THERAPEUTIC POTENTIALS OF TARGETING AMPK SIGNALING IN THE RETINA

By

LEI XU

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2018

© 2018 Lei Xu

To my family

ACKNOWLEDGMENTS

I sincerely thank my mentor, Dr. John Ash. I met him back to 2009 (wow! It has been that long!), without any background knowledge about the eye and did my first PCR in his lab. Over the years, he gave me the greatest support that I could ever ask for; he was always standing on my back to hold on me and not give up on me. It was challenging to move and live in another country. English was a big problem (and still a problem). I remember the first time he talked to me about success; my face looked puzzled “what is that mean?” Then he tried to explain to me “success…success is a good word”. And another time he told me “I am running late to the lab since I have roofers working on my house,” and I delivered the message as “Dr. Ash has roosters in his house” to all my lab mates, and they were actually all convinced that he did have a rooster in his house. We had many good and fun times together, and I can picture that we talk about this 50 years later. I also had a hard time back to the first year of my graduate school with balancing all the exams, lab work, and my family. He studied together with me, practiced, gave me all the advice and helped me to stay positive, confident and be strong. The word “thank” is not enough to tell how much I appreciate all he has done for me. He trained me to be a scientist and better person throughout the years. He is the best mentor in the world and a family friend of lifelong.

I also want to thank my supervisory committee members, Dr. Alfred Lewin (who has always asked me “where is your paper”), Dr. Christiaan Leeuwenburg, and Dr.

Shannon Boye for taking the time to give me feedback and guidance.

I would also acknowledge my lab members to make up this great Ash Family.

They are Marcus Hooper, Clayton Santiago, Casey Keuthan, Emily Brown, and

4

previous lab members Ana Chucair-Elliott, Yumi Ueki, Gary Jiangang Wang, Annise

Saddi, Jing Zhang, Huiming Xia, Caroline Abrahan, LaGina Shine, Xiang Ren, Haijun

Liu. I would also acknowledge my undergraduate students Maria Abdo, Abraham Bell,

Lena Phu Linda Qian and Eric Nayman who have been working with me and be masked observes of many of my experiments.

I would like to thank my family, my parents-in-law who are the best in-laws in the world, my parents, my brother, sister-in-law, and friends for their constant love, support, and confidence in me. Foremost I would like to acknowledge my husband Bo Dong for his patients who drove me to the lab every weekend to inject metformin to the mice; for the understanding and continued supports throughout my graduate studies; for the inspiration of each day is better and happier during this nine years marriage and many more years to go. I would like to acknowledge my children Dorothy Dong and Timothy

Dong who brighten my days and my life. They both love science, and they consider mom is the best scientist.

I would like to thank Interdisciplinary Program (IDP) in Biomedical Sciences for offering me the wonderful opportunity and support for my graduate training. Special thanks go to Ms. Kris Minkoff for all her assistance throughout the years.

In the end, I would like to mention all the mice that I have worked with who sacrificed themselves for science and allow me to explore and answer my scientific questions.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 9

LIST OF FIGURES ...... 10

LIST OF ABBREVIATIONS ...... 12

ABSTRACT ...... 14

CHAPTER

1 RESEARCH BACKGROUND ...... 17

Visual System ...... 17 The Eye ...... 17 Visual Signal Transduction ...... 17 Photoreceptors and RPE ...... 18 Energy Metabolism in the Healthy Retina ...... 19 Metabolic Dysregulation in the Diseased Retina ...... 22 Retinitis Pigmentosa ...... 22 AMD ...... 23 AMPK Signaling Cascade ...... 25 AMPK as an Energy Sensor (83) ...... 26 Regulation of Mitochondrial Biogenesis by AMPK ...... 28 Regulation of mTOR Pathway by AMPK ...... 29 Regulation of Inflammation Response by AMPK ...... 30 Activation of AMPK Signaling by Metformin ...... 31 History of Metformin ...... 31 Metformin Usages and its Side Effect ...... 31 Mechanisms of Metformin’s Action ...... 33 Metformin as a Tool to Target Neurodegeneration, Aging, and Cancer ...... 33 Concluding Remarks ...... 34

2 METHODS AND MATERIALS ...... 36

Animals ...... 36 BALB/cj Mice ...... 36 PDE6Brd10 Mice ...... 36 Cre Loxp System to Induce Retinal Specific Knockout Mice ...... 36 Intravitreal and Subcutaneous Injections ...... 37 Sodium Iodate Induced RPE Damage ...... 38 Light Damage ...... 39 Electroretinograms (ERGs) ...... 39 Spectral Domain Optical Coherence Tomography (SD-OCT) ...... 40

6

Morphometric Analysis ...... 41 Western Blots ...... 42 Real-time PCR ...... 43 Immunohistochemistry ...... 43 ATP and NADH Content ...... 44 Metformin Concentration by LC-MS ...... 45 Complex I Activity ...... 45 Metabolomic Analysis ...... 46 Statistics ...... 46

3 STIMULATION OF AMPK PREVENTS DEGENERATION IN THE PHOTORECEPTORS AND RETINAL PIGMENTED EPITHELIAL ...... 48

Introduction ...... 48 Results ...... 50 Metformin Protected Retinal Photoreceptors from Light Damage Induced Retinal Degeneration ...... 50 Metformin-induced Protection is Mediated by Local Signaling and is Acting through AMPK α2 Subunit ...... 55 A Minimum of 4 days of Daily Metformin Injection is Required to Induce Protection from Light Damage ...... 61 Metformin Induces Changes in Mitochondrial Gene Expression following Light Damage ...... 63 Metformin Prevented Light-induced Oxidative Stress and DNA Damage ...... 68 Metformin Delayed Retinal Degeneration in Rd10 Mouse Model and Preserved Cone Photoreceptors ...... 71 Metformin Prevents RPE Damage From Sodium Iodate-induced RPE Injury .. 76 PPARδ is Not Required for Metformin-induced Neuroprotection ...... 79 Loss of PPARδ in the Neural Retina does not Change Retinal Structure and Function up to 12 months of Age ...... 79 PPARδ is not Required for Metformin-induced Neuroprotection from Light Damage ...... 82 Discussion ...... 84

4 EVIDENCE THAT AMPK IS ESSENTIAL FOR RETINAL FUNCTION, SURVIVAL, AND METABOLIC HOMEOSTASIS ...... 89

Introduction ...... 89 Results ...... 92 AMPKα1 and α2 are Essential for Retinal Function and Survival ...... 92 mRNA level of AMPK α1 and α2 in the retina of double knockout mice .... 92 Loss of AMPKα resulted in morphological changes at 12 months of age .. 93 Loss of AMPKα led to photoreceptor and RPE functional decline at 12 months of age ...... 98 Reduced cone and rod photoreceptor at young age ...... 100

7

Deletion of AMPK leads to reduced cone number and decreased expression of opsin at three months of age ...... 101 Mitochondria dysfunction is associated retinal degeneration caused by AMPKα deficiency ...... 103 Impaired glucose metabolism and fatty acid metabolism is associated with AMPKα deficiency-caused retinal degeneration ...... 108 Oxidative stress is likely not involved in AMPKα deficiency-caused retinal degeneration ...... 110 Loss of AMPKα results in mitochondria fragmentation at an early age .... 112 Loss of AMPKα results metabolic dysfunction of photoreceptors ...... 114 AMPKα is Important for Maintaining the Metabolic Homeostasis between the Photoreceptors and RPE ...... 116 AMPKα2, but not α1 are Essential for Maintaining Cone Photoreceptor Function ...... 117 mRNA level of α1 and α2 in single AMPK knockout mice ...... 117 AMPK α2 is Essential for Retinal Function and Morphology, but not α1 Subunit ...... 118 AMPKα2, but not α1 has a unique role in cone photoreceptors ...... 119 Cre-loxp System does not Affect Retinal Structure and Function ...... 121 Discussion ...... 123

5 CONCLUSIONS AND FURTHER DIRECTION ...... 126

LIST OF REFERENCES ...... 128

BIOGRAPHICAL SKETCH ...... 144

8

LIST OF TABLES

Table page 2-1 Primer sequences: ...... 47

9

LIST OF FIGURES

Figure page 3-1 Metformin prevents retinal degeneration from light damage in a dose- dependent manner...... 52

3-2 Intravitreal administration of metformin protects photoreceptors from light- induced degeneration...... 54

3-3 Subcutaneously injected metformin crosses the blood-retinal barrier, activates AMPK in the retina, and required AMPK a2 subunit to protect photoreceptors from LD...... 57

3-4 Metformin mediated neuroprotection through AMPK signaling pathway, and required AMPK α2 catalytic subunit...... 59

3-5 A minimum of 4 days of daily metformin injections is required to induce protection of photoreceptors from light damage...... 62

3-6 Metformin increases mitochondria biogenesis in vivo following light damage.. .. 66

3-7 Metformin induces changes in mitochondrial protein expression following light damage...... 67

3-8 Metformin injections prevent oxidative stress induced by damaging light...... 69

3-9 Metformin delays retinal degeneration in RD10 mice...... 72

3-10 Metformin delays rod degeneration in RD10 mice, and rescues cone but not rod function...... 74

3-11 Metformin regulates mitochondrial profile change in RD10 mice...... 75

3-12 Metformin protects RPE from sodium iodate-induced damage...... 77

3-13 Genetic loss of PPARδ does not change retinal structure and function at an early age...... 80

3-14 Genetic loss of PPARδ does not change retinal structure and function at 12 months old...... 81

3-15 PPARδ is not required for metformin-induced protection against light damage...... 83

4-1 Gene expression level of AMPK α1 and AMPK α2 in double knockout mice. .... 92

4-2 OCT analysis of morphological changes of DKO mice at 12 months of age...... 94

10

4-3 DKO mice have decreased total retinal, OS, IS, ONL and INL thicknesses...... 96

4-4 Averaged ONL thickness were plotted over time from 2 months to 12 months. . 97

4-5 Reduced retinal function of DKO mice at 12 months of age...... 99

4-6 Reduced cone and rod photoreceptor function were observed before three months of age...... 100

4-7 The number of cones and levels of opsin expression are reduced in AMPKα deficient mice...... 102

4-8 DKO mice have altered mitochondria at 12 months of age...... 104

4-9 DKO mice have altered mitochondria at 12 months of age...... 105

4-10 Mitochondrial DNA copy number, mitochondria related gene expression was reduced in the DKO mice...... 107

4-11 Genes involved in glucose and fatty acid metabolism are down regulated in DKO mice at six months of age...... 109

4-12 Deletion of AMPK α did not change oxidative stress-related gene expression including GPX-1, Thioredoxin, and HO-1, but SOD2...... 111

4-13 Retinal structure of DKO mice at 4 months of age and mitochondria fragementation by EM...... 113

4-14 Reduced carbon flux of glycolysis...... 115

4-15 Reduced RPE function of AMPKα knock out mice...... 116

4-16 Gene expression level of AMPKα1 and AMPKα2 in single knockout mice...... 117

4-17 Single KO mice did not have significant morphological changes over time...... 118

4-18 AMPKα2 knockout mice have reduced cone photoreceptor function by 3 months of age...... 120

4-19 Chx10 cre AMPK heterozygous mice do not display cone function reduction by 6 months of age...... 122

4-20 Loss of AMPKα can affect multiple downstream targets...... 125

11

LIST OF ABBREVIATIONS

AMPK Adenosine monophosphate protein-activated kinase

4E-BP1 Eukaryotic translation initiation factor 4E-binding protein 1

ACC Acetyl coenzyme A carboxylase

ADP Adenosine diphosphate

AICAR 5-aminoimidazole-4-carboxamide ribonucleoside

AMD Age-related Macular Degeneration

AMP Adenosine monophosphate

ATP5g mitochondrial ATP synthase subunit 9

AREDS Age-Related Eye Disease Study

β-HB β-hydroxybutyrate cGMP Cyclic GMP

ERG Electroretinogram

ETC Electron Transport Chain

Glut1 Glucose transporter 1

GPX1 Glutathione peroxidase 1

GCAP Guanylyl cyclase activating proteins

GRK1 G-protein rhodopsin kinase

HO-1 Heme oxygenase 1

HK Hexokinase

ICAM1 Intercellular adhesion molecule 1

INL Inner nuclear layer

IPL Inner plexiform layer

IS Inner Segment

LCA Leber's congenital amaurosis

12

LPS Lipopolysaccharide

LRAT Lecithin retinol acyltransferase mTOR Mammalian target of rapamycin

Nrf1 Nuclear respiration factor 1

NADH Nicotinamide adenine dinucleotide

NADPH Nicotinamide adenine dinucleotide phosphate

ONL Outer nuclear layer

OPL Outer plexiform layer

OS Outer Segment

OXPHOS oxidative phosphorylation

RDCVF Rod-derived cone viability factor

PDE6B Phosphodiesterase-b subunit beta

PDK4 Pyruvate dehydrogenase kinase isoform 4

PGC-1 Peroxisome proliferator-activated receptor gamma coactivator 1

PKM2 pyruvate kinase M2

ROS Reactive oxygen species

PPARδ Peroxisome Proliferator Activated Receptor Delta

RP Retinitis Pigmentosa

RPE Retinal Pigmented Epithelium

Sirt6 histone deacetylase sirtuin 6

SIRT6 histone deacetylase sirtuin 6

SOD2 Mitochondrial super dismutase oxidase 2

TAK1 Mammalian transforming growth factor β-activated kinase

Tom 20 Translocase of outer membrane 20

ZO-1 zonula occludens-1

13

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

THERAPEUTIC POTENTIALS OF TARGETING AMPK SIGNALING IN THE RETINA

By

Lei Xu

May 2018

Chair: John Ash Major: Medical Science – Genetics

Retinal degenerative diseases are characterized by a permanent loss of light-

sensitive retinal neurons known as photoreceptors or their support cell, the retinal

pigmented epithelium (RPE). Metabolic dysfunction has been implicated as a common

mechanism of degeneration. In this study, we used a gain of function approach to alter

adenosine-monophosphate activated protein kinase (AMPK)-dependent metabolism to determine whether activation of this pathway could induce neuroprotection in mouse models of retinal degeneration. Metformin was used as an activator of AMPK pathway.

We found that metformin could protect photoreceptors and RPE from both acute and chronic injury. Protection was associated with decreased oxidative stress, decreased

DNA damage, and increased mitochondrial energy production. Our data demonstrate that increasing the activity of AMPK in retinal neurons or glia can delay or prevent degeneration of photoreceptors and the RPE from multiple types of cell death triggers.

For the loss of function study, we approached by using neural retina-specific AMPKα1

and α2 single knockout mice. To determine whether metformin-induced protection

requires local AMPK activity, we injected metformin to single AMPKα1 and single

AMPKα2 for seven days and then exposed them to light damage. We found metformin

14

was still able to protect AMPKα1 single knockout mice from light damage; however, metformin lost protective effect in AMPKα2 knockout mice. These data indicated that expression of the AMPK catalytic subunit α2 in the neural retina is required for metformin-induced protection, and is a local activity rather than a systemic effect. This suggests AMPK has the potential as a therapeutic target for retinal degeneration.

To determine the role of AMPK in the photoreceptor function and survival, we used AMPKα1α2 double knockout mice. We found all the mice have normal retinal structure and function up to the age of 4 weeks old, which suggested that these mice developed normally. However, cone photoreceptor function was declined at six weeks of age; rod photoreceptor was decreased at three months of age compared to WT control mice. The degeneration rate is relatively slow, we did not observe ONL thinking until 8 months of age by SD-OCT; However, at 12 months of age, there were extensive changes in retinal morphology, including thinning of total retina thickness, the ONL thickness, thinning of IS, disorganized OS, thinning of the IPL, even the RPE was also highly vacuolated. Relative mitochondrial DNA copy number was reduced in the knockout mice. Expression of genes involved in mitochondrial biogenesis and fatty acid metabolism were deceased at six months, but there was no change in antioxidant defense genes. Mitochondrial were highly fragmented in the IS, and disorganized in the

IPL by electron microscopy. Metabolomics data indicated that glycolysis metabolism was impaired. This suggests AMPK plays an important role in maintaining retinal function and survival. Mitochondria alteration, dysregulated glucose metabolism, and fatty acid metabolism are involved in AMPKα deficiency - caused retinal degeneration.

Since stimulation of the AMPK pathway can reduce oxidative stress and protect

15

mitochondria, the approach has potential to delay or prevent a broad-spectrum of neural degenerations.

16

CHAPTER 1 RESEARCH BACKGROUND

Visual System

The Eye

Vision is one of the five fundamental senses, which allows us to visualize and observe the beauty of the world, and loss of vision results in a substantial decrease in quality of life. The eye is one of the most complex organs in the body, as normal visual processes require many components. Light passes through the front of the eye, which includes the cornea, pupil, and lens, which work together to focus light on the retina.

The retina is a part of the central nervous systems (CNS); it contains a vast variety of cell types and is highly organized (1). The layers of the retina include the retinal pigmented epithelium cells (RPE), photoreceptors, bipolar cells, Müller cells and ganglion cells, among others. These cells function together to maintain healthy vision.

The visual process begins with phototransduction in the photoreceptors which results in signals being transmitted to the brain to lead to vision (2).

Visual Signal Transduction

Visual transduction begins with photon capture by rhodopsin. Upon absorption of a photon, 11-cis-retinal, bound as a chromophore to rhodopsin (Rho), is converted to all-trans-retinal. This changes rhodopsin to meta-rhodopsin, which is its active form.

Activated rhodopsin signals to the G-protein coupled receptor transducin by catalyzing a

GDP exchange for a GTP and results in the separation of the transducin α subunit from the β and γ subunits(3). The β and γ subunits then signal to phosphodiesterase (PDE) to hydrolyze cyclic GMP (cGMP). This reduces the concentration of cGMP and results in the closing of the cGMP-gated Na+ channels and causes a hyperpolarization in

17

membrane potential thus inhibiting the inflow of Na+ and Ca2+ ions into photoreceptor

(4, 5). For the recovery phase, activated rhodopsin is phosphorylated by the G-protein

rhodopsin kinase (GRK1). In the dark, GRK1 activity is reduced from binds to a

recoverin-Ca2+ complex due to high levels of intracellular Ca2+. In contrast, in the light,

when the cGMP gated channels close, the intracellular Ca2+ level decreased, GRK1 is

disassociated from recoverin Ca2+ complex and have a high activity to phosphorylate

rhodopsin. Guanylyl cyclase (GC) will replenish cGMP to levels sufficient to open cyclic

nucleotide-gated channels once more (4, 5).

Photoreceptors and RPE

Photoreceptors are the light sensing cells of the retina and are essential for

vision. There are two types of photoreceptors: rods and cones. Rod photoreceptors are

highly sensitive to light, and they are capable of responding to a single photon. Thus rod

photoreceptors mediate vision in dim light conditions. Cone photoreceptors function in

bright light and can distinguish different wavelengths of light, and are also responsible

for high acuity vision (6). Human retinas have a high dense only cone photoreceptor

region near optic nerve called fovea. Surrounding the fovea is a narrow ring called the

macula region (7). The mouse does not have macula (8).

The rod and cone photoreceptors consist of a synaptic terminal, the cell body

that includes the nucleus, outer segment (OS) and inner segment (IS). The OS contains

the cGMP-gated Na+ channel on its outer membrane and is composed of a stack of

folded double phospholipid membrane discs that contain rhodopsin to absorb photons

and initiate the visual cycle. The IS contains a high density of mitochondria and ion

pumps such as Na+ K+ ion pump and non-gated K+ channels. These pumps utilize ATP

18

to pump out Na+ and Ca2+, which are a voltage-gated influx to maintain homeostasis, especially in dark condition. Both rod and cone photoreceptors shed ten percent of their

OS discs on a daily basis, which is then phagocytized and catabolized by RPE (9-13).

Photoreceptors must produce new lipids, proteins, and nucleic acids to maintain OS length and function. Therefore, the retina is one of the most energy demanding systems of all the organs and tissues.

The RPE interacts closely with photoreceptors to provide metabolic and nutrient support to maintain energy metabolism by transporting transports oxygen, glucose, and ions between the retina and the choroid (14). As mentioned above, 11-cis-retinal is required for photoreceptors to respond to light. RPE is the principal site for 11-cis-retinal regeneration in the visual cycle. All-trans retinal is metabolized into all-trans-retinol and transported to the RPE, and then isomerize back to 11-cis-retinal in the RPE by essential enzymes such as lecithin retinol acyltransferase (LRAT). The newly generated

11-cis retinal will be shuttled back to the OS to bind with opsin and regenerate functional visual pigment to complete the visual cycle (15).

Energy Metabolism in the Healthy Retina

Each cell type in the retina has specific and unique metabolic demands, leading to coordinated and complex metabolic regulation. Metabolism in the retina is highly coordinated and compartmentalized, especially between the photoreceptors and RPE.

Rod photoreceptors consume upwards to 108 ATP per second to maintaining the

“dark current” (16, 17). Cone photoreceptors are thought to have an even higher metabolic rate compared to rod photoreceptors. While both cell types have similar ATP

19

expenditure in the dark, cones consume more energy in the light compared to rods

(18). Notably, the mitochondrial density of photoreceptor IS is much greater in cones versus rods (16, 19). Studies estimate that there are three times as much mitochondrial inner membrane volume in cones versus rods (16). High levels of ATP are produced partially from oxidative metabolism to meet such high energy demands(20),(21),(22).

Studies have demonstrated that mouse retinas function at their maximal respiratory rate with very limited capacity (23). Cytochrome c oxidase is a component of the mitochondria electron transport chain (ETC) complex IV that is essential for oxidative metabolism and reflects the oxidative capacity to meet energy demands. Data have demonstrated that cytochrome C oxidase is highly abundant in the IS of the retina, as well as outer plexiform layer (OPL) and the apical side of the RPE in macaque retina

(24). These data support that photoreceptors depend on oxidative phosphorylation

(OXPHOS).

The retina also relies on glycolysis to meet energy demand. Otto Warburg reported a specialized type of metabolism that converts most of the glucose to lactate as an energy source even when oxygen is abundant, often referred as “aerobic glycolysis” (Otto Warburg 1924). Tumors and retinas are the two tissues that utilize aerobic glycolysis and retina display a cancer-like metabolism that consumes high amounts of glucose and favors glycolysis even in the presence of oxygen (25-28).

Glucose is primarily used for glycolysis in the outer retina. Glycolysis in photoreceptors results in the generation of lactate (22), which is produced at a high rate even when the oxygen level is abundant (29).

20

Blood-derived glucose is transported to the retina from the choroid. It passes through the blood-retina barrier and RPE cells. Glucose transporters (GLUTs) mediate and facilitate the movement of glucose, which is sodium- and ATP- independent (30).

Studies from Adler and Southwick found that glucose and lactate are distributed, consumed and released at different levels in the photoreceptors and RPE (31). The glycolytic enzymes hexokinase (HK) catalyzes the initial phosphorylation of glucose, while pyruvate kinase catalyzes the final step in glycolysis. Several papers have shown that both hexokinase and pyruvate kinase M2 (PKM2) are localized to photoreceptors

(28, 32, 33).

The RPE is also dependent on beta-oxidation (22). As mentioned previously, photoreceptor shed outer segment disc on a daily basis, which contains a bolus of lipid and proteins and then is digested and phagocytosed by RPE cells. These lipids undergo fatty acid oxidation to produce β-hydroxybutyrate (β-HB) which is called ketogenesis

(34). β-HB is then transported to the retina and used as a metabolic substrate.

James Hurley and his colleges have proposed an ecosystem model of RPE and photoreceptor metabolic homeostasis, particularly in lactate shuttling. Photoreceptors use most of the glucose to generate lactate; then this lactate is exported and taken up by the RPE, where lactate has the highest consumption rate. Neighboring Müller cell also can take up this lactate, which stored as glycogen through gluconeogenesis or distribute it to other cells in the retina. Recent data from Hurley’s group suggests that lactate in the RPE inhibits the utilization of glucose by the RPE, which then increases the level of glucose that is transported to the photoreceptors from the RPE (22, 35, 36).

21

Metabolic Dysregulation in the Diseased Retina

Metabolic homeostasis is critical for normal function and survival of retinal neurons. Metabolic dysregulation is considered as a contributing factor for accelerating retinal degeneration in diseases, such as retinitis pigmentosa (RP) and age-related macular degeneration (AMD).

Retinal degeneration is characterized by progressive loss of neurons, most often

photoreceptors, RPE, and ganglion cell. Retinal degeneration can eventually lead to

blindness, which has a tragic effect on quality of life. As of 2015, 940 million people

worldwide are under some degree of vision loss (37). The common causes of vision

impairment include inherited retinal diseases such as RP and multifactorial diseases

that are due to genetic and environmental factors such as AMD, glaucoma or diabetic

retinopathy; or other insults from traumatic injury or retinal detachment.

Retinitis Pigmentosa

RP is a group of inherited retinal disorder, which lead to progressive

photoreceptor degeneration; result in tunnel vision and night blindness (38, 39).

Worldwide prevalence of RP is 1 in 4000, and more than 1 million people are affected

(40). Retnet network has documented up to 84 genes and genetic loci which can cause

autosomal dominant or recessive, or X-linked forms of RP (41). Clinically RP is

characterized by the presence of pigment deposits of fundus exam. Some patients

develop visual impairment in early childhood age, while other do not display symptoms

until mid-adulthood age.

22

RP is a type of rod-cone dystrophy since rods first undergo degeneration, which is followed by cone photoreceptor death in many cases. There has been no successful gene therapy for RP except in animal models. Leber congenital amaurosis (LCA) is another inherited retinal degeneration characterized by severe vision loss at birth, and

17 genes have been identified, including Rpe65 (42, 43). Rpe65 is an important component of the visual transduction cascade that restores 11-cis-retinal after its photoisomerization to its all-trans form (44). Clinical trials of gene therapy to treat

Leber’s congenital amaurosis (LCA) have shown its safety and efficacy of slowing disease progression but did not halt the degeneration (45-54), and was approved by the

FDA (55). One limitation of gene therapy for RP is the vast genetic heterogeneity of RP.

The degenerative mechanism and potential therapies have been studied extensively for RP. Studies have shown that oxidative stress and metabolic dysregulation involved in rod and cone photoreceptors death in RP (56). In the P23H autosomal dominant RP model, glucose was found to be trapped in RPE (57).

Approaches aimed at increasing glycolysis to increase glucose availability to photoreceptors may improve photoreceptor survival and function to halt disease progression (58-60).

AMD

AMD is the leading cause of blindness among people age 50 or older in

Americans (61). Over 2.07 million people are suffering visual impairment from AMD in the United States, and this number is expected to more than double from 2 to 5.44 million by 2050 (62). Vision loss due to AMD reduces the ability of those affected to conduct daily activities and results in a loss of independence.

23

AMD is a multifactorial disease with both genetic and environmental factors

involved in its development. AMD mainly affects the macular region of the eye, which is

responsible for central high acuity vision. Age is the primary risk factor for AMD, with

onset often occurring after the age of 50. Smoking, hypertension, and family history are

also involved; and race has been considered as a factor since Caucasians have a

higher risk compared to other populations, especially African American people (62).

More than 20 genes and loci have been associated with increased risk of AMD, such as

complement factor H which is a component of the complement pathway and is one of

the most well-studied genes associated with AMD (41, 63-65).

AMD has been classified into three stages as early AMD, intermediate AMD, and

advanced AMD base on the severity and symptoms. There is currently no effective treatment for early AMD, and most often, no symptoms will display at that stage. In about 10% of cases, there is an abnormal growth of blood vessels out of the choroid into the retina, known as neo-vascular AMD. For intermediate and advanced neo- vascular AMD, anti-VEGF injection therapy and laser therapy have been applied to prevent the growth of abnormal blood vessels. Also, clinical trials of the Age-Related

Eye Disease Study (AREDS) and AREDS2 have demonstrated supplementation with high levels of antioxidants and zinc significantly reduce the risk of advanced AMD and its associated vision loss (66).

Mechanisms of AMD have been studied as extensively as the application of potential therapeutic targets. Proposed mechanisms include elevated oxidative stress, altered mitochondrial bioenergetics, dysregulated RPE metabolic metabolism and increased inflammation(64, 67-71).

24

Ferrington and her colleges have shown that RPE from human AMD patients have greater levels of mitochondrial DNA lesions (72), and the level of mitochondrial

lesions are associated with the severity of the disease. Work from Golestaneh et al.

provides evidence that RPE metabolism shifts to from beta-oxidation to glycolysis in

disease using induced pluripotent stem cells (iPSC) derived from patients with AMD

(73). Kurihara et al. have reported that the RPE stability and ability to support retinal

function is reduced when it is forced to rely on glycolysis (74). Additional evidence has

shown that when RPE is genetically modified to favor glycolysis by ablation of

mitochondrial OXPHOS, photoreceptors suffered from glucose starvation and

underwent degeneration (75).

AMPK Signaling Cascade

In 1973, two independent studies from Beg and Carlson observed that the same

kinase modulates 3-hydroxy-3-methyl glutaryl coenzyme A (CoA) reductase and hepatic

acetyl coenzyme A carboxylase (ACC) activity in the liver (76, 77). In 1988, Hardie and

Munday proposed the name of AMP-activated protein kinase (AMPK) that are

responsible for ACC enzymatic activity (76, 78). Subsequently, Hardie purified AMPK

and analyzed its subunit structure (79-81). Work from Kemp lab found that Snf1 protein

in the yeast shares the same structural and functional homology as mammalian AMPK

(82).

25

AMPK as an Energy Sensor (83)

AMPK is an evolutionally conserved serine/threonine kinase. Homologs for

AMPK subunits have been found in all eukaryotic, suggesting that it arose throughout 1

evolution. AMPK is the energy sensor and is responsible for maintaining energy homeostasis at the cellular level. AMPK functions as a heterotrimeric protein, and is comprised of a catalytic α-subunit (α1, α2), β-regulatory subunit (β1, β2) and the AMP- binding subunit (γ1, γ2 and γ3). Each of these three subunits has a specific role in regulating the activity and stability of AMPK. Because there are multiple isoforms for each subunit in mammals, there are 12 possible combinations of subunits and therefore

12 unique AMPK complexes. However, isotypes have different tissue distributions, suggesting that not all AMPK complexes exist in anyone cell type. For example, α1 and

α2 are both presents in the liver; while in adipose tissue, only AMPK complexes containing the α1 catalytic subunit are present (84). Also, different isotypes may have different cellular distributions. For example, AMPK α2 containing complexes are found

in both the nucleus and the cytoplasm, which raises the possibility that α2 complexes

may phosphorylate transcription co-activators and transcription factors in the nucleus to

regulate gene expression (85, 86). In contrast, AMPKα1 containing complexes are only

localized to the cytoplasm. In skeletal muscle, AMPK activity promotes myogenesis

through a mechanism mediated by AMPKα1, but not AMPKα2 (87). This unique tissue

and sub-cellular distributions suggest that complex types may have different substrates

1 Reprinted with permission from Xu L & Ash JD (2016) The Role of AMPK Pathway in Neuroprotection. Adv Exp Med Biol 854:425-430

26

and therefore have unique functions. Consistent with this possibility, AMPK α2 but not

α1 mediates oxidative stress-induced inhibition of RPE cell phagocytosis of

photoreceptor outer segment in vitro (88). Also, in vitro data have suggested AMPKα1

and α2 play distinct roles in regulating 4-HNE effects on RPE function and viability (89).

Studies using in situ hybridization have shown that AMPK α2 is expressed throughout

the retina, including in photoreceptors (90). However, a clear role of each isoform and

their distribution in the retina is not yet known.

AMPK not only senses energy status, but also functions at the cellular and

organismal level to regulate energy systems and orchestrate responses to physiological

and pathophysiological metabolic stressors such as fasting, exercises, ischemia,

hypoxia, and cellular redox state. AMPK is allosterically activated by the elevated AMP

levels, and the mechanisms of activation have been reviewed extensively elsewhere

(91). In brief, binding of AMP to the γ-subunit promotes a conformational change that either enables the phosphorylation of Thr172 in the activation domain of the α-subunit or prevents it dephosphorylation by protein phosphatases. Several kinases have been proposed to phosphorylate AMPK including liver kinase B1 (LKB1) (a tumor suppressor gene whose germline mutations in humans are the cause of Peutz-Jeghers syndrome),

calmodulin-dependent protein kinase kinase ΙΙβ (CaMKK II β), and mammalian transforming growth factor β-activated kinase (TAK1) (84, 92). Because AMPK is

activated by elevated AMP levels, it has been proposed that AMPK functions as a

cellular energy sensor and plays a central role in regulating energy homeostasis.

Normal functioning cells have a very little AMP, and AMPK is maintained in the inactive,

dephosphorylated state. When cells undergo an energy crisis, and ATP levels decline,

27

adenylate kinase is activated, which uses two molecules of adenosine diphosphate

(ADP) to produce ATP and the byproduct AMP. As AMP levels rise, AMPK is phosphorylated making it an activated kinase. AMPK functions to restore energy balance by turning down ATP-consuming pathways such as protein synthesis, RNA synthesis, and fatty acid synthesis, while at the same time turning on pathways that generate ATP such as glycolysis, β-oxidation, and mitochondrial biogenesis (91).

Regulation of Mitochondrial Biogenesis by AMPK

The mitochondrion is a critical organelle for cell function and survival.

Mitochondrial not only are the major source of energy production but also is a major source of reactive oxygen species (ROS). To combat the production of ROS, mitochondria also contain many of ROS detoxifying enzymes. In addition to ATP production, mitochondrial is also involved in steroid synthesis and calcium regulation.

Retinal IS, and OPL has an abundance of mitochondria. Damaged mitochondrial is a common feature in retinal degeneration. Mitochondrial dysfunction has been proposed as a mechanism of cell death in retinal degenerative diseases, such as age-related macular degeneration, diabetic retinopathy, inherited retinal degenerations, and glaucoma (93). Regulation of mitochondrial biogenesis has been proposed as a neuroprotective target in retinal degeneration models and diseases (94) since mitochondrial biogenesis is likely an adaptation to compromised bioenergetics (95).

Mitochondrial biogenesis is regulated by nuclear transcription factors Nuclear

Respiratory Factor 1(NRF-1), Nuclear Factor Erythroid 2-Related Factor 2 (NRF-2),

Estrogen Related Receptor alpha (ESR1), thyroid hormone receptors, and retinoic acid receptors. These, however, all require a co-activator peroxisome proliferator-activated

28

receptor-λ co-activator (PGC-1α)(96). AMPK has been shown to directly phosphorylate and activate PGC-1 α in muscle to induce mitochondrial biogenesis (85). Retinal mitochondrial biogenesis is impaired in diabetic retinopathy (97). This suggests that

AMPK is also important for mitochondrial function and resistance to oxidative stress. In support of this hypothesis, mice lacking both AMPK α1 and α2 subunits in the muscle had greatly reduced muscle mitochondrial DNA content (98). Metformin, an AMPK activator, has been used to promote mitochondrial biogenesis and conferring neuroprotection against apoptotic cell death in primary cortical neurons in vitro (99).

Regulation of mTOR Pathway by AMPK

A potential mechanism by which AMPK activation can protect neurons is through activation of autophagy or inhibition of protein synthesis. These processes are regulated by AMPK substrates mammalian target of rapamycin (mTOR) complexes, mTORC1 and mTORC2 respectively. Activated AMPK will inhibit mTOR, which is a serine/ threonine protein kinase that regulates multiple cellular processes such as cell growth, cell cycle, and autophagy. mTOR forms two protein complexes: mTOR complex 1

(mTORC1) and mTOR complex 2 (mTORC2). AMPK directly phosphorylates multiple components in the mTORC1 complex including TSC2 and Raptor (100, 101). Activation of Unc-51 like autophagy activating kinase (ULK1 and ULK2) are essential to form autophagosomes. It has been shown that AMPK and mTOR regulate autophagy through direct phosphorylation of ULK1 (102). Experimental evidence has suggested that pre-activation of AMPK-dependent autophagy pathway with metformin treatment confers neuroprotection against focal cerebral ischemia (103). Also, induction of AMPK dependent autophagy by ischemic preconditioning can protect from ischemic

29

stroke(104). In retinal RPE cells, autophagy regulating kinases have been proposed as potential therapeutic targets for AMD through activation of AMPK pathway (105). In support of this hypothesis, another activator of AMPK, AICAR, was found to protect

RPE cells in response to oxidative stress (88). Moreover, AMPK-induced autophagy protected RPE cells from TRAIL-induced cell death (92). Activation of AMPK inhibits

mTORC2 signaling pathway, thus regulating translation and protein synthesis through

inhibiting eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) and S6 kinase 1 (S6K1). Pharmacological inhibition of mTOR with rapamycin has been proposed as a potential treatment option in neurodegenerative diseases, such as

Parkinson’s disease, Huntington’s disease and Alzheimer’s disease and retinal degeneration such as AMD (106). In the eye, treatment with rapamycin blunted RPE dedifferentiation and hypertrophy, preserved photoreceptor numbers and function for both metabolic and oxidative stress models (75). Also, treatment with rapamycin

dramatically promotes retinal ganglion cells survival in a rat chronic ocular hypertension

model (107).

Regulation of Inflammation Response by AMPK

Multiple inflammatory signaling pathways are involved in the pathogenesis of

retinal degeneration. Although AMPK is well known for its role in cellular energy

homeostasis, it may also regulate inflammatory signals(108). In a lipopolysaccharide

(LPS) induced mouse model of retina inflammation, AICAR injections preserved

photoreceptor function and rhodopsin protein levels. This protection was associated

with inhibition of NF-κB signaling (109). The role of AMPK has also been examined in

diabetic retinopathy. Inflammation in diabetes was found to down regulate the AMPK

30

pathway, which leads to NF-κB activation and increased inflammation as shown by elevated Intercellular adhesion molecule 1(ICAM1) and VEGF expression (110). Also, resveratrol also prevents the development of choroidal neovascularization by restoring

AMPK activity and inhibiting macrophage migration (111).

Overall, AMPK is a major energy sensor of energy and redox status. Once activated, AMPK can restore energy balance to promote cell health and function. The ability of AMPK to stimulate mitochondrial biogenesis, autophagy, inhibit inflammation, and prevent cell death suggest that AMPK is a key target for new therapies to slow or prevent retinal degeneration.

Activation of AMPK Signaling by Metformin

History of Metformin

Metformin was discovered in 1922 and was first used in Europe as traditional herbal medicine. Metformin was originally derived from galegine, which is a natural product of the plant Galega officinalis (also known as goat's rue, false indigo, professor- weed, French lilac, Spanish sanfoin and Italian fitch) (112). Studies found that galegine lowered glucose level, but was found to be too toxic (113). Based on the chemical structure of galegine, also known as isoprenyl-guanidine, metformin was synthesized as biguanides that are responsible for reducing blood glucose in the liver. Metformin was tested and introduced in a clinic in the1950s by French physician Jean Sterne.

Metformin Usages and its Side Effect

Metformin is the most widely used anti-hypoglycemic drug to treat type 2 diabetic patients and is prescribed to over 100 million people. It is primarily used for

31

lowering glucose level, but also improves patients’ lipid metabolism, and reduces

inflammation and oxidative stress (114-116). It has been shown that diabetic patients

that take metformin have better cognitive function compared to patients who use other

anti-diabetic drugs (117-119). A clinical trial of long-term interventions with metformin by the Diabetes Prevention Program (DPP) have demonstrated that metformin treatment reduced the incidence of Type 2 diabetes in 30% of participants and that participants on metformin have reduced cardiovascular disease risk factors and atherosclerosis (120-

122).

In patients, metformin is taken orally with a bioavailability of 50-60% by the small intestine. Metformin is not metabolized but is excreted rapidly by the kidney, rather the liver (123, 124). Metformin has had a great safety record for over 60 years. Its common side effects are nausea, vomiting, diarrhea, and cramps. The most severe potential side effect is lactic acidosis. Lactic acidosis is very rare and often associated with comorbid health conditions, such as impaired liver or kidney function, rather than to the metformin itself (125). Lactic acid is an acid that formed by anion lactate and H+. In normal

physiological conditions, almost all lactic acid is present as lactate anion due to the pH

(126). Lactate is a product from glycolysis, and is a substrate for gluconeogenesis in the

liver; however, metformin inhibits hepatic gluconeogenesis, which results in higher

lactate levels. Patients taking metformin must monitor calorie intake to reduce lactate

levels. Additionally, in healthy conditions, the kidneys can help to clear lactate. It has

also been shown that metformin accumulation can induce lactate production by anaerobic metabolism of glucose in the intestine (127). When patients have poor kidney

function, the combination of lactate less utilized by the liver and the increased

32

production in the small intestine will lead to increased levels of lactic acid, leading to lactic acidosis, which can eventually result in kidney failure and other organs failure

(128).

Mechanisms of Metformin’s Action

Unlike most FDA approved medications, metformin has been used to treat diabetic patients well before its mechanism of action was well studied. However, it is well known that metformin acts as an insulin sensitizer and reduces hepatic glucose output from gluconeogenesis (129). Several studies have shown that metformin inhibits mitochondrial electron transport chain (ETC) complex I activity (130). This inhibition effect depends on the concentration of metformin and the time duration of treatment

(131-133). Inhibition of complex I will reduce ATP production by ETC, and change the ratio of ADP:ATP and AMP:ATP. In a stable cell line that expresses AMPK complexes with an AMP-insensitive variant, metformin is no longer able to active AMPK, which confirmed metformin activates AMPK through inhibition of mitochondrial respiration

(134). Recently, metformin has been proposed to activate AMPK through a lysosomal pathway. Cellular AMP, not ADP, will drive the scaffold protein AXIN to tether with LKB1 and form an AXIN-LKB1-AMPK complex, especially under glucose starvation conditions. This complex will dock to the surface of lysosome to form a complex with the v-ATPase-Regulator of AXIN/LKB1, ultimately leading to AMPK activation (135-137).

Metformin as a Tool to Target Neurodegeneration, Aging, and Cancer

While metformin has been shown to extend lifespan in C.elegans, nematodes, and mouse models (136, 138-141), but not in Drosophila (142). This beneficial effects of metformin likely dependent on the dose, as demonstrated by Martin and his colleagues

33

that high doses of metformin are toxic but lower doses (10% of the high dose used in their studies) extends both health and lifespan of mice. Nir Barzilai from Albert Einstein

College of Medicine recently proposed a clinical trial entitled “Targeting Aging with

Metformin” (TAME) based on metformin’s protective effect, in hope to development of better approaches for overall health rather than treating each medical condition. A recent retrospective study has shown that metformin use in diabetic patients is associated with a reduction in risk of retinal ganglion cell death caused by primary open angle glaucoma (143). There is also clinical trails initiated at University of California in

2017 for the effffect of metformin for the minimization of geographic atrophy progression in patients with AMD.

There are also increasing evidence for metformin’s effect on suppressing tumorigenesis in vivo and in vitro. Work by Anisimov demonstrated that metformin treatment could delay the onset of breast cancer in a mouse model (144, 145). Meta- analyses have shown that metformin reduces the incidence and risk of developing cancer in type 2 diabetic patients (146, 147). In addition, metformin is associated with a better survial rate in ovarian cancer (148).

Concluding Remarks

We appreciate the importance of normal healthy vision. Homeostasis of metabolism in the retina is fundamental processes that govern functional vision and maintains photoreceptor and RPE health and survival. AMPK has been established as a central energy sensor in studies of other tissues, but little work has focused on the role of AMPK in the retina.

34

In my dissertation, we asked two questions: (1) whether regulation of energy metabolism through AMPK contributes to the survival and function of retinal neurons, and (2) whether regulation of metabolism has the potential as a therapeutic target to treat retinal degeneration. To achieve this, we studied the AMPK signaling cascade through two approaches: 1) we examined the gain of functionof AMPK by stimulating

AMPK with metformin to determine if activation of AMPK could protect the photoreceptors in several retinal degenerative mouse models, and 2) we examined the loss of function of AMPK by using a conditional knockout of AMPKα subunit in the neuro retinas of mice to determine the role of AMPK in retinal function and survival.

35

CHAPTER 2 METHODS AND MATERIALS

Animals

All animal procedures followed the guidelines of the ARVO statement for the Use

of Animals in Ophthalmic and Vision Research and were approved by the IACUC at the

University of Florida.

BALB/cj Mice

5-6 week old of male and female BALB/cj mice were purchased from Jackson

Laboratory. Mice were acclimated to our animal facility for two weeks before any experimental procedures. They were reared in dim light conditions (50 lux) throughout.

All experiments were performed on 7-8 week old BALB/cj mice.

PDE6Brd10 Mice

PDE6Brd10 mice were generously given by Dr. William Hauswirth at the University

of Florida, and are in the C57BL/6 strain. Mice were genotyped as described for mutations rd10 (149), rd1 (149), rd8 (150), and the Rpe65 (151) genes. Mice were

homozygous for the rd10 mutation, wild type for the rd1 and rd8 mutations, and were

homozygous for the Rpe65 M450 allele. Mice were bred in the animal facility of the

University of Florida. All mice were reared in 12 h light - 12 h dark cycles (lights on at 7 am) with 50 lux lighting intensities at cage level. Food and water were given ab libitum.

2-8 weeks old RD10 mice were used for experiments.

Cre Loxp System to Induce Retinal Specific Knockout Mice

The retinal homeobox gene Chx10 is expressed in uncommitted priogenitor cells

and mature bipolar cells in the retina. Mutations in Chx10 gene cause growth

36

abnormalities in the development of lens, iris, and retina, which results in the small eye and characterized as microphthalmia/anophthalmia in patients (152). A Chx10 BAC reporter system contains cre recombinase, a translational fusion of enhanced green fluorescent protein (GFP), internal ribosome entry sites (IRES) fused to human placental alkaline phosphatase (AP), which can mediate recombination at loxP sites in the genome. Chx10 RNA is detectable in the retina at embryonic day 10-10.5 (153).

Utilizing the reporter constructs allows us to generate pan-retinal-specific knockouts to study interested genes.

Germ line knockout of both AMPKα1 (also known as Prkaa1) and α2 (also known as Prkaa2) is embryonic lethal at ~10.5 days post-conception (84). AMPK α1 and α2 floxed mice were purchased from Jackson Laboratory. rd8 and Rpe65 were screened and bred out of these mice. Then they were mated to mice that express

Chx10 promoter to conditional knock out the gene in the neural retina (153). Mice with neural retina knockout of both AMPKα1 and α2 (Chx10-Cre; AMPKα1f/f AMPKα2 f/f) were examined at various ages.

Intravitreal and Subcutaneous Injections

Normal BALB/cj mice were deeply anesthetized with a single intraperitoneal injection of xylazine (5.2 mg/Kg) and ketamine (100 mg/Kg). Metformin was obtained from Calbiochem (La Jolla, CA) and Sigma-Aldrich (PHR1084-500MG). 5 µg metformin

(dissolved in 1μl of PBS (phosphate buffered saline)) or 1 µl PBS as vehicle control was injected intravitreally into the eye using a 36 gauge needle (World Precision

Instruments, Sarasota, FL, USA) through the temporal limbus of the eye. In each

37

animal, the left eye was injected with metformin and the right eye with PBS. Thus, each animal served as its control. Any eye showing signs of damage because of intravitreal injection, such as inflammation and morphological disruption were excluded from both electroretinogram (ERG) and histological analysis.

Three doses of metformin (300/400/500 mg/kg/day) were administered by subcutaneous injection daily. Control mice were given PBS daily. All mice were injected between 2 to 4 pm each day. Light damage or sodium iodate studies were given after

seven days of metformin treatment unless otherwise stated. RD10 mice were given

daily subcutaneous metformin injections (300 mg/Kg) beginning on postnatal day 13

(P13). AMPK α1 and AMPK α2 conditional knockout mice were injected with metformin

at 300 mg/Kg/day for seven days before light exposure.

Sodium Iodate Induced RPE Damage

Mice were pre-treated with metformin 300 mg/Kg or PBS for seven days. On the

seventh day after metformin injection, mice were given a single intraperitoneal injection

of sodium iodate. Sodium iodate solutions are prepared fresh before each experiment.

Sodium iodate powder was dissolved in sterile PBS at a final concentration of 10 mg/ml.

This stock solution was diluted to make 3 mg/ml and 3.5 mg/ml working solutions. To

administer the two doses of sodium iodate used (30 mg/Kg and 35 mg/Kg), we injected

10µl of either working solution per gram mouse weight, into the intraperitoneal

cavity. ERG and OCT were performed seven days after sodium iodate injections to

study the RPE function and retinal structure, and eyes were collected after twelve days

for ZO1 staining for RPE morphology.

38

Light Damage

Light damage is an acute model to induce retinal degeneration. Unlike any inherited retinal degeneration models, the light damage can induce synchronized cell

death to most of the photoreceptors. It was firstly reported back to 1960s (154), and

have been used widely as retinal degeneration model. Unanesthetized 6-8 weeks old

Balbc/j mice were exposed to diffuse, white fluorescent light coming from the top of the

cage. Food and water were provided ad libitum but were placed in the cage bottom to

avoid blocking light exposure. Average luminance was measured on the center of the

cage floor using a light meter (Extech Instruments, Waltham, MA, USA). In all

subsequent experiments, mice were housed in dim light (50 lux), room light turns on

and off at 6 am and 6 pm. Mice were placed in 4000 lux light from 8:00 pm to 12:00 am.

After light exposure, all mice were kept in the dim light room for five days before further

analyzed by electroretinography and histology.

Electroretinograms (ERGs)

ERGs were recorded using a Colordome ERG instrument (Diagnosis, Littleton,

MA) to measure the function of surviving photoreceptors. ERGs were recorded five days

after bright-light exposure. Briefly, after overnight dark adaptation, mice were deeply

anesthetized with a single intraperitoneal injection of xylazine (5.2 mg/Kg) and ketamine

(100 mg/Kg). Body temperature was maintained at 37°C on a heating pad. Animals

were placed in the center of the dome. Pupils have dilated with 1% tropicamide (from

Akorn) and 2.5% phenylephrine (from Akorn). Full-field ERGs were recorded from both

eyes using gold wire electrodes placed centrally on the cornea. A platinum reference

electrode was attached to the mouth, and a platinum needle electrode in the tail served

39

as a ground. Electrode positioning was monitored throughout the measurements using

an infrared camera. Scotopic, photopic ERG was used to measure a-, b-, and c- waves to determine the ability of metformin to protect photoreceptor and RPE function.

Scotopic ERGs were recorded from overnight dark-adapted mice using a series of increasing flash intensities over a range of different logarithmic units of intensity from -4 to 2.77 Log (cd.s/m2). Photopic ERGs were recorded using a background illumination of

30 cd.s/m2 and flash intensities from 10 to 60 photopic units as well as flicker ERG. To measure c-waves, we used scotopic ERGs at light intensities of 20 cd.s/m2 to record

RPE function. After ERG recordings, retinas were harvested for histological analysis. At

least eight mice per group were analyzed.

Spectral Domain Optical Coherence Tomography (SD-OCT)

SD-OCT imaging (Bioptigen) was used to visualize retinal structure including the

inner segment/outer segment (IS/OS) junction, external limiting membrane (ELM), outer

nuclear layer (ONL), and outer plexiform layer (OPL) and inner nuclear layer (INL).

Before imaging, the pupils of the mice were dilated at least 30 minutes prior the test with

1% tropicamide and 2.5% phenylephrine hydrochloride solution (from AKORN) to obtain

high quality images. Artificial tears/lubricant eye gel were given directly after anesthesia

with Ketamine and Xylene and were used throughout the procedure to maintain corneal

clarity. Linear scan and rectangular scan were performed. Diver software from bioptigen

was used to measure ONL thickness and quantify the thickness of all and each retinal

layers by auto-segmentation. Averaged ONL thickness was calculated from the average

of ONL thickness at 250 μm, 375 μm and 500 μm of both inferior and superior and

plotted as a bar graph of different experimental groups.

40

Morphometric Analysis

Mice were euthanized with CO2, and the eyes were marked with a green dye to

orient the superior and inferior retina. Eyes were then enucleated and fixed in PERFIX

(20% isopropanol, 2% trichloroacetic acid, 4% paraformaldehyde, and 2% zinc chloride)

overnight, then changed to 70% ethanol at room temperature followed by embedding in paraffin for sectioning. 5 µm vertical sections were cut through the center of the eye with the optic nerve, then stained with hematoxylin and eosin (H&E). The number of photoreceptors nuclei were counted in histological sections every 240 µm intervals from optic nerve head (ONH) to both superior and inferior retina.

To look at morphological changes at a high resolution, electron microcopy was used. Sodium pentobarbital (as Euthasol) was IP injected at a dose of 150mg/Kg.

Complete anesthesia was confirmed by the absence of response to toe-pinch and eye-

flinch. Mice were positioned on a board. After opening the thoracic cavity to visualize

the heart, blood was collected from the left ventricle using a heparinized needle and

syringe. The mouse was then be infused with a sterile saline solution and subsequently

fixed by infusion of 2% paraformaldehyde 2.5% glutaraldehyde in 0.1M Cacodylate (pH

7.4) also via the left ventricle. The fixation solution was infused for 10 min at constant

pressure with a syringe pump. Then carefully remove the eye from the mice by scissors

and place the eye in fixative with 2.5% glutaraldehyde in 0.1M phosphate buffer (pH

7.4). After fixation, wash the tissue with 0.1M Cacodylate (pH7.4) for three times and 10

min each time. Dissect the tissue to trim the muscle and fat surrounded the eye. Cut

cornea to allow better penetration. Retina samples were post-fixed with 1% osmium

tetroxide and 1.5% potassium ferrocyanide in 0.1 M cacodylate buffer for 1 hour. After

41

rinsing with de-ionized water for 10 minutes, samples were dehydrated with 25%, 50%,

75% and 95% ethanol for 10 minutes each and then placed in three 100% ethanol for

15 minutes each. Following dehydration, retina samples were infiltrated with a mixture of propylene oxide and Eponate 12 resin (Ted Pella, Inc., Redding, CA) at a 1:1 ratio overnight. After additional infiltration in propylene oxide and Epnonate 12 resin at a 1:2 ratio for 6 hours, retina samples were placed in pure Eponate 12 resin overnight. Each half of retina samples were then placed in two separate labeled Beem capsule filled with newly thawed Eponate 12 resin and then placed in a 60 °C oven for polymerization.

Semi-thin sections were sectioned at 0.5 µm and placed on glass slides. Sections were stained with Toluidine Blue and then cover slipped. Ultrathin sections were sectioned at

70-80 nanometer on a Leica UltraCut S ultramicrotome (Leica Microsystems Inc.,

Buffalo Grove, IL). Grids with ultrathin sections were stained with 5% uranyl acetate and 2% lead citrate for 15 minutes each. Ultra-thin sections were imaged on a JEOL

JEM-1400 transmission electron microscope (JEOL Tokyo, Japan) equipped with a

Gatan US1000 CCD camera (Gatan, Pleasanton, CA).

Western Blots

Retinas are homogenized in a lysis buffer (50 mM Tris–HCl (pH 7.5), 150 mM

NaCl, 5 mM EDTA, 1% (v/v) NP-40, 5% (v/v) glycerol, and protease inhibitor cocktail

(Calbiochem, San Diego, CA) Or using NE-PER nuclear and cytoplasmic extraction reagents kit (Pierce, Prod#78833) to separate nuclear and cytoplasmic protein. Protein content was measured using BCA protein assay (Pierce, Rutherford, IL). Total protein from each sample (15 μg) was electrophoresed on 4–20% gradient SDS-polyacrylamide gels (Invitrogen, Carlsbad, CA), and transferred to nitrocellulose membranes (Bio-Rad,

42

Hercules, CA). The membranes were incubated with Odyssey blocking buffer for 1 hour

at room temperature, and then incubated overnight at 4 °C with pAMPK antibody

(#2535S, Cell Signaling Technology, Beverly, MA), mitocomplex (Abcam 123545) and

PPAR delta (cell signaling) in blocking buffer, followed by 1-hour incubation at room

temperature with HRP-conjugated goat anti-rabbit secondary antibody (Amersham

Biosciences, Piscataway, NJ). Signals were visualized Odyssey CLX imaging system.

Real-time PCR

Gene expression levels of selected genes were measured using real-time PCR with cDNA extracted from retinas as templates. Primers (Table 1) were designed using

IDT oligo analyzer tool (Integrated DNA Technologies, Coralville, IA, USA) and Primer

Blast spanning the intron–exon boundary to amplify the corresponding mRNAs without amplifying potentially contaminating genomic DNA. Real-time PCR was carried out with

the SYBR green PCR master mix (Bio-Rad Lab., Hercules, CA, USA) using the MyiQ

Single-Color Real-Time PCR detection system (Bio-Rad Lab., Hercules, CA, USA)

following the manufacturer's instructions. Electrophoresis of PCR products was

performed to identify that a single band of the correct size had been amplified. All

primers were validated using a standard curve of serial two fold dilutions of retinal

cDNA. All primers used produced efficiencies between 90 and 99%, without producing

primer dimers.

Immunohistochemistry

Eyes were enucleated after animals were euthanized with CO2. The cornea and

lens were removed, and the eyecups were placed in 4% formaldehyde for 25 min at

room temperature. Eyes were cryoprotected in a series of gradient sucrose (10%, 20%,

43

and 30%) in PBS at room temperature, followed by overnight incubation at 4°C in 30%

sucrose in PBS. Eyes were placed in Tissue-Tek OCT Compound (Sakura Fintek,

Torrance, CA, USA), rapidly frozen in liquid nitrogen, and then sectioned on a cryostat at a thickness of 14 μm. Slides were dipped in −20°C methanol briefly, dried at 23°C, and stored at −20°C until use. Retina flatmounts were processed similarly, fixed in 4% formaldehyde for 30 mins, and then changed to PBS.

For immunofluorescence labeling, either cryosections or paraffin sections or

retina flatmounts were thawed/deparaffinized and washed three times with PBS

containing 0.5% Triton X-100. Non-specific binding was blocked by incubating sections

with 10% horse serum in PBS for at least 1h at 23°C, and primary antibody was applied

overnight at 4°C. Primary antibodies used were 8-OHdg (Genox corporation, MOG-

020P), anti-Opsin Red/Green (Millipore, AB5405), anti-short wavelength opsin

(OPM1SW) (Santa Cruz Biotechnology, sc-14363) and anti-Cone arrestin (kindly gifted

by Dr. W. Clay Smith). Sections were washed and incubated with secondary antibody

Alexa Fluor 488 goat anti-rabbit IgG (#A11008) or Alexa Fluor 594 donkey anti-goat IgG

(A11058) and Alexa Fluor 488 goat anti-mouse IgG (#A11001) for one h at 23°C. Nuclei were counterstained with 4-6-Diamidino-2-phenylindole (Vector Laboratory, Burlingame,

CA, USA) for 10 min and then cover glasses were placed with PBS containing 50% glycerol. Images were taken and analyzed by using Keyence fluorescence microscope

(Keyence, BZ-9000).

ATP and NADH Content

6-8 weeks old BALB/cj mice were injected with metformin at a dose of 300mg/Kg for different days including 1d, 2d, 4d and seven days. Retinas were collected at 2

44

hours after the last injection. After harvesting, retinas were quickly lysed in ATP assay buffer and NADH assay buffer, respectively. ATP and NADH content was measured by colorimetric assay according to the protocol from Abcam (ab83355) and Biovision

(catalog 347-100) respectively. Each experiment has repeated three times.

Metformin Concentration by LC-MS

Metformin concentration was measured by hydrophilic interaction LC-MS (liquid chromatography-tandem mass spectrometry) (155). Mice were injected 300 mg/Kg of metformin; retinas were collected at different time points after one single injection or 2 hours after multiple days of injections. Simple protein precipitation was performed.

Protein precipitation solutions were prepared by spiking acetonitrile with 0.5% formic acid with internal control Metformin-D6 (Medical Isotopes, D11574) at 5ng/ml. A 4 times volume of precipitation solution was added to the lysed retina samples. Then samples were vortexed and centrifuged for 10 min at 1522 × g, 4°C. Metformin-D6 (Medical

Isotopes, D11574) and phenformin (Sigma Aldrich P7054) were applied as an internal control to improve the precision of analytical method by controlling for variations in extraction, LC injection and ionization efficiency.

Complex I Activity

Mice were injected with metformin once daily subcutaneously for 1d, 2d, 4d or 7 days. Additional mice were injected with metformin for seven days following by exposed to light damage. Retinas were collected either 2 hours after metformin administration or

6 hours after light damage. Complex I activity was measured according to the protocol

(Complex I Enzyme Activity Microplate Assay Kit from Abcam ab109721). Six retinae of the same treatment were grouped to isolated mitochondria. Retinas were lysed using

45

Dounce homogenizer following the protocol of mitochondria isolation kit for tissue from

Thermo Fisher Scientific (catalog number: 89801). BCA assay was used for

mitochondrial quantification according to the protocol.

Metabolomic Analysis

Mice were treated with metformin for 7 days to study metformin-induced

metabolic reprogramming. Mice were also exposed to 1200 lux white light for 4 hours

from 6 pm to 10 pm. Retinas and posterior cups were collected after 7 days of

metformin injection or 6 hours after light damage. Steady state level of metabolomic

analysis was performed using Liquid and Gas chromatography-mass spectrum (LC-

MS/MS and GC-MS). We also injected mice with 13C labeled glucose intraperitoneally to

vehicle and metformin treated mice to study carbon flux of metabolic processes. Cre

negative and cre positive of Chx10 cre; AMPK α1f/f α2f/f 4 months of age mice were

injected with 13C glucose intraperitoneally, and retinas were collected 45 minutes after

injecting glucose subcutaneously at 300 mg/Kg/ day. The data was analyzed using

MetaboAnalyst 4.0.

Statistics

GraphPad Prism was used for all statistical analyses. Results are expressed as a

mean ± standard error (SEM). Differences between two groups were assessed using

either paired or unpaired t-tests while differences between more than two groups were

assessed using Analysis of Variance (ANOVA) followed by Tukey post hoc test. A p-

value less than 0.05 were considered significant.

46

Table 2-1．Primer sequences: Gene Forward Reverse Efficiency PGC-1α TGCTGTGTGTCAGAGTGGATTGGA ACCAACCAGAGCAGCACACTCTAT 96.2% NRF-1 TCTGAGACGCTGCTTTCAGTCCTT TGGGCTTCTATGGTAGCCATGTGT 94% TFAm TGGCAGTCCATAGGCACCGTATT ACAGACAAGACTGATAGACGAGGG 96.8% Gadd45b TACGAGGCGGCCAAACTGATGAAT ACGACTGGATCAGGGTGAAGTGAA 97.8% Parp14 TTGGCACAGGAAATGCTCAACAGG ACTCTCTTCACAGCCTGCACTGAT 95% Txnrd1 AGATTGCTGGCTCAGAGGCTGTAT TTCAGAGAGGCCACAACAGCCATA 96.2% COXII ACCTGGTGAACTACGACTGCTAGA TGCTTGATTTAGTCGGCCGAT 97.3% RPL19 TCACAGCCTGTACCTGAAGG TCGTGCTTCCTTGGTCTTAG 96% HO-1 AGCCCCACCAAGTTCAAACA GCAGTATCTTGCACCAGGCT 92.8% SOD2 CAGGATGCCGCTCCGTTAT TGAGGTTTACACGACCGCTG 95.6% β-actin TGAGAGGCAAATCGTGCGTGACAT ACCGCTCGTTGCCAATAGTGATGA 98.9% AMPKα1 CCTTCGGGAAAGTGAAAGTGAAGGT ACTGATGACCTGGTACAGTTTGAT 94.2% GG AMPKα2 GGAGAACACCAATTGACAGGC GTGCTGATCACCTGGTAGAGT 96% HO-1 AGCCCCACCAAGTTCAAACa GCAGTATCTTGCACCAGGCT 95.1% SOD2 CAGGATGCCGCTCCGTTAT TGAGGTTTACACGACCGCTG 97% PDK4 GAAGCTGATGACTGGTGTATCC GACCCACTTTGATCCCGTAAA 97% ATP5g CCTGTGCCTGTCTTTCTACC CCTTCCACACTCTGCCTTATC 95.6% GLUT1 CTCGGGTGTCTTGTCACTTT CCTCGTGCTCTTCTTCATCTT 98% ACC1 CCCGTCAGAACACAGAGATAAA CTGAGGTGGTTGAGTGTGTT 96.5% ACC2 GTGGCCTTCAGGAGATTTGA CACGCCTTACTGAAGAGAAGAG 97.6% GPX1 CGACATCGAACCTGACATAGAA GACCACGAGGAAGACGAAATG 95.8%

47

CHAPTER 3 STIMULATION OF AMPK PREVENTS DEGENERATION IN THE PHOTORECEPTORS AND RETINAL PIGMENTED EPITHELIAL

Introduction

Retinal degeneration is a cluster of diseases that can be characterized by progressive loss of rod or cone photoreceptors or their support cells, known as the retinal pigmented epithelium (RPE). Retinitis pigmentosa (RP) is a group of inherited retinal diseases that have been causally linked to mutations in 84 identified genes and genetic loci (41). One of these genes encodes the beta subunit of the cGMP phosphodiesterase 6 enzyme (PDE6B) that plays a pivotal role in light stimulated a response in photoreceptors (149, 156). Age-Related Macular degeneration (AMD) is the most common form of retinal degeneration and is considered as a multifactorial disease

that affects the macular region of the eye. More than 30 million individuals worldwide

are affected by vision loss by AMD (157). Mutation in more than 20 genes and loci have

been associated with increased risk of AMD (65, 69). Age and smoking have remained as the two highest risk factors for AMD, which suggests that oxidative stress and ROS production play a pivotal role in early AMD (67),(158). While there are no perfect mouse

models for AMD, several studies have used sodium iodate to induce an acute oxidative

injury in PRE that mimics one aspect of early disease (159, 160).

Rods, cones, and RPE cells are highly interactive and have the highest metabolic

demands of all cells in the body. Photoreceptors have extensive ciliary organelles that

are composed of stacks of disk membranes known as outer segments (OS) that are

necessary for light capture and initiation of vision. The outer segments of approximately

40 photoreceptors in humans, or 150 in mice, are interdigitated with the RPE apical

48

processes (63). On a daily basis, each photoreceptor sheds 10% of outer segment

discs, which is then phagocytized and catabolized by RPE. The daily metabolic and

catabolic energy demand is therefore quite high for photoreceptors and RPE(161), (162).

These cells also have an intrinsically high energy demand to maintain membrane

potential and ion flux through abundant Na+K+-ATPases (20). To meet these energy

demands, high levels of ATP are produced from glycolysis and mitochondrial oxidative

phosphorylation (21). It is, therefore, a logical hypothesis that dysregulated metabolism

may be a major contributing factor to retinal disease, and that approaches to enhance

metabolism have a therapeutic benefit to blinding retinal diseases such as RP and

AMD.

In most cells, metabolism is controlled by key energy sensors such as adenosine

monophosphate-activated protein kinase (AMPK). AMPK is considered as energy

sensor since it is activated by conditions such as nutrient deprivation, low energy states,

an increased ratio of AMP/ATP, oxidative stress, fasting, and hypoxia (163). AMPK

activation requires phosphorylation by the upstream kinases liver kinase B1 (LKB1) or

calmodulin-dependent protein kinase kinase (CamKK). Once activated,

AMPK phosphorylates multiple substrates to restore the energy balance. For

example, protein, lipid, and RNA synthesis are slowed through inhibition of protein synthesis and fatty acid synthesis. AMPK also increases energy production by increasing glycolysis and promoting mitochondrial biogenesis through phosphorylation of peroxisome proliferator-activated receptor gamma coactivator 1 (PGC-1) (96, 164-

166).

49

Metformin (1, 1-dimethyl biguanide hydrochloride) is a known activator of the

AMPK pathway (167). It actives the signaling cascade by either inhibiting Complex I of

the electron transport chain to reduce ATP synthesis and subsequently elevated levels

of AMP or by binding directly bind to the α subunit of AMPK and promoting the

formation of the active αβγ - heterotrimeric AMPK complex to forming active AMPK

(168). Metformin is widely used to reduce serum glucose levels in type II diabetics but has also been studied for its ability to protect cells and tissues in vivo including brain

against ischemia/reperfusion injury (169), cardiovascular disease (170),(171), and

against statin-associated muscle symptoms (SAMS) (172).

In this chapter, we used the AMPK activator-metformin, to determine whether

stimulation of the AMPK pathway can protect photoreceptors rods, cones, and RPE. We

tested metformin in three different mouse retinal degeneration models: bright light damaging model, to injure rods; mice with an inherited, aggressive form of RP caused by a missense mutation in the PDE6B gene (PDE6Brd10) to study protection of rods and

cones, and a sodium iodate-induced damage model to study protection of RPE.

Results

Metformin Protected Retinal Photoreceptors from Light Damage Induced Retinal Degeneration

We used metformin to activate AMPK in the retina in vivo to determine if

activation of the AMPK pathway promotes neuroprotection of photoreceptors from

damaging light injury. Light damage is a well-established model to induce the death of

rod photoreceptors (173). Exposing albino mice to 4000 lux of light for four hours is

sufficient to induce a synchronized loss of 50% to 75% of retinal photoreceptors in

50

untreated mice or mice treated with vehicle (Figures 3-1 and 3-2). Since metformin can cross the blood-brain barrier (174, 175), we chose once-daily subcutaneous injections for delivery. Metformin was injected for seven days before light damage. Light damage alone resulted in the loss of retinal function and outer nuclear layer thickness. However, mice given the highest dose of metformin (500 mg/kg) were almost fully protected from light damage and were observed to have similar numbers of photoreceptors compared to undamaged retinas. Protection was evident in both the retinal structure (Figure 3-1a and 1b) and photoreceptor function (Figure 3-1c). Metformin-induced protection was also dose-dependent (Figure 1b and 1c). Notably, metformin did not alter retinal structure or function in the absence of light damage demonstrating that the drug was not harmful to the retina.

51

Figure 3-1: Metformin prevents retinal degeneration from light damage in a dose- dependent manner. Mice received subcutaneous injections of metformin or diluent (PBS) for seven days before the light injury. (a) Representative histological sections from mice treated with PBS or 300, 400, or 500 mg/kg of metformin before light damage. (b) Quantitative histological analysis of photoreceptor protection by metformin. Photoreceptor nuclei in the outer nuclear layers (y-axis) were counted in histological sections every 240 μm from the optic nerve head (ONH) in both the inferior and superior retina. The ONH is located in the center of the x-axis and has no photoreceptors. The dotted lines indicate regions with statistical difference. (c) Photoreceptor function was measured by electroretinography (ERG). The a-wave amplitude (photoreceptor light response) was plotted with increasing light intensities. In both b and c, error bars indicate S.E.M.; n=8 mice per group; experiments were performed three times. For statistical analysis, data were analyzed by one-way ANOVA with a Tukey’s post hoc test. *p < 0.001.

52

To determine whether protection was a function of local activity within the retina

or systemic metabolic changes, we used intravitreal injection to directly deliver

metformin to the eye two days prior to light damage. Metformin injected into the vitreous of the eye also prevented photoreceptor death and preserved photoreceptor function in light damaged mice, suggesting that protection was a local activity in the retina (Figure 3-2).

53

Figure 3-2: Intravitreal administration of metformin protects photoreceptors from light- induced degeneration. Mice were intravitrously injected with either PBS or metformin two days prior exposed to light damage. (a) Representative histological sections through the superior retina near the optic nerve head are shown. (b) The number of ONL photoreceptor nuclei was counted at both inferior and superior of ONH. (c) Photoreceptor function was measured by ERG a-wave amplitude. In both b and c, error bar indicates SEM, n=8 mice per group, and experiments were performed three times. For statistical analysis, data were analyzed by ANOVA in Graphpad Prism with a Tukey’s post hoc test, *p < 0.05.

54

Metformin-induced Protection is Mediated by Local Signaling and is Acting through AMPK α2 Subunit

Since both systemic and local drug delivery of metformin protected

photoreceptors from light damage, our results suggest metformin crosses the blood-

retinal barrier. To test this possibility, we measured the concentration of metformin in

the retina by liquid chromatography-tandem mass spectrometry (LC-MS) following

injection of metformin(155). Retinas were collected two hours after subcutaneous

metformin injections (300 mg/kg). Mice given a single injection yielded the same retinal

levels of metformin as mice given once-daily injections for multiple days (Figure 3-3a).

Following a single injection, metformin levels in the retina remained fairly constant for up

to 8 hours, then declined rapidly (Figure 3-3b). These findings confirmed that metformin

could cross the blood-retinal barrier, is cleared from the retina over time, and does not

accumulate with repeated dosing. These results are consistent with the known

metformin pharmacology in humans where metformin’s half-life in serum is approximately five hours, and it is excreted in urine (123).

Previous studies have shown that metformin leads to phosphorylation and activation of AMPK in liver and skeletal muscles where it can increase glycolysis and initiate mitochondrial biogenesis (130, 176, 177). We found that single daily systemic doses of metformin resulted in rapid and sustained phosphorylation of AMPK in the retina (Figure3-3 c and d).

To investigate whether metformin mediated neuroprotection is acting through

AMPK signaling, we used AMPKα1 and AMPKα2 retinal specific conditional knockout mice. Using the Chx10-cre line we were able to the knockout expression of AMPKα1 or

55

AMPKα2 to about 15 to 20% of the normal mRNA level respectively (Figure 3-4 a and b). This conditional knockout strategy will remove floxed genes in all retinal neurons and Müller glial (130). Retinal thickness and scotopic a-wave amplitude were not affected by the loss of either gene (Figure 3-4 c-e). Knockout mice had normal retinal structure and function at six weeks of age. To determine whether metformin was protective in the absence of either subunit, we injected metformin into cre+ and cre- mice as described in methods before exposure to bright light. We found that metformin was able to protect photoreceptors structure and function in AMPKα1 conditional knockout at a level similar to cre negative controls (Figure 3-3 e and f). However, in mice lacking AMPKα2, metformin was not able to preserve photoreceptors from light damage (Figure 3-3 e and f). These data indicated that to induce protection from light damage, metformin must activate AMPKα2 in the retina, and suggests that protection is not mediated by systemic drug-induced metabolic changes.

56

Figure 3-3: Subcutaneously injected metformin crosses the blood-retinal barrier, activates AMPK in the retina, and required AMPK a2 subunit to protect photoreceptors from LD. (a) Delivery of metformin in the retina was measured by LC-MS after 1, 2, 4, or 7 days of once-daily subcutaneous injections. All retinas were collected 2 hours after the last injection. n=6 per group.(b) Metformin concentration in the retina was measured at 2-48 hours after a single subcutaneous metformin injection. n=6 per group. (c) Representative Western blots. Levels of phosphorylated AMPK (pAMPK) were measured in retinal lysate collected after the indicated days of once-daily subcutaneous metformin injections. (d) Average levels of pAMPK after 1, 2, 4, or 7 days daily metformin injection were quantified. n=3 per group from three

57

independent experiments. Data were analyzed by One-way ANOVA with post-hoc Tukey’s test, vehicle vs. 2d P= 0.0035; vehicle vs. 4d P=0.0016. (e) Mice deficiency of α1 and α2 subunit were treated with metformin for 7 days and then exposed to light damage. Mice were divided into three experimental groups: Before LD, LD and MFLD. Averaged ONL thickness were plotted as different groups of cre negative control, AMPK a1f/f, a2f/f knockout mice. Data were analyzed by two-way ANOVA,* P<0001.(f) Scotopic a-wave amplitude were shown at light intensity of log 1 (cd.s/cm2). N=5-8 mice per group. Data were analyzed by two-way ANOVA,* P<0001.

58

Figure 3-4: Metformin mediated neuroprotection through AMPK signaling pathway, and required AMPK α2 catalytic subunit. (a-b) mRNA levels of AMPKa1 and

59

AMPKa2 were measured by q-PCR to evaluate deletion efficiency; expression levels of a1 and a2 in DKO (Chx10 cre pos; AMPK a1f/fAMPK a2 f/f) were normalized to the levels in WT (WT: Chx10 cre neg; AMPK a1f/fAMPK a2). (c) Represented histology and OCT images of cre negative control, AMPK a1f/f and AMPK a2f/f cKO from before LD, LD and MFLD groups. (d) Scotopic ERG and OCT were performed on AMPK a1f/f cKO mice before LD, with LD and metformin-treated before LD three experimental groups. N=5-8 per group. (e) Scotopic ERG and OCT were performed on AMPK a2f/f cKO mice before LD, with LD and metformin-treated before LD three experimental groups. N=5-8 per group. Two-way ANOVA analysis was used to analysis the data.

60

A Minimum of 4 days of Daily Metformin Injection is Required to Induce Protection from Light Damage

Since our data show that metformin-induced rapid AMPK phosphorylation, we wanted to determine whether metformin-induced protection was also rapid or did it require multiple days of treatment. Mice were treated with metformin for different days at

300mg/kg before exposure to light damage. We found that four days of metformin injections were necessary to induce photoreceptor protection from light damage.

61

Figure 3-5: A minimum of 4 days of daily metformin injections is required to induce protection of photoreceptors from light damage. (a-c) Mice were treated with daily subcutaneous injections of metformin for 1, 2, 4, or 7 days prior to exposure to damaging light. Additional mice were injected with PBS and either not exposed to damaging light (Vehicle) or exposed to damaging light (LD). (a) Representative histological images are shown from each group. (b) Quantitative histological analysis of photoreceptor protection by metformin as described in Figure 1. (c) Photoreceptor function was measured by ERG. The a-wave amplitude (photoreceptor light response) was plotted versus increasing light intensities. In both b and c, n=8 mice per group, and experiments were performed 3 times. The error bars indicate S.E.M. For statistical analysis, data were analyzed by two-way ANOVA with Tukey’s post hoc test. Vehicle vs. 7d LD ns p=0.0651; LD vs. 4d LD P<0.0001; LD vs. 7d LD P<0.0001; 4d LD vs.7d LD ns P=0.7134.

62

Metformin Induces Changes in Mitochondrial Gene Expression following Light Damage

Since multiple days of metformin treatment were required for protection, it seems

likely that protection requires substantial changes in retinal metabolic programing,

including mitochondrial biogenesis. To measure biogenesis, we used qPCR to measure

mitochondrial DNA content relative to nuclear DNA content. Any increase in

mitochondrial DNA would indicate mitochondrial biogenesis. We found that repeated

daily subcutaneous injections of metformin increased mitochondrial DNA content in the

retina and that 4 days of metformin injections was sufficient to induce a two-fold

increase in mitochondrial DNA content (Figure 3-6a). The increase in mitochondrial

DNA content remained unchanged with further treatment and did not decrease after

exposure to damaging light (Figure 3-6a). Peroxisome proliferator-activated receptor

gamma coactivator 1 alpha (PGC-1α) is a major regulator of mitochondrial biogenesis. It

functions by co-activating numerous downstream mitochondrial transcription factors,

including the nuclear respiratory factor 1 (Nrf1) and mitochondrial transcription factor A

(Tfam) (178). mRNA expression of PGC-1α, Tfam, and Nrf1 were not significantly

elevated by metformin alone but were markedly upregulated after light damage in

metformin-treated mice (Figure 3-6 b, c and d). Expression of the mitochondrial-

encoded gene cytochrome c oxidase subunit II (COX II) was slightly increased by

metformin alone, but was markedly increased in metformin-treated mice following light damage (Figure 3-6 e). Nuclear-encoded mitochondrial complex II (SDH-A) and mitochondrial encoded subunit I of complex IV (COX-I) protein levels were measured by

Western blot. PGC-1α protein was not measured because all commercially available antibodies failed validation tests. A slight increase of COX-I expression was observed in

63

the mice treated with metformin following exposure to light damage, while SDH-A levels remained similar between all the groups (Figure 3-7 a, b and c). These results suggest that metformin regulates some, but not all, mitochondrial and nuclear encoded mitochondrial-related gene expression. Studies have shown that metformin inhibits mitochondrial electron transport chain (ETC) complex I activity (131, 132). We found that mice given subcutaneous injections of metformin for one or two days had a small, but reproducible, decrease in complex I activity (Figure 4f). However, after four or more daily doses, complex I activity returned to baseline levels. Interestingly, light-damaged mice pre-treated with metformin for 7 days had increased mitochondrial complex I activity (Figure 3-6f). Peroxisome proliferator-activated receptor delta (PPARδ) is an isoform of the PPAR family that directly regulates genes required for mitochondrial biogenesis (179-181). PPARδ protein expression increased with metformin treatment

(Figure 3-6g). Taken together, increased mitochondrial DNA content, increased gene expression and elevated complex I activity with metformin treatment suggest increased mitochondrial biogenesis in the retina. AMPK is also known to increase ATP through increased glycolysis (182). We measured retinal ATP levels following daily subcutaneous metformin injections. These data showed that, like AMPK phosphorylation, ATP levels were elevated within two hours after injection (Figure 3-6h).

The increase in ATP is likely the result of increased glycolysis since complex I activity was suppressed at the two hour time.

64

65

Figure 3-6: Metformin increases mitochondria biogenesis in vivo following light damage. Mice were treated with daily subcutaneous injections of PBS (Vehicle) or metformin (MF) for 7 days. Additional mice injected with PBS (LD) or metformin (MFLD) were exposed to damaging light. (a) Mitochondrial DNA mass was measured by qPCR and was expressed as a ratio of mitochondrial DNA amplicons in the COX-ll gene relative to nuclear DNA amplicons in the β-actin gene. DNA was isolated from mouse retinas that were collected 2 hours after injection or 6 hours after light damage. n=5 per group and experiments were repeated three times. Data were analyzed by One-way ANOVA with post-hoc Tukey’s test, vehicle vs. 2d P=0.0364; vehicle vs. 4d P=0.0016; vehicle vs. 7d P<0.0001; LD6h vs. MFLD6h P=0.001 (b-e) Quantitative RT-PCR was used to measure gene expression of PGC-1α, COXII, Tfam, and Nrf1. Error bars indicate standard deviation; n=3 mice per group; experiments were performed 3 times. For statistical analysis, data were analyzed by One-way ANOVA with a Tukey’s post hoc test, LD vs. MFLD Nrf1 P=0.0273 Tfam P=0.0042 PGC-1 P<0.001 COXll P=0.001. (f) Electron transport chain complex I activity was measured from isolated mitochondria isolated of mouse retinas. Retinas were collected 2 hours after metformin injection or 6 hours after light damage.6 retinas from 3 mice were combined for each treatment, n= 9 per group, experiments were repeated twice. Data were analyzed by One-way ANOVA with post-hoc Tukey’s test. Vehicle vs. 1d P=0.0168; vehicle vs. 2d P=0.0168 and vehicle vs. MFLD P=0.0168. (g) Mice were treated with metformin for 1d, 2d, 4d and 7d, retina cytosol and nuclear protein were extracted. Representative Western blot of PPAR δ expression in the cytoplasm and nuclei and quantification of PPAR δ level from the average of three independent experiments. (h) ATP levels were measured 2 hours after 1, 2, 4, or 7 days of once-daily metformin injections.Data were analyzed by One-way ANOVA with post-hoc Tukey’s test. Vehicle vs. 1d P=0.0023; vehicle vs. 4d P=0.0076; vehicle vs. 7d P=0.0076. 0076. In all graphs, error bars indicate S.E.M.

66

Figure 3-7: Metformin induces changes in mitochondrial protein expression following light damage. Mice were given once-daily metformin subcutaneous injection for indicated days, following light damage. (a) Western blot were used to measure nuclear-encoded mitochondrial complex II (SDH-A) and mitochondrial encoded subunit I of complex IV (COX-I) protein level. Retinas were collected at the time points indicated in the x-axis of (b). (b, c) Quantification of SDH-A and COX-I protein level were plotted from an average of fluorescent intensities from three different blots. Error bar indicates SD, and experiments were performed 3 times from 3 different biological experiments. For statistical analysis, data were analyzed by oneway-ANOVA in GraphPad prism with a Tukey’s post hoc test, *p < 0.05.

67

Metformin Prevented Light-induced Oxidative Stress and DNA Damage

Intense light-induced retinal degeneration is known to be related to oxidative

stress in the retina, such as oxidized protein and damaged DNA. In response to light

damage, photoreceptors had an increase in DNA damage as measured by 8-Oxo-2'- deoxyguanosine (8-OHdG) levels and increased expression of Poly (ADP-ribose) polymerase (PARP) and Growth arrest and DNA damage-inducible beta (Gadd45b)

(Figures 3-8 a, b, c, f, and g). The ratio of NADH/NAD+ decreased significantly following light damage, which is consistent with a response to oxidative defense. Light damage also decreased expression of oxidative defense genes Heme oxygenase-1 (HO-1) and

Superoxide dismutase 2 (SOD2) and increased expression of Thioredoxin reductase 1

(Txnrd1) (Figures 3-8e, h, and i). In mice treated with metformin injections before exposure to damaging light, the number of photoreceptors positive for 8-OHdG and the expression of oxidative markers did not change from levels found in undamaged mice.

Together, these results demonstrated that metformin protected photoreceptors by preventing light-induced oxidative stress and DNA damage.

68

Figure 3-8: Metformin injections prevent oxidative stress induced by damaging light. Mice were injected once-daily with metformin or vehicle, then exposed to light damage. (a-i) Vehicle indicates mice given PBS and not exposed to light damage. MF indicates mice given metformin and no damaging light. LD indicated mice given PBS and exposed to light damage. MFLD indicates mice given Metformin and subsequently exposed to our light damage protocol. (a) IHC of 8-OHdG (8-Hydroxy-2’-Deoxy Guanosine) staining on retinal cross sections to evaluate DNA damage levels. Scale bar 100um. (b-c) In the non-light damaged groups, retinas were collected at 1, 2, 4, and 7 days following daily metformin injections. For the light damaged group, the mice were given 7 daily metformin injects prior to exposure to damaging

69

light. Retinas were then collected at the time points indicated in the x-axis of (c). (b) A representative Western blot that was probed with antibodies to PARP (Poly(ADP-Ribose) Polymerase 1) is shown (labels are shown on the x-axis of (c) . (c) The Western blots were repeated with three independent biological replicates and protein levels were measured by fluorescence intensity as described in the methods. LD4h vs.MFLD 4h P<0.0001 (d) Ratios of NADH/NAD+ as measured enzymatically are plotted. Vehicle vs.LD P=0.0025; MFvs. LD P=0.0002; Vehicle vs.MFLD P=0.0002 (e-i) Gene expression levels of oxidative defense genes Gadd45b (Growth Arrest and DNA Damage Inducible Beta) (P=0.0002), PARP14 (Poly(ADP-Ribose) Polymerase 14) (P=0.0006) , HO-1 (Heme Oxygenase 1) (P=0.0081), SOD2 (superoxide dismutase 2 ) (P=0.0008), and Txnrd1 (Thioredoxin Reductase 1) (P=0.0456) were measured by q-PCR. Error bars indicate standard deviation; n=3 mice per group; experiments were performed 3 times. For statistical analysis, data was analyzed by one-way ANOVA a Tukey’s post hoc test.

70

Metformin Delayed Retinal Degeneration in Rd10 Mouse Model and Preserved Cone Photoreceptors

Since light damage is an acute injury we wanted to determine whether metformin

could protect photoreceptors from a chronic injury. To investigate if metformin will delay

photoreceptor degeneration from inherited retinal degeneration we used PDE6bRd10 mice

as a model of a highly aggressive photoreceptor degeneration (156). Degeneration of

photoreceptors in RD10 mice begins around postnatal day 16, with all rods dying by 6

weeks of age (Figure 3-9 9c and Figure 3-9a), followed by cone death at 5~6 weeks.

Daily subcutaneous injections of metformin beginning on postnatal day 13 significantly

delayed rod degeneration and preserved rod structure and retinal morphology (Figure 3-

9a, b and c and Figure 3-10a). An averaged ONL thickness were plotted over time from

2 weeks to 8 weeks (Figure 3-9c and Figure 3-10a). Metformin was able to slow the rate of rod photoreceptor degeneration. Cone arrestin, S opsin and M opsin expression were measured by IHC and the number of cones were counted (Figure 3-9d, e). Retina of

RD10 mice treated with metformin at 6 weeks of age have doubled number of cone

arrestin, S opsin and M opsin positive cones (Figure 3-9f, g). To determine whether

metformin protects photoreceptor function, scotopic and photopic ERGs were measured

(Figure 3-10). Because we did not correct the PDE6bRd10 mutation, rods did not have a

measurable response. Cone photoreceptor function is not affected by the mutation

allowing us to measure their light responses. Metformin treatment preserved cone

numbers and function in both photopic and Flicker ERGs at 6 weeks of age. At 8 weeks,

metformin treated mice retained more than 50% of cone activity while untreated mice

were unresponsive (Figure 3-9h, Figure 3-10b, c and d). Later time points were not

measured.

71

Figure 3-9: Metformin delays retinal degeneration in RD10 mice. RD10 mice were given once-daily subcutaneous injections of PBS (vehicle) or metformin (MF) starting at postnatal day 13 (P13), which is prior to the onset of retinal degeneration. Data from C57BL/6J mice are shown as a reference for normal controls. (a) Representative images of SD-OCT at 4 weeks are shown. The double-headed red arrow indicates the thickness of the outer nuclear layer (ONL). (b) Representative histological sections of vehicle and metformin groups at 4 weeks of age are shown to verify SD-OCT images. Regions shown are near the optic nerve head. (c) Averaged ONL thickness was plotted over time at 2 weeks old to 8 weeks old to show the metformin- induced decrease in RD10 degeneration. (d) IHC was used to measure cone arrestin (green) and a combination of S-opsin and M-opsin (red) positive cones in retinas from vehicle or metformin treated RD10 mice at 6 weeks of

72

age. Scale bar 100 µm which indicated on the top left image. (e) The number of cones in each section were counted and plotted as the number of cones per 100 μm of the retina. Scale bar 100 µm which indicated on the top left image. (f) IHC was used to detect S-opsin (green) and M-opsin (red) in retinal flatmounts from vehicle or metformin treated RD10 mice at 6 weeks of age. (g) The number of S-cones and M-cones were counted in retinal flatmounts, and are plotted as the number of cones per 1 mm2. (f) Cone function was measured by flicker ERG. b-wave amplitudes were plotted over time. Error bars in (c, e, g) indicates standard deviation. Error bars in (h) indicate standard error of the mean. In all experiments, n=3 mice per group, and experiments were performed 3 with three biological replicates. Data were analyzed by one-way ANOVA with a Tukey’s post hoc test, *p < 0.001.

73

Figure 3-10: Metformin delays rod degeneration in RD10 mice, and rescues cone but not rod function. (a)Representative OCT images with PBS and metformin treatment at 4, 6 and 8 weeks. (b-d) Flicker ERG plotted from mice treated with PBS and Metformin. At 4 weeks of age, there are no reductions in cone photoreceptor function; at 6 weeks of age, PBS treated mice have significantly reduced flicker ERG. However metformin-treated mice have preserved cone function. Data were analyzed by one-way ANOVA, *P<0.05. (e-g) Scotopic ERG of mice treated with PBS and metformin at 4, 6 and 8 weeks. Metformin did not preserve rod photoreceptor function. There is no significant difference between PBS and metformin treatment.

74

To determine whether the mechanism of protection in RD10 mice was similar to protection from light damage, we measured the expression of COX-1, SDH-A, levels of

ATP, and mitochondrial DNA copy number. As we observed with light damage, metformin increased ATP levels (Figure 3-11d), increased mitochondrial DNA content

(Figure 3-11e), increased COX-I protein expression but did not increase SDH-A (Figure

3-11a, b, and c).

Figure 3-11: Metformin regulates mitochondrial profile change in RD10 mice. (a) PBS and metformin treated RD10 mice Nuclear encoded mitochondrial complex II (SDH-A) and mitochondrial encoded subunit I of complex IV protein level were examined by western blot. β-actin was used as loading control. Represented image are shown. Quantification of SDH-A and COX-I are indicated in b and c respectively. (d) ATP level was measured with PBS and metformin at 3 weeks and 6 weeks of age. (e) Mitochondrial DNA copy number was measured by comparing the ratio of mitochondrial DNA copy number to nuclear DNA copy number. (n=9, *p<0.05, 3 independent experiments were repeated)

75

Metformin Prevents RPE Damage From Sodium Iodate-induced RPE Injury

To determine whether protection was specific to photoreceptors or whether other cells could be protected as well, we used sodium iodate to damage RPE cells in vivo. Sodium iodate, when injected into the intraperitoneal cavity, induces a dose- dependent injury to the retinal pigmented epithelium in the eye (Figure 3-12). SD-OCT imaging showed that mice injected with sodium iodate at 30 mg/Kg and 35 mg/Kg RPE and photoreceptors were damaged. However, mice treated with metformin before sodium iodate, RPE and photoreceptor cells are more resistant to sodium iodate- induced damage (Figure 3-12a). To quantify RPE damage IHC was performed on post- retina eyecups with antibodies to zonula occludens-1 (ZO-1). RPE injury was observed as a loss of the RPE monolayer of cells. The area of RPE preservation was measured and plotted as a percent of the total eyecup area. Mice pretreated with metformin for 7 days, has increased resistance to sodium iodate induced damage (Figure 3-12b and c).

Photoreceptor and RPE function was measured by recording scotopic ERG a-waves and c-waves respectively. Both photoreceptors and RPE function was preserved in mice treated with metformin prior to sodium iodate (Figure 3-12d and e).

76

Figure 3-12: Metformin protects RPE from sodium iodate-induced damage. Mice were given once-daily subcutaneous PBS (Vehicle) or metformin (MF) injections for 7 days. To induce RPE injury, mice were then given a single injection (IP) of sodium iodate at the indicated doses (NaIO3 30 mg/kg and 35 mg/kg) or were injected with PBS as control (NaIO3 0 mg/kg). (a) Representative OCT images are shown from each experimental group. Red arrows indicate sodium iodate-induced damage to RPE and photoreceptors in the PBS group, but the damage was not observed in the metformin group. (b) IHC was used to detect ZO-1 (Zonula Occludes 1 Protein) in flatmounted eyecups to observe RPE damage. (c) The total RPE area and damaged areas were measured in eyecups (5 mice per group), and data were plotted as a percentage of total preserved RPE morphology. Error bars indicate standard deviation. One-way ANOVA with post Tukey test was used. P<0.0001.(d) Retinal and PRE-responses to light stimulation were measured by ERG.

77

Representative ERG traces are shown. The red dashed lines indicate a measurement of a-waves (photoreceptor function), b-waves (inner retina function), and c-waves (RPE response to photoreceptor stimulation). (e) ERG a-, b-, and c-wave amplitudes were averaged and plotted from each experimental group (n=5 mice per group). Error bars indicate standard error of the mean. For statistical analysis, data were analyzed by two-way ANOVA with a Tukey’s post hoc test. a-wave, NaIO3 30 vs. MF and NaIO3 30 P<0.0001.

78

PPARδ is Not Required for Metformin-induced Neuroprotection

Nuclear receptors including PPARδ have been shown to be involved in the regulations of AMD pathology pathways and can be a potential therapeutic target for slowing AMD progression (183, 184). Aged, PPARδ-null mice display early AMD phenotypes such as sub-RPE deposits and Bruch’s membrane thickening (185). One of the questions we asked was whether PPARδ plays an important role in maintaining retinal function and morphology. Also, our previous data showing mice exhibit a dramatic increase in PPARδ protein level with the treatment of metformin, we investigated whether PPARδ is involved in metformin-mediated protection. We approach this by using conditional knockout of PPARδ in the neural retina.

Loss of PPARδ in the Neural Retina does not Change Retinal Structure and Function up to 12 months of Age

We examined retinal structure and function by SD-OCT and ERG at 6 weeks old and 12 months old. We did not observe any different in retinal structure, rod photoreceptor and cone photoreceptor function (Figure 3-13 and Figure 3-14).

79

Figure 3-13: Genetic loss of PPARδ does not change retinal structure and function at an early age. (a) Representative OCT images are shown at 6 weeks old. (b) Quantification of ONL thickness was measured. n= 6 for cre pos and cre neg. (c) Scotopic ERG a-wave were plotted for rod photoreceptor function. n=8. (d) Flicker ERG of cone photoreceptor function. n=8-10 per group.

80

Figure 3-14: Genetic loss of PPARδ does not change retinal structure and function at 12 months old. (a) Representative OCT images are shown at 12 months of age. (b) Quantification of ONL thickness was measured. n= 6 for cre pos, n=7 for cre neg. (c) Scotopic ERG a-wave were plotted for rod photoreceptor function. n=6 for cre pos and n=7 for cre neg. (d) Flicker ERG of cone photoreceptor function. n=6 fro cre pos and n=7 for cre neg.

81

PPARδ is not Required for Metformin-induced Neuroprotection from Light Damage

To investigate whether metformin protect photoreceptors from light damage is

through activation of PPARδ, we injected metformin to 8 weeks old PPARδ knock out

mice at 300 mg/Kg/day for seven days and then exposed them to light damage. By SD-

OCT to exam retinal structure, we found that metformin preserved ONL thickness from

the light damage of both Cre positive and Cre negative mice (Figure 3-15a pink and

orange line). There is no significant difference between Cre pos and Cre neg of

metformin-treated mice. We also observed similar results by scotopic ERG a-wave

responses (Figure 3-15b pink and orange line). We conclude PPARδ is not required for metformin-mediated protection.

82

Figure 3-15: PPARδ is not required for metformin-induced protection against light damage. Mice were treated with metformin for 7 days at 300 mg/Kg/day, then exposed to light damage. (a) ONL thickness was measured by SD-OCT. n= 3 for cre pos MFLD, n=4 for cre neg MFLD, n=2 for cre pos LD, n=2 for cre neg LD, n=4 for cre pos before LD and n=4 for cre neg before LD. (b) Scotopic ERG a-wave were plotted for rod photoreceptor function. n=4 for cre neg and pos LD group, n=4 for cre neg MFLD and n=4 for cre pos MFLD.

83

Discussion

In this study, we found that metformin protects photoreceptors from acute light damage, chronic injury of inherited retinal degeneration, and it protects RPE from oxidative stress induced injury. Multiple days of treatment were needed, and protection was correlated with increased mitochondrial DNA copy number. Metformin made photoreceptors and RPE highly resistant to oxidative stress, which prevented DNA damage and oxidative injury. In the highly aggressive rd10 retinal degeneration model, metformin slowed rod degeneration and preserved cone photoreceptor numbers and function. Metformin’s protective effect was not specific to photoreceptors since metformin treatment also prevented sodium iodate-induced RPE damage.

Metformin induced-protection required AMPKα2 subunit since metformin is not able to protect photoreceptors from light damage in mice that lack the AMPKα2 subunit.

These data sugge that metformin induced protection is mediated primarily through

AMPKα2 and not through AMPKα1. The results also suggest that local activation of

AMPK is necessary for protection. In a previous study, conditional knockout of AMPK

(both α1 and α2) was found to result in synaptic remodeling (90), suggesting the importance of healthy metabolism in maintaining synaptic connections, and supports the hypothesis local activation AMPK in the retina is important for normal cellular function.

In our study, mice at 6-8 weeks of age and single knockouts of α1 or α2 had normal

ERG function, including b-waves, and retinal morphology. It is possible that synaptic dysfunction would occur later in life or would require the loss of both genes. We are

currently exploring these possibilities.

84

We found that metformin can rapidly cross the blood-retinal barrier and activate

AMPK signaling in the retina. Given the robust and rapid phosphorylation of AMPK, and rise in ATP levels in response to metformin injections, we were surprised to find that a minimum of 4 days of metformin treatment was required to induce protection of photoreceptors from light damage. This delayed response was not associated with an accumulation of metformin in the retina and since the drug appears to be cleared on a daily basis. Given the time required, it is likely that metformin-induced protection requires changes in gene expression and metabolic reprogramming. Our data also showed metformin-induced protection was also associated with increased mitochondrial

DNA content, and more robust expression of mitochondrial genes in response to oxidative stress. PPARδ is a lipid sensing nuclear receptor that is thought to regulate genes that mediate mitochondrial metabolism and restore energy balance. PPARδ enhance uptake of free fatty acids (FFA) and increase hydrolysis of lipoprotein triglyceride as well as modifies triglyceride synthesis to increased catabolism of fatty acids. PPARδ has also been shown to regulate glucose homeostasis and can increase mitochondrial gene expression in conjunction with co-factor PGC1α (173-175, 203-205,

212). However, our data indicated metformin was still able to protect photoreceptors from light damage in the absence of PPARδ in the neural retina. This suggests that metformin-mediated protection is not acting through PPARδ activity. We show that in the presence of metformin the expression of HO-1 and SOD2 are increased in response to light stress. It is possible that the increased resistance to oxidative stress provided by these genes is the primary mechanism of protection. Gene delivery with HO-1 and

SOD2 have been shown to protect photoreceptors and RPE respectively (186, 187).

85

However, it is unlikely that the mechanism is simply increased oxidative defense since

antioxidant therapies are not effective at delaying degeneration from inherited

mutations. In addition, gene therapy with SOD2 did not fully protect cells in late stage

degeneration (187). Enhanced catabolism is another likely contributing mechanism to

protection. Recent studies have shown that enhancing metabolism can protect

photoreceptors. Injection of growth factors including insulin, has been shown to promote

survival of cones through activation of AKT and the mechanistic target of rapamycin

rd1 (mTOR) in PDE6b mice(59). Activating glycolysis by knocking out Sirt6 also protected

rods and cones in PDE6bH260Q/H260Q mice (58). Protein or gene delivery of RdCVF into

the eye of the rd1 animal was able to attenuate the loss of cones by increasing glucose

uptake for aerobic glycolysis and increasing ATP levels (188-190). These studies show

that enhancing metabolism can rescue photoreceptors in mice with rod degeneration.

The increase in ATP production, mitochondrial DNA copy number, NADH/NAD+ ratios,

and Cox II protein expression in our data, all suggest that metformin increased retinal

carbon catabolism activity, which is likely contributing to protection. Since both oxidant

defense and metabolic changes are induced, it is likely both are contributing to

metformin-induced protection.

The ability of metformin to increase metabolism, induce mitochondrial

biogenesis, and prevent oxidative damage suggests that metformin has the potential to

protect photoreceptors and RPE from a broad spectrum of insults that cause retinal

degeneration. There are perhaps limitations to metformin-induced protection. In a recent

study, metformin was used to protect photoreceptors from a misfolded protein response

caused by transgenic overexpressing a mutant opsin protein (OpsinP23H) in transgenic

86

rats (191). In contrast to the data in our study, the authors found that metformin did not

slow rod degeneration in OpsinP23H transgenic rats. The study reported that metformin-

induced AMPK activation enhanced trafficking of mutant rhodopsin, suggesting that

metformin can rescue some aspects of the protein misfolding responses. The increased

trafficking of the mutant opsin led to disorganization of rod outer segments and induced

a relatively small (6%) decreased in ONL thickness at 7 weeks of age compared to the

untreated degenerating rat retinas. The authors concluded that the mislocalized opsin in

the outer segment might have a slight detrimental activity. Given these published

results, it is possible that while metformin is not protective from misfolded protein

aggregation. However, our data strongly suggest that metformin can slow degeneration

caused elevated oxidative stress and energy imbalances.

Oxidative stress and mitochondrial dysfunction are frequently associated with

multiple retinal degenerations including RP, AMD, glaucoma, and diabetic retinopathy.

Early AMD has been associated with altered bioenergetics, increased oxidative stress,

increased mitochondrial mutations, and decreased anti-oxidative defense (64, 68,

69),(192). The only approved therapy for early AMD is supplementation with an antioxidant cocktail, which has been shown by the AREDS and AREDS2 studies to have a measurable reduction in disease progression (66). Our data showed metformin

could reduce oxidative stress in photoreceptors from light damage and in RPE from

sodium iodate induced-toxicity, which leads to protection of both cell types.

Photoreceptors and RPE are not the only cells protected by metformin since a recent

retrospective study has shown that metformin use in diabetic patients is associated with

a reduction in risk of retinal ganglion cell death caused by primary open angle glaucoma

87

(143). In addition, emerging evidence have been shown that metformin also modulates the biology of ageing and lifespan although the mechanism is still not quite clear(193).Thus our study further illustrated the mechanism of metformin-induced neuroprotection. The strategy by stimulation of AMPK by metformin to reduce oxidative stress and regulate mitochondrial biogenesis may have a beneficial augmentation therapy to slow retinal cell death and induce broad-spectrum protection in the neurodegeneration of central nervous system.

88

CHAPTER 4 EVIDENCE THAT AMPK IS ESSENTIAL FOR RETINAL FUNCTION, SURVIVAL, AND METABOLIC HOMEOSTASIS

Introduction

Vision loss affects 285 million people worldwide, including more than 23 million

Americans that experience some degree of vision impairment (194, 195). Vision is required for our daily activities, so decreased visual function will result in a lower quality

of life. More than 200 genes have been associated with retinal degeneration (196).

These genes have specific functions and play different roles in visual processes. This

encourages us to target pathophysiological changes that are common to retinal

degenerations caused by different mutations as treatment options for these patients.

Oxidative stress and metabolic dysregulation have been linked to photoreceptor cell

death, especially cone photoreceptors in several RP models (56). A comprehensive

understanding of these responses will provide the fundamental knowledge needed to

discover new therapies.

Visual processing pathways in the retina require a high amount of energy. The

metabolic substrates needed to supply this energy demand include ATP, glucose,

lactate, fatty acid, NADPH among other components of the various metabolic pathways.

Studies have shown that maintaining energy homeostasis is critical for retinal function

and cell survival. Manipulation of cellular metabolism results in either accelerating

retinal degeneration or inducing neuroprotection. Studies have shown that deletion of

mTOR complexes affects cone function (197) while enhancing glycolysis by depleting

the histone deacetylase sirtuin 6 (SIRT6) protected rods and cones in a mouse model of

89

RP PDE6bH260Q/H260Q (58). Studies have also shown that deletion of LKB1 and AMPK

leads to synapses remodeling in the retina, which is similar to aging mice (90).

Our previous data show that stimulation of AMPK protects photoreceptors and

RPE in multiple retinal degeneration models and expression of α2 in the neural retina is

essential for metformin-mediated protection. This chapter aims to determine the role of

AMPK signaling in retinal struture and function. In order to determine the role of AMPK

in the neural retina by Chx10 Cre-loxp system, we use double AMPKα1α2 conditional

knockout mice as an approach. In addition, we use single AMPKα1 and single AMPKα2

conditional knockout mice to determine whether AMPK α1 and α2 have differential roles

in the retina.

AMPK α1 and α2 are the catalytic subunits of AMPK, and in mice, their genomes

have 78% similarity. Additionally, there are unique tissue and sub-cellular distributions

suggesting that complex types may have different substrates and therefore have unique

functions. For example, α1 and α2 are both presents in the liver, while in adipose tissue

only AMPK complexes containing the α1 catalytic subunit are present (84). In skeletal

muscle, AMPK activity promotes myogenesis through a mechanism mediated by

AMPKα1, but not AMPKα2 (87). AMPK α2 containing complexes are found in both the

nucleus and the cytoplasm, which raises the possibility that α2 complexes may

phosphorylate transcription co-activators and transcription factors in the nucleus to

regulate gene expression (85, 86). In contrast, AMPKα1 containing complexes are

localized only in the cytoplasm. Consistent with this possibility, AMPK α2 but not α1

mediates oxidative stress-induced inhibition of RPE cell phagocytosis of photoreceptor

90

outer segment in cell culture (88). In addition, in vitro data have suggested AMPKα1

and α2 play distinct roles in regulating 4-HNE effects on RPE function and viability (89).

Studies using in situ hybridization have shown that AMPK α2 is expressed throughout the retina (90).

We found that deletion of both AMPKα1α2 leads to the reduced cone and rod

photoreceptor function by 2 months of age, reduced cone number by 3 months of age,

reduced ONL thickness starting at 8 months of age and RPE dysfunction at 12 months

of age. Additionally, AMPKα2 has a unique role in cone function. Impaired glycolysis and mitochondria dysfunction are likely contributing factors to the degeneration caused by AMPKα deficiency.

91

Results

AMPKα1 and α2 are Essential for Retinal Function and Survival mRNA level of AMPK α1 and α2 in the retina of double knockout mice

First, we wanted to confirm AMPKα deletion in the neural retina. Gene expression levels of both AMPK α1 and α2 were measured by q-PCR. Using the Chx10- cre line, we were able to knockout gene expression of AMPKα1 or AMPKα2 to about 20 to 25% of the normal mRNA level in the retina. Gene expression levels of AMPK α1 and

α2 gene expression level in the RPE need to be further validated.

Figure 4-1: Gene expression level of AMPK α1 and AMPK α2 in double knockout mice. mRNA levels of AMPK α1 and AMPK α2 were measured by qPCR. Relative mRNA level was normalized to Chx10 cre negative control mice. n= 6 of cre negative and cre positive mice. Paired t-test was used for statistical analysis, *p<0.001.

92

Loss of AMPKα resulted in morphological changes at 12 months of age

To determine if AMPKα is required for maintaining retinal morphology, we studied the retinal structure by SD-OCT. ONL thickness was quantified at 12 months of

age mice. We found ONL thickness was thinner compare to WT mice as data shown in

(Figure 4-2 a, b). Also, the thickness of the total retina, inner plexiform layer (IPL), inner

nuclear layer (INL) and ONL+ inner segment (IS) thickness were also significantly

different from WT, and RNFL thickness was slightly increased.

93

Figure 4-2: OCT analysis of morphological changes of DKO mice at 12 months of age. (a) Represented OCT images of both WT and DKO mice. (b) Spider plot of ONL thickness from WT and DKO mice. ONL thickness was measured per 125 µm away from optic nerve head of both superior and inferior of the eye by Bioptigen Diver software. (c) Total retinal thickness and thickness of each layer as listed were generated from auto segmentation of Diver software. There was a reduction in IPL, INL and ONL+IS thickness. Each group contained 5-8 mice; paired T-test was used for statistical analysis, *p<0.05

94

To validate the auto-segmentation data, we measured the retinal thickness of

plastic sections from WT and DKO 12 month old mice. As shown in Figure 4-3, the

thickness of the total retina, OS, IS, ONL, INL and numbers of nuclei of ONL were

measured at 250 µm intervals starting from optic nerve head to both superior and

inferior of the retina sections. These data confirmed our finding by SD-OCT and demonstrated that overall retinal structure had been altered by deletion of AMPKα in the

retina. We found there are less surviving photoreceptor cells in the ONL, a significant

thinning in the IS, where mitochondria are very abundant, and less organized OS where

the disc is phagocytosed, and new discs form daily, and reduced thickness of IPL where

the synapses to the inner retina are. Interesting, we noticed that the RPE contained

vacuoles and misshapen RPE nuclei.

The data suggest that DKO mice exhibit slow but extensive damage to multiple

cell layers of the retina.

95

Figure 4-3: DKO mice have decreased total retinal, OS, IS, ONL and INL thicknesses. (a) Representative plastic section of Cre negative control and DKO mice at 12 months of age. Sections are about 500-750 µm distance from the optic nerve. (b-g) Quantification of total retinal thickness, IS thickness, ONL thickness, number of nuclei in the ONL layer and INL thickness. n= 3 for cre negative; n=4 for cre positive. The boxed area indicated *p<0.05.

96

To determine when retinal structure changes were detectable, SD-OCT was used to monitor and quantify the retinal structure change. Mouse retina experience a natural thinning with aging; however, we found a significant ONL thickness reduction starting at 8 months of age when compared to Cre negative control mice of the same age. These data indicate a deficiency of AMPKα causes retinal degeneration, but at a

relatively slow rate.

Overall, these data suggested AMPKα subunits are necessary for maintaining

the normal structure of the retina.

Figure 4-4: Averaged ONL thickness were plotted over time from 2 months to 12 months. n= 8 -10 mice per group, paired t-test were used for statistical analysis, *p<0.05.

97

Loss of AMPKα led to photoreceptor and RPE functional decline at 12 months of age

These results presented above show that deletion of AMPKα leads to a slowly progressive degeneration in retinal structure, but we also wanted to study retinal function changes. Photopic and scotopic ERG were applied to measure cone and rod photoreceptor function, respectively. At 12 months of age, mice with deficiency of AMPK

α exhibited drastically decreased cone photoreceptor function (Figure 4-5 a, b) and rod photoreceptor function when compared to WT mice (Figure 4-5 c, d). These data suggest that AMPK α plays an essential role in maintaining normal retinal function.

98

Figure 4-5: Reduced retinal function of DKO mice at 12 months of age. (a) Cone photoreceptor function was measured by flicker ERG at 12 months of age. (b) Photopic ERG was applied to measure cone function. (c-d) Rod photoreceptor function was measured by scotopic ERG at different light intensities. Each group n=5-8, experiments were repeated three times. *p<0.05.

99

Reduced cone and rod photoreceptor at young age

To determine the onset of retinal function reduction, we measured scotopic and photopic ERG over time. Surprisingly, we observed cone function decrease by six weeks of age, and rod function was also declined by three months of age although we did not observe any alterations in the retinal structure by OCT until eight months of age

(Figure 4-6). This unexpected result suggests that rod and cone photoreceptors may still survive until later ages; even though they already exhibit functional abnormalities.

Figure 4-6: Reduced cone and rod photoreceptor function were observed before three months of age. (a) Scotopic ERG was measured at three different groups of WT and DKO mice over time from 1 month to 12 months old. Results were plotted as the average of 16 mice. (b) Photopic ERG was measured to estimate cone photoreceptor function of WT and DKO mice over time from 1 month to 12 months old. n= 16 per group. *p<0.05

100

Deletion of AMPK leads to reduced cone number and decreased expression of opsin at three months of age

Arrestins are a family of multi-functional proteins that regulate signal transduction at G protein-coupled receptors (198). Cone arrestin, also known as arrestin 4, is specific to cone photoreceptors (199). It is expressed in cone photoreceptor IS, OS and cone cell body of ONL. Opsins are another marker for the cone; there are two types of cone opsins in the mouse. OPN1SW (S-opsin) is the short-wave opsin or blue opsin, and

OPN1L/MW (M-opsin) are the medium/long-wave opsin or red and green opsin. They are expressed in the outer segment and are components of the visual transduction machinery (200). We used antibodies against cone arrestin, S-opsin, and M-opsin to detect the expression in the retina, and found that their expression appears to be less organized in the AMPKα deficient mice compared to the Cre negative control mice(Figure 4-7 a-f). Quantification of the numbers of cones that are positive for these proteins indicated that there are reduced numbers of cone photoreceptors in the knockout mice (Figure 4-7 g).

We also measured gene expression levels of S-opsin, M-opsin, and rhodopsin

(rod photoreceptor-specific protein). We found both cone opsin levels are decreased compared to Cre negative control, but rhodopsin level remains the same (Figure 4-7 h).

101

Figure 4-7: The number of cones and levels of opsin expression are reduced in AMPKα deficient mice. (a-f) Cone arrestin (green) and a combination of S+M opsin (red) antibodies were used to stain cone photoreceptors. (g) Quantification of cone arrestin and S+M opsin are plotted as numbers per 100µm. Scale bar 100mm. n=3 for cre negative mice, n=6 for cre positive mice. (h) qRT-PCR was used to measure M-opsin, S-opsin and rhodopsin gene expression level. n=3 per group, *p<0.05.

102

Mitochondria dysfunction is associated retinal degeneration caused by AMPKα deficiency

We hypothesized that mitochondria might be altered in the retinas of mice with

AMPKα deficiency base on our previous data showing activation of AMPK can induce mitochondrial biogenesis, and since we observed highly disrupted IS in these mice.

Therefore, we aimed to investigate the mitochondrial mechanisms of retinal

degeneration with deletion of AMPKα.

Translocase of outer membrane 20 (Tom20) is a central component of Tom

receptor complex responsible for translocation of cytosolically synthesized mitochondrial

pre-proteins, and it was used as a mitochondria marker to look at mitochondrial

localization and expression of this mitochondria-associated protein by IHC. Using retinal

sections, we found that the Tom20 signal was concentrated at the IS as well as the OPL

in the WT mice, where mitochondria are known to be abundant. In contrast with WT

mice, we found there was a less intense signal of Tom20, especially in the IS of the retina in the DKO mice (Figure 4-7). These data suggested DKO mice have altered mitochondria. To further confirm these results, we used electron microscopy and found

DKO mice have smaller and more fragmented mitochondria and in the synapse of OPL.

Additionally, RPE disruption was also observed with the presence of many vacuoles,

which may explain why these mice have a lower c-wave function as measured by ERG

function (Figure 4-8).

103

Figure 4-8: DKO mice have altered mitochondria at 12 months of age. IHC using Tom20 (red) indicated there are fewer mitochondria staining in the IS and OPL.

104

WT DKO

Figure 4-9: DKO mice have altered mitochondria at 12 months of age. EM images of IS indicated DKO mice have smaller and more fragmented mitochondria (top). Mitochondria in the synapse of OPL are disrupted (middle), and RPE is highly vacuolated (bottom).

105

For further analysis, we chose time points of two weeks and six months to ensure cell death was not involved. We measured relative mitochondrial DNA copy number by comparing the ratio of mitochondrial and nuclear DNA content. Gene expression levels of mitochondrial ATP synthase subunit 9 (ATP5g), Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), and mitochondrial transcription factor A

(Tfam) were measured by q-PCR. We found that mitochondrial DNA content was reduced about 30% in mice at six months of age but not at two weeks of age; the expression level of ATP5g, PGC-1α, and Tfam was significantly different from WT mice at six months. These data suggested that mitochondrial dysfunction is associated with

AMPKα deficiency leads to retinal degeneration.

106

Figure 4-10: Mitochondrial DNA copy number, mitochondria related gene expression was reduced in the DKO mice. (A) Mitochondrial DNA content was measured by comparing the relative ratio of mitochondrial gene COX ll to nuclear gene β-actin. (B-D) ATP5g, PGC-1α, and Tfam mRNA level were decreased in the DKO mice. (E-F) WB of Tfam and its quantification. *p<0.05.

107

Impaired glucose metabolism and fatty acid metabolism is associated with AMPKα deficiency-caused retinal degeneration

We also wanted to investigate if glucose metabolism and fatty acid metabolism are affected in these mice. Glucose uptake is mediated by glucose transporter 1

(GLUT1) which is responsible for transporting glucose to photoreceptors from the choroid and RPE. We found gene expression level of Glut1 was lower at six months in

DKO mice but no significant different at two weeks. Pyruvate dehydrogenase kinase 4

(PDK4) is known to inhibit pyruvate dehydrogenase to downregulate glucose utilization.

Gene expression of PDK4 was decreased significantly to about 20% of wild-type at six months of age.

Acetyl-CoA carboxylase 1 (ACC1) and ACC2 are both involved in a fatty acid synthesis, and ACC1 catalyzes a rate-limiting step. Gene expression level of ACC1 was down regulated, and this indicates there may be a dysregulation of fatty acid metabolism.

108

Figure 4-11: Genes involved in glucose and fatty acid metabolism are down regulated in DKO mice at six months of age. (a-b) Glucose metabolism genes GLUT1, PDK4, and (c-d) β-oxidation gene ACC-1, ACC2 were measured by qPCR. n=3 of each group. *p<0.05

109

Oxidative stress is likely not involved in AMPKα deficiency-caused retinal degeneration

Messenger RNA level of oxidative stress-related genes, including antioxidant genes glutathione peroxidase 1(GPX1), thioredoxin (Txn1) and Hmox1, but super dismutate oxidase 2 (Sod2) were measured at two weeks and six months of age. We did not detect any significant different between WT and DKO except Sod2. Since we use the whole retina to extract RNA and reduction in relative mitochondrial copy number was already observed at six months of age. We speculate that the decreased mRNA level of Sod2 could due to reduced mitochondrial mass.

110

Figure 4-12: Deletion of AMPK α did not change oxidative stress-related gene expression including GPX-1, Thioredoxin, and HO-1, but SOD2. (a-d) Gene expression level of GPX-1, Thioredoxin, HO-1, and SOD2 were measured by q-PCR of WT and DKO mice at two weeks of age and six months of age. DKO mice were compared to WT at the same age, *p<0.05.

111

Loss of AMPKα results in mitochondria fragmentation at an early age

To determine the onset of mitochondrial dysregulation, we collected eyes for

Electron microscopy from AMPK double knockout mice at 4 months of age. There was no significant difference in the thickness of all layers between knockout mice and cre negative control from the plastic section. However, mitochondria appeared more fragmented in knockout mice at 4 months of age.

112

Figure 4-13: Retinal structure of DKO mice at 4 months of age and mitochondria fragementation by EM. Top panel: Images of the retinal section were taken around 500-750 µm from optic nerve head. n= 6 for WT mice and n=7 for KO mice. Bottom panel: EM images at same magnification showing mitochondria in the IS.

113

Loss of AMPKα results metabolic dysfunction of photoreceptors

To under how AMPK regulate metabolic responses in the retina, we measured

180 metabolites at steady states level in the retina. We found at 4 months of age,

metabolites in the glycolytic pathways are altered in the knockout mice (Figure 4-14 a).

This is further validated with the result from 13C glucose labeling experiment (Figure 4-

14 b). Unexpectedly, we found intermediate metabolites in the TCA cycle did not change significantly. However, we do observe a significant reduction in glutamate and glutamine level, and a slight increase in a-Ketoglutarate (α-KG) level.

114

Figure 4-14: Reduced carbon flux of glycolysis. (a) Steady state level of metabolites revealed that reduction of several metabolites, including glucose, glucose 6- phosphate (G6P), glucose 1-phosphate (G1P), phosphoenolpyruvate (PEP), pyruvate and lactate in the glycolysis pathway. Green indicate upregulated and red indicated downregulated. The number is the percentage relative to cre negative control. (b) 13C glucose tracing indicated that reduced carbon flux in the AMPKa deficient mice. N=5 of cre negative and cre positive mice.

115

AMPKα is Important for Maintaining the Metabolic Homeostasis between the Photoreceptors and RPE

Since we observed RPE’s morphological changes by plastic section and

photoreceptors and RPE interact with each other, we suspect that RPE function may

potential been affected as well. Scotopic c-wave ERG was used to measure RPE function. Decrease c-wave amplitude indicates that there was a decline in RPE function

(Figure 4-15).

Figure 4-15: Reduced RPE function of AMPKα knock out mice. The c-wave function was measured by scotopic c-wave ERG at a series of different light intensities. Each group n=5-8, experiments were repeated three times. *p<0.05.

116

AMPKα2, but not α1 are Essential for Maintaining Cone Photoreceptor Function mRNA level of α1 and α2 in single AMPK knockout mice

To confirm deletion efficiency, we measured both AMPK α1 and α2 gene expression level in single knockout mice. We found there are 15-25% expression at mRNA level compared to Cre negative control mice. Additionally, there was no compensation between α1 and α2 in either single KO mice (Figure 4-16).

Figure 4-16: Gene expression level of AMPKα1 and AMPKα2 in single knockout mice. mRNA levels of AMPK α1 and AMPK α2 were measured by qPCR. Relative mRNA level was normalized to Chx10 cre negative control mice. Each group n= 4 for α1 single knock out mice; n=3 for α2 single knockout mice. Paired t test was used for statistical analysis, *p<0.001.

117

AMPK α2 is Essential for Retinal Function and Morphology, but not α1 Subunit

We also followed nature history of single α1 and α2 KO mice. There were no significant different of ONL thickness between WT and single AMPKα1 KO mice by 12 months old (Figure 4-17). However, we did see a significant reduction of ONL thickness of AMPKα2 KO mice at 12 months of age. This suggested AMPKα2, but not α1 are required for maintaining the retinal structure.

Figure 4-17: Single KO mice did not have significant morphological changes over time. (a) ONL thickness of Chx10cre positive; AMPK α1f/f single knockout mice compared to WT (Cre negative control mice) over time from 2 months to 12 months. (b) ONL thickness of Chx10cre positive; AMPK α2f/f single knockout mice compared to WT over time from 2 months to 12 months. n=8-10 mice per group, *p<0.05.

118

AMPKα2, but not α1 has a unique role in cone photoreceptors

To determine the role of AMPKα1 and α2 in cone photoreceptors, we found that

AMPKα1 knockout mice had normal cone function at 6 months of age. However,

AMPKα2 had detectable decreased photopic ERG responses at 3 months of age. This suggested that AMPK α2 is an essential protein in cones.

When comparing the AMPKα2 single knockout to AMPKα1α2 double knockout mice, we found that the onset of cone function reduction was earlier in the double knockouts, we suspect α1 has a potential role to compensate for the loss the α2.

Moreover, in either single knockout model, we did not observe RPE abnormalities by

EM. AMPKα1 may play a role in maintaining the energy homeostasis between photoreceptor and RPE. To further study the role of AMPKα1 and AMPKα2 in the RPE, another project is ongoing in the lab to study them by RPE conditional knockout mouse model.

119

Figure 4-18: AMPKα2 knockout mice have reduced cone photoreceptor function by 3 months of age. Photopic ERG was used to measure cone function of AMPK α1 (d-e) and α2 (a-c) single knockout mice. n=8 per group, experiments were repeated three times. *p<0.05.

120

Cre-loxp System does not Affect Retinal Structure and Function

Our conditional mouse model utilizes the Chx10 Cre system. The retinal homeobox gene is Chx10 expressed in uncommitted progenitor cells and mature bipolar cells in the retina. The progenitor cells will differentiate into rod photoreceptors, cone photoreceptors, bipolar cells, amacrine cells, horizontal cell, ganglion cell, and Müller glia cells. To determine if the reduction in photoreceptor function was due to cre recombinase, we studied chx10 cre mice with heterozygous for the floxed alleles of α1 or α2.

We measured cone photoreceptor function by photopic ERG and flicker ERG.

We did not observe any significant difference in cone photoreceptor function. We conclude the reduction of cone photoreceptor function is not attributable to the cre recombinase.

121

Figure 4-19: Chx10 cre AMPK heterozygous mice do not display cone function reduction by 6 months of age. Photopic ERG and Flicker ERG were used to measure cone function of AMPK α1 f/+(c-d) and α2f/+ (a-b) single knockout mice. n=6 per group. *p<0.05.

122

Discussion

In this study, we found that deletion of AMPKα1 and α2 in the neural retina led to both retinal and RPE degeneration. First, we observed reduced cone photoreceptors function in six weeks old mice, and cone photoreceptor numbers are reduced at three months of age. Rod photoreceptor function also started to decline by 3 months of age.

Thinning of the retinal was significant by eight months of age. Our data suggest that

AMPK signaling plays an important role in maintaining cone and rod photoreceptors survival and function.

Our data suggest that mitochondria are dysregulated in AMPKα knockout mice.

The ratio of mitochondrial DNA relative to nuclear DNA was reduced at six months of age but not two weeks of age. However, we do not have evidence to confirm if mitochondria dysregulation is a cause or consequences of the retinal phenotype, further experiments will carry out to investigate this question.

We didn’t observe any morphological changes in the AMPKα-deficiency mice until eight months of age. However, we did find a reduction in cone function at 6 weeks of age. Electron microcopy of AMPK knockout mice revealed that mitochondrial abnormalities at 4 months of age.

From the functional ERG study, we noticed that cone function declined earlier than rod function. Why are cones been affected first? This led us to think about the basic structure and biology of rod and cone photoreceptors and the difference between them. Compared to rods, cones are bioenergetically more active, and have a higher energy demand and production in order to response and recover quickly to light

123

stimulation (201). It has been shown that photoreceptors utilize glucose to generate

ATP and NADPH (202, 203). Studies have shown that glucose deprivation results in

retinal cell death, and was associated with lower mitochondrial activity and lack of substrates to maintain cellular homeostasis (21). We found decreased expression levels

of glucose transporter GLUT1 in the neural retina. Studies have shown that GLUT1

localization is absent from photoreceptor outer segments, and metabolic substrates are

diffused to the outer segments through connecting cilium (204). A difference in glucose

accessibility has also been reported in primate rod and cone photoreceptors (205).

Glucose deficiency may also contribute to cone photoreceptor cell death in the

PDE6bRd1 RP mouse model (59, 206). In our degenerative model, we hypothesized that

deletion of AMPKα1 and α2 dysregulated the mitochondria in the cones, thus impairing

ATP production, which results in degeneration of cones. However, further cell type

specific experiments are needed to carry out.

RPE function was also measured at 5 and 12 months of age. We found RPE function is diminished by 12 months of age but not at 5 months. The RPE was also

highly vacuolated at 12 months of age. This finding leads us to ask the question “Why

do RPE become sick when AMPKα1 and α2 are deleted only in the neural retina and

not within RPE.” We are currently working to validate AMPK α1 and α2 gene expression

in the RPE. We propose that phagocytosis process is dysregulated in the RPE of the

AMPKα-deficient mice that they are not properly phagocytosing the outer segment.

Alteration in fatty acid metabolism will lead to accumulation of lipids in the

photoreceptors. As the RPE are still phagocytosing the discs, pathological lipids in the

discs could lead to degeneration of RPE. We propose to perform oil red O staining

124

AMPK knockout retinas to examine their lipid metabolic status(207). We will also carry

out the experiments to determine if the phagocytosis process is affected.

Genetic loss of AMPKα in the neural retina leads to both retinal and RPE degeneration. Mitochondrial dysfunction is a contributing factor to this degeneration, as well as alterations in glucose and fatty acid metabolism. Yet, AMPK also interacts with other downstream signaling pathways, which can also mediate metabolic changes, such as autophagy and protein synthesis (Figure 4-19). Further work in necessary to

examine the role of these processes in the retinal phenotyoe observed with AMPKα deficiency.

Figure 4-20: Loss of AMPKα can affect multiple downstream targets.

125

CHAPTER 5 CONCLUSIONS AND FURTHER DIRECTION

In my thesis work, I have demonstrated that activation of the AMPK signaling pathway protects photoreceptor and RPE from cell death in three different retinal degeneration models, including light damage, mutation of PDE6b induced retinitis pigmentosa, and sodium iodate-induced RPE injury. Metformin was used as an activator for the AMPK pathway. We found metformin was able to cross blood-retina barrier, and phosphorylate

AMPK in the retina. In addition, we found that metformin induced-protection required the

AMPKα2 subunit since metformin was not able to protect photoreceptors from light damage in mice with a deletion of AMPKα2 in the retina. This data suggests that metformin-induced protection is mediated primarily through AMPKα2 and not through

AMPKα1. We found that activation of AMPK by metformin led to increased mitochondrial DNA content, reduce oxidative stress, changes in gene expression.

Metformin’s protective effect was not specific to photoreceptors since metformin treatment also prevented sodium iodate-induced RPE damage. This broad-spectrum protection could greatly benefit treatment strategies for a variety of retinal degenerations. Targeting AMPK signaling has the potential to keep photoreceptors and

RPE alive and functional for a longer period for patients suffering from this disease. In the case of inherited retinal disorders, this could allow for a larger window for intervention with a secondary-treatment, such as gene therapy, to correct the mutation in these patients. Since metformin is already widely prescribed to type 2 diabetic patients, we are currently investigating the association between metformin and development or progression of AMD. To further understand the mechanism of metformin-induced neuroprotection, we are collaborating with Dr. Jianhai Du at West

126

Virginia University to study metabolomic regulation in photoreceptors and RPE using

Liquid and Gas chromatography-mass spectrum. This will allow us to have a comprehensive understanding of how activation of AMPK reprograms photoreceptors and RPE to be more resistant to cell injury.

By utilizing the AMPK conditional knockout mice, we found that deletion of

AMPKα1 and α2 in the neural retina led to both retinal structural and functional decline.

This indicated that AMPK signaling plays an important role in maintaining cone and rod photoreceptor survival and function. Interestingly, we found that the reduction in cone function was early onset compared to the decrease in rod photoreceptor function, which hints that cone and rod could have different metabolic flux in the retina. Deletion of

AMPK triggered mitochondrial fragmentation, decreased mitochondrial DNA content, and reduced mitochondria-associated gene expression. It has been shown that each cone contains a double amount of mitochondria compared to the rod photoreceptor.

Also this may be one explanation why cones are affected first. We also found that genes involved in glucose metabolism and fatty acid metabolism were down-regulated.

We demonstrated that the reduction of cone function is likely due to the specific activity of AMPK α2 and not α1 in the neural retina. This suggests that AMPKα2 has a unique role in cone photoreceptors.

To conclude, my dissertation work has demonstrated the role of AMPK in the retina and that regulation of energy metabolism by AMPK is critical for the function and survival of photoreceptors and RPE.

127

LIST OF REFERENCES

1. Masland RH (2001) The fundamental plan of the retina. Nat Neurosci 4(9):877- 886.

2. Kolb H (1995) Simple Anatomy of the Retina. Webvision: The Organization of the Retina and Visual System, eds Kolb H, Fernandez E, & Nelson RSalt Lake City (UT)).

3. Shichida Y & Morizumi T (2007) Mechanism of G-protein activation by rhodopsin. Photochem Photobiol 83(1):70-75.

4. N. HKEaR (Webvision : the organization of the retina and visual system:.

5. Sung CH & Chuang JZ (2010) The cell biology of vision. J Cell Biol 190(6):953- 963.

6. Kolb H (1995) Photoreceptors. Webvision: The Organization of the Retina and Visual System, eds Kolb H, Fernandez E, & Nelson RSalt Lake City (UT)).

7. Welfer D, Scharcanski J, & Marinho DR (2011) Fovea center detection based on the retina anatomy and mathematical morphology. Comput Methods Programs Biomed 104(3):397-409.

8. Jeon CJ, Strettoi E, & Masland RH (1998) The major cell populations of the mouse retina. J Neurosci 18(21):8936-8946.

9. Besharse JC & Pfenninger KH (1980) Membrane assembly in retinal photoreceptors I. Freeze-fracture analysis of cytoplasmic vesicles in relationship to disc assembly. J Cell Biol 87(2 Pt 1):451-463.

10. Young RW (1967) The renewal of photoreceptor cell outer segments. J Cell Biol 33(1):61-72.

11. Nguyen-Legros J & Hicks D (2000) Renewal of photoreceptor outer segments and their phagocytosis by the retinal pigment epithelium. Int Rev Cytol 196:245- 313.

12. LaVail MM (1980) Circadian nature of rod outer segment disc shedding in the rat. Invest Ophthalmol Vis Sci 19(4):407-411.

13. Anderson RE, Maude MB, Kelleher PA, Maida TM, & Basinger SF (1980) Metabolism of phosphatidylcholine in the frog retina. Biochim Biophys Acta 620(2):212-226.

14. Strauss O (2005) The retinal pigment epithelium in visual function. Physiol Rev 85(3):845-881.

128

15. Ebrey T & Koutalos Y (2001) Vertebrate photoreceptors. Prog Retin Eye Res 20(1):49-94.

16. Wong-Riley MT (2010) Energy metabolism of the visual system. Eye Brain 2:99- 116.

17. Graymore C (1959) Metabolism of the developing retina. I. Aerobic and anaerobic glycolysis in the developing rat retina. Br J Ophthalmol 43(1):34-39.

18. Yagi T & Macleish PR (1994) Ionic conductances of monkey solitary cone inner segments. J Neurophysiol 71(2):656-665.

19. Zhang C & Wong-Riley MT (2000) Synthesis and degradation of cytochrome oxidase subunit mRNAs in neurons: differential bigenomic regulation by neuronal activity. J Neurosci Res 60(3):338-344.

20. Okawa H, Sampath AP, Laughlin SB, & Fain GL (2008) ATP consumption by mammalian rod photoreceptors in darkness and in light. Curr Biol 18(24):1917- 1921.

21. Chertov AO, et al. (2011) Roles of glucose in photoreceptor survival. J Biol Chem 286(40):34700-34711.

22. Hurley JB, Lindsay KJ, & Du J (2015) Glucose, lactate, and shuttling of metabolites in vertebrate retinas. J Neurosci Res 93(7):1079-1092.

23. Kooragayala K, et al. (2015) Quantification of Oxygen Consumption in Retina Ex Vivo Demonstrates Limited Reserve Capacity of Photoreceptor Mitochondria. Invest Ophthalmol Vis Sci 56(13):8428-8436.

24. Rueda EM, et al. (2016) The cellular and compartmental profile of mouse retinal glycolysis, tricarboxylic acid cycle, oxidative phosphorylation, and ~P transferring kinases. Mol Vis 22:847-885.

25. Ng SK, et al. (2015) Cancer-like metabolism of the mammalian retina. Clin Exp Ophthalmol 43(4):367-376.

26. Casson RJ, Chidlow G, Han G, & Wood JP (2013) An explanation for the Warburg effect in the adult mammalian retina. Clin Exp Ophthalmol 41(5):517.

27. Saavedra RA, Cordoba C, & Anderson GR (1985) LDHk in the retina of diverse vertebrate species: a possible link to the Warburg effect. Exp Eye Res 41(3):365- 370.

28. Rajala RV, Rajala A, Kooker C, Wang Y, & Anderson RE (2016) The Warburg Effect Mediator Pyruvate Kinase M2 Expression and Regulation in the Retina. Sci Rep 6:37727.

129

29. Winkler BS (1981) Glycolytic and oxidative metabolism in relation to retinal function. J Gen Physiol 77(6):667-692.

30. Zhao FQ & Keating AF (2007) Functional properties and genomics of glucose transporters. Curr Genomics 8(2):113-128.

31. Adler AJ & Southwick RE (1992) Distribution of glucose and lactate in the interphotoreceptor matrix. Ophthalmic Res 24(4):243-252.

32. Morohoshi K, et al. (2012) Identification of anti-retinal antibodies in patients with age-related macular degeneration. Exp Mol Pathol 93(2):193-199.

33. Lowry OH, Roberts NR, Schulz DW, Clow JE, & Clark JR (1961) Quantitative histochemistry of retina. II. Enzymes of glucose metabolism. J Biol Chem 236:2813-2820.

34. Adijanto J, et al. (2014) The retinal pigment epithelium utilizes fatty acids for ketogenesis. J Biol Chem 289(30):20570-20582.

35. Rajala A, et al. (2018) Pyruvate kinase M2 regulates photoreceptor structure, function, and viability. Cell Death Dis 9(2):240.

36. Kanow MA, et al. (2017) Biochemical adaptations of the retina and retinal pigment epithelium support a metabolic ecosystem in the vertebrate eye. Elife 6.

37. Disease GBD, Injury I, & Prevalence C (2016) Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet 388(10053):1545-1602.

38. Hamel C (2006) Retinitis pigmentosa. Orphanet J Rare Dis 1:40.

39. Maubaret C & Hamel C (2005) [Genetics of retinitis pigmentosa: metabolic classification and phenotype/genotype correlations]. J Fr Ophtalmol 28(1):71-92.

40. Hartong DT, Berson EL, & Dryja TP (2006) Retinitis pigmentosa. Lancet 368(9549):1795-1809.

41. Stephen P. Daiger LSS, Sara J. Bowne, (1996) RetNet "Retinal Information Network".

42. den Hollander AI, Roepman R, Koenekoop RK, & Cremers FP (2008) Leber congenital amaurosis: genes, proteins and disease mechanisms. Prog Retin Eye Res 27(4):391-419.

43. Kumaran N, Moore AT, Weleber RG, & Michaelides M (2017) Leber congenital amaurosis/early-onset severe retinal dystrophy: clinical features, molecular genetics and therapeutic interventions. Br J Ophthalmol 101(9):1147-1154.

130

44. Saari JC (2016) Vitamin A and Vision. Subcell Biochem 81:231-259.

45. Maguire AM, et al. (2008) Safety and efficacy of gene transfer for Leber's congenital amaurosis. N Engl J Med 358(21):2240-2248.

46. Ashtari M, et al. (2015) Plasticity of the human visual system after retinal gene therapy in patients with Leber's congenital amaurosis. Sci Transl Med 7(296):296ra110.

47. Bainbridge JW, et al. (2008) Effect of gene therapy on visual function in Leber's congenital amaurosis. N Engl J Med 358(21):2231-2239.

48. Cideciyan AV, et al. (2009) Human RPE65 gene therapy for Leber congenital amaurosis: persistence of early visual improvements and safety at 1 year. Hum Gene Ther 20(9):999-1004.

49. Maguire AM, et al. (2009) Age-dependent effects of RPE65 gene therapy for Leber's congenital amaurosis: a phase 1 dose-escalation trial. Lancet 374(9701):1597-1605.

50. Simonelli F, et al. (2010) Gene therapy for Leber's congenital amaurosis is safe and effective through 1.5 years after vector administration. Mol Ther 18(3):643- 650.

51. Jacobson SG, et al. (2012) Gene therapy for leber congenital amaurosis caused by RPE65 mutations: safety and efficacy in 15 children and adults followed up to 3 years. Arch Ophthalmol 130(1):9-24.

52. Testa F, et al. (2013) Three-year follow-up after unilateral subretinal delivery of adeno-associated virus in patients with Leber congenital Amaurosis type 2. Ophthalmology 120(6):1283-1291.

53. Bennett J, et al. (2012) AAV2 gene therapy readministration in three adults with congenital blindness. Sci Transl Med 4(120):120ra115.

54. Ashtari M, et al. (2011) The human visual cortex responds to gene therapy- mediated recovery of retinal function. J Clin Invest 121(6):2160-2168.

55. Chacon-Camacho OF & Zenteno JC (2017) [Gene therapy for vision restoration in patients with Leber congenital amaurosis (LCA) due to RPE65 gene mutations: beginning the phase IV trial]. Gac Med Mex 153(2):276-278.

56. Punzo C, Xiong W, & Cepko CL (2012) Loss of daylight vision in retinal degeneration: are oxidative stress and metabolic dysregulation to blame? J Biol Chem 287(3):1642-1648.

57. Wang W, et al. (2016) Two-Step Reactivation of Dormant Cones in Retinitis Pigmentosa. Cell Rep 15(2):372-385.

131

58. Zhang L, et al. (2016) Reprogramming metabolism by targeting sirtuin 6 attenuates retinal degeneration. J Clin Invest 126(12):4659-4673.

59. Punzo C, Kornacker K, & Cepko CL (2009) Stimulation of the insulin/mTOR pathway delays cone death in a mouse model of retinitis pigmentosa. Nat Neurosci 12(1):44-52.

60. Venkatesh A, et al. (2015) Activated mTORC1 promotes long-term cone survival in retinitis pigmentosa mice. J Clin Invest 125(4):1446-1458.

61. Foundation B (2018) BrightFocus Foundation.

62. Anonymous (2017) National Eye Institute (NEI).

63. Volland S, Esteve-Rudd J, Hoo J, Yee C, & Williams DS (2015) A comparison of some organizational characteristics of the mouse central retina and the human macula. PLoS One 10(4):e0125631.

64. Ferrington DA, et al. (2016) Increased retinal mtDNA damage in the CFH variant associated with age-related macular degeneration. Exp Eye Res 145:269-277.

65. Grassmann F, et al. (2017) Genetic pleiotropy between age-related macular degeneration and 16 complex diseases and traits. Genome Med 9(1):29.

66. Age-Related Eye Disease Study Research G (2001) A randomized, placebo- controlled, clinical trial of high-dose supplementation with vitamins C and E, beta carotene, and zinc for age-related macular degeneration and vision loss: AREDS report no. 8. Arch Ophthalmol 119(10):1417-1436.

67. Blasiak J, Petrovski G, Vereb Z, Facsko A, & Kaarniranta K (2014) Oxidative stress, hypoxia, and autophagy in the neovascular processes of age-related macular degeneration. Biomed Res Int 2014:768026.

68. Ferrington DA, et al. (2017) Altered bioenergetics and enhanced resistance to oxidative stress in human retinal pigment epithelial cells from donors with age- related macular degeneration. Redox Biol 13:255-265.

69. Fritsche LG, et al. (2014) Age-related macular degeneration: genetics and biology coming together. Annu Rev Genomics Hum Genet 15:151-171.

70. Ambati J, Atkinson JP, & Gelfand BD (2013) Immunology of age-related macular degeneration. Nat Rev Immunol 13(6):438-451.

71. Abd AJ, Kanwar RK, & Kanwar JR (2017) Aged macular degeneration: current therapeutics for management and promising new drug candidates. Drug Discov Today.

132

72. Terluk MR, et al. (2015) Investigating mitochondria as a target for treating age- related macular degeneration. J Neurosci 35(18):7304-7311.

73. Golestaneh N, et al. (2016) Repressed SIRT1/PGC-1alpha pathway and mitochondrial disintegration in iPSC-derived RPE disease model of age-related macular degeneration. J Transl Med 14(1):344.

74. Kurihara T, et al. (2016) Hypoxia-induced metabolic stress in retinal pigment epithelial cells is sufficient to induce photoreceptor degeneration. Elife 5.

75. Zhao C, et al. (2011) mTOR-mediated dedifferentiation of the retinal pigment epithelium initiates photoreceptor degeneration in mice. J Clin Invest 121(1):369- 383.

76. Beg ZH, Allmann DW, & Gibson DM (1973) Modulation of 3-hydroxy-3- methylglutaryl coenzyme A reductase activity with cAMP and wth protein fractions of rat liver cytosol. Biochem Biophys Res Commun 54(4):1362-1369.

77. Carlson CA & Kim KH (1973) Regulation of hepatic acetyl coenzyme A carboxylase by phosphorylation and dephosphorylation. J Biol Chem 248(1):378- 380.

78. Carlson CA & Kim KH (1974) Regulation of hepatic acetyl coenzyme A carboxylase by phosphorylation and dephosphorylation. Arch Biochem Biophys 164(2):478-489.

79. Munday MR, Campbell DG, Carling D, & Hardie DG (1988) Identification by amino acid sequencing of three major regulatory phosphorylation sites on rat acetyl-CoA carboxylase. Eur J Biochem 175(2):331-338.

80. Carling D, Clarke PR, Zammit VA, & Hardie DG (1989) Purification and characterization of the AMP-activated protein kinase. Copurification of acetyl- CoA carboxylase kinase and 3-hydroxy-3-methylglutaryl-CoA reductase kinase activities. Eur J Biochem 186(1-2):129-136.

81. Davies SP, et al. (1994) Purification of the AMP-activated protein kinase on ATP- gamma-sepharose and analysis of its subunit structure. Eur J Biochem 223(2):351-357.

82. Mitchelhill KI, et al. (1994) Mammalian AMP-activated protein kinase shares structural and functional homology with the catalytic domain of yeast Snf1 protein kinase. J Biol Chem 269(4):2361-2364.

83. Xu L & Ash JD (2016) The Role of AMPK Pathway in Neuroprotection. Adv Exp Med Biol 854:425-430.

84. Viollet B, et al. (2009) AMPK: Lessons from transgenic and knockout animals. Front Biosci (Landmark Ed) 14:19-44.

133

85. Jager S, Handschin C, St-Pierre J, & Spiegelman BM (2007) AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proceedings of the National Academy of Sciences of the United States of America 104(29):12017-12022.

86. Viollet B, et al. (2006) Activation of AMP-activated protein kinase in the liver: a new strategy for the management of metabolic hepatic disorders. The Journal of physiology 574(Pt 1):41-53.

87. Fu X, et al. (2013) AMP-activated protein kinase alpha1 but not alpha2 catalytic subunit potentiates myogenin expression and myogenesis. Mol Cell Biol 33(22):4517-4525.

88. Qin S & De Vries GW (2008) alpha2 But not alpha1 AMP-activated protein kinase mediates oxidative stress-induced inhibition of retinal pigment epithelium cell phagocytosis of photoreceptor outer segments. The Journal of biological chemistry 283(11):6744-6751.

89. Qin S & Rodrigues GA (2010) Differential roles of AMPKalpha1 and AMPKalpha2 in regulating 4-HNE-induced RPE cell death and permeability. Experimental eye research 91(6):818-824.

90. Samuel MA, et al. (2014) LKB1 and AMPK regulate synaptic remodeling in old age. Nat Neurosci 17(9):1190-1197.

91. Hardie DG, Ross FA, & Hawley SA (2012) AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nature reviews. Molecular cell biology 13(4):251-262.

92. Herrero-Martin G, et al. (2009) TAK1 activates AMPK-dependent cytoprotective autophagy in TRAIL-treated epithelial cells. The EMBO journal 28(6):677-685.

93. Barot M, Gokulgandhi MR, & Mitra AK (2011) Mitochondrial dysfunction in retinal diseases. Current eye research 36(12):1069-1077.

94. Lee S, et al. (2011) Mitochondrial dysfunction in glaucoma and emerging bioenergetic therapies. Experimental eye research 93(2):204-212.

95. Wu SB, Wu YT, Wu TP, & Wei YH (2014) Role of AMPK-mediated adaptive responses in human cells with mitochondrial dysfunction to oxidative stress. Biochimica et biophysica acta 1840(4):1331-1344.

96. Lin J, Handschin C, & Spiegelman BM (2005) Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab 1(6):361-370.

97. Santos JM, Tewari S, Goldberg AF, & Kowluru RA (2011) Mitochondrial biogenesis and the development of diabetic retinopathy. Free radical biology & medicine 51(10):1849-1860.

134

98. O'Neill HM, et al. (2011) AMP-activated protein kinase (AMPK) beta1beta2 muscle null mice reveal an essential role for AMPK in maintaining mitochondrial content and glucose uptake during exercise. Proceedings of the National Academy of Sciences of the United States of America 108(38):16092-16097.

99. El-Mir MY, et al. (2008) Neuroprotective role of antidiabetic drug metformin against apoptotic cell death in primary cortical neurons. Journal of molecular neuroscience : MN 34(1):77-87.

100. Hyttinen JM, Petrovski G, Salminen A, & Kaarniranta K (2011) 5'-Adenosine monophosphate-activated protein kinase--mammalian target of rapamycin axis as therapeutic target for age-related macular degeneration. Rejuvenation research 14(6):651-660.

101. Inoki K, Kim J, & Guan KL (2012) AMPK and mTOR in cellular energy homeostasis and drug targets. Annual review of pharmacology and toxicology 52:381-400.

102. Kim J, Kundu M, Viollet B, & Guan KL (2011) AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nature cell biology 13(2):132- 141.

103. Jiang T, et al. (2014) Acute metformin preconditioning confers neuroprotection against focal cerebral ischaemia by pre-activation of AMPK-dependent autophagy. British journal of pharmacology 171(13):3146-3157.

104. Jiang T, et al. (2014) Ischemic Preconditioning Provides Neuroprotection by Induction of AMP-Activated Protein Kinase-Dependent Autophagy in a Rat Model of Ischemic Stroke. Molecular neurobiology.

105. Kaarniranta K, Kauppinen A, Blasiak J, & Salminen A (2012) Autophagy regulating kinases as potential therapeutic targets for age-related macular degeneration. Future medicinal chemistry 4(17):2153-2161.

106. Bove J, Martinez-Vicente M, & Vila M (2011) Fighting neurodegeneration with rapamycin: mechanistic insights. Nature reviews. Neuroscience 12(8):437-452.

107. Ai D, et al. (2014) Disruption of mammalian target of rapamycin complex 1 in macrophages decreases chemokine gene expression and atherosclerosis. Circulation research 114(10):1576-1584.

108. O'Neill LA & Hardie DG (2013) Metabolism of inflammation limited by AMPK and pseudo-starvation. Nature 493(7432):346-355.

109. Kamoshita M, et al. (2014) AMPK-NF-kappaB Axis in the Photoreceptor Disorder during Retinal Inflammation. PloS one 9(7):e103013.

135

110. Kubota S, et al. (2011) Roles of AMP-activated protein kinase in diabetes- induced retinal inflammation. Investigative ophthalmology & visual science 52(12):9142-9148.

111. Nagai N, Kubota S, Tsubota K, & Ozawa Y (2014) Resveratrol prevents the development of choroidal neovascularization by modulating AMP-activated protein kinase in macrophages and other cell types. The Journal of nutritional biochemistry.

112. Wrobel MP, et al. (2017) Metformin - a new old drug. Endokrynol Pol 68(4):482- 496.

113. Petrcic J & Kalogjera Z (1982) [Bestimmung des Galegins und die antidiabetische Wirkung der Droge Herba Galegae]. Planta Med 45(3):140.

114. Mahmood K, Naeem M, & Rahimnajjad NA (2013) Metformin: the hidden chronicles of a magic drug. Eur J Intern Med 24(1):20-26.

115. Wang C, et al. (2016) Metformin preconditioning provide neuroprotection through enhancement of autophagy and suppression of inflammation and apoptosis after spinal cord injury. Biochem Biophys Res Commun 477(4):534-540.

116. Xu T, et al. (2015) Effects of metformin on metabolite profiles and LDL cholesterol in patients with type 2 diabetes. Diabetes Care 38(10):1858-1867.

117. Hervas D, et al. (2017) Metformin intake associates with better cognitive function in patients with Huntington's disease. PLoS One 12(6):e0179283.

118. Biemans E, et al. (2015) Cobalamin status and its relation with depression, cognition and neuropathy in patients with type 2 diabetes mellitus using metformin. Acta Diabetol 52(2):383-393.

119. Ng TP, et al. (2014) Long-term metformin usage and cognitive function among older adults with diabetes. J Alzheimers Dis 41(1):61-68.

120. Goldberg RB, et al. (2017) Effect of Long-Term Metformin and Lifestyle in the Diabetes Prevention Program and Its Outcome Study on Coronary Artery Calcium. Circulation 136(1):52-64.

121. Varga TV, et al. (2016) Comprehensive Analysis of Established Dyslipidemia- Associated Loci in the Diabetes Prevention Program. Circ Cardiovasc Genet 9(6):495-503.

122. Aroda VR, et al. (2016) Long-term Metformin Use and Vitamin B12 Deficiency in the Diabetes Prevention Program Outcomes Study. J Clin Endocrinol Metab 101(4):1754-1761.

136

123. Graham GG, et al. (2011) Clinical pharmacokinetics of metformin. Clin Pharmacokinet 50(2):81-98.

124. Gong L, Goswami S, Giacomini KM, Altman RB, & Klein TE (2012) Metformin pathways: pharmacokinetics and pharmacodynamics. Pharmacogenet Genomics 22(11):820-827.

125. Hsu WH, et al. (2018) Effect of metformin on kidney function in patients with type 2 diabetes mellitus and moderate chronic kidney disease. Oncotarget 9(4):5416- 5423.

126. Robergs RA, Ghiasvand F, & Parker D (2004) Biochemistry of exercise-induced metabolic acidosis. Am J Physiol Regul Integr Comp Physiol 287(3):R502-516.

127. McCreight LJ, Bailey CJ, & Pearson ER (2016) Metformin and the gastrointestinal tract. Diabetologia 59(3):426-435.

128. Greco P, et al. (2016) [Metformin-associated lactic acidosis and acute kidney injury]. G Ital Nefrol 33(6).

129. Anonymous (1998) Effect of intensive blood-glucose control with metformin on complications in overweight patients with type 2 diabetes (UKPDS 34). UK Prospective Diabetes Study (UKPDS) Group. Lancet 352(9131):854-865.

130. Cheng SC, et al. (2014) mTOR- and HIF-1alpha-mediated aerobic glycolysis as metabolic basis for trained immunity. Science 345(6204):1250684.

131. Owen MR, Doran E, & Halestrap AP (2000) Evidence that metformin exerts its anti-diabetic effects through inhibition of complex 1 of the mitochondrial respiratory chain. Biochem J 348 Pt 3:607-614.

132. El-Mir MY, et al. (2000) Dimethylbiguanide inhibits cell respiration via an indirect effect targeted on the respiratory chain complex I. J Biol Chem 275(1):223-228.

133. Bridges HR, Jones AJ, Pollak MN, & Hirst J (2014) Effects of metformin and other biguanides on oxidative phosphorylation in mitochondria. Biochem J 462(3):475-487.

134. Hawley SA, et al. (2010) Use of cells expressing gamma subunit variants to identify diverse mechanisms of AMPK activation. Cell Metab 11(6):554-565.

135. Zhang CS, et al. (2016) Metformin Activates AMPK through the Lysosomal Pathway. Cell Metab 24(4):521-522.

136. Chen J, et al. (2017) Metformin extends C. elegans lifespan through lysosomal pathway. Elife 6.

137

137. Zhang YL, et al. (2013) AMP as a low-energy charge signal autonomously initiates assembly of AXIN-AMPK-LKB1 complex for AMPK activation. Cell Metab 18(4):546-555.

138. Cabreiro F, et al. (2013) Metformin retards aging in C. elegans by altering microbial folate and methionine metabolism. Cell 153(1):228-239.

139. Anisimov VN, et al. (2008) Metformin slows down aging and extends life span of female SHR mice. Cell Cycle 7(17):2769-2773.

140. De Haes W, et al. (2014) Metformin promotes lifespan through mitohormesis via the peroxiredoxin PRDX-2. Proc Natl Acad Sci U S A 111(24):E2501-2509.

141. Martin-Montalvo A, et al. (2013) Metformin improves healthspan and lifespan in mice. Nat Commun 4:2192.

142. Slack C, Foley A, & Partridge L (2012) Activation of AMPK by the putative dietary restriction mimetic metformin is insufficient to extend lifespan in Drosophila. PLoS One 7(10):e47699.

143. Lin HC, et al. (2015) Association of Geroprotective Effects of Metformin and Risk of Open-Angle Glaucoma in Persons With Diabetes Mellitus. JAMA Ophthalmol 133(8):915-923.

144. Anisimov VN, et al. (2010) Metformin extends life span of HER-2/neu transgenic mice and in combination with melatonin inhibits growth of transplantable tumors in vivo. Cell Cycle 9(1):188-197.

145. Anisimov VN, et al. (2011) If started early in life, metformin treatment increases life span and postpones tumors in female SHR mice. Aging (Albany NY) 3(2):148-157.

146. Tseng CH (2017) Metformin is associated with a lower risk of colorectal cancer in Taiwanese patients with type 2 diabetes: A retrospective cohort analysis. Diabetes Metab 43(5):438-445.

147. Lee MS, et al. (2011) Type 2 diabetes increases and metformin reduces total, colorectal, liver and pancreatic cancer incidences in Taiwanese: a representative population prospective cohort study of 800,000 individuals. BMC Cancer 11:20.

148. Kumar S, et al. (2013) Metformin intake is associated with better survival in ovarian cancer: a case-control study. Cancer 119(3):555-562.

149. Chang B, et al. (2007) Two mouse retinal degenerations caused by missense mutations in the beta-subunit of rod cGMP phosphodiesterase gene. Vision Res 47(5):624-633.

138

150. Mattapallil MJ, et al. (2012) The Rd8 mutation of the Crb1 gene is present in vendor lines of C57BL/6N mice and embryonic stem cells, and confounds ocular induced mutant phenotypes. Invest Ophthalmol Vis Sci 53(6):2921-2927.

151. Wenzel A, Reme CE, Williams TP, Hafezi F, & Grimm C (2001) The Rpe65 Leu450Met variation increases retinal resistance against light-induced degeneration by slowing rhodopsin regeneration. J Neurosci 21(1):53-58.

152. Ferda Percin E, et al. (2000) Human microphthalmia associated with mutations in the retinal homeobox gene CHX10. Nat Genet 25(4):397-401.

153. Rowan S & Cepko CL (2004) Genetic analysis of the homeodomain transcription factor Chx10 in the retina using a novel multifunctional BAC transgenic mouse reporter. Dev Biol 271(2):388-402.

154. Geeraets WJ & Ridgeway D (1963) Retinal Damage from High Intensity Light. Acta Ophthalmol Suppl:SUPPL76:109-112.

155. Liu A & Coleman SP (2009) Determination of metformin in human plasma using hydrophilic interaction liquid chromatography-tandem mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 877(29):3695-3700.

156. Chang B, et al. (2002) Retinal degeneration mutants in the mouse. Vision Res 42(4):517-525.

157. Abd AJ, Kanwar RK, & Kanwar JR (2017) Age-related macular degeneration: current therapeutics for management and promising new drug candidates. Drug Discov Today.

158. Ugurlu N, Asik MD, Yulek F, Neselioglu S, & Cagil N (2013) Oxidative stress and anti-oxidative defence in patients with age-related macular degeneration. Curr Eye Res 38(4):497-502.

159. Kannan R & Hinton DR (2014) Sodium iodate induced retinal degeneration: new insights from an old model. Neural Regen Res 9(23):2044-2045.

160. Hanus J, Anderson C, Sarraf D, Ma J, & Wang S (2016) Retinal pigment epithelial cell necroptosis in response to sodium iodate. Cell Death Discov 2:16054.

161. Basinger S, Hoffman R, & Matthes M (1976) Photoreceptor shedding is initiated by light in the frog retina. Science 194(4269):1074-1076.

162. LaVail MM (1976) Rod outer segment disk shedding in rat retina: relationship to cyclic lighting. Science 194(4269):1071-1074.

163. Mihaylova MM & Shaw RJ (2011) The AMPK signalling pathway coordinates cell growth, autophagy and metabolism. Nat Cell Biol 13(9):1016-1023.

139

164. Ashabi G, Khodagholi F, Khalaj L, Goudarzvand M, & Nasiri M (2014) Activation of AMP-activated protein kinase by metformin protects against global cerebral ischemia in male rats: interference of AMPK/PGC-1alpha pathway. Metab Brain Dis 29(1):47-58.

165. Jones AW, Yao Z, Vicencio JM, Karkucinska-Wieckowska A, & Szabadkai G (2012) PGC-1 family coactivators and cell fate: roles in cancer, neurodegeneration, cardiovascular disease and retrograde mitochondria-nucleus signalling. Mitochondrion 12(1):86-99.

166. Scarpulla RC (2011) Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network. Biochim Biophys Acta 1813(7):1269-1278.

167. Zhou G, et al. (2001) Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest 108(8):1167-1174.

168. Meng S, et al. (2015) Metformin activates AMP-activated protein kinase by promoting formation of the alphabetagamma heterotrimeric complex. J Biol Chem 290(6):3793-3802.

169. Ge XH, et al. (2017) Metformin protects the brain against ischemia/reperfusion injury through PI3K/Akt1/JNK3 signaling pathways in rats. Physiol Behav 170:115-123.

170. Griffin SJ, Leaver JK, & Irving GJ (2017) Impact of metformin on cardiovascular disease: a meta-analysis of randomised trials among people with type 2 diabetes. Diabetologia.

171. Nesti L & Natali A (2017) Metformin effects on the heart and the cardiovascular system: A review of experimental and clinical data. Nutr Metab Cardiovasc Dis 27(8):657-669.

172. Elsaid O, Taylor B, Zaleski A, Panza G, & Thompson PD (2017) Rationale for investigating metformin as a protectant against statin-associated muscle symptoms. J Clin Lipidol.

173. Chollangi S, Wang J, Martin A, Quinn J, & Ash JD (2009) Preconditioning- induced protection from oxidative injury is mediated by leukemia inhibitory factor receptor (LIFR) and its ligands in the retina. Neurobiol Dis 34(3):535-544.

174. Wilcock C, Wyre ND, & Bailey CJ (1991) Subcellular distribution of metformin in rat liver. J Pharm Pharmacol 43(6):442-444.

175. Labuzek K, et al. (2010) Quantification of metformin by the HPLC method in brain regions, cerebrospinal fluid and plasma of rats treated with lipopolysaccharide. Pharmacol Rep 62(5):956-965.

140

176. Rena G, Hardie DG, & Pearson ER (2017) The mechanisms of action of metformin. Diabetologia.

177. Izzo A, et al. (2017) Metformin restores the mitochondrial network and reverses mitochondrial dysfunction in Down syndrome cells. Hum Mol Genet 26(6):1056- 1069.

178. Villena JA (2015) New insights into PGC-1 coactivators: redefining their role in the regulation of mitochondrial function and beyond. FEBS J 282(4):647-672.

179. Zolezzi JM, et al. (2017) PPARs in the central nervous system: roles in neurodegeneration and neuroinflammation. Biol Rev Camb Philos Soc.

180. Miglio G, et al. (2009) PPARgamma stimulation promotes mitochondrial biogenesis and prevents glucose deprivation-induced neuronal cell loss. Neurochem Int 55(7):496-504.

181. Fan W & Evans R (2015) PPARs and ERRs: molecular mediators of mitochondrial metabolism. Curr Opin Cell Biol 33:49-54.

182. Hardie DG (2011) AMP-activated protein kinase: an energy sensor that regulates all aspects of cell function. Genes Dev 25(18):1895-1908.

183. Malek G & Lad EM (2014) Emerging roles for nuclear receptors in the pathogenesis of age-related macular degeneration. Cell Mol Life Sci 71(23):4617-4636.

184. Malek G (2014) Nuclear receptors as potential therapeutic targets for age-related macular degeneration. Adv Exp Med Biol 801:317-321.

185. Choudhary M, et al. (2016) PPARbeta/delta selectively regulates phenotypic features of age-related macular degeneration. Aging (Albany NY) 8(9):1952- 1978.

186. Sun MH, et al. (2007) Photoreceptor protection against light damage by AAV- mediated overexpression of heme oxygenase-1. Invest Ophthalmol Vis Sci 48(12):5699-5707.

187. Biswal MR, et al. (2017) Timing of Antioxidant Gene Therapy: Implications for Treating Dry AMD. Invest Ophthalmol Vis Sci 58(2):1237-1245.

188. Leveillard T, et al. (2004) Identification and characterization of rod-derived cone viability factor. Nat Genet 36(7):755-759.

189. Ait-Ali N, et al. (2015) Rod-derived cone viability factor promotes cone survival by stimulating aerobic glycolysis. Cell 161(4):817-832.

141

190. Byrne LC, et al. (2015) Viral-mediated RdCVF and RdCVFL expression protects cone and rod photoreceptors in retinal degeneration. J Clin Invest 125(1):105- 116.

191. Athanasiou D, et al. (2017) Rescue of mutant rhodopsin traffic by metformin- induced AMPK activation accelerates photoreceptor degeneration. Hum Mol Genet.

192. Lin H, et al. (2011) Mitochondrial DNA damage and repair in RPE associated with aging and age-related macular degeneration. Invest Ophthalmol Vis Sci 52(6):3521-3529.

193. Barzilai N, Crandall JP, Kritchevsky SB, & Espeland MA (2016) Metformin as a Tool to Target Aging. Cell Metab 23(6):1060-1065.

194. Anonymous (2015 interview survery) American Foundation for the blindness.

195. Anonymous (World Health Organization (WHO).

196. Stephen P. Daiger P, Professor , Lori S. Sullivan P, Faculty Associate , & Sara J. Bowne P, Research Scientist (2018) RetNet, the Retinal Information Network.

197. Ma S, et al. (2015) Loss of mTOR signaling affects cone function, cone structure and expression of cone specific proteins without affecting cone survival. Exp Eye Res 135:1-13.

198. Lamb TD, Patel HR, Chuah A, & Hunt DM (2018) Evolution of the shut-off steps of vertebrate phototransduction. Open Biol 8(1).

199. Deming JD, et al. (2015) Arrestin 1 and Cone Arrestin 4 Have Unique Roles in Visual Function in an All-Cone Mouse Retina. Invest Ophthalmol Vis Sci 56(13):7618-7628.

200. Lamb TD (2013) Evolution of phototransduction, vertebrate photoreceptors and retina. Prog Retin Eye Res 36:52-119.

201. Perkins GA, Ellisman MH, & Fox DA (2003) Three-dimensional analysis of mouse rod and cone mitochondrial cristae architecture: bioenergetic and functional implications. Mol Vis 9:60-73.

202. Hsu SC & Molday RS (1994) Glucose metabolism in photoreceptor outer segments. Its role in phototransduction and in NADPH-requiring reactions. J Biol Chem 269(27):17954-17959.

203. Narayan DS, Chidlow G, Wood JP, & Casson RJ (2017) Glucose metabolism in mammalian photoreceptor inner and outer segments. Clin Exp Ophthalmol.

142

204. Gospe SM, 3rd, Baker SA, & Arshavsky VY (2010) Facilitative glucose transporter Glut1 is actively excluded from rod outer segments. J Cell Sci 123(Pt 21):3639-3644.

205. Nihira M, Anderson K, Gorin FA, & Burns MS (1995) Primate rod and cone photoreceptors may differ in glucose accessibility. Invest Ophthalmol Vis Sci 36(7):1259-1270.

206. Bovolenta P & Cisneros E (2009) Retinitis pigmentosa: cone photoreceptors starving to death. Nat Neurosci 12(1):5-6.

207. Mehlem A, Hagberg CE, Muhl L, Eriksson U, & Falkevall A (2013) Imaging of neutral lipids by oil red O for analyzing the metabolic status in health and disease. Nat Protoc 8(6):1149-1154.

143

BIOGRAPHICAL SKETCH

Lei Xu was born and grown up in China. She attended Dalian Medical University

and majored in Clinical Medicine from 2003-2008. She joined the master program at

Dalian Medical University. After the first semester, she received this “life-changing”

opportunity to finish her thesis project at Dean McGee Eye Institute at University of

Oklahoma Health and Science Center where she met Dr. John Ash and started her

avenue in vision research. She graduated and received her Master of Science degree in

2011 from Dalian Medical University.

Continuing the path, Lei applied and was accepted to the graduate school at the

University of Florida in the Interdisciplinary Program for Biomedical Sciences under the

mentorship of Dr. John D. Ash in 2012. She received her doctoral degree from

University of Florida in the spring of 2018. She feels lucky for the mentorship and

guidance she received from her mentor Dr. John Ash and committee members Drs.

Shannon Boye, Alfred Lewin and Christiaan Leeuwenburgh. She hopes to make them

proud in her future endeavors.

144