SUPPLEMENTARY DATA Supplementary Table 1

SUPPLEMENTARY DATA Supplementary Table 1

SUPPLEMENTARY DATA Supplementary Table 1. Multivariable analysis with circulating CD34+ cell level as dependent variables and clinical characteristics identified by univariate analysis as explanatory variables. Variable Beta-coefficient p-value DAN -0.377 <0.001 Age -0.101 0.297 Diabetes type 0.151 0.121 HbA1c -0.141 0.085 Retinopathy 0.096 0.289 Heart rate 0.023 0.791 Supplementary Table 2. Clinical characteristics of patients with available measure of PBMC expression of p66Shc and Sirt1 (extracted from table 1). Characteristic No DAN DAN Age, years 60.0±14.0 59.7±15.0 Sex male, % 70 70 Type 1 / type 2 diabetes 3/7 3/7 Disease duration, years 10.0±7.8 12.9±7.8 HbA1c, % 7.7±1.8 7.9±1.4 p66Shc / β-actin expression 1.01±0.15 1.63±0.95 Sirt1 / β-actin expression 1.09±0.29 0.75±0.17 ©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-0894/-/DC1 SUPPLEMENTARY DATA Supplementary Table 3. Primer sequences. Sequence Genes FW primer sequence RV primer sequence accession number Mouse genes vascular cell adhesion molecule 1 (Vcam1) TATGTCAACGTTGCCCCCAA GCTGTCTGCTCCACAGGATT NM_011693.3 src homology 2 domain-containing transforming protein C1 (Shc1) – p66shc TGACAGGATGGCTGGCTT ACGGACTTCATGGTCTCC NM_001113331.2 intercellular adhesion molecule 1 (Icam1) AGCTCGGAGGATCACAAACG TCCAGCCGAGGACCATACAG NM_010493.2 integrin alpha L (Itgal) – CD11a ACTTCCACTTCCCGATCTGC CCACCTTTTGGTCCCTTGGT NM_001253872.1 integrin alpha 4 (Itga4) – CD49d GTTCTCCACCAAGAGCGCAT GATGAGCCAGCGCTTCGAC NM_010576.3 integrin alpha 5 (Itga5) – CD49e GAACCCTGTGTCCTGCATCA TTGGAGTTCCACCTCGAAGC NM_010577.3 selectin, lymphocyte (Sell) – CD62L TGATGCAGGGTATTACGGGC CACTGGACCACTTGGCAGAT NM_001164059.1 integrin alpha X (Itgax) – CD11c TCTTCTGCTGTTGGGGTTTGT GAGCACACTGTGTCCGAACT NM_021334.2 CAGTAGCACTAATTCCAAGTTCT Sirtuin 1 (Sirt1) A TTGGCATATTCACCACCTAGC NM_001159589.1 ubiquitin C (Ubc) GCCCAGTGTTACCACCAAGA CCCATCACACCCAAGAACA NM_019639.4 Human Genes sirtuin 1 (SIRT1) TACCGAGATAACCTTCTGTTCG GTTCGAGGATCTGTGCCAAT NM_012238.4 selectin L (SELL) – CD62L GCCCTCTGTTACACAGCTTCT GGCCCATAGTACCCCACATC NM_000655.4 actin, beta (ACTB) GGATGCCACAGGACTCCA AGAGCTACGAGCTGCCTGAC NM_001101.3 src homology 2 domain-containing transforming protein C1 (SHC1) – p66shc AATCAGAGAGCCTGCCACATT CTCTTCCTCCTCCTCATC NM_001130040 ©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-0894/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 1. Baseline levels of EPC and LKS cells in diabetic and sympathectomized (6- OHDA) mice. * p<0.05 versus non-diabetic control mice. “n.s.” stands for “not significant” compared with non-diabetic control mice. ©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-0894/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 2. Effects of STZ and 6-OHDA in vitro on apoptosis and necrosis of total murine bone marrow cells (A), murine CD34+ bone marrow cells (B) and growth of hematopoietic colonies from murine bone marrow cells (C). In panel (A), *p<0.05 versus percentages in the control (CTRL) condition. In (C), both STZ and 6-OHDA were incubated at 10 microM concentration. AB C ©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-0894/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 3. Effects of isoproterenol on PBMC Sirt1 and CD62L expression. PBMC of healthy human donors were incubated without or with isoproterenol 100 μM and gene expression of Sirt1 and CD62L (L-selectin, Sell), were analyzed. The cellular concentration of cyclic AMP (cAMP) were also determined to select isoproterenol concentrations that result in increased cAMP production. *p<0.05 100 vs 0 μM isoproterenol. 2.0 * 2.0 2.0 * 1.5 1.5 1.5 1.0 1.0 1.0 * cAMP (pg/mL) cAMP 0.5 0.5 0.5 Sirt1 mRNA (fold change) (fold Sirt1 mRNA 0.0 0.0 change) (fold mRNA CD62L 0.0 0 M 100 M 0 M 100 M 0 M 100 M [Isoproterenol] [Isoproterenol] [Isoproterenol] Supplementary Figure 4. Generation and characterization of transgenic animals. The breeding strategy used to generate Vav1-Sirt1-/- and Vav1-Sirt1TG mice is shown. Knock-out and overexpression of Sirt1, respectively, was confirmed by real time PCR on LKS cells isolated by FACS. Cre/+ flox/flox Cre/+ stop‐flox Vav1 : Sirt1ex4 Vav1 Sirt1 ∆flox/+ Sirt1ex4 Sirt1 expression Without Dapi With Dapi + Ctr cKit KO Lin– Lin– Sca1+ Over LKS sorting: efficient knock-down / overexpression ©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-0894/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 5. Contribution of Vav1+ cells to the microvasculature of ischemic muscles. Vav1-YFP mice were subjected to hind limb ischemia and muscle sections stained for Isolectin B4 (red) to visualize the vascular network (nuclei counterstained in blue with Hoechst); the green/yellow signal represents the spontaneous YFP fluorescence. Merged figures are shown. YFP-expressing cells, indicating Vav1+ cells were only found in sections of ischemic muscles and not of non ischemic contralateral control muscles. Some YFP+ cells were clearly integrated into the vasculature co-staining with Isolectin, while other YFP+ cells did not co-localize with the red Isolectin signal and were considered not integrated (likely intravascular). The right panel shows quantification of total (integrated and non integrated) and integrated cells in ischemic and non ischemic muscle sections. Ischemic muscle section Non-ischemic muscle section Ischemic muscle sections Non-ischemic muscle sections Hoechst 4 Isolectin 2.1 YFP 3 1.4 2 Cells /Cells field 1 integrated 0.0 0.0 0 s s ll ll e e + c + c P P F F Y Y l d not ta e o t T ra integrated g te In Supplementary Figure 6. Expression of niche adhesion molecules in the BM. mRNA was extracted from BM cells of control non diabetic, T1D (STZ) and sympathectomised (6-OHDA) mice and analyzed for expression of typical niche genes encoding for adhesion molecules (n=5/group). *p<0.05 versus non diabetic control. 4 CTRL T1D (STZ) * * * 6-OHDA 3 * * * ** * 2 * 1 BM mRNA expression mRNA BM 0 a e 9d 2L 4 6 CD11 CD11c CD CD49 CD ICAM1 ©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-0894/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 7. upregulation of adhesion molecule lower panel, *p<0.05 versus ba Time course analysis of bone 4 3 sal; **p<0.05 versus 1 week. mRNA Basal s in T1D mice from 1 to 4 weeks after STZ administration. In the 1 Week 2 2 Week 3 Week 1 4 Week (fold change vs basal) 0 CD49e CD49d ICAM1 CD62L CD11a marrow neuropathy development and CD11c CD49e CD49d ICAM1 CD62L CD11a CD11c p<0.05 vs basal CD49e CD49d ICAM1 CD62L CD11a CD11c p<0.05 vs basal CD49e CD49d ICAM1 CD62L CD11a n.s. CD11c CD49e CD49d ICAM1 CD62L CD11a CD11c ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org /lookup/suppl/doi:10.2337/db13-089 4/-/DC1 .

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    7 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us