SUPPLEMENTARY DATA Supplementary Table 1

Home , CD34, CD6, Integrin alpha 5, Integrin alpha X

SUPPLEMENTARY DATA

Supplementary Table 1. Multivariable analysis with circulating CD34+ cell level as dependent variables and clinical characteristics identified by univariate analysis as explanatory variables.

Variable Beta-coefficient p-value

DAN -0.377 <0.001

Age -0.101 0.297

Diabetes type 0.151 0.121

HbA1c -0.141 0.085

Retinopathy 0.096 0.289

Heart rate 0.023 0.791

Supplementary Table 2. Clinical characteristics of patients with available measure of PBMC expression of p66Shc and Sirt1 (extracted from table 1).

Characteristic No DAN DAN

Age, years 60.0±14.0 59.7±15.0

Sex male, % 70 70

Type 1 / type 2 diabetes 3/7 3/7

Disease duration, years 10.0±7.8 12.9±7.8

HbA1c, % 7.7±1.8 7.9±1.4

p66Shc / β-actin expression 1.01±0.15 1.63±0.95

Sirt1 / β-actin expression 1.09±0.29 0.75±0.17

Supplementary Table 3. Primer sequences.

Sequence Genes FW primer sequence RV primer sequence accession number Mouse genes vascular cell adhesion molecule 1 (Vcam1) TATGTCAACGTTGCCCCCAA GCTGTCTGCTCCACAGGATT NM_011693.3 src homology 2 domain-containing transforming protein C1 (Shc1) – p66shc TGACAGGATGGCTGGCTT ACGGACTTCATGGTCTCC NM_001113331.2 intercellular adhesion molecule 1 (Icam1) AGCTCGGAGGATCACAAACG TCCAGCCGAGGACCATACAG NM_010493.2 integrin alpha L (Itgal) – CD11a ACTTCCACTTCCCGATCTGC CCACCTTTTGGTCCCTTGGT NM_001253872.1 integrin alpha 4 (Itga4) – CD49d GTTCTCCACCAAGAGCGCAT GATGAGCCAGCGCTTCGAC NM_010576.3 integrin alpha 5 (Itga5) – CD49e GAACCCTGTGTCCTGCATCA TTGGAGTTCCACCTCGAAGC NM_010577.3 selectin, lymphocyte (Sell) – CD62L TGATGCAGGGTATTACGGGC CACTGGACCACTTGGCAGAT NM_001164059.1 integrin alpha X (Itgax) – CD11c TCTTCTGCTGTTGGGGTTTGT GAGCACACTGTGTCCGAACT NM_021334.2 CAGTAGCACTAATTCCAAGTTCT Sirtuin 1 (Sirt1) A TTGGCATATTCACCACCTAGC NM_001159589.1 ubiquitin C (Ubc) GCCCAGTGTTACCACCAAGA CCCATCACACCCAAGAACA NM_019639.4 Human Genes sirtuin 1 (SIRT1) TACCGAGATAACCTTCTGTTCG GTTCGAGGATCTGTGCCAAT NM_012238.4 selectin L (SELL) – CD62L GCCCTCTGTTACACAGCTTCT GGCCCATAGTACCCCACATC NM_000655.4 actin, beta (ACTB) GGATGCCACAGGACTCCA AGAGCTACGAGCTGCCTGAC NM_001101.3 src homology 2 domain-containing transforming protein C1 (SHC1) – p66shc AATCAGAGAGCCTGCCACATT CTCTTCCTCCTCCTCATC NM_001130040

Supplementary Figure 1. Baseline levels of EPC and LKS cells in diabetic and sympathectomized (6- OHDA) mice. * p<0.05 versus non-diabetic control mice. “n.s.” stands for “not significant” compared with non-diabetic control mice.

Supplementary Figure 2. Effects of STZ and 6-OHDA in vitro on apoptosis and necrosis of total murine bone marrow cells (A), murine CD34+ bone marrow cells (B) and growth of hematopoietic colonies from murine bone marrow cells (C). In panel (A), *p<0.05 versus percentages in the control (CTRL) condition. In (C), both STZ and 6-OHDA were incubated at 10 microM concentration.

Supplementary Figure 3. Effects of isoproterenol on PBMC Sirt1 and CD62L expression. PBMC of healthy human donors were incubated without or with isoproterenol 100 μM and gene expression of Sirt1 and CD62L (L-selectin, Sell), were analyzed. The cellular concentration of cyclic AMP (cAMP) were also determined to select isoproterenol concentrations that result in increased cAMP production. *p<0.05 100 vs 0 μM isoproterenol.

2.0 * 2.0 2.0 * 1.5 1.5 1.5

1.0 1.0 1.0 *

cAMP (pg/mL) cAMP 0.5 0.5 0.5 Sirt1 mRNA (fold change) (fold Sirt1 mRNA

0.0 0.0 change) (fold mRNA CD62L 0.0 0 M 100 M 0 M 100 M 0 M 100 M [Isoproterenol] [Isoproterenol] [Isoproterenol]

Supplementary Figure 4. Generation and characterization of transgenic animals. The breeding strategy used to generate Vav1-Sirt1-/- and Vav1-Sirt1TG mice is shown. Knock-out and overexpression of Sirt1, respectively, was confirmed by real time PCR on LKS cells isolated by FACS.

Cre/+ flox/flox Cre/+ stop‐flox Vav1 : Sirt1ex4 Vav1 Sirt1 ∆flox/+ Sirt1ex4

Sirt1 expression Without Dapi With Dapi + Ctr

cKit KO Lin– Lin– Sca1+ Over

LKS sorting: efficient knock-down / overexpression

Supplementary Figure 5. Contribution of Vav1+ cells to the microvasculature of ischemic muscles. Vav1-YFP mice were subjected to hind limb ischemia and muscle sections stained for Isolectin B4 (red) to visualize the vascular network (nuclei counterstained in blue with Hoechst); the green/yellow signal represents the spontaneous YFP fluorescence. Merged figures are shown. YFP-expressing cells, indicating Vav1+ cells were only found in sections of ischemic muscles and not of non ischemic contralateral control muscles. Some YFP+ cells were clearly integrated into the vasculature co-staining with Isolectin, while other YFP+ cells did not co-localize with the red Isolectin signal and were considered not integrated (likely intravascular). The right panel shows quantification of total (integrated and non integrated) and integrated cells in ischemic and non ischemic muscle sections.

Ischemic muscle section Non-ischemic muscle section Ischemic muscle sections Non-ischemic muscle sections Hoechst 4 Isolectin 2.1 YFP 3 1.4 2

Cells /Cells field 1 integrated 0.0 0.0 0

s s ll ll e e + c + c P P F F Y Y l d not ta e o t T ra integrated g te In

Supplementary Figure 6. Expression of niche adhesion molecules in the BM. mRNA was extracted from BM cells of control non diabetic, T1D (STZ) and sympathectomised (6-OHDA) mice and analyzed for expression of typical niche genes encoding for adhesion molecules (n=5/group). *p<0.05 versus non diabetic control.

4 CTRL T1D (STZ) * * * 6-OHDA 3 * * * **

* 2 *

1 BM mRNA expression mRNA BM

0 a e 9d 2L 4 6 CD11 CD11c CD CD49 CD ICAM1

Supplementary Figure 7. Time course analysis of bone marrow neuropathy development and upregulation of adhesion molecules in T1D mice from 1 to 4 weeks after STZ administration. In the lower panel, *p<0.05 versus basal; **p<0.05 versus 1 week.

4 Basal p<0.05 vs basal p<0.05 vs basal 1 Week 3 2 Week 3 Week 4 Week 2

mRNA n.s. 1 (fold change vs change basal) (fold 0 d 1 L c d L c d L c a c a c 1 1 1 9d 2L 1 9d 2L 1 49 M 62 49 62 49 62 4 6 11 4 6 11 D D D1 D D D1 D D D1 D1 D D1 D CD49eC ICA C CD11aC CD49eC ICAM1C CD11aC CD49eC ICAM1C CD11aC CD49eCD ICAM1CD C C CD49eCD ICAM1CD C C