41142797 8.22941189 4.16672244 7.97805323 Irf5 0.56110279 1.1810647 1.24514176 1.28797179 Irf5 1.02119317 2.70171033 6.94322729 5.84627138 Irf5 1.06647341 1.09525439 Irf5 1.34490382 1.15064708 Irf6 0.57602334 0.8920753 1.46823578 0.90098459 Irf6 1.18325786 2.34010187 0.55119893 1.70709311 Irf6 0.32323582 0.56013986 0.90816353 0.51908367 Irf6 1.98905725 1.33058346 2.0024905 2.77905194 Irf6 1.00644198 0.45743955 Irf6 0.45211008 0.57148693 Irf7 2.435659 6.257782 7.36765582 26.3483065 Irf7 17.4397868 76.5399648 87.7158712 177.589657 Irf7 0.658903 14.9630793 23.0626278 21.5166206 Irf7 3.3196147 23.6453895 77.8025966 73.2257825 Irf7 1.03420272 0.53130161 Irf7 0.9834898 0.60062998 Irf8 1.69051892 1.45289496 1.89618624 1.95412307 Irf8 1.03516267 0.94752396 0.64938186 2.59570197 Irf8 3.80021752 5.19098385 2.9289854 2.89862962 Irf8 0.76631147 0.76113802 1.39502831 1.18729859 Irf8 0.97453979 1.51636283 Irf8 1.99785655 1.02673538 Irgm 1.26650183 2.31898004 2.37225758 6.80323693 Irgm 2.67836671 4.33058022 16.2387986 9.23218254 Irgm 1.45973248 5.97880849 7.23306442 8.25592005 Irgm 1.70228052 6.8633551 15.1468973 16.7855488 Irgm 1.20917495 1.12472243 Irgm 1.24291273 1.06676057 Lepr 0.50790697 1.88083123 2.50366349 1.37930483 Lepr 7.69830857 2.33707063 0.94735037 2.39707783 Lepr 0.83134142 1.39388351 0.72433802 0.9610111 Lepr 1.0226552 0.97886242 0.67654622 1.03968018 Lepr 1.2270942 0.60451414 Lepr 0.84597562 0.4347625 Lif 1.54509031 1.39825201 1.17978393 1.40723116 Lif 1.9519316 2.57339931 3.71864751 2.08807242 Lif 0.71719434 2.64464119 2.3136137 1.99683206 Lif 1.248397 3.3437454 4.05751492 4.78521849 Lif 0.86438324 0.49355337 Lif 0.61062815 0.36622937 Lifr 1.01767519 1.31032292 1.46860118 1.48599919 Lifr 0.71211123 0.78968398 1.30450909 1.40261081 Lifr 0.38636679 0.47579236 0.40760566 0.42731 Lifr 2.44660263 2.30367309 5.89167725 5.24280832 Lifr 0.92253465 0.79318758 Lifr 1.43957305 0.92831504 Mpl 0.44108517 2.25818299 2.26836164 1.70294204 Mpl 1.03516267 1.20453335 0.84303066 2.59570197 Mpl 0.5128362 0.38927052 0.23026898 0.24237789 Mpl 0.43563259 0.60679874 0.71091274 1.37658033 Mpl 0.14419699 0.19636028 Mpl 1.99785655 1.29178359 Mx1 11.945333 36.1267207 65.5653496 422.953231 Mx1 66.9792585 406.655223 851.370328 583.848703 Mx1 0.15949388 100.551528 222.487735 147.165185 Mx1 9.36584914 100.168355 657.481459 766.577477 Mx1 0.46079373 0.71698508 Mx1 1.99785655 1.02673538 Oas1a 2.12725674 2.05857127 7.63630998 52.8162268 Oas1a 25.2722201 113.429048 25.6230978 245.360253 Oas1a 0.43170239 1.25428918 4.75037696 2.6767114 Oas1a 1.20389352 3.19894458 20.7274021 15.969307 Oas1a 0.06663717 0.19104654 Oas1a 1.45446744 1.25174214 Osm 1.69051892 5.34363105 1.89618624 1.95412307 Osm 1.15127102 0.94752396 1.04307146 2.59570197 Osm 0.49078974 0.22649954 0.2500539 0.12813797 Osm 1.03944455 0.91644487 1.13407134 1.049491 Osm 0.21506922 0.33464306 Osm 1.99785655 1.02673538 Osmr 1.25390336 1.11293582 1.22906112 1.42064622 Osmr 1.05641706 1.22652474 0.82352651 1.67231051 Osmr 0.42748598 0.51212042 0.54079661 0.47739223 Osmr 0.87246962 0.78816577 1.28713413 1.28765919 Osmr 0.8612715 0.81560188 Osmr 1.08279715 0.92935159 Prlr 1.69993569 0.43085084 0.56230729 0.57948826 Prlr 3.31401814 2.32978098 1.39277673 3.0178681 Prlr 1.47860634 3.17658363 5.62642292 2.33242065 Prlr 1.01892919 0.28780429 1.01946864 1.54487038 Prlr 0.19475726 0.30303808 Prlr 1.99785655 1.02673538 Crlf2 0.82153683 0.98825921 1.07356435 1.21669481 Crlf2 1.24522418 1.809341 1.70447803 0.7512405 Crlf2 0.56314682 0.47311638 0.43696451 0.39191101 Crlf2 0.89832712 1.11644486 1.22946903 1.36543705 Crlf2 1.06464319 0.68124847 Crlf2 1.03742209 0.69134915