DOCSLIB.ORG

First Record of Ixodes Affinis Tick (Acari: Ixodidae) Infected With

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
First Record of Ixodes Affinis Tick (Acari: Ixodidae) Infected With iolog ter y & c P a a B r f a o s i l Journal of Bacteriology and t o a l n o r g u y o J Parasitology Scott et al., J Bacteriol Parasitol 2016, 7:3 ISSN: 2155-9597 DOI: 10.4172/2155-9597.1000281 Research Article Open Access First Record of Ixodes affinis Tick (Acari: Ixodidae) Infected with Borrelia burgdorferi Sensu Lato Collected from a Migratory Songbird in Canada John D Scott1*, Kerry L Clark2, Janet E Foley3, Lance A Durden4, Jodi M Manord2 and Morgan L Smith2 1Research Division, Lyme Ontario, 365 St. David Street South, Fergus, Ontario, Canada 2Epidemiology & Environmental Health, Department of Public Health, University of North Florida, Jacksonville, Florida 32224, USA 3Department of Medicine and Epidemiology, School of Veterinary Medicine, University of California, Davis, California 95616, USA 4Department of Biology, Georgia Southern University, 4324 Old Register Road, Statesboro, Georgia 30458, USA *Corresponding author: John D. Scott, Research Division, Lyme Ontario, 365 St. David Street South, Fergus, Ontario N1M 2L7, Canada, Tel: 519-843-3646; Fax: +1-650-618-1414; E-mail: [email protected] Received date: April 14, 2016; Accepted date: June 25, 2016; Published date: June 30, 2016 Copyright: © 2016 Scott JD, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Migratory songbirds transport hard-bodied ticks (Acari: Ixodidae) into Canada during northward spring migration, and some of these bird-feeding ticks harbor a wide diversity of pathogenic microorganisms. In this study, we collected a nymphal Ixodes affinis Neumann from a Common Yellowthroat, Geothylypis trichas (Linnaeus), at Ste-Anne-de-Bellevue, Québec, and it was infected with the Lyme disease bacterium, Borrelia burgdorferi sensu lato (s.l.) Johnson, Schmid, Hyde, Steigerwalt & Brenner. Using PCR on this tick extract and DNA sequencing on the borrelial amplicons, we detected B. burgdorferi sensu stricto (s.s.), a genospecies that is pathogenic to people and certain domestic animals. In addition, we collected an I. affinis nymph from a Swainson's Thrush, Catharus ustulatus (Nuttall), at Toronto, Ontario, and a co-feeding nymphal blacklegged tick, Ixodes scapularis Say, tested positive for B. burgdorferi s.s. These bird-tick findings constitute the first reports of I. affinis in Ontario and Québec and, simultaneously, the first report of a B. burgdorferi s.l.-infected I. affinis in Canada. Since Neotropical and southern temperate songbirds have a rapid flight pace, they are capable of transporting ticks infected with B. burgdorferi s.l. hundreds of kilometres to Canada. Health- care professionals should be cognisant that migratory songbirds can transport diverse genotypes of B. burgdorferi s.l. into Canada from southern latitudes that may be missed by current Lyme disease serological tests. Keywords: Tick; Ixodes affinis; Borrelia burgdorferi; Lyme array of mammals, including cotton mouse, Peromyscus disease; Migratory songbirds; Bird parasitism; Eastern gossypinus (LeConte); cotton rat, Sigmodon hispidus Say Canada and Ord; marsh rice rat, Oryzmys palustris Harlan; southern short-tailed shrew, Blarina carolinensis Abbreviations: (Bachman); gray squirrel, Sciurus carolinensis Gmelin; PCR: Polymerase Chain Reaction eastern cottontail, Sylvilagus floridanus (J.A. Allen); raccoon, Procyon lotor (Linnaeus); Virginia opossum, Introduction Didelphis virginiana (Kerr); domestic cat, Felis catus (L.); dog, Canis lupus familiaris L.; bobcat, Lynx rufus Ixodes affinis Neumann (Acari: Ixodida: Ixodidae) is an (Schreber); cougar, Puma concolor (L.); white-tailed deer, obligate, blood-sucking ectoparasite that feeds on Odocoileus virginianus Zimmermann; and American mammals and birds [1,2]. Biogeographically, this ixodid black bear, Ursus americanus (Pallus) [2]. In particular, (hard-bodied) tick is native to Central and South America the cotton mouse and the cotton rat are major reservoir [3], and occurs in the United States from Florida to hosts for Borrelia burgdorferi sensu lato (s.l.) Johnson, Virginia [2,4,5]. In the coastal plains of the Mid-Atlantic Schmid, Hyde, Steigerwalt & Brenner in the southeastern and southeastern United States, I. affinis parasitizes a wide United States [6]. Of biological and medical significance, J Bacteriol Parasitol Volume 7 • Issue 3 • 1000281 ISSN:2155-9597 JBP, an open access journal Citation: Scott JD, Clark KL, Foley JE, Durden LA, Manord JM, et al. (2016) First Record of Ixodes affinis Tick (Acari: Ixodidae) Infected with Borrelia burgdorferi Sensu Lato Collected from a Migratory Songbird in Canada. J Bacteriol Parasitol 7: 281. doi: 10.4172/2155-9597.1000281 Page 2 of 10 I. affinis enhances the epidemiological cycle of B. with slightly moistened paper towel. The ticks were burgdorferi s.l., especially within indigenous areas [7]. promptly sent by express mail to the tick identification laboratory (J.D.S.). The nymphal ticks were tentatively Songbirds (Passeriformes) are avian hosts of I. affinis identified using a taxonomic key [21]. After fully and I. scapularis larvae and nymphs [1,5,8]. While en engorged nymphs moulted to adults, they were put in 94% route to their breeding grounds, passerine migrants make ethyl alcohol, and sent by overnight courier for landfall at Lyme disease endemic areas, and are often confirmation of identification (L.A.D.). parasitized by host-seeking ticks. Since peak questing activity of I. scapularis and I. affinis nymphs coincides Spirochete detection with peak northward songbird migration, ground- frequenting passerines are often parasitized by both of In phase 1, ticks were sent to a separate laboratory these nymphal species. In Canada, Scott et al. [8] reported (K.L.C.) for B. burgdorferi s.l. testing and molecular I. affinis and I. scapularis on a Swainson's Thrush, analysis. DNA extraction, PCR testing, and DNA Catharus ustulatus (Nuttall), in south-central Manitoba sequencing were performed as previously described [22]. during northward spring migration. In a recent study, In phase 2, four I. affinis nymphs, which were collected Heller et al. [5] reported I. affinis immatures on 6 in 2016, were sent to another laboratory (J.E.F) for PCR different passerine species in southeastern Virginia, and testing and molecular analysis. The flagellin gene was one songbird-derived nymph was infected with B. used on these I. affinis ticks. The primers include: burgdorferi s.l. External: Based on tick-host-pathogen studies in the FlaLL: ACATATTCAGATGCAGACAGAGGT; southeastern United States, researchers found that I. FlaRL: GCAATCATAGCCATTGCAGATTGT; affinis is a competent vector of the Lyme disease bacterium, B. burgdorferi s.l. [6,7]. Globally, the B. Internal: burgdorferi s.l. complex consists of at least 23 genospecies FlaLS: AACAGCTGAAGAGCTTGGAATG; or genomospecies. In North America, at least nine B. FlaRS: CTTTGATCACTTATCATTCTAATAGC. burgdorferi s.l. genospecies are present, namely B. The methodology for DNA extraction, PCR testing, and americana, B. andersonii, B. bissettii, B. burgdorferi sensu DNA sequencing is outlined in the scientific articles stricto (s.s.), B. californiensis, B. carolinensis, B. garinii, B. [23-26]. kurtenbachii, and B. mayonii [9-16]. Of these genospecies, B. americana, B. andersonii, B. bissettii, B. Nucleotide sequence accession numbers burgdorferi s.s., B. garinii, and B. mayonii are known to be pathogenic to humans [16-20]. The DNA sequence of the 194-bp (base position 313 to 506), and the 206-bp (base position 532 to 737) amplicons The aim of the present study was to expound on the of B. burgdorferi s.l. flagellin (flaB) gene, which were movement of songbird-transported ticks in the Northern acquired from the I. affinis nymph (15-5A51) using PCR1 Hemisphere during northward spring migration, and and PCR2 primer sets have been deposited in the report any novel tick-host associations in Canada. In GenBank data base with accession number: KX011447. In addition, we wanted to determine whether any ticks on addition, B. burgdorferi s.l. amplicons from the I. Neotropical and southern temperate songbirds are scapularis nymph (15-5A47A) using PCR1 and PCR2 infected with B. burgdorferi s.l. primer sets have been submitted to the GenBank database with accession number: KX011446. Materials and Methods Results Tick collection Six Ixodes nymphs were collected from five species of During spring migration, I. affinis and I. scapularis passerine birds at four different collection sites in eastern nymphs were collected from songbirds by bird banders at Canada (Figure 1). The vector-host-pathogen associations four different sites in eastern Canada. Nymphs were are listed in Table 1. A partially engorged I. scapularis removed using fine-pointed, stainless steel forceps, and nymph (15-5A47A) and a fully engorged I. affinis nymph stored in polypropylene vials that were labelled with (15-5A47B) were collected from a Swainson's Thrush on background information (i.e., bird species, collection date, 24 May 2015 at Toronto, Ontario. geographic location, collector's name). The vented vials were placed in a self-sealing, double-zippered plastic bag J Bacteriol Parasitol Volume 7 • Issue 3 • 1000281 ISSN:2155-9597 JBP, an open access journal Citation: Scott JD, Clark KL, Foley JE, Durden LA, Manord JM, et al. (2016) First Record of Ixodes affinis Tick (Acari: Ixodidae) Infected with Borrelia burgdorferi Sensu Lato Collected from a Migratory Songbird in Canada. J Bacteriol Parasitol 7: 281. doi: 10.4172/2155-9597.1000281 Page 3 of 10 The I. scapularis nymph moulted to a female in 39 d, whereas the I. affinis nymph moulted to a female in 43 d. The I. scapularis nymph tested positive for B. burgdorferi s.l., and the I. affinis was negative. This bird parasitism is the first record of I. affinis in Ontario and, simultaneously, the first documentation of I. affinis on a bird in this province. At Ste-Anne-de-Belleville, Québec, a partially engorged I. affinis nymph (15-5A51) was collected from a Common Yellowthroat, Geothylypis trichas (Linnaeus), a southern temperate songbird, on 26 May 2015 (Figure 2).
Load more

Recommended publications
  • Parallelisms and Contrasts in the Diverse Ecologies of the Anaplasma Phagocytophilum and Borrelia Burgdorferi Complexes of Bacteria in the Far Western United States
    veterinary sciences Review Parallelisms and Contrasts in the Diverse Ecologies of the Anaplasma phagocytophilum and Borrelia burgdorferi Complexes of Bacteria in the Far Western United States Nicole Stephenson * and Janet Foley School of Veterinary Medicine, Medicine and Epidemiology, University of California, Davis, CA 95616, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-530-7549-740 Academic Editor: Ulrike Munderloh Received: 6 June 2016; Accepted: 14 September 2016; Published: 22 September 2016 Abstract: Anaplasma phagocytophilum and Borrelia burgdorferi are two tick-borne bacteria that cause disease in people and animals. For each of these bacteria, there is a complex of closely related genospecies and/or strains that are genetically distinct and have been shown through both observational and experimental studies to have different host tropisms. In this review we compare the known ecologies of these two bacterial complexes in the far western USA and find remarkable similarities, which will help us understand evolutionary histories and coadaptation among vertebrate host, tick vector, and bacteria. For both complexes, sensu stricto genospecies (those that infect humans) share a similar geographic range, are vectored mainly by ticks in the Ixodes ricinus-complex, utilize mainly white-footed mice (Peromyscus leucopus) as a reservoir in the eastern USA and tree squirrels in the far west, and tend to be generalists, infecting a wider variety of vertebrate host species. Other sensu lato genospecies within each complex are generally more specialized, occurring often in local enzootic cycles within a narrow range of vertebrate hosts and specialized vector species. We suggest that these similar ecologies may have arisen through utilization of a generalist tick species as a vector, resulting in a potentially more virulent generalist pathogen that spills over into humans, vs.
    [Show full text]
  • Molecular Biology and Ecology of Ticks and Tick-Borne Pathogens:Co-Existence, Distribution, Interactions
    Molecular biology and ecology of ticks and tick-borne pathogens: co-existence, distribution, interactions Rudenko Natasha Biology Centre Czech Academy of Sciences, Institute of Parasitology TICK FACTOIDS TICK FACTOIDS All ticks are obligate, nonpermanent blood feeders; tick hosts include all terrestrial vertebrates. Ticks are vectors of more kinds of microorganisms than any other arthropod taxon. Worldwide distribution - from Arctic to Antarctic. Approximately 900 tick species exists; 10% are of concern to humans. The most important genera of human-biting hard ticks are: Amblyomma, Dermacentor, Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus. The capacity of ticks for active migrations is limited. The questing larvae usually can move up to 20 cm, nymphs up to 40-50 cm, and adults up to 1.0 m. Reservoir Hosts - mammals; -rodents; -birds; -lizards; Reservoir hosts of Borrelia burgdorferi sensu lato Lyme disease spirochetes infect diverse animal species, but not all of them serve as competent hosts. Efficient reservoir hosts of B. burgdorferi s.l. share several characteristics. They are abundant, large number of them is naturally infected and serves as hosts to numerous vector competent ticks. They do not usually become resistant to repeated tick feeding. They are readily infected and remain infected and infective to competent tick vectors for long periods of time, often for life. Response of vertebrate serum complement to B. burgdorferi s.l. spirochetes. Ticha et al., 2016 Ticks of medical importance, “bridge” vectors of B. burgdorferi s.l. (human-biting species) Ixodes ricinus, Ixodes persulcatus – Europe, Asia Ixodes scapularis, Ixodes pacificus – North America Hypostome of the castor been tick Ixodes ricinus.
    [Show full text]
  • Lauren Maestas M.S
    11/5/12 Lauren Maestas M.S. Candidate University of Tennessee Department of Forestry, Wildlife and Fisheries Photo Credits: Robyn Nadolny, Chelsea Wright Wayne Hynes, Daniel Sonenshine, Holly Gaff Old Dominion University Dept. of Biology } Introduction and Justification } Objectives } Methods } Anticipated Results } Future Directions 1 11/5/12 Bridging Vector • Ticks carry and transmit a I. scapularis greater variety of pathogens to domestic animals than any Sylvaticother type cycle of biting arthropod • Ticks are a close second to mosquitos worldwide in human disease transmission I. affinis Photo Credit: Robyn Nadolny, Chelsea Wright Wayne Hynes, Daniel Sonenshine, Holly Gaff Old Dominion University Dept. of Biology Maria Duik-Wasser Ixodes affinis Ixodes scapularis •Both have a 1-2 year life cycle •Both feed on multiple wildlife hosts http://www.humanillnesses.com/Infectious-Diseases-He-My/Lyme-Disease.html 0% Bbsl 40% Bbsl Maggi 2009 Bbss? Photo Credit: Robyn Nadolny, Chelsea Wright Wayne Hynes, Daniel Sonenshine, Holly Gaff Old Dominion University Dept. of Biology A. Causey personal communication http://www.fishing-nc.com/nc-fishing-regulations.php 2 11/5/12 18 Species of Borrelia currently recognized in the Bbsl complex Rudenko et al. 2011 1. To test for North- South latitudinal trends in Ixodes spp. genotype, and Bbsl prevalence and strain type. 2. In South Carolina, to compare the prevalence of Bbsl and Ixodid tick species collected from wild mesomammals with those from a) vegetation, and b) domestic dogs (Sentinels). 3 11/5/12
    [Show full text]
  • Trends in Borrelia Spp. Prevalence in Ixodes Spp. Ticks from the Southeastern Coastal United States
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Masters Theses Graduate School 8-2013 TRENDS IN BORRELIA SPP. PREVALENCE IN IXODES SPP. TICKS FROM THE SOUTHEASTERN COASTAL UNITED STATES Lauren Paul Maestas University of Tennessee - Knoxville, [email protected] Follow this and additional works at: https://trace.tennessee.edu/utk_gradthes Part of the Biodiversity Commons, Biology Commons, Entomology Commons, Molecular Genetics Commons, Parasitology Commons, and the Population Biology Commons Recommended Citation Maestas, Lauren Paul, "TRENDS IN BORRELIA SPP. PREVALENCE IN IXODES SPP. TICKS FROM THE SOUTHEASTERN COASTAL UNITED STATES. " Master's Thesis, University of Tennessee, 2013. https://trace.tennessee.edu/utk_gradthes/2433 This Thesis is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Masters Theses by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a thesis written by Lauren Paul Maestas entitled "TRENDS IN BORRELIA SPP. PREVALENCE IN IXODES SPP. TICKS FROM THE SOUTHEASTERN COASTAL UNITED STATES." I have examined the final electronic copy of this thesis for form and content and recommend that it be accepted in partial fulfillment of the equirr ements for the degree of Master of Science, with a major in Wildlife and Fisheries Science. Graham J. Hickling, Major Professor We have read this thesis and recommend its acceptance: Debra L. Miller, Rebecca T. Trout Fryxell Accepted for the Council: Carolyn R. Hodges Vice Provost and Dean of the Graduate School (Original signatures are on file with official studentecor r ds.) TRENDS IN BORRELIA SPP.
    [Show full text]
  • Annotated List of the Hard Ticks (Acari: Ixodida: Ixodidae) of New Jersey
    applyparastyle "fig//caption/p[1]" parastyle "FigCapt" applyparastyle "fig" parastyle "Figure" Journal of Medical Entomology, 2019, 1–10 doi: 10.1093/jme/tjz010 Review Review Downloaded from https://academic.oup.com/jme/advance-article-abstract/doi/10.1093/jme/tjz010/5310395 by Rutgers University Libraries user on 09 February 2019 Annotated List of the Hard Ticks (Acari: Ixodida: Ixodidae) of New Jersey James L. Occi,1,4 Andrea M. Egizi,1,2 Richard G. Robbins,3 and Dina M. Fonseca1 1Center for Vector Biology, Department of Entomology, Rutgers University, 180 Jones Ave, New Brunswick, NJ 08901-8536, 2Tick- borne Diseases Laboratory, Monmouth County Mosquito Control Division, 1901 Wayside Road, Tinton Falls, NJ 07724, 3 Walter Reed Biosystematics Unit, Department of Entomology, Smithsonian Institution, MSC, MRC 534, 4210 Silver Hill Road, Suitland, MD 20746-2863 and 4Corresponding author, e-mail: [email protected] Subject Editor: Rebecca Eisen Received 1 November 2018; Editorial decision 8 January 2019 Abstract Standardized tick surveillance requires an understanding of which species may be present. After a thorough review of the scientific literature, as well as government documents, and careful evaluation of existing accessioned tick collections (vouchers) in museums and other repositories, we have determined that the verifiable hard tick fauna of New Jersey (NJ) currently comprises 11 species. Nine are indigenous to North America and two are invasive, including the recently identified Asian longhorned tick,Haemaphysalis longicornis (Neumann, 1901). For each of the 11 species, we summarize NJ collection details and review their known public health and veterinary importance and available information on seasonality. Separately considered are seven additional species that may be present in the state or become established in the future but whose presence is not currently confirmed with NJ vouchers.
    [Show full text]
  • An Ixodes Minor and Borrelia Carolinensis Enzootic Cycle
    An Ixodes minor and Borrelia carolinensis enzootic cycle involving a critically endangered Mojave Desert rodent Janet Foley1, Caitlin Ott-Conn1, Joy Worth1, Amanda Poulsen1 & Deana Clifford2,3 1Department of Medicine and Epidemiology, School of Veterinary Medicine, University of California, 1320 Tupper Hall, Davis, California 95616 2Wildlife Investigations Lab, California Department of Fish and Wildlife, 1701 Nimbus Road, Rancho Cordova, California 95670 3Wildlife Health Center, University of California, Davis, California 95616 Keywords Abstract 16S rRNA, Amargosa vole, Borrelia burgdorferi sensu lato, calreticulin, Microtus Microtus californicus scirpensis is an endangered, isolated subspecies of Califor- californicus scirpensis, Migration. nia vole. It requires water pools and riparian bulrush (Schoenoplectus americ- anus) and occupies some of the rarest habitat of any North American mammal. Correspondence The minimally vegetated, extremely arid desert surrounding the pools is essen- Janet Foley, Department of Medicine and tially uninhabitable for Ixodes species ticks. We describe an enzootic cycle of Epidemiology, School of Veterinary Medicine, Borrelia carolinensis in Ixodes minor ticks at a site 3500 km distant from the University of California, 1320 Tupper Hall, region in which I. minor is known to occur in Tecopa Host Springs, Inyo Davis, CA 95616. Tel: +530-754-9740; Fax: +530-752-0414 County, eastern Mojave Desert, California. Voles were live-trapped, and ticks E-mail: [email protected] and blood samples queried by PCR and DNA sequencing for identification and determination of the presence of Borrelia spp. Between 2011–2013, we found 21 Funding Information Ixodes minor ticks (prevalence 4–8%) on Amargosa voles and Reithrodontomys This project was funded by the California megalotis.
    [Show full text]
  • Focus Stacking Images of Morphological Character States for Differentiating the Adults of Ixodes Affinis and Ixodes Scapularis (Acari: Ixodidae) in Areas of Sympatry
    Old Dominion University ODU Digital Commons Biological Sciences Faculty Publications Biological Sciences 2021 Focus Stacking Images of Morphological Character States for Differentiating the Adults of Ixodes affinis and Ixodes scapularis (Acari: Ixodidae) in Areas of Sympatry Robyn M. Nadolny Marcée Toliver Holly D. Gaff Old Dominion University, [email protected] John G. Snodgrass Richard G. Robbins Follow this and additional works at: https://digitalcommons.odu.edu/biology_fac_pubs Part of the Biology Commons, Forest Biology Commons, and the Parasitology Commons Original Publication Citation Nadolny, R. M., Toliver, M., Gaff, H. D., Snodgrass, J. G., & Robbins, R. G. (2021). Focus stacking images of morphological character states for differentiating the adults of Ixodes affinis and Ixodes scapularis (Acari: Ixodidae) in areas of sympatry. Journal of medical entomology, 1-7, Article tjab058. https://doi.org/10.1093/jme/tjab058 This Article is brought to you for free and open access by the Biological Sciences at ODU Digital Commons. It has been accepted for inclusion in Biological Sciences Faculty Publications by an authorized administrator of ODU Digital Commons. For more information, please contact [email protected]. applyparastyle "fig//caption/p[1]" parastyle "FigCapt" applyparastyle "fig" parastyle "Figure" Journal of Medical Entomology, XX(X), 2021, 1–7 doi: 10.1093/jme/tjab058 Short Communication Morphology, Systematics, Evolution Focus Stacking Images of Morphological Character Downloaded from https://academic.oup.com/jme/advance-article/doi/10.1093/jme/tjab058/6231888 by guest on 31 May 2021 States for Differentiating the Adults of Ixodes affinis and Ixodes scapularis (Acari: Ixodidae) in Areas of XX Sympatry Robyn M. Nadolny,1,7, Marcée Toliver,2 Holly D.
    [Show full text]
  • Human Bartonellosis: an Underappreciated Public Health Problem?
    Tropical Medicine and Infectious Disease Review Human Bartonellosis: An Underappreciated Public Health Problem? Mercedes A. Cheslock and Monica E. Embers * Division of Immunology, Tulane National Primate Research Center, Tulane University Health Sciences, Covington, LA 70433, USA; [email protected] * Correspondence: [email protected]; Tel.: +(985)-871-6607 Received: 24 March 2019; Accepted: 16 April 2019; Published: 19 April 2019 Abstract: Bartonella spp. bacteria can be found around the globe and are the causative agents of multiple human diseases. The most well-known infection is called cat-scratch disease, which causes mild lymphadenopathy and fever. As our knowledge of these bacteria grows, new presentations of the disease have been recognized, with serious manifestations. Not only has more severe disease been associated with these bacteria but also Bartonella species have been discovered in a wide range of mammals, and the pathogens’ DNA can be found in multiple vectors. This review will focus on some common mammalian reservoirs as well as the suspected vectors in relation to the disease transmission and prevalence. Understanding the complex interactions between these bacteria, their vectors, and their reservoirs, as well as the breadth of infection by Bartonella around the world will help to assess the impact of Bartonellosis on public health. Keywords: Bartonella; vector; bartonellosis; ticks; fleas; domestic animals; human 1. Introduction Several Bartonella spp. have been linked to emerging and reemerging human diseases (Table1)[ 1–5]. These fastidious, gram-negative bacteria cause the clinically complex disease known as Bartonellosis. Historically, the most common causative agents for human disease have been Bartonella bacilliformis, Bartonella quintana, and Bartonella henselae.
    [Show full text]
  • Mammalian Diversity in Nineteen Southeast Coast Network Parks
    National Park Service U.S. Department of the Interior Natural Resource Program Center Mammalian Diversity in Nineteen Southeast Coast Network Parks Natural Resource Report NPS/SECN/NRR—2010/263 ON THE COVER Northern raccoon (Procyon lotot) Photograph by: James F. Parnell Mammalian Diversity in Nineteen Southeast Coast Network Parks Natural Resource Report NPS/SECN/NRR—2010/263 William. David Webster Department of Biology and Marine Biology University of North Carolina – Wilmington Wilmington, NC 28403 November 2010 U.S. Department of the Interior National Park Service Natural Resource Program Center Fort Collins, Colorado The National Park Service, Natural Resource Program Center publishes a range of reports that address natural resource topics of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Report Series is used to disseminate high-priority, current natural resource management information with managerial application. The series targets a general, diverse audience, and may contain NPS policy considerations or address sensitive issues of management applicability. All manuscripts in the series receive the appropriate level of peer review to ensure that the information is scientifically credible, technically accurate, appropriately written for the intended audience, and designed and published in a professional manner. This report received formal peer review by subject-matter experts who were not directly involved in the collection, analysis, or reporting of the data, and whose background and expertise put them on par technically and scientifically with the authors of the information. Views, statements, findings, conclusions, recommendations, and data in this report do not necessarily reflect views and policies of the National Park Service, U.S.
    [Show full text]
  • Prevalencija Zaraženosti Krpelja Vrste Ixodes Ricinus Uzroċnikom Borrelia
    UNIVERZITET U NOVOM SADU POLJOPRIVREDNI FAKULTET Departman za fitomedicinu i zaštitu ţivotne sredine Kandidat: Mentor: Ivana Ivanović doc. dr Aleksandar Jurišić PREVALENCIJA ZARAŢENOSTI KRPELJA VRSTE IXODES RICINUS UZROČNIKOM BORRELIA BURGDORFERI U ŠUMSKIM EKOSISTEMIMA MASTER RAD Novi Sad, 2014. Prevalencija zaraženosti krpelja vrste Ixodes ricinus uzročnikom Borrelia burgdorferi u šumskim ekosistemima SADRŢAJ SAŢETAK ............................................................................................................................ 4 ABSTRACT ......................................................................................................................... 5 1. UVOD............................................................................................................................... 6 1.1. Zadatak i cilj istraţivanja ........................................................................................... 7 2. PREGLED LITERATURE ................................................................................................ 9 2.1. Istorijat istraţivanja krpelja i vektorske uloge Ixodes ricinus u širenju Borrelia burgdorferi u Srbiji i Evropi ............................................................................................. 9 2.2. Sistematika krpelja ................................................................................................... 12 2.3. Geografska distribucija i stanište vrste Ixodes ricinus ............................................... 13 2.4. Morfološke i anatomske karakteristike
    [Show full text]
  • 24 1048 Sherrill 5.Indd
    2012 SOUTHEASTERN NATURALIST 11(3):529–533 Survey of Zoonotic Pathogens in White-tailed Deer on Bald Head Island, North Carolina Brandon L. Sherrill1,*, Anthony G. Snider2, Suzanne Kennedy-Stoskopf 3, and Christopher S. DePerno1 Abstract - Odocoileus virginianus (White-tailed Deer) have become overabundant in many urban and suburban areas, which can cause concern about exposure of humans and pets to zoonotic pathogens. Bald Head Island, NC is a small barrier island that has experienced ongoing residential development since the mid-1980s and has a relatively high deer density (15–17 deer/km2). To address concerns expressed by residents, we screened ≈13% of the White-tailed Deer population for potential zoonotic pathogens. We collected blood from 8 deer in January through March 2008 and 5 deer in January 2009. We tested sera for antibodies to Anaplasma phagocytophilum, Borrelia burgdorferi, and six serovars of Leptospira interrogans; and whole blood samples for Bartonella spp. and B. burgdorferi DNA. All sera were negative for antibodies to L. interrogans; two samples were seropositive for A. phagocytophilum, and one was seropositive for B. burgdorferi. Whole blood PCR results were negative for Bartonella spp. and B. burgdorferi. Con- tinued surveillance for wildlife diseases on Bald Head Island is necessary to determine prevalence of specifi c pathogens, their impacts on the White-tailed Deer population, and the risk of exposure to humans and pets. Introduction Odocoileus virginianus Zimmerman (White-tailed Deer; hereafter also “Deer”) are overabundant in many areas throughout their range and can often negatively impact human populations (e.g., property damage, vehicle collisions, exposure to zoonotic pathogens), particularly in suburban areas with expanding residential development (Butfi loski et al.
    [Show full text]
  • Extensive Distribution of the Lyme Disease Bacterium, Borrelia Burgdorferi Sensu Lato, in Multiple Tick Species Parasitizing Avian and Mammalian Hosts Across Canada
    UC Davis UC Davis Previously Published Works Title Extensive Distribution of the Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, in Multiple Tick Species Parasitizing Avian and Mammalian Hosts across Canada. Permalink https://escholarship.org/uc/item/7950629h Journal Healthcare (Basel, Switzerland), 6(4) ISSN 2227-9032 Authors Scott, John D Clark, Kerry L Foley, Janet E et al. Publication Date 2018-11-12 DOI 10.3390/healthcare6040131 Peer reviewed eScholarship.org Powered by the California Digital Library University of California healthcare Article Extensive Distribution of the Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, in Multiple Tick Species Parasitizing Avian and Mammalian Hosts across Canada John D. Scott 1,*, Kerry L. Clark 2, Janet E. Foley 3, John F. Anderson 4, Bradley C. Bierman 2 and Lance A. Durden 5 1 International Lyme and Associated Diseases Society, Bethesda, MD 20827, USA 2 Environmental Epidemiology Research Laboratory, Department of Public Health, University of North Florida, Jacksonville, FL 32224, USA; [email protected] (K.L.C.); [email protected] (B.C.B.) 3 Department of Medicine and Epidemiology, School of Veterinary Medicine, University of California, Davis, CA 95616, USA; [email protected] 4 Department of Entomology, Center for Vector Ecology and Zoonotic Diseases, The Connecticut Agricultural Experiment Station, New Haven, CT 06504, USA; [email protected] 5 Department of Biology, Georgia Southern University, Statesboro, GA 30458, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-519-843-3646 Received: 13 September 2018; Accepted: 2 November 2018; Published: 12 November 2018 Abstract: Lyme disease, caused by the spirochetal bacterium, Borrelia burgdorferi sensu lato (Bbsl), is typically transmitted by hard-bodied ticks (Acari: Ixodidae).
    [Show full text]