Hybrid Sterility and Segregation Distortion in Drosophila Pseudoobscura and Drosophila Persimilis

Hybrid Sterility and Segregation Distortion in Drosophila pseudoobscura and Drosophila persimilis

Shannon Rose McDermott

University Program in Genetics and Genomics Duke University

Date:______Approved:

______Mohamed Noor, Supervisor

______Beth Sullivan

______John Willis

______Amy Bejsovec

Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program of Genetics and Genomics in the Graduate School of Duke University

2012

ABSTRACT

Hybrid Sterility and Segregation Distortion in Drosophila Pseudoobscura and Drosophila Persimilis

Shannon Rose McDermott

University Program in Genetics and Genomics Duke University

Date:______Approved:

______Mohamed Noor, Supervisor

______Beth Sullivan

______John Willis

______Amy Bejsovec

An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program in Genetics and Genomics in the Graduate School of Duke University

2012

Abstract

Speciation has occurred countless times throughout history, and yet the genetic mechanisms that lead to speciation are still missing pieces. Here, we describe the genetics of two processes that can act alone or together to cause speciation: hybrid sterility and meiotic drive.

We use the Drosophila pseudoobscura /D, persimilis species as a model system to study these processes. We expanded on a prior study and saw little variation in strength of previously known hybrid sterility alleles between distinct strains of D. persimilis and the Bogota subspecies of D. pseudoobscura . Introgression of an autosomal, noninverted hybrid sterility allele from the USA subspecies of D. pseudoobscura into D. persimilis demonstrated that the D. pseudoobscura copy of a

D. persimilis hybrid sterility factor also causes hybrid male sterility in a D. pseudoobscura bogotana background. This allelism suggests that the introgressed allele is ancestral, but was lost in the

Bogota lineage, or that gene flow between D. pseudoobscura USA and D. persimilis moved the sterility-conferring allele from D. persimilis into D. pseudoobscura . To further understand the genetic basis of speciation, we asked if meiotic drive in D. persimilis is associated with hybrid sterility seen in D. persimilis /D. pseudoobscura hybrids. QTL mapping of both traits along the right arm of the X chromosome, where both drive and hybrid sterility loci are found, suggest that some of the causal loci overlap and may be allelic.

Contents

Abstract ...... iv

List of Tables ...... viii

List of Figures ...... ix

Acknowledgements ...... x

1. The role of meiotic drive in hybrid male sterility ...... 1

1.1 Introduction ...... 1

1.2 Forms of meiotic drive and how they may (or may not) contribute to hybrid sterility ...... 2

1.3 Recent empirical studies linking meiotic drive and speciation ...... 7

1.4 Population genetics of drive and speciation ...... 12

1.5 Concluding Remarks ...... 15

2. Genetics of hybrid male sterility among strains and species in the Drosophila pseudoobscura species group ...... 16

2.1 Introduction ...... 16

2.2 Methods ...... 19

2.2.1 Fly Stocks ...... 19

2.2.2 Fly Crosses ...... 19

2.2.3 Fertility Assays ...... 20

2.2.4 Microsatellite Genotyping ...... 21

2.2.5 Data Analysis ...... 22

2.3 Results ...... 22

2.3.1 Variation among strains in effect of inverted regions on hybrid sterility ...... 22

2.3.2 Variation among strains in hybrid sterility effect of collinear regions ...... 26

2.3.3 Allelism in collinear regions of D. pseudoobscura USA and D. persimilis ...... 28

2.4 Discussion ...... 30

2.4.1 Variation in hybrid incompatibilities within species ...... 31

2.4.2 Allelism in hybrid incompatibilities between species ...... 32

3. Association of within-species segregation distortion in D. persimilis with hybrid sterility between D. persimilis and D. pseudoobscura ...... 36

3.1 Introduction ...... 36

3.1.1 Sex chromosome segregation distortion, genetic conflict, and speciation ...... 36

3.1.2 Drosophila persimilis "sex-ratio" and hybrid sterility alleles on the X chromosome ...... 38

3.2 Materials and Methods ...... 41

3.2.1 Fly stocks ...... 41

3.2.2 Fly crosses ...... 41

3.2.3 Fertility assays ...... 43

3.2.4 Microsatellite genotyping ...... 44

3.2.5 Data Analysis ...... 44

3.3 Results ...... 45

3.3.1 Characterization of D. persimilis SR ...... 45

3.3.2 Preliminary test of linkage between hybrid sterility and segregation distortion ...... 46

3.3.3 QTL mapping hybrid male sterility between SR D. persimilis SCI and D. pseudoobscura white ...... 47

3.3.4 QTL Mapping segregation distortion in SR D. persimilis ...... 48

3.4 Discussion ...... 50

3.4.1 Linkage of hybrid sterility and segregation distortion factors ...... 50

3.4.2 QTL Mapping ...... 51

3.4.3 Characterization of segregation distortion in D. persimilis ...... 52

4. Summary ...... 54

Appendix A...... 57

Appendix B ...... 58

Appendix C ...... 59

References ...... 60

Biography ...... 79

vii

List of Tables

Table 1: Variation in percent fertility between lines of D. pseudoobscura bogotana at each inversion genotype...... 24

Table 2: Variation in percent fertility between lines of D. persimilis at the inversions...... 25

Table 3: Variation in percent fertility between lines of D. persimilis at the collinear QTLs...... 27

viii

List of Figures

Figure 1: Backcross Design...... 20

Figure 2: Percent fertility of individuals with a D. pseudoobscura USA copy of QTL 2. .. . 29

Figure 3: Orientation of inversions and location of markers along XR...... 40

Figure 4: Crossing scheme to map sterility and segregation distortion on the X chromosome...... 42

Figure 5: QTL map along XR of hybrid sterility between SR D. persimilis SCI and D. pseudoobscura white ...... 48

Figure 6: QTL map of segregation distortion on the D. persimilis SCI XR...... 49

Acknowledgements

First and foremost, I thank the current and previous members of the Noor lab, for their extensive support and assistance. Throughout my time at Duke, the help of our technical staff (Samantha Roth, Callie Barnwell, Sarah Bennett, Allie Graham, Jennifer

Merrill, and Brenda Manzano-Winkler) has been invaluable. I also appreciate the help of

Steve Schaeffer at Penn State for performing the salivary chromosome preparation to confirm presence of the SR inversion.

I am grateful to the many people who have read, edited, and critiqued my writing over the years, including Dan Barbash, Norman Johnson, Richard Kliman, and members of UPGG and Biology.

While at Duke, I received awards from UPGG (Marcy Speer Memorial

Fellowship), Biology (Biology Department Fellowship), and the Graduate School (Dean’s

Award for Excellence in Teaching). I truly appreciate the accolades, and am grateful for their generous financial support.

I thank members of UPGG, Biology, and my committee: John Willis, Beth

Sullivan, and Amy Bejsovec, for support, advice, and feedback throughout my dissertation. My advisor, Mohamed Noor, is the best advisor a student could ask for; I appreciate him more than I can say in words. Thank you for everything, Mohamed.

1. The role of meiotic drive in hybrid male sterility

Meiotic drive causes the distortion of allelic segregation away from Mendelian expected ratios, often also reducing fecundity and favoring the evolution of drive suppressors. If different species evolve distinct drive-suppressor systems, then hybrid progeny may be sterile as a result of negative interactions of these systems' components. Although the hypothesis that meiotic drive may contribute to hybrid sterility, and thus species formation, fell out of favor early in the

1990s, recent results showing an association between drive and sterility have resurrected this previously controversial idea. Here, we review the different forms of meiotic drive and their possible roles in speciation. We discuss the recent empirical evidence for a link between drive and hybrid male sterility, also suggesting a possible mechanistic explanation for this link in the context of chromatin remodeling. Finally, we revisit the population genetics of drive that allow it to contribute to speciation.

1.1 Introduction

Species formation occurs when gene exchange between two populations has mostly or completely stopped. Gene exchange may be prevented by extrinsic factors, such as geographic isolation, but such extrinsic factors may say little or nothing about the genetic divergence that allows species to coexist without losing their identity. Instead, most studies of "speciation" focus on intrinsic genetic differences between populations that limit gene exchange. Typical examples of such differences are behavioral mating discrimination and hybrid sterility.

Hybrid sterility and other hybrid incompatibilities have been a focus of genetic studies of speciation. Part of this intensive focus comes from their association with one of the most consistently followed patterns in evolutionary biology: Haldane's Rule. This rule states that the 1

heterogametic (XY or ZW) sex is more likely than its counterpart to exhibit F 1 hybrid inviability or sterility (Haldane 1922). Studies mapping the genetic basis of F 1 hybrid male sterility have identified a major cause being interactions between genes on the sex chromosomes and autosomes, and a few of the interacting genes have been cloned in the last few years (see reviews in Noor and Feder 2006; Orr et al. 2007; Presgraves 2007).

Despite this progress in mapping the genes and their interactions, researchers have not yet determined whether particular evolutionary or genetic forces disproportionately lead to the evolution of hybrid sterility. Some of the cloned genes associated with hybrid sterility exhibit a strong signature indicating recent natural selection (Ting et al. 1998) while others do not exhibit this pattern (Masly et al. 2006; Phadnis and Orr 2009). One hypothesis for a force contributing to hybrid male sterility is meiotic drive, the subject of this review. Most studies of meiotic drive and its association with hybrid male sterility have been performed in Drosophila, which potentially limits the scope of the research covered in this review. Such an association has been postulated in other systems, but in those cases, meiotic drive could not be distinguished from other genotype frequency distortions in hybrids (e.g., inviability of particular hybrid genotypes) or was not linked to mapped hybrid sterility QTLs (e.g., Mimulus: see Fishman and Willis (2005)). The lack of studies of meiotic drive involved in hybrid sterility in other systems presents a large gap in this field that future studies are encouraged to address.

1.2 Forms of meiotic drive and how they may (or may not) contribute to hybrid sterility

The term “meiotic drive” can be used in a variety of contexts (described below), though it is generally defined as a distortion of segregation away from Mendelian ratios of allelic

inheritance in heterozygotes (Presgraves 2008). Meiotic drive is characterized by the differential formation or success of gametes, and this meiotic or gametic failure may reduce overall fertility.

Usually, homologous chromosomes segregate equally (one homologue to each gamete); however, alleles or chromosomes containing a “drive element” will be transmitted to more than 50% of offspring, at the expense of their homologue. Despite the reduction in fertility of the bearer, the allelic transmission advantage can allow the driving chromosome to spread within a species.

Driving alleles also tend to be located in inversions or other regions of low recombination, and therefore deleterious mutations linked to the driver may increase in frequency via hitchhiking.

Drivers located on the sex chromosomes can strongly distort sex ratios, which could possibly lead to extinction. These many deleterious effects select for drive suppressors, which have evolved for most known drive systems. We describe two types of meiotic drive that can lead to hybrid sterility: female (chromosomal) and male (genic).

Female or “chromosomal” drive occurs via competition among oocyte chromosomes for deposition into the resultant egg cell; however, this competition runs an added risk of causing hybrid male sterility. Most Drosophila oocytes undergo four rounds of incomplete cytokinesis during meiosis; only one of the resulting cells will become an egg and pass its chromosomes to offspring. Meiotic products may compete for deposition into the egg cell via spindle fiber attachment (Zwick et al. 1999; Pardo-Manuel de Villena and Sapienza 2001). Variation in satellite sequences at the centromere (the site of spindle attachment) and numerous replacement polymorphisms at the centromeric histones suggests rapid evolution, and further support the hypothesis of an arms race to be “chosen” to be relegated to the egg cell (Malik and Henikoff

2001; Malik et al. 2002). This arms race for spindle attachment can have negative side effects;

centromeric and telomeric sequences in different populations may be divergent enough to cause misalignment of the centromeres, thereby disrupting meiosis in hybrid males and causing sterility (McKee 1998; Henikoff et al. 2001; Zwick et al. 1999). However, although a possible contributing force, female drive may not provide the single best explanation of Haldane’s Rule for two reasons: female drive does not explain hybrid inviability, and female drive seemingly would not apply to haplodiploid species or species lacking an XY or ZW sex (whereas Haldane’s

Rule still applies to both species types). Further, in haplodiploid or XO species, competition between the two chromosomes would be eliminated and no arms race would occur to increase the chance of hybrid incompatibilities (reviewed further in Coyne and Orr 2004). The remainder of this review will focus mainly on X chromosome male drive and its relevance to speciation.

While chromosomal drive is characterized by a competition between centromeres for spindle fiber attachment, male drive (also called genic drive) is a competition between alleles during sperm development. The mutations caused by this competition may increase divergence between two species and therefore also run the risk of causing hybrid male sterility. During normal spermatogenesis, half of the newly formed haploid sperm cells should contain X chromosomes and the other half should contain Y chromosomes. Deviations from a 50-50 sex ratio in offspring (typically towards females) often indicate genic drive of sex chromosomes in males. Male drive may result from lack of production of Y-bearing sperm or producing Y- bearing sperm rendered incapable of fertilization (see Recent Empirical Studies section). In many instances, sex chromosome meiotic drive is specifically associated with a particular chromosomal rearrangement (see Population Genetics of Drive and Speciation section) and in Drosophila, these rearrangements are dubbed "sex-ratio (or SR) chromosomes." While sex chromosome drive

appears more common than autosomal drive, this perception may result from an observational bias: sex chromosome drive is easily detected by sex-ratio disruptions ranging from 60-100 percent female offspring (reviewed in Jaenike 2001 [supplemental material]). Autosomal drive is more difficult to observe directly unless a visible phenotypic trait difference is closely linked to the driving locus.

Suppressors of meiotic drive are likely to evolve on the autosomes as a response to a change in the sex ratio caused by X-linked drivers, causing them to be observed often in sex chromosome drive systems. Autosomal suppressors will adjust the sex ratio back to normal; however, they may not spread to fixation quickly. Y-linked suppressors can also restore the sex ratio and will exhibit intense positive selection since nonsuppressing Y-chromosomes will not appear (Atlan et al. 2003; Hurst and Pomiankowski 1991). However, the size, gene content, and number of autosomes compared to the Y chromosome provide greater possibility for suppressors to evolve (Hurst and Pomiankowski 1991). Atlan et al. (2003) further showed that, when the strength of autosomal suppression of drive was substantially greater than Y-linked suppression, autosomal suppressors would spread faster. This observation suggests a reason why autosomal suppressors are observed in so many drive systems and why drive systems that contain Y-linked suppressors nearly always contain autosomal suppressors as well (Stalker 1961; Carvalho and

Klaczko 1993; Carvalho and Klaczko 1994; Jaenike 1999).

Almost twenty years ago, two independent publications discussed the likelihood of mutations in male drive systems explaining hybrid sterility and Haldane’s Rule in particular

(Frank 1991; Hurst and Pomiankowski 1991). These authors described a model where rapid coevolution of drivers and suppressors increases the divergence between species. A reduction in

fertility is a common byproduct of meiotic drive, and thus accelerated evolution at drive loci may disproportionately impact spermatogenesis genes, inadvertently increasing the chance of hybrid sterility-causing interactions. The arms race between the evolution of drivers and suppressors is thought to cycle, each triggering evolution in the other (Carvalho et al. 1997; Hall 2004). Because distorters may be evolving repeatedly on the X chromosome, this cycle model reinforces the idea that rapid evolution on the sex chromosomes could greatly increase divergence between species and may be a contributor to the large-X effect observed in genetic studies of hybrid sterility

(Coyne and Orr 1989; Turelli and Orr 2000; Masly and Presgraves 2007; Tao et al. 2007b;

Charlesworth et al. 1987).

However, these meiotic drive theories for hybrid male sterility were quickly criticized for multiple shortcomings (Coyne et al. 1991; Charlesworth et al. 1993). For example, recombination between distorter alleles and their responders can prevent the spread of new drive systems if the responder allele is recombined onto the same chromosome as the distorter, thereby causing the distorter to drive against itself (Lessard 1985; Charlesworth and Hartl 1978; Prout et al. 1973;

Hartl 1975; Thomson and Feldman 1976; Liberman 1976). Because of the absence of crossing over between the X and Y chromosomes, Frank (1991) argues that drivers should evolve faster on the sex chromosomes than autosomes. While Coyne et al. (1991) argue that in certain cases, autosomes are actually more likely to evolve drivers, recent empirical studies have repeatedly identified X-linked drivers, including the four discussed in the next section.

Perhaps the strongest criticisms of the meiotic drive models came from the lack of supporting data from empirical studies at the time. Frank’s (1991) model assumed that meiotic drive should occur in interspecies crosses, yet early studies failed to detect evidence of meiotic

drive in fertile backcross hybrid males (Coyne and Orr 1993; Johnson and Wu 1992). Hurst and

Pomiankowski (1991) further predicted that the Y chromosome would play a major role in the association of meiotic drive and hybrid male sterility, but at least some studies of hybrid sterility detected no involvement of the Y chromosome, and Haldane's Rule is even observed in species not bearing a Y-chromosome (Coyne et al. 1991; Charlesworth et al. 1993). Despite such arguments against these early meiotic drive hypotheses for causing hybrid sterility, several recent studies have demonstrated compelling links between male drive and hybrid male sterility (see below).

1.3 Recent empirical studies linking meiotic drive and speciation

Recently, numerous empirical studies linked drive and sterility in hybrids, yet few have proposed a precise mechanism for this link. Most drive systems are characterized as “true drive,” where the drive actually takes place during meiosis. This class of drive causes target- carrying sperm to never be produced, as opposed to “gamete-killing drive,” where the target- carrying sperm are produced but are incapable of fertilization due to disruptions occurring anytime after meiosis. True drive, such as fragmentation of the Y chromosome (Novitski et al.

1965) seems to be more common in sex chromosomal drive systems (see discussion in

Montchamp-Moreau 2006), whereas autosomal drive systems, such as SD in Drosophila melanogaster and the t haplotype in mice, exhibit gamete-killing drive (Lyon 2003; Kusano et al.

2003).

Hauschteck-Jungen (1990) identified a link between hybrid sterility and a driving X chromosome derived from one population of Drosophila subobscura . Some wild D. subobscura males collected from Tunis produced 90% female offspring. These males carried A 2+3+5+7 , an SR

arrangement on the X chromosome containing four inversions relative to the standard.

Hauschteck-Jungen (1990) further observed that males possessing the Tunis A 2+3+5+7 X chromosome with autosomes derived from another strain (Küsnacht) were sterile, while males possessing the Küsnacht X chromosome and Tunis autosomes were fertile. Hence, presence of

SR X chromosome arrangement contributed to sterility in hybrids within species when paired with autosomes that had not coevolved with it.

A driving factor also causes sterility in hybrids between Drosophila simulans and D. mauritiana when made homozygous (Tao et al. 2001). Tao et al. (2001) introgressed 259 homozygous segments of the D. mauritiana third chromosome into D. simulans and scored the offspring for fertility and drive. Two segments interact to cause both drive and sterility: too much yin (tmy ) and broadie . Too much yin is presumed to be an autosomal suppressor of X chromosome drive. The D. simulans copy of Tmy appears to be dominant to the D. mauritiana copy ( tmy ), which explains why their study only observed sterility when the D. mauritiana introgression was homozygous in the D. simulans background. When the D. simulans copy was present in the same background, all males were fertile with no sex ratio distortion and the same results were observed for Tmy/tmy males. About half of the males homozygous for D. mauritiana tmy in a D. simulans background were sterile (235/452) while the others were fertile with a strong sex ratio bias. They determined that, while tmy alone fails to suppress the sex ratio bias, the added presence of the broadie modifier causes complete male sterility. They further fine-mapped tmy , narrowing it down to a region spanning 80kb and demonstrated that recombination cannot separate the two phenotypes (sterility and drive), indicating that tmy can act alone to cause both.

Multiple links between meiotic drive and hybrid sterility have been made through

genetic mapping studies in the Drosophila pseudoobscura species group. The first such link is inferential. Early mapping studies by Wu and Beckenbach (1983) and Orr (1989) identified effects of the right arm of the X chromosome of D. persimilis as contributing to sterility in a D. pseudoobscura genetic background. These studies both used strains of D. persimilis bearing a SR driving X chromosome. Curiously, the opposite effect was observed by Noor et al. (2001a), where the same D. persimilis X chromosome region derived from non-driving D. persimilis X chromosomes reduced hybrid sterility-conferring interactions elsewhere in the genome when in a

D. pseudoobscura background. This discrepancy suggests a link between the driving X chromosome and hybrid sterility, but this link is only inferential until more precise mapping is conducted.

More recently, drive and sterility have been directly linked in hybridizations between the

D. pseudoobscura subspecies. One direction of the subspecies cross (bogotana females crossed to pseudoobscura males) produces very weakly fertile male progeny (Orr and Irving 2005).

Moreover, these hybrid males produce strongly female-biased offspring, a driving effect masked in pure D. pseudoobscura bogotana due to autosomal suppressors. The X-linked factor causing segregation distortion was localized near the sepia locus; however, this factor is necessary but not sufficient: distortion requires additional D. pseudoobscura bogotana introgressions to exhibit drive.

The location implicated here for meiotic drive is the same location mapped in a previous study for hybrid male sterility (Orr and Irving 2001), leading the authors to suggest that the same factor causes both drive and hybrid male sterility (Orr and Irving 2005). This region was recently mapped further and a gene, Overdrive , was identified that is responsible for both phenotypes

(Phadnis and Orr 2009). Overdrive encodes a protein with a Myb/SANT-like domain in an Adf-1

(MADF) DNA-binding domain. Adf-1 is a transcription factor known to activate genes regulated during Drosophila development (England et al. 1992).

Some meiotic drive systems and hybrid sterility-conferring genes share common factors that can be incorporated into a potential single mechanistic explanation for the link between these two phenotypes: chromatin remodeling. Heterochromatin formation was recently implicated in causing hybrid female lethality between Drosophila melanogaster males and D. simulans females

(Ferree and Barbash 2009). In hybrid females, the region of the D. melanogaster X chromosomes containing the Zygotic hybrid rescue (Zhr ) gene disrupts separation of chromatids and the D. simulans machinery is unable to compensate. The aforementioned gene Overdrive , which contributes to both meiotic drive and hybrid sterility, may also be involved in chromatin remodeling. Further, Overdrive is not the only Drosophila hybrid sterility gene to contain a

MADF domain; Hybrid Male Rescue (HMR) in Drosophila melanogaster contains four MADF domains (Barbash et al. 2003; Maheshwari et al. 2008). HMR causes hybrid male lethality and hybrid female sterility between D. melanogaster and its sibling species, D. mauritiana , D. simulans and D. sechellia (Hutter and Ashburner 1987; Barbash et al. 2003; Barbash and Ashburner 2003).

Recent studies suggest that some of HMR’s MADF domains may be involved in chromatin binding (Maheshwari et al. 2008; Barbash and Lorigan 2007), while other studies have also implicated defects in chromatin remodeling as a potential mechanism of meiotic drive (Tao et al.

2007a; Hauschteck-Jungen and Hartl 1982; Montchamp-Moreau 2006).

Silencing on the X chromosome also involves changes in chromatin states that occur during spermatogenesis. The X chromosome is inactivated in primary spermatocytes during spermatogenesis in Drosophila, mammals and nematodes (Lifschytz and Lindsley 1972; Kelly et

al. 2002; Hense et al. 2007). Lifschytz and Lindsley (1972) demonstrated that factors that prevent proper silencing during inactivation may cause sterility. A potential change in chromatin states could result from the different arrangement of the X chromosome in SR Drosophila ; the rearrangement then causes a failure of the X and Y chromosomes to align during metaphase in hybrids, leading to an arrest of spermatogenesis (McKee 1998). Hence, changes in chromatin states due to meiotic drivers may also negatively impact X chromosome silencing and therefore fertility. Drosophila XO males also undergo X chromosome inactivation, and if such males exhibit disrupted silencing due to the aforementioned hypothesis, this explanation may address one of the issues raised by Coyne and Orr (2004) regarding the inability of female drive to explain sterility in XO species. Interactions involving chromatin remodeling, and the MADF binding domain in particular, may prove to be involved in multiple hybrid incompatibilities.

Finally, our suggestion that changes in chromatin modifications can affect hybrid sterility is further strengthened by a recent finding by Bayes and Malik (2009). The Drosophila mauritiana allele of OdysseusH (OdsH) contributes to hybrid male sterility when in a D. simulans genetic background (Ting et al. 1998). The endogenous protein binds to heterochromatin, particularly loci on the X and 4th chromosomes. Coexpression of the Drosophila mauritiana and D. simulans OdsH alleles in sterile hybrids led to anomalous binding of the D. mauritiana copy to the Y- chromosome, resulting in altered chromosome condensation. Transgenic lines into multiple species also exhibited altered localization of OdsH, reflecting the rapid evolution seen within the

OdsH homeodomain (Ting et al. 1998). These results demonstrate rapid coevolution between a hybrid sterility gene and its heterochromatic targets across this clade.

1.4 Population genetics of drive and speciation

Understanding how drive contributes to speciation requires an understanding of how drive arises and is maintained despite associated fitness detriments. Drive systems on sex chromosomes arise more easily than on autosomes, yet become fixed less easily. This delay between emergence and fixation allows more time for selection to act against sex-chromosome drive systems via recombination, introduction of suppressors and association of unpreferred traits. However, certain effects of drive are also selected, thus causing the cyclical evolution of drivers and suppressors mentioned previously. Again, this cycling can increase the opportunity for hybrid incompatibilities to arise and cause speciation. We discuss each of these processes in this section.

Drive systems are inherently more detectable to investigators when they arise on sex chromosomes than autosomes because of the associated skew in sex ratio. However, despite the observational bias, there are also evolutionary reasons why drive systems would favor the X chromosome. Autosomal drivers must arise on an insensitive chromosome and then drive against a sensitive chromosome (Charlesworth and Hartl 1978). Taking into account the fitness cost (usually a reduction in male fertility) typically associated with drive, Hurst and

Pomiankowski (1991) showed that, for autosomal drivers to invade, the frequency of the insensitive chromosome must be low, and the driver must be in strong linkage disequilibrium

(LD) with the target. Sex-linked drive systems require fewer starting conditions; since the X and

Y chromosomes do not recombine, it is easier to maintain LD between the driver and target (Wu and Hammer 1991). Thus, autosomal drivers must depend on strong LD for invasion, whereas sex-linked drivers rely only on the equilibrium that must be maintained between selection and

drive (Hurst and Pomiankowski 1991).

Sex-linked drive systems become fixed less easily than autosomal systems, and this feature may predispose them to acquiring suppressors (Wu 1983a; Jaenike 1996; Jaenike 2001;

Wilkinson and Fry 2001; Taylor and Jaenike 2002; Atlan et al. 2004; James and Jaenike 1990;

Wilkinson et al. 2006; Capillon and Atlan 1999). A system with an X-linked driver will skew the sex ratio of the population such that there is less competition for females, and thus males mate more often (Jaenike 1996). However, driver-carrying males often exhibit reduced fertility (Hartl et al. 1967; Beckenbach 1978; Wu 1983a; James and Jaenike 1992; Jaenike 1996; Atlan et al. 2004;

Fry and Wilkinson 2004; Wilkinson et al. 2006). Therefore the driver is held at equilibrium, where selection against it increases as its frequency increases (Wu 1983a; Jaenike 1996; Jaenike 2001;

Wilkinson and Fry 2001; Taylor and Jaenike 2002; Atlan et al. 2004; James and Jaenike 1990;

Wilkinson et al. 2006; Capillon and Atlan 1999). This balance between selection and frequency allows greater time for a drive suppressor to evolve and drivers that skew the sex ratio provoke selection against themselves. Therefore, evolution of suppressors is more likely under X-linked drive systems (Hurst and Pomiankowski 1991).

Non-Mendelian sex ratios are generally disadvantageous, and thus in sex-linked drive systems, selective pressure is applied that pushes the ratio back to normal (Lyttle 1979). This selective pressure may yield greater probability of inducing the arms race discussed earlier, where rapid evolution at drivers and suppressors increases divergence and thus hybrid incompatibilities are more likely to arise (Frank 1991). Given the fertility reduction in SR males, offspring would be more fit if recombination broke up drivers and their linked targets; however, many drivers are located in inversions, where recombination is prevented. Thus, recombination

may prevent drivers from initially fixing, but recombination will have little effect if the drivers are already fixed or reached a stable equilibrium. Furthermore, in Drosophila, where drivers are typically located within inversions, the X chromosome drive loci are thought to have originated prior to the introduction of the inversions (Babcock and Anderson 1996; Wu and Beckenbach

1983; Lyttle 1991). These drive loci would not have been linked without the inversions, and thus no drive would occur. However, as the inversions evolved, more of the X would become linked and eventually the final inversion would have linked the drive loci together, causing meiotic drive and increasing the frequency of the inversion arrangement in the population (Babcock and

Anderson 1996).

In addition to recombination, the evolution of suppressors also will push the sex ratio back to Fisherian proportions (Lyttle 1979). Continued driver presence will favor the evolution of suppressors; however, once suppressed, a different driver may arise and start the cycle over (Hall

2004). Again, this cycling hypothesis could explain how meiotic drive is linked to hybrid sterility, where this rapid evolution at different regions of the genome can cause increased divergence and therefore heighten the likelihood of hybrid incompatibilities arising.

Selecting for traits associated with drive can further affect driver frequency, which may induce an arms race between drivers and suppressors. In mice and stalk-eyed flies, females can distinguish between males carrying driving elements and non-driving males (Wilkinson et al.

1998; Lenington and Egid 1985; Carroll et al. 2004). In both species, the females actually preferentially mate to non-driving males, and thus drive is selected against (Lenington et al. 1992;

Wilkinson et al. 1998). Females of the stalk-eyed fly species C. dalmanni and C. whitei prefer mates with the longest eye-stalks (Burkhardt and de la Motte 1985) and eye span (Wilkinson and Reillo

1994; Burkhardt and de la Motte 1988). However, longer eye-stalks are associated with genetic factors that suppress female-biased sex chromosome drive.

1.5 Concluding Remarks

While meiotic drive was not a popular explanation for hybrid sterility just over a decade ago (Coyne and Orr 1993; Johnson and Wu 1992), many recent studies implicating an association between meiotic drive and hybrid male sterility suggest that the community ruled out this possibility too quickly (Wu and Beckenbach 1983; Hauschteck-Jungen 1990; Tao et al. 2001; Orr and Irving 2005; Phadnis and Orr 2009). Theoretical studies suggest evolutionary reasons why meiotic drive may contribute to hybrid sterility, and recent empirical studies suggest explicit links between these two phenomena. Furthermore, exploring the genetic architecture of both drive and sterility may provide clues as to the mechanistic basis of an association between them.

Future studies of drive and hybrid male sterility should consist of cloning the underlying genes as well as clarifying the role of chromatin remodeling and X chromosome inactivation during spermatogenesis. Overall, this area is ripe for further investigation to help us understand hybrid sterility and the origin of biodiversity.

2. Genetics of hybrid male sterility among strains and species in the Drosophila pseudoobscura species group

Taxa in the early stages of speciation may bear intraspecific allelic variation at loci conferring barrier traits in hybrids such as hybrid sterility. Additionally, hybridization may spread alleles that confer barrier traits to other taxa. Historically, few studies examine within- and between-species variation at loci conferring reproductive isolation. Here, we test for allelic variation within Drosophila persimilis and within the Bogota subspecies of D. pseudoobscura at regions previously shown to contribute to hybrid male sterility. We also test whether D. persimilis and the USA subspecies of D. pseudoobscura share an allele conferring hybrid sterility in a D. pseudoobscura bogotana genetic background. All loci conferred similar hybrid sterility effects across all strains studied, though we detected some statistically significant quantitative effect variation among D. persimilis alleles of some hybrid incompatibility QTLs. We also detected allelism between D. persimilis and D. pseudoobscura USA at a second chromosome hybrid sterility

QTL. We hypothesize that either the QTL is ancestral in D. persimilis and D. pseudoobscura USA and lost in D. pseudoobscura bogotana , or gene flow transferred the QTL from D. persimilis to D. pseudoobscura USA. We discuss our findings in the context of population features that may contribute to variation in hybrid incompatibilities.

2.1 Introduction

The process of speciation results when gene flow is prevented between populations, creating reproductive isolation. A wide variety of traits can inhibit gene flow, and understanding the genetic differences that lead to these traits informs us about the genetic changes that create new species. More progress has been made in mapping , characterizing, and cloning genes that

cause incompatibilities, such as fitness reduction, in species hybrids (reviewed in Presgraves

2010) than in traits that prevent formation of hybrids (e.g., mate preference, pollinator differences), although both have been studied extensively (Coyne and Orr 2004, Chapters 5 and

6).

However, the genetic mapping studies that lead to cloning incompatibility genes are often unreplicated. A typical speciation genetics study will identify quantitative trait loci (QTLs) differentiating one strain of one species from one strain of another species but does not test between other pairs of strains. Yet, the localized QTL may be specific to the strains studied and not actually characteristic of the entire species, and many recent studies have demonstrated intraspecies variation in QTLs (Demuth and Wade 2007; Case and Willis 2008; Good et al. 2008;

Nolte et al. 2008; Reed et al. 2008; Sweigart et al. 2007; Teeter et al. 2010). For example, Barnwell and Noor (2008) examined variation within and between populations of Drosophila pseudoobscura in species mate discrimination. Although the behavioral difference between these populations was fixed, the underlying QTLs differentiating one pair of strains failed to contribute to the behavioral difference in any other pair of strains surveyed (see also Ortiz-Barrientos et al. 2004).

Thus, two questions must be asked of speciation genetics QTL mapping studies: 1) can the same

QTLs be detected in different pairs of strains, and if so, 2) are the effects similar in magnitude?

The Drosophila pseudoobscura /D. persimilis system has been used extensively as a model for hybrid male sterility, pioneered by Dobzhansky (1933; 1936) and continued by others (Orr 1987;

Orr and Irving 2001; Phadnis and Orr 2009; Wu and Beckenbach 1983). Noor et al. (2001b) found that much of the genetic basis for hybrid sterility in this system localizes to three regions bearing fixed inversion differences between the two species. Brown et al. (2004b) and Chang and Noor

(2010; 2007) found that a geographically isolated subspecies of D. pseudoobscura (D. pseudoobscura bogotana ) had additional factors outside the inverted regions that conferred sterility in hybrid males between the subspecies and D. persimilis . These findings supported a model in which sterility factors in hybridizing species ( D. pseudoobscura USA and D. persimilis ) persist in fixed inverted regions that differ between the two species. Unlike the inverted regions, most collinear

(uninverted) regions of the genome are prevented from diverging if the nascent species were sympatric or are homogenized by interspecies gene flow after secondary contact if the nascent species emerged in allopatry (Machado et al. 2007; Noor et al. 2007; Kulathinal et al. 2009). In contrast, non-hybridizing species ( D. pseudoobscura bogotana and D. persimilis ) can maintain additional sterility factors across the genome, both in inverted and collinear regions.

Here, we examine the system in greater detail, specifically the D. pseudoobscura bogotana-

D. persimilis hybridization, to determine the extent of genetic variation contributing to hybrid sterility within and among these taxa. We test whether and how variation within species affects hybrid sterility by reexamining the data of Brown et al. (2004b) and collecting new data to see if the inverted regions contributed similar effects in D. persimilis/D. pseudoobscura bogotana hybrids when using different strains of the two taxa. We also replicate the experimental design of Chang and Noor (2007) in multiple strains of D. persimilis to detect variation among collinear factors contributing to hybrid sterility between D. persimilis and D. pseudoobscura bogotana . Finally, to understand the evolutionary history of hybrid sterility in this system and study between-species variation, we test for shared alleles in a collinear region of D. pseudoobscura USA and D. persimilis that confers sterility in D. persimilis /D. pseudoobscura bogotana hybrids. Demonstration of allelism

(that this region has the same effect when derived from either D. persimilis or D. pseudoobscura

USA) could suggest that this hybrid sterility-conferring allele introgressed from D. persimilis into

D. pseudoobscura USA in collinear regions from the homogenizing gene flow described above.

2.2 Methods

2.2.1 Fly Stocks

The D. persimilis MSH1993 line was derived from females collected at Mount Saint

Helena, California, in 1993 (Noor 1995). The D. persimilis MSH3 and MSH1 lines were derived from females collected at Mount Saint Helena, California, in 1997 (stock number 14011-0111.49).

The D. persimilis Santa Cruz Island (SCI) was obtained from the stock center (number

14011-0111.50, year: 2004). The D. pseudoobscura USA Flagstaff1993 line was derived from four different lines, each collected in Flagstaff, Arizona, in 1993 (Noor 1995). Because the collections vary both spatially and temporally, we assume that our sampling does not affect our tests of variation. The D. pseudoobscura bogotana line is a subculture of the D. pseudoobscura bogotana El

Recreo line collected in 1978 (provided by H. A. Orr). Lines of D. pseudoobscura bogotana and crosses described in the re-examination of the Brown et al. (2004b) data are described therein.

2.2.2 Fly Crosses

Drosophila pseudoobscura bogotana females carrying a white eye mutation (hereafter bogw) were collected as virgins and maintained for at least six days. After six days, bogw females were crossed to D. persimilis MSH3, MSH1993, MSH1, or SCI males (Figure 1). F 1 females were backcrossed to bogw males to generate backcross males (hereafter “BCbogw males”) for fertility assays. Only those male progeny bearing the white mutation were scored because the mutation is linked to an inversion on the left arm of the X chromosome (XL), which is known to confer sterility between the two species (Brown et al. 2004b; Dobzhansky 1936; Noor et al. 2001a; Orr

1987). Because a D. persimilis XL inversion would cause sterility in a D. pseudoobscura bogotana background, we selected white-eyed flies, which maintain a D. pseudoobscura bogotana XL inversion, allowing sterility conferred from other loci to be detected.

For the test for allelism of a hybrid sterility locus, regions of the D. pseudoobscura USA

Flagstaff1993 second and fourth chromosomes that correspond to D. persimilis MSH1993 QTLs associated with hybrid male sterility when in a D. pseudoobscura bogotana background (Chang and

Noor 2007), were introgressed separately into a D. persimilis MSH1993 background. These introgressed males were crossed to bogw females, and F1 females were backcrossed to bogw males to generate backcross males (BCbogw males) used for fertility assays. All crosses were performed on standard sugar/yeast/agar medium at 20° ± 1° and 85% relative humidity.

2.2.3 Fertility Assays

BCbogw males were collected as virgins and maintained for seven days in food-

Figure 1: Backcross Design. Males from each line of D. persimilis were crossed to white-eyed D. pseudoobscura bogotana (bog) females. The fertile F1 hybrid females were backcrossed to white-eyed D. pseudoobscura bogotana males. The white-eyed backcross male progeny (BCbogw) were then dissected and genotyped.

containing vials holding 1–20 males. On day 7, the fertility of each backcross male was assessed by dissection of the testes in Ringer’s solution following the method of Coyne (1984). A male was scored as “fertile” if at least one motile sperm was observed and “sterile” if no motile sperm were observed. Treating fertility as a binary trait has been shown to be conservative (Campbell and

Noor 2001), although other methods of scoring fertility exist (e.g., White-Cooper 2004). All dissected BCbogw males were labeled and stored at -20°.

2.2.4 Microsatellite Genotyping

DNA was extracted from all dissected BCbogw males following the protocol of Gloor and Engels (1992). Microsatellite genotyping was performed in two steps. First, all BCbogw males were genotyped for markers associated with each inversion that distinguishes D. pseudoobscura from D. persimilis . The markers used for this initial screen were DPSX002 or DPSX046 (left arm of

X chromosome- XL), DPSX030 (XR), and DPS2022 or DPS2026 (2). These markers denoted the species identity of the inversion arrangement on these chromosome arms. Second, only those

BCbogw males that were hemizygous or homozygous for the D. pseudoobscura bogotana allele at the three inversion markers (hereafter “BCbogwLim males”) were further genotyped at the three collinear QTLs identified previously (Chang and Noor 2007). Again, these markers were selected because the D. pseudoobscura bogotana inversion alleles permit detection of sterility caused by autosomal loci. The markers used for genotyping at these QTLs were DPS2_27.05 and

DPS2_2395c for chromosome 2, DPS3001 for chromosome 3 and two of the following for chromosome 4: DPS4G1a, DPS4G1h, DPS4033h, DPS4611966. Primer sequences for all markers used in this study are available in appendix A. PCR amplification followed a touchdown

protocol: 95° for 1 min; 3 cycles of 94° for 30 sec, 56° for 30 sec, 72° for 30 sec; 3 cycles of 94° for 30 sec, 53° for 30 sec, 72° for 30 sec; and 30 cycles of 94° for 30 sec, 50° for 30 sec, 72° for 30 sec. PCR products were visualized on acrylamide gels on LiCor 4200 and 4300 DNA sequencer/analyzers.

2.2.5 Data Analysis

Following the protocols of Brown et al. (2004b) and Chang and Noor (2007), each individual from each cross was parsed into categories based on genotype using Microsoft Excel.

Counts of the number of individuals in each category in each cross were summed. The number of fertile progeny for each genotype category was divided by the total number of progeny with that genotype to obtain the percent fertility of individuals with that genotype. Crosses of a similar type were also analyzed together (i.e. backcrosses of different lines of D. persimilis to the same line of D. pseudoobscura bogotana ). The fertile individuals in each of those crosses of that type were summed and divided by the total number of progeny to calculate percent fertility of a certain genotype for all crosses together. Statistical differences in fertility between each of the crosses of a similar type were calculated using a G-test or Chi-Square (if the G-test failed).

Analyses were performed using StatView5 (SAS; Cary, NC), although Chi-Square probabilities were estimating using the online calculator at: http://faculty.vassar.edu/lowry/fisher2x4.html.

2.3 Results

2.3.1 Variation among strains in effect of inverted regions on hybrid sterility

Brown et al. (2004b) examined the fertility of backcross hybrids between D. persimilis and

D. pseudoobscura bogotana, specifically limiting analysis to those hybrids that were homo- or hemizygous for all inversions from D. pseudoobscura bogotana . We reanalyzed the raw data they obtained (Brown et al. 2004a) before they imposed this limitation. We tested if the effects of the

inverted regions on hybrid sterility are similar between crosses using different strains of D. persimilis . We split the data into two classes (discussed below) for analysis because in some of the previous research (Brown et al. 2004b; Chang and Noor 2007) and in all of our new research, selection of progeny for phenotyping and genotyping was limited to males bearing the XL chromosome arm from D. pseudoobscura bogotana . This limitation is based on the "white" visible mutation located on the XL; flies bearing an XL from D. persimilis were almost invariably sterile

(see below). We focus on the fertility of backcross progeny from the cross shown in Figure 1.

Two classes of backcross progeny were analyzed: strains of D. pseudoobscura bogotana with an XL from either species (Table 1, corresponding P-values 1), and strains with only a D. pseudoobscura bogotana -derived XL (Table 1, corresponding P-values 2) while using a single strain of D. persimilis . We found that all backcrosses bearing a D. persimilis -derived XL had greatly reduced fertility (less than 15%), regardless of the genotypes at the other markers. Among all backcross progeny, fertility remains comparatively high in individuals with D. pseudoobscura bogotana genotypes at the XL (Table 1, lines 1-4). However, we observe a strong reduction in fertility when the XR chromosome arm is derived from D. pseudoobscura bogotana , in combination with a heterozygous second chromosome (Table 1, line 2).

Generally, we detect few statistically significant differences in fertility among the backcross progeny classes of the same genotype derived from different strains of D. pseudoobscura bogotana . Among the different genotypes, we observe very similar reductions in fertility when particular D. persimilis inverted regions are introduced. Although a few genotypes exhibited statistically significant variation in hybrid sterility effects among strains (Table 1, lines 2), the difference is in the magnitude of associated hybrid sterility rather than the absence or presence of

an effect on hybrid sterility.

Although the crosses from Brown et al (2004b) used the same strain of D. persimilis, but varied the strains of D. pseudoobscura bogotana , we performed an analogous cross using the D. pseudoobscura bogotana ER white strain for background but varied the D. persimilis strain from which the inverted regions were derived (strains MSH1993, MSH1, MSH3 and SCI). Only white males were selected, so we surveyed backcross hybrid males with an XL inversion derived from

D. pseudoobscura bogotana. These results are presented in Table 2. Again, we observed a noticeable reduction in fertility when the XR chromosome arm is derived from D. pseudoobscura bogotana but the second chromosome is heterozygous for D. persimilis (Table 2, line 2). We detected statistically significant differences in fertility among the backcross hybrids from different strains when the XR chromosome arm was derived from D. persimilis (Table 2, lines 3-4),

Table 1: Variation in percent fertility between lines of D. pseudoobscura bogotana at each inversion genotype. For each cross, D. persimilis MSH1993 was backcrossed to each of three D. pseudoobscura bogotana strains (described in Brown et al (2004b) and the percent fertility at each genotype is listed. 1The p-value listed in this column represents statistical significance of the difference between the percent fertilities of only crosses ( D. pseudoobscura bogotana Susa6 and Sutatausa5. 2The P-value listed in this column represents statistical significance of the difference between the percent fertilities of all three crosses ( D. pseudoobscura bogotana Susa6, Sutatausa5, and ER white). Both types of analyses were performed using a G-test (see Methods). “bog”: D. pseudoobscura bogotana allele, “per”: D. persimilis allele, and “het”: heterozygous for both a D. pseudoobscura bogotana and D. persimilis alleles.

ain is is

D. persimilis fertilities of each allele, "per": alleles. D. persimilis at theinversions. For each cross, a different str

and ER whiteand the percent fertility ateach genotype D. pseudoobscuraD. bogotana D. persimilis ds). "bog": esof significance of the differencebetween the percent D. pseudoobscuraD. bogotana D. pseudoobscurabogotana was was backcrossed to D. persimilisD. Table 2: Variation in percent fertility between lin of listed. Thep-value listed represents statistical cross, and wascalculated using a G-test (seeMetho allele,and"het": heterozygous for both 25

but again, the differences are in the magnitude of associated hybrid sterility rather than the absence or presence of an effect on hybrid sterility.

In summary, we detect generally small, though statistically significant, variance among strains of D. pseudoobscura bogotana and D. persimilis in hybrid sterility effects associated with inverted regions.

2.3.2 Variation among strains in hybrid sterility effect of collinear regions

Chang and Noor (2007) identified three D. persimilis autosomal QTLs outside the fixed inversions contributing to hybrid sterility when in a D. pseudoobscura bogotana background. Using the MSH1993 line of D. persimilis , we tested the effects of one of the three collinear QTLs using backcrosses involving three other lines of D. persimilis : MSH1, MSH3 and SCI, into the D. pseudoobscura bogotana background. The collinear QTL tested is located on chromosomes 2 (Q2), where Q2 is 1.42 Mb long. The QTL on chromosome 3 (Q3) was located within an inversion polymorphic within the species, rendering fine-mapping this QTL impossible, and it is not examined here. The third QTL is located on the fourth chromosome (Q4) and is not tested because of its much weaker effect on hybrid sterility compared to Q2 (Chang and Noor 2007) .

Following Chang and Noor (2007), we focused on backcross hybrid individuals bearing the left and right arm inversions of the X chromosome (XL and XR) and the second chromosome inversion derived from D. pseudoobscura bogotana . The effects of each collinear QTL in each of the three additional lines tested, including the original, D. persimilis MSH1993 is presented in Table 3.

Each QTL is represented by two flanking markers (listed in appendix A). As expected, having both QTLs with D. persimilis genotypes in a D. pseudoobscura bogotana background strongly

allele, D.

e is listed for D. persimilis D. Each line of

ent fertilities of each alleles. allele, "per": D. persimilis at the collinear QTLs.

and D. persimilis D. pseudoobscurabogotana es of ER white,and the percent fertility at each genotyp D. pseudoobscuraD. bogotana ds). "bog": cal cal significance of thedifference between percthe D. pseudoobscurabogotana and"het": heterozygous for both Table 3: Variation in fertilitypercent between lin wasbackcrossed to each Thecross. p-valuelisted represents statisti persimilis cross,and was calculated using a G-test (seeMetho

reduces fertility in all lines (Table 3, line 4; appendix B, line 8). The very slight reduction in fertility in the presence of a D. persimilis Q4 by itself (Table 3, line 2) confirms the observation that this foreign allele can be made homozygous and maintained in a D. pseudoobscura bogotana background (Chang and Noor 2010). The slight effect of a D. persimilis Q4 is amplified when in combination with a D. persimilis Q2, and is consistent with the epistatic effects discussed in

Chang and Noor (2010). As with our other analysis of the inverted regions, the fertility of backcross hybrid males bearing particular genotypes are not significantly different across the strains surveyed.

2.3.3 Allelism in collinear regions of D. pseudoobscura USA and D. persimilis

The results from the experiments described above demonstrate only some quantitative within-species variation in the hybrid sterility effects of particular QTLs. Both D. pseudoobscura

USA and D. persimilis form sterile hybrid males when crossed with D. pseudoobscura bogotana , and work reported here and elsewhere (e.g., Orr and Irving 2001) has shown that dominant, collinear, autosomal QTLs contribute to this sterility. Many studies have shown evidence for gene exchange between D. pseudoobscura USA and D. persimilis in such collinear regions (Machado et al. 2007; Noor et al. 2007; Kulathinal et al. 2009), suggesting the hybrid-sterility-conferring allele may have even spread from between the two species. We tested for allelism between D. pseudoobscura USA and D. persimilis at one collinear QTL (Q2) that confers sterility in a D. pseudoobscura bogotana genetic background. Q3 was not introgressed because of its linkage to an inversion, and Q4 is demonstrated a much weaker effect on hybrid sterility between D. persimilis and D. pseudoobscura bogotana (Chang and Noor 2007). First, we introgressed approximately 1.42

Mb of a 2 Mb hybrid sterility QTL on chromosome 2 (Q2) identified in Chang and Noor (2007) from D. pseudoobscura into D. persimilis . Once made homozygous in D. persimilis , those flies were backcrossed to D. pseudoobscura bogotana . If hybrid sterility is observed to be associated with this

QTL, D. pseudoobscura USA must contain the same hybrid-sterility-conferring allele as D. persimilis when in a D. pseudoobscura bogotana genetic background. The presence of the D. pseudoobscura USA copy of the D. persimilis hybrid sterility QTL on chromosome 2 was significantly associated with hybrid sterility (Figure 2). We also examined whether the D. pseudoobscura USA alleles have the same effect on hybrid sterility at the Q2 regions as the D. persimilis alleles (comparing Figure 2 to Table 3/appendix B). Both the D. persimilis Q2 and D. pseudoobscura USA Q2 show a greater fertility reduction when in combination with either a D. persimilis Q3 or Q4, and an even stronger reduction when all three QTLs are heterozygous.

Figure 2: Percent fertility of individuals with a D. pseudoobscura USA copy of QTL 2. Genotypes for each QTL (Q2, Q3, and Q4) are listed vertically. Sample sizes for each genotype combination are listed below the genotypes. "bog": D. pseudoobscura bogotana allele, "per/bog": heterozygous for D. persimilis and D. pseudoobscura bogotana alleles, "ps/bog": heterozygous for D. pseudoobscura USA and D. pseudoobscura bogotana alleles. 29

The effects of the D. pseudoobscura USA Q2 are indeed similar to the effects of the D. persimilis Q2, especially when in combination with other QTLs. BCbogw males with a D. pseudoobscura USA

Q2 and two other D. persimilis MSH1993 alleles at Q3 and Q4 exhibit 53.5% fertility (Figure 2). In

Table 3, BCbogw males with D. persimilis MSH1993 alleles at Q2 and Q4 exhibit 35% fertility, and in appendix B, BCbogw males with D. persimilis MSH1993 alleles at Q2, Q3 and Q4 exhibit 30% fertility. Although the D. pseudoobscura USA allele at Q2 may not reduce fertility as much as D. persimilis , the effect of the Q2 marker is still highly significant (p<0.0001) and the epistatic effects between a D. pseudoobscura USA Q2 and D. persimilis Q3/Q4 are still maintained. Therefore, the

D. pseudoobscura USA allele at Q2 is associated with hybrid sterility in a D. pseudoobscura bogotana background.

2.4 Discussion

Historically, most genetic studies mapping reproductive isolation have been unreplicated and make the unstated assumption that the mapped loci are representative across the population or species. This study tests that assumption in the D. pseudoobscura- D. persimilis system.

Previous studies in this system demonstrate an association of inverted regions of the D. persimilis genome with hybrid male sterility when crossed to D. pseudoobscura USA (Noor et al. 2001a; Noor et al. 2001b) or to D. pseudoobscura bogotana (Brown et al. 2004b). In addition, Chang and Noor

(2007) demonstrate an association of collinear regions of D. persimilis with hybrid male sterility when crossed to D. pseudoobscura bogotana . We test for variation in those regions responsible for hybrid male sterility, both between lines of the same species as well as between species. We find that, in this system, effects of both inverted and collinear regions on hybrid male sterility vary minimally when derived from different strains within species, suggesting little intraspecific

variation in their effect on reproductive isolation. We also found a hybrid sterility QTL shared between D. pseudoobscura USA and D. persimilis when introgressed into D. pseudoobscura bogotana .

These findings are discussed in turn.

2.4.1 Variation in hybrid incompatibilities within species

We found that the same QTLs across the different lines occasionally exhibited statistically significant variation in effect on hybrid male sterility. However, all regions exhibited statistically significant effects in the same direction; any variation detected was in magnitude of effect rather than presence or absence, unlike the differences observed in Case and Willis (2008), Nolte et al.

(2008), Barnwell and Noor (2008), Good et al. (2008), and Sweigart et al. (2007). Further, the effects of these QTLs from various lines were assayed over long, non-overlapping periods of time, which may contribute environmental variance. Therefore, a lack of temporal control may have overestimated differences in effect among lines. However, only three strains of D. pseudoobscura bogotana and four strains of D. persimilis were used – inclusion of additional strains might demonstrate greater variation in hybrid sterility effects. Additionally, the effects of the inverted regions were likely averaged across many loci because of the multi-megabase length of each inversion, which may have underestimated differences in effect by averaging across many loci. This study further tested the effects of the collinear regions on hybrid male sterility, where we still detected minimal variation in sterility effects among strains within species.

Testing the presence or absence of effects of localized QTLs across lines within species is extremely important, yet rarely performed. Variation in reproductive isolation factors has been demonstrated in Crepis (Hollingshead 1930), Mimulus (Case and Willis 2008; Sweigart et al. 2007)

Drosophila (Patterson 1952, Chapter 10; Reed and Markow 2004), Tribolium (Wade et al. 1994), and

mouse (Good et al. 2008). Despite these recent studies showing variation in hybrid incompatibilities within species, many studies assume fixation of the same hybrid incompatibility alleles within species. Part of this assumption may be tied with the observation that directional selection and/or meiotic drive seem to be associated with the fixation of multiple cloned hybrid incompatibility genes (Barbash et al. 2004; Ting et al. 1998; Phadnis and Orr 2009; but see Masly et al. 2006; Presgraves et al. 2003).

Several factors may contribute to the amount of segregating variation in factors contributing to hybrid incompatibilities. These may include divergence time, amount of hybridization, amount of standing molecular genetic variation, effective population size, or disadvantage as a homozygote. In the case of D. pseudoobscura bogotana and D. persimilis , the divergence time is roughly 0.5-1.0 million years (Aquadro et al. 1991; Wang et al. 1997; Leman et al. 2005; Hey and Nielsen 2004), which is long enough to observe limited variation in hybrid incompatibility alleles within species. Also, D. pseudoobscura bogotana and D. persimilis do not hybridize because they are on different continents, and D. pseudoobscura bogotana has a very small effective population size and little standing genetic variation (Machado et al. 2002). Given the long divergence time and low effective population size, this system may be less likely than others to bear extensive standing genetic variation for hybrid incompatibilities.

2.4.2 Allelism in hybrid incompatibilities between species

A previous study demonstrated the significant effect of D. persimilis Q2 on hybrid male sterility when in a D. pseudoobscura bogotana background (Chang and Noor 2007), and here we demonstrate a significant effect of a D. pseudoobscura USA Q2 allele on hybrid male sterility in a

D. pseudoobscura bogotana background. The D. pseudoobscura USA region may contain distinct

hybrid-sterility-conferring loci that are not identical to those in D. persimilis . However, such loci are not ubiquitous: Chang and Noor (2010) introgressed a large collinear region of chromosome 2 between D. pseudoobscura bogotana and D. persimilis and found no effect on hybrid sterility.

Further, our introgression of Q2 interacts precisely the same way as the D. persimilis region with a

D. pseudoobscura bogotana genetic background (although there may be additional interactions between the D. pseudoobscura USA Q2 and D. pseudoobscura USA Q4 that we were unable to tease out). That said, the effects of a D. pseudoobscura USA allele at Q2 is perhaps slightly reduced compared to the effects of a D. persimilis allele at Q2 (see results in Chang and Noor 2010).

Therefore, our results are suggestive of allelism between D. pseudoobscura USA and D. persimilis at

Q2, and the effect of the D. pseudoobscura allele appears to be weaker than the D. persimilis allele, but multiple linked factors cannot be completely ruled out.

Several scenarios could explain the possible allelism between D. pseudoobscura USA and

D. persimilis at the hybrid-sterility-conferring Q2 locus. The simplest explanation is that this allele may represent the ancestral form, and a subsequent change within the lineage leading to D. pseudoobscura bogotana eliminated this effect, hence allowing for the other changes in D. pseudoobscura bogotana that led to the incompatibility. Serial changes within one lineage resulting in hybrid lethality have been suggested to have occurred in D. mauritiana (Cattani and Presgraves

2009). If these alleles are ancestral, perhaps the observed variation in strength of Q2 was caused by functional divergence of the incompatibility alleles in D. persimilis and D. pseudoobscura USA.

Another intriguing possibility, for which there is some limited support, is that the sterility-conferring allele arose in D. persimilis , and gene flow between D. persimilis and D. pseudoobscura USA in the collinear regions led to allelism at Q2 after the split of D. pseudoobscura

USA and D. pseudoobscura bogotana . These species are known to hybridize in the wild

(Dobzhansky 1973), molecular data suggest interspecies introgression has occurred in or near the

Q2 region (Noor et al. 2007; Machado et al. 2007; Kulathinal et al. 2009), and this introgression appears to have affected the genetic architecture of hybrid sterility in this system (Brown et al.

2004b; Chang and Noor 2007). Machado et al. (2007) also demonstrated extensive gene flow and higher variation in collinear regions on the second chromosome (not only near Q2), as well as in both arms of the X chromosome, which collectively make up approximately 60% of the genome.

The D. persimilis Q2 allele could have introgressed into D. pseudoobscura USA following hybridization. This explanation is supported by evidence from Kulathinal et al. (2009), who demonstrated that at least some gene flow occurred in collinear regions between D. pseudoobscura

USA and D. persimilis after the divergence of the two D. pseudoobscura subspecies.

We know of no demonstrations in which introgression between two species led to hybrid sterility with respect to a third, but a vaguely similar situation where subdivisions within one lineage (e.g. D. pseudoobscura USA and bogotana ) have experienced divergence from each other via reproductive isolation with a different lineage (e.g. D. persimilis ) was observed in green-eyed tree frogs ( Litoria genimaculata ). Premating isolation between the northern and southern lineages of

Litoria genimaculata led to divergence not only from each other but also between an isolate of the southern lineage found in the northern region (Hoskin et al. 2005). To distinguish between a loss of ancestral Q2 in D. pseudoobscura bogotana and introgression of Q2 from D. persimilis into D. pseudoobscura USA, the causative loci would need to be cloned and sequenced.

This study has demonstrated that some minor within-species variation in strength of hybrid male sterility exists within D. persimilis and D. pseudoobscura bogotana ; however, even the

minor variation we observe is likely overestimated due to environmental variation in experimental setup. Despite the negative finding here, QTL mapping studies should continue to test relevant QTLs in multiple lines. We have also determined that a collinear region on chromosome 2 in D. persimilis is allelic to the same region in D. pseudoobscura USA. This study raises the question of whether this region is involved not only in speciation between D. persimilis and D. pseudoobscura bogotana , but also between the two D. pseudoobscura subspecies. If so, perhaps other regions are more closely related between D. pseudoobscura USA and D. persimilis than either are to D. pseudoobscura bogotana .

3. Association of within-species segregation distortion in D. persimilis with hybrid sterility between D. persimilis and D. pseudoobscura

In contrast to the prevailing dogma in the 1990s, recent studies have suggested that an evolutionary history of segregation distortion within species may contribute to sterility in species hybrids. However, these recent works identified segregation distortion exclusively in species hybrids, and thus could not confirm a causal link between segregation distortion exhibited within species and hybrid sterility. In this work, we expand on previous studies by more directly testing for an association between an evolutionary history of segregation distortion and hybrid sterility.

We use a strain of Drosophila persimilis exhibiting segregation distortion within species, and we compare our segregation distortion QTL map to a hybrid sterility QTL map generated from D. persimilis /D. pseudoobscura backcross hybrid males, to determine co-localization of hybrid sterility and segregation distortion factors. The maps indicate an overlapping QTL, suggestive of an association between the two traits. Our work provides preliminary evidence for a true association between segregation distortion within species and hybrid sterility, supporting additional a genetic conflict model of speciation.

3.1 Introduction

3.1.1 Sex chromosome segregation distortion, genetic conflict, and speciation

Diploid taxa typically transmit the two alleles from each locus to their offspring in equal

Mendelian proportions. In contrast, “segregation distortion” (SD) describes the phenomenon wherein alleles are not found in equal proportions among the offspring. Meiotic drive is a form of

SD characterized by the loss of gametes carrying a certain allele, such that by the end of meiosis,

the favored allele is passed on more often (Werren 2011; Sandler and Novitski 1957). Many

Drosophila species exhibit SD of the entire X chromosome in males (reviewed in Jaenike 2001), but it is sometimes unclear whether this SD occurs during meiosis, and is truly "meiotic" drive

(Policansky 1974; Pardo-Manuel de Villena and Sapienza 2001), so we conservatively refer to this phenomenon as X chromosome segregation distortion or the “sex-ratio” (SR) trait. The SR trait appears during either meiosis or after, during sperm maturation (reviewed in Presgraves 2008) and biases transmission of the male’s X chromosome, causing a higher ratio of female relative to male progeny. Since the distorter is located on the X chromosome, the resultant females produce male offspring of which at least half exhibit SR. Continuing the cycle, those SR male offspring then produce a disproportionately large number of female SR-carrier offspring relative to male non-carrier offspring. Some SR factors are associated with fertility reduction, so though they are not selected for, SR factors can rise in frequency quickly due to the transmission advantage alone.

The spread of factors causing segregation distortion, such as SR, can initiate a genetic conflict, where selfish genetic elements are detrimental to their host or decrease transmission of other genetic elements, while increasing transmission of themselves (Werren 2011). Due to the spread of SR X chromosomes, selection will favor other chromosomes that bear loci suppressing

SR, hence recovering their own transmission. After SR suppression, new X chromosome distorters (or new modifiers that restore the original distorter) that arise will again spread through the population, reinitiating selection for new suppressors. As these elements jockey for higher frequency, an arms race is set off – potentially accumulating modifiers that suppress distortion, as well as modifiers that enhance distortion, and likely increasing divergence between populations (Carvalho et al. 1997; Hall 2004). A suppressor may be specific to a particular

distorter, and therefore may not function in hybrids when confronted with different distorters.

Suppression malfunction in hybrids could lead to defects in chromosomal segregation, for example, mutual distortion from two unsuppressed homologs may prevent both homologs from entering gametes, resulting in aneuploidy, gamete failure, and hybrid sterility (Hurst and

Pomiankowski 1991; Frank 1991). Since hybrid sterility prevents gene exchange between taxa, genetic conflict can possibly contribute to speciation via arms races and the resultant formation of reproductive incompatibilities.

If this type of genetic conflict leads to speciation, then hybrid sterility between species should sometimes be associated with segregation distortion (reviewed in: Presgraves 2010;

McDermott and Noor 2010; Johnson 2010). Indeed, studies in Drosophila simulans/D. mauritiana and D. pseudoobscura USA/ D. pseudoobscura Bogota have identified that genes causing hybrid sterility also cause segregation distortion in hybrids (Tao et al. 2001; Phadnis and Orr 2009).

However, the distorter/sterility alleles from these two studies have only been detected in systems of “cryptic distortion,” where the distortion was not identified within species – only in species hybrids. Such cases may suggest an evolutionary history of segregation distortion within species causing hybrid sterility, or merely a hybrid defect, acting simultaneously with hybrid sterility but without causation. In contrast, the model system used here, Drosophila persimilis , has alleles causing SR within species. Observing an association between alleles causing segregation distortion within species and alleles causing hybrid sterility between species provides a new type of support for the genetic conflict models of speciation.

3.1.2 Drosophila persimilis "sex-ratio" and hybrid sterility alleles on the X chromosome

Here, we investigate a strain of Drosophila persimilis which exhibits SR (SR D. persimilis ), 38

and carries the distorter(s) within an inversion on the right arm of the X chromosome (XR)

(Sturtevant and Dobzhansky 1936). The XR of SR D. persimilis has a different inversion arrangement than Standard (non sex-ratio) D. persimilis , but shares the chromosomal arrangement with Standard D. pseudoobscura (used to map hybrid sterility—see Figure 3). D. pseudoobscura is the sister species of D. persimilis , and when they hybridize, male hybrid offspring are sterile, while female hybrid offspring are fertile. Some strains of D. pseudoobscura also exhibit the SR trait, but those strains carry a chromosomal arrangement that differs from both Standard

D. pseudoobscura and SR D. persimilis (Sturtevant and Dobzhansky 1936). Since the XR of SR D. persimilis and Standard D. pseudoobscura is homosequential, recombination along the XR can proceed in hybrid female gametes, unlike in inversion heterozygotes where recombination products from within the inversion are not recovered in the offspring. Historically, fine-mapping hybrid sterility loci between D. persimilis and D. pseudoobscura has been difficult because Standard lines of both species (which are heterozygous for large inversions) are often used. Since hybrid sterility loci in these lines are located within inversions (Noor et al. 2001a), the only surviving progeny in Standard hybrids are non-recombinant, making mapping within the inversion impossible.

Previous studies mapped sterility factors between D. persimilis and D. pseudoobscura

(Noor et al. 2001a; Dobzhansky 1936; Orr 1989; Wu and Beckenbach 1983), and distorters in SR D. persimilis (Wu and Beckenbach 1983) to the XR chromosome arm. Wu and Beckenbach (1983) were the first to describe a possible association between segregation distortion and hybrid sterility in D. persimilis and D. pseudoobscura . They introgressed sections of the SR XR from D. persimilis into D. pseudoobscura , and observed that certain segments (at least three loci) of the SR

Figure 3: Orientation of inversions and location of markers along XR. (A) Arrows indicate the orientation of the inversion, located from band 27D to band 38 on the D. pseudoobscura polytene chromosome (images of chromosomes adapted from Figures 8 and 9 of Schaeffer et al. (2008), with permission from Genetics Society of America). SR D. persimilis and Standard (nonSR) D. pseudoobscura are homosequential for the XR inversion, while Standard D. persimilis carries a unique arrangement. (B) The XR of D. pseudoobscura was used to map the marker locations, given its better coverage and annotation (Schaeffer et al. 2008). Markers represented only three of the eight scaffolds (group 6, group 8a, and group8b), since our work focused on the region carrying the inversion. The marker locations are indicated to scale based on the physical location; the recombination distance (cM) indicated between each marker is based on our sterility map results.

D. persimilis XR marked by visible mutations resulted in hybrid sterility in a D. pseudoobscura background. Orr (1989) also observed that the SR XR from D. persimilis increased the proportion of sterile hybrids. In contrast, when the Standard XR from D. persimilis is crossed into a D. pseudoobscura background, it reduces the proportion of sterile hybrids (Noor et al. 2001a). This combination of results provides circumstantial evidence of an association between segregation distortion and hybrid sterility in these species, associated with factors on the XR chromosome arm. Here, we expand on Wu and Beckenbach’s work in this system by using more markers to map the responsible regions.

Our work describes the first direct test of an association between segregation distortion

within species and sterility in hybrid males-- an expansion on previous studies. We found evidence of an association between the two phenotypes and mapped both traits to overlapping regions on the X chromosome. We speculate that the sex-ratio trait in D. persimilis contributes to hybrid sterility between D. persimilis and D. pseudoobscura , and therefore contributes to speciation.

3.2 Materials and Methods

3.2.1 Fly stocks

The D. persimilis MSH1993 line (Standard XR chromosome arrangement) was derived from females collected at Mount Saint Helena, California, in 1993 (Noor 1995). D. persimilis Santa

Cruz Island (SCI) was obtained from the Drosophila Species Stock Center (stock number

14011-0111.50). This line contained both SR and Standard flies – sublines were established of

Standard D. persimilis SCI, and strongly distorting SR D. persimilis SCI. The strongly distorting subline was created by selecting individuals each generation that produced a strong female- biased sex ratio. This selection was continued for eleven generations. The strongly distorting subline was used here for the crosses to map both hybrid sterility and segregation distortion. The

D. pseudoobscura white line was obtained from the Drosophila Species Stock Center (stock number

14011-0121.12).

3.2.2 Fly crosses

For the cross used to map sterility (Figure 4A): D. pseudoobscura white (hereafter psw) females were collected as virgin adults and maintained for at least six days to reach sexual maturity and receptivity. After six days, psw females were crossed to SR D. persimilis males from

Figure 4: Crossing scheme to map sterility and segregation distortion on the X chromosome. Long boxes indicate X chromosomes, and short boxes indicate the Y chromosome (autosomes are not shown). The crosses for sterility (A) and segregation distortion (B) both start by crossing D. pseudoobscura white (white) to SR D. persimilis SCI (black). F 1 hybrid females are then either backcrossed to D. pseudoobscura white for the sterility cross, or crossed to D. persimilis MSH1993 (gray) for the distortion cross. The resultant recombinant males are then backcrossed to their respective paternal species, BCps males from panel A are scored for fertility, and sex ratios of their progeny are counted. the strongly distorting subline of D. persimilis SCI. F 1 females were backcrossed to psw males to generate backcross male progeny (hereafter “BCps males”) for fertility assays and preliminary tests of linkage between sterility and distortion factors. Single pair crosses of BCps males and psw females were set up, and after 2 days, the male was collected, assayed for fertility, and genotyped. The female remained in the vial for another 7-8 days to lay eggs. If larvae are present after a total of 9-10 days, the female would be discarded, and the cross would be kept to later count the sex ratio of the progeny.

As we were only interested in mapping hybrid sterility factors that reside on the XR chromosome arm (where distortion factor(s) are located), we sought to limit the flies used for analysis to those without other regions known to contribute to hybrid male sterility. We limited the dataset in two ways. First, since the red eye allele is associated with hybrid sterility factors on

the D. persimilis XL (Orr 1987; Noor et al. 2001a), we only assayed white-eyed BCps male progeny, which would bear the fertile XL alleles in a D. pseudoobscura background. Therefore any observed hybrid sterility can be attributed to factors on the XR without interference from the XL.

Second, prior to scoring markers on the XR chromosome arm, we scored microsatellite markers on the XL and sterility-conferring 2nd chromosome, and limited the dataset to just those flies bearing the D. pseudoobscura (non-sterility conferring) allele at both loci (see below).

For the cross used to map segregation distortion (Figure 4B): The F 1 females from the sterility cross were crossed to D. persimilis MSH1993 males to generate backcross male progeny

(hereafter “BCper males”). Red-eyed BCper males were selected to minimize hybrid sterility effects, since the XL inversion would be of D. persimilis origin. For this cross, all white-eyed

BCper males are fully sterile, thus interfering with mapping segregation distortion, which requires fertility to observe. Single-pair crosses of BCper males and D. persimilis MSH1993 females were set up, and if larvae were present in the vial after 9-10 days, the male was collected for genotyping, and the female was discarded. Numbers of male and female progeny were counted for each fertile cross to obtain sex ratios. All crosses were performed on standard sugar/yeast/agar medium at 20° ± 1° and 80% relative humidity.

3.2.3 Fertility assays

BCps adult males were collected two days after setting up the cross to psw females, and maintained alone in food-containing vials. One to three days later, the fertility of each backcross male was assessed by dissection of the testes in Ringer’s solution following Coyne (1984). A male was scored as “fertile” if at least one motile sperm was observed and “sterile” if no motile sperm were observed. Treating fertility as a binary trait is conservative (Campbell and Noor 2001),

although other methods of scoring sperm motility exist (Davis and Wu 1996; Reed et al. 2008;

Moehring et al. 2006). All dissected BCps males were labeled and stored at -20°.

3.2.4 Microsatellite genotyping

DNA was isolated from all dissected BCps and BCper males following the Gloor and

Engels (1992) protocol. Microsatellite genotyping was performed in two steps. First, all BCps males were genotyped for markers associated with each inversion that distinguishes D. pseudoobscura from D. persimilis . The markers used for this initial screen were DPSX046 (XL),

DPSX014 (XR), and DPS2026 (2). Primer sequences for all markers are available in Appendix C.

Since we are interested in mapping traits located on the XR, two additional XR markers were added: DPSX063, and DPSX021B2. These markers denoted the species identity of the inversion arrangement on these chromosome arms. Second, only those BCps males that were hemizygous or homozygous for the D. pseudoobscura allele at the XL and 2 nd chromosome inversion markers were further genotyped at additional markers on the XR. The markers used on this limited set of flies were DPSX029, DPSX007, DPSX048, DPSX024, DPSX030, DPSX012, and DPSX062. Locations of these and the preliminary XR markers are shown in Figure 3B. PCR amplification protocol and touchdown cycle details are described in Noor et al. (2001a) and Palumbi (1996), respectively.

PCR products were visualized on acrylamide gels on LiCor 4200 and 4300 DNA sequencer/analyzers.

3.2.5 Data Analysis

To analyze hybrid sterility in BCps males, all males included in the limited set were used for mapping (a total of 1898 males). All males that produced 20 or greater progeny were also used for a preliminary test of linkage between sterility and distorter loci. Scoring at least 20

progeny enhances detection of moderate segregation distortion, so crosses producing fewer than

20 progeny were not scored for this phenotype. Numbers of females and male progeny from each

BCps male were counted and tested for distortion using a Chi-square test for goodness-of-fit, comparing the observed sex ratio to an expected 1:1 sex ratio. The number of estimated false positives was determined using sex ratio data collected from Standard males that produced 20+ progeny, and equals the number of sex ratios (fraction of females) greater than 2 standard deviations above the mean. To map segregation distortion in BCper males, only males that produced 15 or greater progeny were used to ensure any segregation distortion would be detectable.

For BCps and BCper analyses, recombination distances were obtained using OneMap

(Margarido et al. 2007) via R 2.13.1 (Ihaka and Gentleman 1996) (see Figure 3B). Both traits were mapped using Composite Interval Mapping (CIM) in Windows QTL Cartographer 2.5_009

(Wang et al. 2011), and permuted 1000 times to establish a significance threshold. While CIM does not account for binary data (e.g. our sterility data), Categorical Trait Multiple Interval

Mapping (CT-MIM) in Windows QTL Cartographer does. However, CT-MIM fails when using sex-linked and hemizygous data (Shengchu Wang, personal communication), and using CIM to analyze binary data appears comparable to CT-MIM (Moehring et al. 2004). The BCper analysis to map segregation distortion used the fraction of the total progeny that are female, and therefore

CIM is appropriate.

3.3 Results

3.3.1 Characterization of D. persimilis SR

Unlike previous reports for homozygous SR D. pseudoobscura (Wallace 1948, Curtsinger

and Feldman 1980, Beckenbach 1983, Beckenbach 1996, but see Gebhardt and Anderson 1993), our homozygous SR D. persimilis females from Santa Cruz Island (SCI) were fertile, and therefore stocks of SR were easily made. The D. persimilis SCI line from the Drosophila Species Stock

Center was polymorphic for the SR inversion, so we created sublines homozygous for either the

SR or Standard inversion. The subline used in the crosses exhibited an average of 73% female progeny. The presence of the D. persimilis SR inversion was confirmed by polytene squash, and genetic markers were used later that differentiated between the inversion types.

3.3.2 Preliminary test of linkage between hybrid sterility and segregation distortion

Using the results of the hybrid sterility cross, we were able to perform a preliminary test of our primary question: whether loci causing hybrid sterility and segregation distortion are linked. Results from this test would approximate the extent of linkage. If hybrid sterility and segregation distortion are caused by completely linked or the same loci, we should expect that backcross hybrid (BCps) males containing both loci will be sterile, and segregation distortion as measured by the sex-ratio of the nonexistent offspring will be undetectable. BCps males will either inherit both loci and be sterile, or inherit neither locus and be fertile with equal sex ratios.

However, if the loci causing both traits are incompletely linked, recombination should be able to separate them. In this case, we will also observe sterile BCps males inheriting only the sterility factor, but also BCps males inheriting only the segregation distortion factor, who will be fertile with biased sex ratios. Therefore, the presence of biased sex ratios in the progeny of BCps males serves as a preliminary test of linkage of the two traits. Of the 350 BCps males that produced progeny, 9 showed sex ratios significantly different from 1:1 (Chi-Square, p<0.05). Of these 9, 1 shows a significant excess of males and 7 have no region from D. persimilis on their XR, indicating 46

that at least these 8 are false positives. Only 1 BCps male showed a significant excess of female progeny and contained a region of the XR of D. persimilis origin. This BCps male contained D. persimilis genotypes at markers DPSX014 and DPSX029; however, as described below, our QTL map of segregation distortion is only marginally significant at those markers. To determine the predicted number of false positives, we pooled sex ratio data from 216 crosses performed outside this work, all using a Standard male parent- so no segregation distortion was acting. Sex ratios of offspring from 9 out of 216 males were greater than 2 standard deviations above the mean (mean fraction of females: 0.56, SD: 0.103). If 9/216 sex ratios are false positives, we predict 14/350 to be false positives in our BCps dataset. We cannot exclude that the single female-biased, D. persimilis - bearing BCps male is a recombinant between separate segregation distortion- and sterility- conferring factors, but a more parsimonious conclusion is that it is a false positive.

3.3.3 QTL mapping hybrid male sterility between SR D. persimilis SCI and D. pseudoobscura white

To demonstrate that hybrid male sterility and segregation distortion are under the control of the same or linked genes, QTL maps of both traits should exhibit peaks at the same locations. To create the QTL map for hybrid sterility, 5329 BCps males were mated, tested for fertility, genotyped at 2 initial markers: DPSX046 (chromosome XL), DPS2026 (chromosome 2), and genotyped at 3 XR markers: DPSX014, DPSX063, and DPSX021B2. Of these 5329, 1898 exhibited D. pseudoobscura genotypes at the XL and second chromosome. This limited set was genotyped at an additional 7 XR markers at locations shown in Figure 3B. We used CIM in

Windows QTL Cartographer to generate a QTL map, shown in Figure 5, of hybrid sterility between Drosophila persimilis SCI and Drosophila pseudoobscura white . Our QTL map shows a large proximal region of no significant effect, followed by one broad significant region with possibly 47

Figure 5: QTL map along XR of hybrid sterility between SR D. persimilis SCI and D. pseudoobscura white . Map generated using Composite Interval Mapping (CIM) of BCps males with ps genotypes at XL and second chromosome inversions. Significance threshold (LOD 1.5) was calculated by 1000 permutations, shown as the horizontal line. Marker locations are indicated with solid gray arrowheads. three peaks, and a less significant minor peak near the distal end of the inversion. The broad region starts at marker DPSX007 and ends at DPSX030, and is approximately 5.23 Mb long. The second region is between DPSX012 and possibly continues beyond DPSX021B2, and is at least 1.9

Mb long. These regions are too large to identify candidate loci.

3.3.4 QTL Mapping segregation distortion in SR D. persimilis

To create the QTL map for segregation distortion, 10,683 BCper males were mated and genotyped at the same 10 markers used in the sterility map. Of the 10,683 BCper males, only 109 had over 15 progeny. We used CIM in Windows QTL Cartographer to generate the QTL map for segregation distortion shown in Figure 6. Between the markers DPSX014 and DPSX029 is a minor

Figure 6: QTL map of segregation distortion on the D. persimilis SCI XR. Map generated using Composite Interval Mapping (CIM) of BCper males producing 15 or greater progeny. Significance threshold (LOD 1.5) was calculated by 1000 permutations, shown as the horizontal line. Marker locations are indicated with solid gray arrowheads. peak that is 3.69 Mb long. However, given that only two markers define that peak, we cannot be positive of its effect and position. Between the markers DPSX024 and DPSX012 (2.06 Mb) is a peak of major effect, which overlaps with the broad hybrid sterility peak at both DPSX024 and

DPSX030. Our segregation distortion map also has a third minor peak between DPSX012 and

DPSX021B2, but unlike the peak at this same location in the hybrid sterility map, the peak for segregation distortion appears to stop before DPSX021B2. Maps of both traits appear to overlap at two peaks: the major peak in the center of the inversion, and the minor peak distal to the centromere. The segregation distortion map also appears to contain a third proximal peak distinct from the hybrid sterility map. The presence of multiple peaks suggests multiple factors may be required for segregation distortion, as initially observed by Wu and Beckenbach (1983).

3.4 Discussion

In this study, we characterized and mapped SR Drosophila persimilis SCI segregation distortion, and mapped hybrid sterility of this species with its sister species, D. pseudoobscura .

Additionally, we found that these two maps partially overlap, indicating the potential for shared loci causing both segregation distortion within D. persimilis and hybrid sterility between these two species.

3.4.1 Linkage of hybrid sterility and segregation distortion factors

We failed to identify clear recombinants (barring one possible case in 350 that may be a false positive) between XR factors conferring distortion and factors conferring sterility, indicating that the two traits are caused by the same factor or factors very close together. We cannot estimate the actual recombination rate without including the sterile individuals, in whom recombination is undetectable– they could have inherited both sterility and segregation distortion factors (non-recombinant), or inherited only the sterility factor (recombinant).

Regardless, the segregation distortion and hybrid sterility factors in D. persimilis are closely linked to each other, raising the possibility that the factors are associated or identical.

The major peaks of both hybrid sterility and segregation distortion maps colocalize, despite the large width of the sterility map. They also share a minor peak towards the telomere of the XR, flanking marker DPSX021B2. Combined with the data from the preliminary linkage test, evidence suggests an association between the two traits. However, the broad peak of the hybrid sterility map could be hiding multiple factors contributing to hybrid sterility between D. persimilis and D. pseudoobscura . Multiple peaks in our segregation distortion map also suggest multiple required factors (Figure 6). A similar finding suggested at least 3 segregation distortion

factors on the XR (Wu and Beckenbach 1983).

Using a species like D. persimilis that exhibits segregation distortion within species to understand the possible link between segregation distortion, hybrid sterility, and speciation provides for more direct testing than using cryptic hybrid distortion – which may merely be a hybrid incompatibility itself. This work built on studies done by Tao et al. (2001) and Phadnis and Orr (2009) by directly testing for an association between the two traits, and expanded on Wu and Beckenbach (1983) by adding more individuals to map hybrid sterility and more markers for both traits. Future work could include combining elements of Wu and Beckenbach (1983) and this work by using SR D. persimilis individuals with visible mutations linked to the QTLs to analyze individuals more likely to be informative.

The association between hybrid incompatibilities and segregation distortion continues to strengthen as more genes are discovered that influence both phenotypes: tmy (Tao et al. 2001),

Ovd (Phadnis and Orr 2009), nad6/PPR gene (Case and Willis 2008; Barr and Fishman 2010), and other hybrid incompatibility genes suggested to be influenced by segregation distortion

(reviewed in Johnson 2010). This association also strengthens the link to speciation, providing more evidence for Frank’s (1991) and Hurst and Pomiankowski’s (1991) hypothesis that segregation distortion can cause hybrid sterility in some cases. In further support of their hypothesis, Bastide et al. (2011) provides evidence that a possible arms race between SR segregation distorters and suppressors in the D. simulans Paris system is ongoing.

3.4.2 QTL Mapping

Wu and Beckenbach (1983) failed to observe the SR trait in any of their isolated segments of the SR XR of D. persimilis when in a D. pseudoobscura background, suggesting that the presence

of all four segments were required for segregation distortion to be expressed. They mapped a region causing hybrid sterility linked to the sepia (se ) gene, which is located about 0.5 Mb proximal to our marker DPSX029, which does show an effect on segregation distortion (Figure 6), but not hybrid sterility (Figure 5). Other work has demonstrated the strong effect of the SR

D.persimilis XR on hybrid sterility with D. pseudoobscura (Orr 1989), while the Standard XR from

D. persimilis reduces the proportion of sterile hybrids (Noor et al. 2001a). These previous studies’ results provide additional circumstantial evidence of an association of factors located on the XR with segregation distortion and hybrid sterility in these species.

The segregation distortion QTL map would be more precise with a larger sample size; however, given the success rate of crosses, a larger sample size would be extremely difficult (e.g.

100,000 crosses to generate 1000 individuals with 15 or greater progeny). A lower cutoff value would increase the sample size, but even with a cutoff value of 5 progeny, the sample size only increases from 109 to 205. Our cutoff of 15 progeny is within the range used by recent studies:

Phadnis (2011) used 5 progeny, Dyer (2011) used 20 progeny, and Bastide et al. (2011) used 70 progeny (though D. simulans , used by Bastide et al., is more fecund than D. pseudoobscura or D. persimilis ). Using Chi-square goodness-of-fit tests, a significantly biased sex ratio is undetectable until at least 8 progeny are counted, and even then the p-value is marginally significant

(p=0.0455).

3.4.3 Characterization of segregation distortion in D. persimilis

Despite their overall genetic similarity, D. persimilis and D. pseudoobscura each maintain distinct segregation distortion systems. The SR XR of D. pseudoobscura contains three nonoverlapping inversions (Dobzhansky 1939; Beckenbach 1996), while D. persimilis only

contains one (Sturtevant and Dobzhansky 1936). D. pseudoobscura females homozygous for the SR inversion have reduced fertility compared to both Standard homozygotes, and inversion heterozygotes (Wallace 1948, Curtsinger and Feldman 1980, Beckenbach 1983, Beckenbach 1996, but see Gebhardt and Anderson 1993). The SR D. persimilis from Santa Cruz Island does not appear to inflict reduced fertility in female SR inversion homozygotes allowing the strain to be easily used as a stock.

Critical for this study, SR D. persimilis and ST D. pseudoobscura share the same XR chromosomal arrangement, allowing mapping of SR factors, unlike SR D. pseudoobscura which carries unique inversion arrangements, preventing recovery of recombinant progeny. While more is known about the within-species fertility effects of SR in D. pseudoobscura (Wallace 1948;

Beckenbach 1978; Curtsinger and Feldman 1980; Beckenbach 1981; Wu 1983a; Wu 1983b;

Beckenbach 1996; Price et al. 2008a; Price et al. 2008b; Price et al. 2009), SR D. persimilis actually serves as a better model system for understanding the genetic basis of SR given that it is homosequential with the Standard D. pseudoobscura XR-chromosome.

In summary, we characterized and developed lines of SR D. persimilis , mapped segregation distortion within D. persimilis , and mapped hybrid sterility between D. persimilis and

D. pseudoobscura . Our maps suggest an association between both traits, hinting at a possible causal relationship. This work expands on previous mapping studies and opens opportunities for other research using SR D. persimilis . Future work in all SR systems will hopefully provide answers to the various questions surrounding segregation distortion, including its association with hybrid sterility and speciation.

4. Summary

Understanding the genetic basis of speciation, including hybrid sterility and its possible causes, is extremely important to the field of evolution. Knowing how species changed in the past can help biologists predict how species are currently changing or will change in the future. Many studies of hybrid sterility only use single strains of two species to map QTLs; however, if variation exists within either species, the hybrid sterility QTLs may not have the broad isolating effect that authors usually assume. My work here tests a prior finding of hybrid sterility QTLs using Drosophila persimilis and D. pseudoobscura bogotana . We repeated the experiment using different strains of D. persimilis to test for variation in regions known to confer hybrid sterility.

We observed little variation at these regions in this system; however, new studies continue to demonstrate within-species variation for hybrid incompatibilities (Bracewell et al. 2011;

Kozlowska et al. 2011; Turner et al. 2012).

A previous study (Chang and Noor 2007) mapped hybrid sterility QTLs on the second, third and fourth chromosomes of D. persimilis that act in a D. pseudoobscura bogotana background.

We further tested introgressed D. pseudoobscura USA copies of the second chromosome locus for hybrid sterility effects in the D. pseudoobscura bogotana background. The Bogota allele

(introgressed into D. persimilis ) did confer hybrid sterility in the USA background, suggesting that the second chromosome QTL is ancestral to D. persimilis and D. pseudoobscura USA and was lost in the Bogota lineage, or gene flow between D. persimilis and D. pseudoobscura USA can transfer hybrid incompatibilities with a third taxa. Since this work was published, a new study

(Phadnis 2011) mapped D. pseudoobscura USA hybrid sterility alleles in a D. pseudoobscura bogotana background. Two of the mapped alleles were in the same position as the second and third

chromosome QTLs identified in Chang and Noor (2007). Phadnis (2011) confirmed our introgression experiment:,the same alleles act in both D. pseudoobscura USA and D. persimilis to cause sterility in the Bogota subspecies. Phadnis (2011) also mapped the third chromosome QTL, which we could not do in our introgression experiment, since D. persimilis and D. pseudoobscura bogotana differ in their third chromosome inversion arrangements, making detecting recombinants across that region impossible.

The association of meiotic drive with hybrid sterility has a controversial history, but accumulating work (reviewed in Johnson 2010) supports previous hypotheses that drive can cause hybrid sterility (Frank 1991; Hurst and Pomiankowski 1991). In the first chapter, we elaborate on a possible mechanism where chromatin remodeling caused by meiotic drive can, in turn, lead to hybrid sterility (also reviewed in Sawamura 2012). We argue that changes in chromatin due to meiotic drive may cause failure of meiotic sex chromosome inactivation

(MSCI), where male X chromosomes are inactivated briefly during spermatogenesis. Such failure has been known to cause sterility within-species, and therefore perhaps between-species as well

(though defects in MSCI would need to be suppressed within-species for this hypothesis to be supported). MSCI is known to occur in a variety of organisms (Namekawa and Lee 2009), but recent work demonstrates the controversy over MSCI in Drosophila (Meiklejohn et al. 2011;

Mikhaylova and Nurminsky 2011; Kemkemer et al. 2011). Meiklejohn et al. (2011) does indicate that while evidence of MSCI and dosage compensation is absent, they still observe differential expression on the X chromosome before meiosis, suggestive of some mechanism similar to MSCI and dosage compensation. Since our hypothesis described in the first chapter was dependent only on some form of chromatin remodeling caused by meiotic drive and leading to hybrid

sterility, our hypothesis is not rejected, but it is unlikely that the causal mechanism is MSCI in particular.

Appendix A

Microsatellite markers used in testing variation and allelism. This list does not include markers used in previous studies. F: forward primer, R: reverse primer. We attached an M13 sequence (CACGACGTTGTAAAACGAC) to the 5' end of each forward primer. Marker Chromosome Size (bp) Sequence (F) Sequence (R) DPSX002 XL 150 attcttgtcgctctgttggc tcagctgcgtaacaatctgg DPSX046 XL 119 aaatcgcagcggcattgac aaatgcagagcaagtacacgcatc DPSX030 XR 130 gctaacacacactcgcgcaca tgcacactgtgatggccaaat DPS2022 2 138 ggcgcaaggtccttttttgt tcccgataccgacgaaacatt DPS2026 2 144 cagactcttactacgagcacggaga gcaaatatccttgaagcagatgca DPS2_27.05 2 140 tgtgtgggtggtttgttttgaaacg ccaataactatgtatgacctgacaaccctg DPS2_2395c 2 103 gaactggaaaattgcatggccacc catgccacacagtgagtggc DPS3001 3 150 gggaaaccataagaaaatgcc gtacatgaatcggctacggg DPS4G1a 4 110 atggctgacacagaagcatctgtg cttatgcatgaaatgtgcgcataattggtc DPS34G1h 4 99 taaagcgcaacccatcgaccatatc agcatccacaaagttgatgcctctc DPS4033h 4 106 ttctcggtggcacttcataagcc ctggctggtgttgttgctgc DPS4611966 4 112 aaaacgactcacgagcaaag gagcgctttagcatagggt

Appendix B

Variation in percent fertility between lines of D. persimilis at the collinear QTLs, including Q3. Each line of D. persimilis was backcrossed to D. pseudoobscura bogotana ER white, and the percent fertility at each genotype is listed for each cross. The p-value listed represents statistical significance of the difference between the percent fertilities of each cross, and was calculated using a G-test (see Methods) or aChi-Square if the G-test failed (see Methods). "bog": D. pseudoobscura bogotana allele, "per": D. persimilis allele, and "het": heterozygous for both D. pseudoobscura bogotana and D. persimilis alleles. "nc": not able to be calculated.

BCbog (MSH1993) BCbog (MSH1) BCbog (MSH3) BCbog (SCI) Line Genotype % Fertility Sample Size % Fertility Sample Size % Fertility Sample Size % Fertility Sample Size p-value 1 Q2=bog, Q3=bog, Q4=bog 87% 86 90% 31 88% 17 84% 38 0.898 2 Q2=bog, Q3=bog, Q4=het 73% 95 100% 33 93% 15 78% 41 0.004 a 3 Q2=bog, Q3=het, Q4=bog 93% 103 74% 43 71% 21 100% 7 nc 4 Q2=bog, Q3=het, Q4=het 67% 93 49% 47 67% 24 60% 10 0.222 5 Q2=het, Q3=bog, Q4=bog 65% 67 83% 35 100% 25 52% 21 0.0004 a 6 Q2=het, Q3=bog, Q4=het 33% 60 50% 34 53% 17 55% 31 0.149 7 Q2=het, Q3=het, Q4=bog 65% 74 38% 42 41% 22 67% 6 0.021 8 Q2=het, Q3=het, Q4=het 30% 69 22% 41 24% 29 14% 7 0.645

Appendix C

Microsatellite markers used in mapping segregation distortion within D. persimilis SCI and hybrid sterility between D. persimilis SCI and D. pseudoobscura white . F: forward primer, R: reverse primer. We attached an M13 sequence (CACGACGTTGTAAAACGAC) to the 5' end of each forward primer. Marker Chromosome Size (bp) Sequence (F) Sequence (R) DPSX046 XL 119 aaatcgcagcggcattgac aaatgcagagcaagtacacgcatc DPS2026 2 144 cagactcttactacgagcacggaga gcaaatatccttgaagcagatgca DPSX014 XR 118 atgtgtatctgtgcatgtgca actccacacccaaggaacaat DPSX029 XR 132 actgtgtgcctgggtgaacct gcccagctgagctttcagctt DPSX007 XR 150 cactcgaggttattgaacgg aatctatggcgggttctaag DPSX048 XR 121 ggaaatgattcagctgctggg ccgagctaatcaaattaccagacg DPSX063 XR 100 gctctgctctggacagcc tgcgttgcctgataaaacct DPSX024 XR 199 tttgtgaggcagcagcagc ttcgtcctccatcctcattcg DPSX030 XR 130 gctaacacacactcgcgcaca tgcacactgtgatggccaaat DPSX012 XR 112 tatgtccctgtgtgcgtgtgt acagcacttgcttttgctga DPSX062 XR 106 cagagacagccccaaagaga ttagtggcacaaacagacgg DPSX021B2 XR 180 gagctaagccgatttcctccct tgccaacaacagacagccga

References

Aquadro, C. F., A. L. Weaver, S. W. Schaeffer and W. W. Anderson (1991). Molecular evolution of inversions in Drosophila pseudoobscura - the amylase gene region. Proceedings of the National Academy of Sciences of the United States of America 88 (1): 305-309.

Atlan, A., C. Capillon, N. Derome, D. Couvet and C. Montchamp-Moreau (2003). The Evolution of Autosomal Suppressors of Sex-Ratio Drive in Drosophila simulans . Genetica 117 (1): 47-58.

Atlan, A., D. Joly, C. Capillon and C. Montchamp-Moreau (2004). Sex-ratio distorter of Drosophila simulans reduces male productivity and sperm competition ability. Journal of Evolutionary Biology 17 (4): 744-751.

Babcock, C. S. and W. W. Anderson (1996). Molecular evolution of the sex-ratio inversion complex in Drosophila pseudoobscura : Analysis of the esterase-5 gene region. Molecular Biology and Evolution 13 (2): 297-308.

Barbash, D. A. and M. Ashburner (2003). A novel system of fertility rescue in Drosophila hybrids reveals a link between hybrid lethality and female sterility. Genetics 163 (1): 217-226.

Barbash, D. A., P. Awadalla and A. M. Tarone (2004). Functional divergence caused by ancient positive selection of a Drosophila hybrid incompatibility locus. PLoS Biology 2(6): 839-848.

Barbash, D. A. and J. G. Lorigan (2007). Lethality in Drosophila melanogaster /Drosophila simulans species hybrids is not associated with substantial transcriptional misregulation. Journal of Experimental Zoology Part B-Molecular and Developmental Evolution 308B (1): 74-84.

Barbash, D. A., D. F. Siino, A. M. Tarone and J. Roote (2003). A rapidly evolving MYB- related protein causes species isolation in Drosophila. Proceedings of the National Academy of Sciences of the United States of America 100 (9): 5302-5307.

Barnwell, C. V. and M. A. F. Noor (2008). Failure to replicate two mate preference QTLs across multiple strains of Drosophila pseudoobscura . Journal of Heredity 99 (6): 653- 656.

Barr, C. M. and L. Fishman (2010). The nuclear component of a cytonuclear hybrid incompatibility in Mimulus maps to a cluster of pentatricopeptide repeat genes. Genetics 184 (2): 455-465.

Bastide, H., M. Cazemajor, D. Ogereau, N. Derome, F. Hospital and C. Montchamp- Moreau (2011). Rapid rise and fall of selfish sex-ratio X chromosomes in Drosophila simulans : spatiotemporal analysis of phenotypic and molecular data. Molecular biology and evolution 28 (9): 2461-2470.

Beckenbach, A. (1981). Multiple mating and the sex-ratio trait in Drosophila pseudoobscura . Evolution; international journal of organic evolution 35 (2): 275-281.

Beckenbach, A. T. (1978). The "Sex-ratio" trait in Drosophila pseudoobscura : Fertility relations of males and meiotic drive. American Naturalist 112 (983): 97-117.

Beckenbach, A. T. (1996). Selection and the ''sex-ratio'' polymorphism in natural populations of Drosophila pseudoobscura . Evolution; international journal of organic evolution 50 (2): 787-794.

Bracewell, R. R., M. E. Pfrender, K. E. Mock and B. J. Bentz (2011). Cryptic postzygotic isolation in an eruptive species of bark beetle ( Dendroctonus ponderosae ). Evolution 65 (4): 961-975.

Brown, K. M., L. M. Burk, L. M. Henagan and M. A. F. Noor (2004a). Data from: A test of the chromosomal rearrangement model of speciation in Drosophila pseudoobscura . Dryad Digital Repository: doi:10.5061/dryad.1150.

Brown, K. M., L. M. Burk, L. M. Henagan and M. A. F. Noor (2004b). A test of the chromosomal rearrangement model of speciation in Drosophila pseudoobscura . Evolution 58 (8): 1856-1860.

Burkhardt, D. and I. de la Motte (1985). Selective pressures, variability, and sexual dimorphism in stalk-eyed flies (Diopsidae). Naturwissenschaften 72 (4): 204-206.

Burkhardt, D. and I. de la Motte (1988). Big antlers are favored - female choice in stalk- eyed flies (Diptera, Insecta), field collected harems and laboratory experiments. Journal of Comparative Physiology A - Sensory Neural and Behavioral Physiology 162 (5): 649-652.

Campbell, R. and M. A. F. Noor (2001). Assessing hybrid male fertility in Drosophila species: Correlation between sperm motility and production of offspring. Drosophila Information Service 84 : 6-9.

Capillon, C. and A. Atlan (1999). Evolution of driving X chromosomes and resistance factors in experimental populations of Drosophila simulans . Evolution 53 (2): 506- 517.

Carroll, L. S., S. Meagher, L. Morrison, D. J. Penn and W. K. Potts (2004). Fitness effects of a selfish gene (the Mus T complex) are revealed in an ecological context. Evolution 58 (6): 1318-1328.

Carvalho, A. B. and L. B. Klaczko (1993). Autosomal suppressors of sex-ratio in Drosophila mediopunctata . Heredity 71 : 546-551.

Carvalho, A. B. and L. B. Klaczko (1994). Y-linked suppressors of the sex-ratio trait in Drosophila mediopunctata . Heredity 73 : 573-579.

Carvalho, A. B., S. C. Vaz and L. B. Klaczko (1997). Polymorphism for Y-linked suppressors of sex-ratio in two natural populations of Drosophila mediopunctata . Genetics 146 (3): 891-902.

Case, A. L. and J. H. Willis (2008). Hybrid male sterility in Mimulus (Phrymaceae) is associated with a geographically restricted mitochondrial rearrangement. Evolution; international journal of organic evolution 62 (5): 1026-1039.

Cattani, M. V. and D. C. Presgraves (2009). Genetics and lineage-specific evolution of a lethal hybrid incompatibility between Drosophila mauritiana and its sibling species. Genetics 181 : 1545-1555.

Chang, A. S. and M. A. F. Noor (2007). The genetics of hybrid male sterility between the allopatric species pair Drosophila persimilis and D. pseudoobscura bogotana : dominant sterility alleles in collinear autosomal regions. Genetics 176 (1): 343-349.

Chang, A. S. and M. A. F. Noor (2010). Epistasis modifies the dominance of loci causing hybrid male sterility in the Drosophila pseudoobscura species group. Evolution 64 (1): 253-260.

Charlesworth, B., J. A. Coyne and N. H. Barton (1987). The relative rates of evolution of sex chromosomes and autosomes. American Naturalist 130 (1): 113-146.

Charlesworth, B., J. A. Coyne and H. A. Orr (1993). Meiotic Drive and Unisexual Hybrid Sterility - a Comment. Genetics 133 (2): 421-424.

Charlesworth, B. and D. L. Hartl (1978). Population dynamics of segregation distorter polymorphism of Drosophila melanogaster . Genetics 89 (1): 171-192.

Coyne, J. A. (1984). Genetic basis of male sterility in hybrids between 2 closely related species of Drosophila. Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 81 (14): 4444-4447.

Coyne, J. A., B. Charlesworth and H. A. Orr (1991). Haldane's rule revisited. Evolution 45 (7): 1710-1714.

Coyne, J. A. and H. A. Orr (1989). Patterns of Speciation in Drosophila. Evolution 43 (2): 362-381.

Coyne, J. A. and H. A. Orr (1993). Further Evidence against Meiotic-Drive Models of Hybrid Sterility. Evolution; international journal of organic evolution 47 (2): 685- 687.

Coyne, J. A. and H. A. Orr (2004). Speciation. Sunderland, Mass., Sinauer Associates.

Curtsinger, J. W. and M. W. Feldman (1980). Experimental and theoretical analysis of the "sex-ratio" polymorphism in Drosophila pseudoobscura . Genetics 94 (2): 445-466.

Davis, A. W. and C. I. Wu (1996). The broom of the sorcerer's apprentice: The fine structure of a chromosomal region causing reproductive isolation between two sibling species of Drosophila. Genetics 143 (3): 1287-1298.

Demuth, J. P. and M. J. Wade (2007). Population differentiation in the beetle Tribolium castaneum. II. Haldane's rule and incipient speciation. Evolution; international journal of organic evolution 61 (3): 694-699.

Dobzhansky, T. (1933). On the sterility of the interracial hybrids in Drosophila pseudoobscura. Proceedings of the National Academy of Sciences of the United States of America 19 : 397-403.

Dobzhansky, T. (1936). Studies on hybrid sterility. II. Localization of sterility factors in Drosophila pseudoobscura hybrids. Genetics 21 (2): 113-135.

Dobzhansky, T. (1939). Facts and problems of the "sex-ratio" condition in Drosophila. Scientia Genetica 11 : 67-75.

Dobzhansky, T. (1973). Is there gene exchange between Drosophila pseudoobscura and Drosophila persimilis in their natural habitats. American Naturalist 107 (954): 312- 314.

Dyer, K. A. (2011). Local selection underlies the geographic distribution of sex-ratio drive in Drosophila neotestacea . Evolution: doi: 10.1111/j.1558-5646.2011.01497.x.

England, B. P., A. Admon and R. Tjian (1992). Cloning of Drosophila transcription factor Adf-1 reveals homology to Myb oncoproteins. Proceedings of the National Academy of Sciences of the United States of America 89 (2): 683-687.

Ferree, P. M. and D. A. Barbash (2009). Species-specific heterochromatin prevents mitotic chromosome segregation to cause hybrid lethality in Drosophila. PLoS Biology: In press.

Fishman, L. and J. H. Willis (2005). A novel meiotic drive locus almost completely distorts segregation in mimulus (monkeyflower) hybrids. Genetics 169 (1): 347- 353.

Frank, S. A. (1991). Divergence of meiotic drive-suppression systems as an explanation for sex-biased hybrid sterility and inviability. Evolution 45 (2): 262-267.

Fry, C. L. and G. S. Wilkinson (2004). Sperm survival in female stalk-eyed flies depends on seminal fluid and meiotic drive. Evolution 58 (7): 1622-1626.

Gloor, G. B. and W. R. Engels (1992). Single-fly DNA preps for PCR. Drosophila Information Service 71 : 148-149.

Good, J. M., M. A. Handel and M. W. Nachman (2008). Asymmetry and polymorphism of hybrid male sterility during the early stages of speciation in house mice. Evolution; international journal of organic evolution 62 (1): 50-65.

Haldane, J. B. S. (1922). Sex ratio and unisexual sterility in hybrid animals. Journal of Genetics 12 (2): 101-109.

Hall, D. W. (2004). Meiotic drive and sex chromosome cycling. Evolution 58 (5): 925-931.

Hartl, D. L. (1975). Modifier Theory and Meiotic Drive. Theoretical population biology 7(2): 168-174.

Hartl, D. L., Hiraizum.Y and J. F. Crow (1967). Evidence for Sperm Dysfunction as Mechanism of Segregation Distortion in Drosophila Melanogaster. Proceedings of the National Academy of Sciences of the United States of America 58 (6): 2240- &.

Hauschteck-Jungen, E. (1990). Postmating reproductive isolation and modification of the 'sex-ratio' trait in Drosophila subobscura induced by the sex chromosome gene arrangement A 2+3+5+7 . Genetica 83 : 31-44.

Hauschteck-Jungen, E. and D. L. Hartl (1982). Defective histone transition during spermiogenesis in heterozygous segregation distorter males of Drosophila melanogaster . Genetics 101 (1): 57-69.

Henikoff, S., K. Ahmad and H. S. Malik (2001). The centromere paradox: stable inheritance with rapidly evolving DNA. Science 293 (5532): 1098-1102.

Hense, W., J. F. Baines and J. Parsch (2007). X chromosome inactivation during Drosophila spermatogenesis. PLoS Biology 5(10): 2288-2295.

Hey, J. and R. Nielsen (2004). Multilocus methods for estimating population sizes, migration rates and divergence time, with applications to the divergence of Drosophila pseudoobscura and D. persimilis. Genetics 167 (2): 747-760.

Hollingshead, L. (1930). A lethal factor in Crepis effective only in an interspecific hybrid. Genetics 15 (2): 114-140.

Hoskin, C. J., M. Higgie, K. R. McDonald and C. Moritz (2005). Reinforcement drives rapid allopatric speciation. Nature 437 (7063): 1353-1356.

Hurst, L. D. and A. Pomiankowski (1991). Causes of sex-ratio bias may account for unisexual sterility in hybrids - a new explanation of Haldane's rule and related phenomena. Genetics 128 (4): 841-858.

Hutter, P. and M. Ashburner (1987). Genetic rescue of inviable hybrids between Drosophila melanogaster and its sibling species. Nature 327 (6120): 331-333.

Ihaka, R. and R. Gentleman (1996). R: a language for data analysis and graphics. Journal of Computational and Graphical Statistics 5(3): 299-314.

Jaenike, J. (1996). Sex-ratio meiotic drive in the Drosophila quinaria group. American Naturalist 148 (2): 237-254.

Jaenike, J. (1999). Suppression of sex-ratio meiotic drive and the maintenance of Y- chromosome polymorphism in Drosophila. Evolution 53 (1): 164-174.

Jaenike, J. (2001). Sex chromosome meiotic drive. Annual Review of Ecology and Systematics 32 : 25-49. 67

James, A. C. and J. Jaenike (1990). Sex-ratio meiotic drive in Drosophila testacea . Genetics 126 (3): 651-656.

James, A. C. and J. Jaenike (1992). Determinants of mating success in wild Drosophila testacea . Animal Behaviour 44 (1): 168-170.

Johnson, N. A. (2010). Hybrid incompatibility genes: remnants of a genomic battlefield? Trends in Genetics 26 (7): 317-325.

Johnson, N. A. and C. I. Wu (1992). An empirical test of the meiotic drive models of hybrid sterility - sex-ratio data from hybrids between Drosophila simulans and Drosophila sechellia . Genetics 130 (3): 507-511.

Kelly, W. G., C. E. Schaner, A. F. Dernburg, M. H. Lee, S. K. Kim, A. M. Villeneuve and V. Reinke (2002). X-chromosome silencing in the germline of C. elegans. Development 129 (2): 479-492.

Kemkemer, C., W. Hense and J. Parsch (2011). Fine-scale analysis of X chromosome inactivation in the male germ line of Drosophila melanogaster . Molecular Biology and Evolution 28 (5): 1561-1563.

Kozlowska, J. L., A. R. Ahmad, E. Jahesh and A. D. Cutter (2011). Genetic variation for postzygotic reproductive isolation between Caenorhabditis briggsae and Caenorhabditis sp. 9. Evolution: doi: 10.1111/j.1558-5646.2011.01514.x.

Kulathinal, R. J., L. S. Stevison and M. A. Noor (2009). The genomics of speciation in Drosophila: diversity, divergence, and introgression estimated using low- coverage genome sequencing. PLoS Genetics 5(7): e1000550.

Kusano, A., C. Staber, H. Y. E. Chan and B. Ganetzky (2003). Closing the (Ran)GAP on segregation distortion in Drosophila. Bioessays 25 (2): 108-115.

Leman, S. C., Y. G. Chen, J. E. Stajich, M. A. F. Noor and M. K. Uyenoyama (2005). Likelihoods from summary statistics: Recent divergence between species. Genetics 171 (3): 1419-1436.

Lenington, S., C. Coopersmith and J. Williams (1992). Genetic basis of mating preferences in wild house mice. American Zoologist 32 (1): 40-47.

Lenington, S. and K. Egid (1985). Female discrimination of male odors correlated with male genotype at the t-locus - a response to t-locus or H-2-locus variability. Behavior Genetics 15 (1): 53-67.

Lessard, S. (1985). The role of recombination in the modifier theory of autosomal segregation distortion. Theoretical Population Biology 28 (2): 133-149.

Liberman, U. (1976). Modifier theory of meiotic drive - is Mendelian segregation stable. Theoretical Population Biology 10 (2): 127-132.

Lifschytz, E. and D. L. Lindsley (1972). Role of X-chromosome inactivation during spermatogenesis. Proceedings of the National Academy of Sciences of the United States of America 69 (1): 182-186.

Lyon, M. F. (2003). Transmission ratio distortion in mice. Annual Review of Genetics 37 : 393-408.

Lyttle, T. W. (1979). Experimental population genetics of Meiotic Drive systems .II. Accumulation of genetic modifiers of Segregation Distorter (SD) in laboratory populations. Genetics 91 (2): 339-357.

Lyttle, T. W. (1991). Segregation Distorters. Annual review of genetics 25 : 511-557.

Machado, C. A., T. S. Haselkorn and M. A. F. Noor (2007). Evaluation of the genomic extent of effects of fixed inversion differences on intraspecific variation and interspecific gene flow in Drosophila pseudoobscura and D. persimilis . Genetics 175 (3): 1289-1306.

Machado, C. A., R. M. Kliman, J. A. Markert and J. Hey (2002). Inferring the history of speciation from multilocus DNA sequence data: The case of Drosophila pseudoobscura and close relatives. Molecular biology and evolution 19 (4): 472- 488.

Maheshwari, S., J. Wang and D. A. Barbash (2008). Recurrent positive selection of the Drosophila hybrid incompatibility gene Hmr. Molecular biology and evolution 25 (11): 2421-2430.

Malik, H. S. and S. Henikoff (2001). Adaptive evolution of cid, a centromere-specific histone in drosophila. Genetics 157 (3): 1293-1298.

Malik, H. S., D. Vermaak and S. Henikoff (2002). Recurrent evolution of DNA-binding motifs in the Drosophila centromeric histone. Proceedings of the National Academy of Sciences of the United States of America 99 (3): 1449-1454.

Margarido, G. R. A., A. P. Souza and A. A. F. Garcia (2007). OneMap: software for genetic mapping in outcrossing species. Hereditas 144 (3): 78-79.

Masly, J. P., C. D. Jones, M. A. F. Noor, J. Locke and H. A. Orr (2006). Gene transposition as a cause of hybrid sterility in Drosophila. Science 313 (5792): 1448-1450.

Masly, J. P. and D. C. Presgraves (2007). High-resolution genome-wide dissection of the two rules of speciation in Drosophila. PLoS biology 5(9): 1890-1898.

McDermott, S. R. and M. A. Noor (2010). The role of meiotic drive in hybrid male sterility. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 365 (1544): 1265-1272.

McKee, B. D. (1998). Pairing sites and the role of chromosome pairing in meiosis and spermatogenesis in male Drosophila. Current Topics in Developmental Biology 37 : 77-115.

Meiklejohn, C. D., E. L. Landeen, J. M. Cook, S. B. Kingan and D. C. Presgraves (2011). Sex chromosome-specific regulation in the Drosophila male germline but little evidence for chromosomal dosage compensation or meiotic inactivation. PLoS Biology 9(8): e1001126. doi:1001110.1001371/journal.pbio.1001126.

Mikhaylova, L. M. and D. I. Nurminsky (2011). Lack of global meiotic sex chromosome inactivation, and paucity of tissue-specific gene expression on the Drosophila X chromosome. BMC Biology 9(29): doi:10.1186/1741-7007-1189-1129.

Moehring, A. J., J. Li, M. D. Schug, S. G. Smith, M. deAngelis, T. F. Mackay and J. A. Coyne (2004). Quantitative trait loci for sexual isolation between Drosophila simulans and D. mauritiana . Genetics 167 (3): 1265-1274.

Moehring, A. J., A. Llopart, S. Elwyn, J. A. Coyne and T. F. Mackay (2006). The genetic basis of postzygotic reproductive isolation between Drosophila santomea and D. yakuba due to hybrid male sterility. Genetics 173 (1): 225-233.

Montchamp-Moreau, C. (2006). Sex-ratio meiotic drive in Drosophila simulans: cellular mechanism, candidate genes and evolution. Biochemical Society Transactions 34 : 562-565.

Namekawa, S. H. and J. T. Lee (2009). XY and ZW: is meiotic sex chromosome inactivation the rule in evolution? PLoS Genetics 5(5): e1000493. doi:1000410.1001371/journal.pgen.1000493.

Nolte, V., D. Weigel and C. Schlotterer (2008). The impact of shared ancestral variation on hybrid male lethality--a 16 codon indel in the Drosophila simulans Lhr gene. Journal of evolutionary biology 21 (2): 551-555.

Noor, M. A. (1995). Speciation driven by natural selection in Drosophila. Nature 375 (6533): 674-675.

Noor, M. A. F. and J. L. Feder (2006). Speciation genetics: evolving approaches. Nature Reviews Genetics 7(11): 851-861.

Noor, M. A. F., D. A. Garfield, S. W. Schaeffer and C. A. Machado (2007). Divergence between the Drosophila pseudoobscura and D. persimilis genome sequences in relation to chromosomal inversions. Genetics 177 (3): 1417-1428.

Noor, M. A. F., K. L. Grams, L. A. Bertucci, Y. Almendarez, J. Reiland and K. R. Smith (2001a). The genetics of reproductive isolation and the potential for gene exchange between Drosophila pseudoobscura and D. persimilis via backcross hybrid males. Evolution 55 (3): 512-521.

Noor, M. A. F., K. L. Grams, L. A. Bertucci and J. Reiland (2001b). Chromosomal inversions and the reproductive isolation of species. Proceedings of the National Academy of Sciences of the United States of America 98 (21): 12084-12088.

Novitski, E., W. J. Peacock and J. Engel (1965). Cytological basis of sex ratio in Drosophila pseudoobscura . Science 148 (3669): 516-&.

Orr, H. A. (1987). Genetics of male and female sterility in hybrids of Drosophila pseudoobscura and Drosophila persimilis . Genetics 116 (4): 555-563.

Orr, H. A. (1989). Localization of genes causing postzygotic isolation in 2 hybridizations involving Drosophila pseudoobscura . Heredity 63 : 231-237.

Orr, H. A. and S. Irving (2001). Complex epistasis and the genetic basis of hybrid sterility in the Drosophila pseudoobscura Bogota-USA hybridization. Genetics 158 (3): 1089-1100.

Orr, H. A. and S. Irving (2005). Segregation distortion in hybrids between the Bogota and USA Subspecies of Drosophila pseudoobscura . Genetics 169 : 671-682.

Orr, H. A., J. P. Masly and N. Phadnis (2007). Speciation in Drosophila: From phenotypes to molecules. Journal of Heredity 98 (2): 103-110.

Ortiz-Barrientos, D., B. A. Counterman and M. A. F. Noor (2004). The genetics of speciation by reinforcement. PLoS Biology 2(12): 2256-2263.

Palumbi, S. R. (1996). Nucleic Acids II. the polymerase chain reaction. Molecular Systematics. D. M. Hillis, C. Moritz and B. K. Mable. Sunderland, MA, Sinauer : 205-247.

Pardo-Manuel de Villena, F. and C. Sapienza (2001). Nonrandom segregation during meiosis: the unfairness of females. Mammalian Genome 12 (5): 331-339.

Patterson, J. T. (1952). Evolution in the genus Drosophila. New York,, Macmillan.

Phadnis, N. (2011). Genetic architecture of male sterility and segregation distortion in Drosophila pseudoobscura Bogota-USA Hybrids. Genetics 189 (3): 1001-1009.

Phadnis, N. and H. A. Orr (2009). A single gene causes both male sterility and segregation distortion in Drosophila hybrids. Science 323 (5912): 376-379.

Policansky, D. (1974). Sex-ratio, meiotic drive, and group selection in Drosophila pseudoobscura . American Naturalist 108 (959): 75-90.

Presgraves, D. C. (2007). Speciation genetics: Epistasis, conflict and the origin of species. Current Biology 17 (4): R125-R127.

Presgraves, D. C. (2008). Drive and sperm: evolution and genetics of male meiotic drive. Sperm biology: an evolutionary perspective. T. R. Birkhead, D. J. Hosken and S. Pitnick. Burlington, MA, Elsevier.

Presgraves, D. C. (2010). The molecular evolutionary basis of species formation. Nature Reviews Genetics 11 (3): 175-180.

Presgraves, D. C., L. Balagopalan, S. M. Abmayr and H. A. Orr (2003). Adaptive evolution drives divergence of a hybrid inviability gene between two species of Drosophila. Nature 423 (6941): 715-719.

Price, T. A., A. J. Bretman, T. D. Avent, R. R. Snook, G. D. Hurst and N. Wedell (2008a). Sex ratio distorter reduces sperm competitive ability in an insect. Evolution; international journal of organic evolution 62 (7): 1644-1652.

Price, T. A., D. J. Hodgson, Z. Lewis, G. D. Hurst and N. Wedell (2008b). Selfish genetic elements promote polyandry in a fly. Science 322 (5905): 1241-1243.

Price, T. A., Z. Lewis, D. T. Smith, G. D. Hurst and N. Wedell (2009). Sex ratio drive promotes sexual conflict and sexual coevolution in the fly Drosophila pseudoobscura . Evolution; international journal of organic evolution 64 (5): 1504- 1509.

Prout, T., J. Bundgaar and S. Bryant (1973). Population genetics of meiotic drive suppressors. Genetics 74 (Jun): S220-S220.

Reed, L. K., B. A. LaFlamme and T. A. Markow (2008). Genetic architecture of hybrid male sterility in Drosophila: analysis of intraspecies variation for interspecies isolation. PloS ONE 3(8): doi:10.1371/journal.pone.0003076. 74

Reed, L. K. and T. A. Markow (2004). Early events in speciation: polymorphism for hybrid male sterility in Drosophila. Proceedings of the National Academy of Sciences of the United States of America 101 (24): 9009-9012.

Sandler, L. and E. Novitski (1957). Meiotic drive as an evolutionary force. American Naturalist 91 (857): 105-110.

Sawamura, K. (2012). Chromatin evolution and molecular drive in speciation. International Journal of Evolutionary Biology 2012 : doi:10.1155/2012/301894.

Stalker, H. D. (1961). Genetic systems modifying meiotic drive in Drosophila paramelanica . Genetics 46 (2): 177-&.

Sturtevant, A. H. and T. Dobzhansky (1936). Geographical distribution and cytology of "sex ratio" in Drosophila pseudoobscura and related species. Genetics 21 (4): 473-490.

Sweigart, A. L., A. R. Mason and J. H. Willis (2007). Natural variation for a hybrid incompatibility between two species of Mimulus. Evolution; international journal of organic evolution 61 (1): 141-151.

Tao, Y., L. Araripe, S. B. Kingan, Y. Ke, H. Xiao and D. L. Hartl (2007a). A sex-ratio meiotic drive system in Drosophila simulans . II: An X-linked distorter. PLoS Biology 5(11): 2576-2588.

Tao, Y., D. L. Hartl and C. C. Laurie (2001). Sex-ratio segregation distortion associated with reproductive isolation in Drosophila. Proceedings of the National Academy of Sciences of the United States of America 98 (23): 13183-13188.

Tao, Y., J. P. Masly, L. Araripe, Y. Ke and D. L. Hartl (2007b). A sex-ratio meiotic drive system in Drosophila simulans . I: An autosomal suppressor. PLoS Biology 5(11): 2560-2575.

Taylor, J. E. and J. Jaenike (2002). Sperm competition and the dynamics of X chromosome drive: Stability and extinction. Genetics 160 (4): 1721-1731.

Teeter, K. C., L. M. Thibodeau, Z. Gompert, C. A. Buerkle, M. W. Nachman and P. K. Tucker (2010). The variable genomic architecture of isolation between hybridizing species of house mice. Evolution; international journal of organic evolution 64 (2): 472-485.

Thomson, G. J. and M. W. Feldman (1976). Population genetics of modifiers of meiotic drive III. Equilibrium analysis of a general model for genetic control of segregation distortion. Theoretical Population Biology 10 (1): 10-25.

Ting, C. T., S. C. Tsaur, M. L. Wu and C. I. Wu (1998). A rapidly evolving homeobox at the site of a hybrid sterility gene. Science 282 (5393): 1501-1504.

Turelli, M. and H. A. Orr (2000). Dominance, epistasis and the genetics of postzygotic isolation. Genetics 154 (4): 1663-1679.

Turner, L. M., D. J. Schwahn and B. Harr (2012). Reduced male fertility is common but highly variable in form and severity in a natural house mouse hybrid zone. Evolution 66 (2): 443-458.

Wade, M. J., N. A. Johnson and G. Wardle (1994). Analysis of autosomal polygenic variation for the expression of Haldane's rule in flour beetles. Genetics 138 (3): 791-799.

Wallace, B. (1948). Studies on sex-ratio in Drosophila pseudoobscura . I. Selection and sex- ratio. Evolution 2(3): 189-217.

Wang, R. L., J. Wakeley and J. Hey (1997). Gene flow and natural selection in the origin of Drosophila pseudoobscura and close relatives. Genetics 147 (3): 1091-1106.

Wang, S., C. J. Basten and Z. B. Zeng (2011). Windows QTL Cartographer 2.5. Department of Statistics, North Carolina State University, Raleigh, NC. : (http://statgen.ncsu.edu/qtlcart/WQTLCart.htm )

Werren, J. H. (2011). Selfish genetic elements, genetic conflict, and evolutionary innovation. Proceedings of the National Academy of Sciences of the United States of America 108 : 10863-10870.

White-Cooper, H. (2004). Spermatogenesis: analysis of meiosis and morphogenesis. Drosophila Cytogenetics Protocols. D. S. Henderson. Totowa, NJ, Humana Press : 45-75.

Wilkinson, G. S. and C. L. Fry (2001). Meiotic drive alters sperm competitive ability in stalk-eyed flies. Proceedings of the Royal Society of London Series B-Biological Sciences 268 : 2559-2564.

Wilkinson, G. S., P. M. Johns, E. S. Kelleher, M. L. Muscedere and A. Lorsong (2006). Fitness effects of X chromosome drive in the stalk-eyed fly, Cyrtodiopsis dalmanni . Journal of Evolutionary Biology 19 (6): 1851-1860.

Wilkinson, G. S., D. C. Presgraves and L. Crymes (1998). Male eye span in stalk-eyed flies indicates genetic quality by meiotic drive suppression. Nature 391 (6664): 276-279.

Wilkinson, G. S. and P. R. Reillo (1994). Female choice response to artificial selection on an exaggerated male trait in a stalk-eyed fly. Proceedings of the Royal Society of London Series B-Biological Sciences 255 (1342): 1-6.

Wu, C. I. (1983a). Virility deficiency and the sex-ratio trait in Drosophila pseudoobscura .II. Multiple mating and overall virility selection. Genetics 105 (3): 663-679.

Wu, C. I. (1983b). Virility deficiency and the sex-ratio trait in Drosophila pseudoobscura . .I. Sperm displacement and sexual selection. Genetics 105 (3): 651-662.

Wu, C. I. and A. T. Beckenbach (1983). Evidence for extensive genetic differentiation between the sex-ratio and the standard arrangement of Drosophila pseudoobscura and Drosophila persimilis and identification of hybrid sterility Factors. Genetics 105 (1): 71-86.

Wu, C. I. and M. F. Hammer (1991). Molecular evolution of unselfish genes. Evolution at the molecular level. R. K. Selander, A. G. Clark and T. S. Whittam. Sunderland, Mass., Sinauer Associates : xii, 350 p.

Zwick, M. E., J. L. Salstrom and C. H. Langley (1999). Genetic variation in rates of nondisjunction: association of two naturally occurring polymorphisms in the chromokinesin nod with increased rates of nondisjunction in Drosophila melanogaster. Genetics 152 (4): 1605-1614.

Biography

Shannon McDermott was born in West Islip, NY on August 21, 1985. She attended Cedar

Crest College from 2003-2007, and earned her Bachelor’s of Science in Genetic Engineering. After graduation, she started her Ph.D. at Duke University (2007-2012). She published several papers, one of which as an undergraduate (“Estimation of isolation times of the island species in the

Drosophila simulans complex from multilocus DNA sequence data”). She also published three papers during graduate school, “The role of meiotic drive in hybrid male sterility,” “Genetics of hybrid male sterility among strains and species of the Drosophila pseudoobscura species group,” and “Hybrid Sterility.” A fourth paper, “Association of within-species segregation distortion in

D. persimilis with hybrid sterility between D. persimilis and D. pseudoobscura ” has been submitted and is awaiting review. While at Duke, she was awarded two fellowships (Marcy Speer Memorial

Fellowship, and Biology Department Fellowship), and the Dean’s Award for Excellence in

Teaching. She has received two research grants: a Grant-in-Aid of Research awarded by Sigma

Xi, and an REU supplement for an undergraduate mentee awarded by the National Science

Foundation. She has also received travel/tuition grants to attend the Summer Institute in

Statistical Genetics, and the Evolutionary Biology Workshop in the Alps.