Bacterial Expression and Kinetic Analysis of Carboxylesterase 001D from Helicoverpa Armigera

International Journal of Molecular Sciences

Article Bacterial Expression and Kinetic Analysis of Carboxylesterase 001D from Helicoverpa armigera

Yongqiang Li 1, Jianwei Liu 2, Mei Lu 1, Zhiqing Ma 1, Chongling Cai 1, Yonghong Wang 1,* and Xing Zhang 1

1 Research and Development Centre of Biorational Pesticides, Northwest Agriculture and Forestry University, Yangling 712100, China; [email protected] (Y.L.); [email protected] (M.L.); [email protected] (Z.M.); [email protected] (C.C.); [email protected] (X.Z.) 2 Commonwealth Scientiﬁc and Industrial Research Organisation Land & Water Flagship, Canberra, ACT 2601, Australia; [email protected] * Correspondence: [email protected]; Tel.: +86-29-8709-2122

Academic Editor: Christo Z. Christov Received: 25 January 2016; Accepted: 28 March 2016; Published: 2 April 2016

Abstract: Carboxylesterasesare an important class of detoxification enzymes involved in insecticide resistance in insects. A subgroup of Helicoverpa armigera esterases, known as Clade 001, was implicated in organophosphate and pyrethroid insecticide resistance due to their overabundance in resistant strains. In this work, a novel carboxylesterasegene 001D of H. armigera from China was cloned, which has an open reading frame of 1665 nucleotides encoding 554 amino acid residues. We used a series of fusion proteins to successfully express carboxylesterase 001D in Escherichia coli. Three different fusion proteins were generated and tested. The enzyme kinetic assay towards 1-naphthyl acetate showed all three purified fusion proteins are active with a Kcat between 0.35 and 2.29 s´1, and a Km between 7.61 and 19.72 µM. The HPLC assay showed all three purified fusion proteins had low but measurable hydrolase activity towards β-cypermethrin and fenvalerate insecticides (specific activities ranging from 0.13 to 0.67 µM¨ min´1¨ (µM´1¨ protein)). The enzyme was stable up to 40 ˝C and at pH 6.0–11.0. The results imply that carboxylesterase 001D is involved in detoxification, and this moderate insecticide hydrolysis may suggest that overexpression of the gene to enhance insecticide sequestration is necessary to allow carboxylesterases to confer resistance to these insecticides in H. armigera.

Keywords: Helicoverpaarmigera; carboxylesterase; pyrethroid; heterologous expression

1. Introduction The cotton bollworm, Helicoverpa armigera, is a major crop pest in many parts of the world [1–4]. It has rapidly developed resistance to organophosphate (OP) and pyrethroid insecticides [5–8]. Carboxylesterases (EC3.1.1.1) play a critical role in the detoxification of xenobiotic compounds and are implicated in pyrethroid and OP resistance in a wide variety of pest insect species [9–14]. Carboxylesterase-mediated metabolic resistance to OPs and pyrethroids can occur through two mechanisms. The first one involves mutations in the active site (oxyanion hole and acyl-binding pocket) of the enzyme that elevates the OP hydrolytic activity and reduces the activity towards carboxylesterase substrates, such as 1-naphthyl acetate [15–18]. The second mechanism involves overexpression of unaltered carboxylesterases based on gene amplification or up-regulated transcription, allowing for effective sequestration of the insecticides instead of hydrolysis [19–23]. In H. armigera, a correlation between enhanced esterase activity and pyrethroid resistance was found in Australia, Asia, and Africa [4,23–27]. Understanding or combating esterase-mediated resistance is hindered by the fact that over 70 esterases may be present within lepidopteran

Int. J. Mol. Sci. 2016, 17, 493; doi:10.3390/ijms17040493 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2016, 17, 493 2 of 13 genomes [28]. Thirty-nine putative paralogous carboxy/cholinesterase (CCE) sequences were identified from a susceptible H. armigera GR strain, and they were figured into a lot of subgroups according to a phylogenetic analysis [28]. In most cases, the overexpressed esterases in resistant strains remain unidentified at the molecular level, and their substrate spectrums and inhibitor profiles are unknown. In the most extensive study of H. armigera esterases derived from the susceptible GR strain, eight carboxylesterases belonging to the CCE Clade 001 were expressed in Sf9 insect cells, which showed tight binding to OPs and some hydrolytic activity towards OPs [29,30]. However, they all showed relatively low activities against nine cypermethrin and fenvalerate isomers [29,30]. In the resistant H. armigera YGF strain from China, two unique isozyme bands in native polyacrylamide gel electrophoresis (PAGE) were matched with four carboxylesterase genes, 001A, 001D, 001I, 001J by mass spectrometry analysis, shown to be overexpressed up to 90-fold, as compared to the susceptible SCD strain [23]. Additionally, proteomic and molecular analyses of the OP-resistant H. armigera strain (MonoR) from China also showed that the overexpression of six Clade 001 enzymes, including 001D, was associated well with monocrotophos resistance [12].They showed that carboxylesterases in H. armigera were involved in resistance to OP and pyrethroid insecticides via enhanced sequestration, favoured by overexpression. Nearly all published studies focusing on the hydrolytic activity of H. armigera carboxylesterases towards OP and pyrethroid insecticides used the enzymes heterologously expressed in insect Sf9 cells with the baculovirus expression system [29–31]. In other cases, the carboxylesterase E3 from Lucilia cuprina and the juvenile hormone esterase gene (Nljhe) from Nilaparvata lugens have also been expressed in the baculovirus expression system [15,32]. However, due to slow cell growth and low expression levels within eukaryotic cells, only limited amounts of the enzymes can be produced. As a consequence, all of the above studies have been restricted to catalytic studies of unpurified enzymes in raw cell extracts. In contrast, the E. coli system is a preferred expression system because of its extensive characterization and ease of handling [33]. Some insect esterases have been shown to be active when expressed in highly efficient bacterial systems, such as in E. coli [34–36]. In many other cases, however, problems with protein folding have failed to yield active enzymes after expression in bacterial cells. For example, 3 of the 14 H. armigera carboxylesterases from the susceptible GR strain showed no esterase activity when expressed in E. coli, using the Gateway-compatible expression vector with their native start and stop codons [37]. In this study, we sequenced a cDNA (001D) encoding a carboxylesterase from an insecticide-susceptible H. armigera strain from the Wuhan region of China (WH). In order to obtain active enzyme, we heterologously expressed three fusion proteins containing three different solubility/affinity tags in the E. coli cells. We purified each fusion protein and evaluated their hydrolytic activities towards a model substrate (1-naphthyl acetate, 1-NA) and two pyrethroid insecticides (β-cypermethrin and fenvalerate). We demonstrated that all three purified proteins of 001D were capable of metabolizing two real insecticide substrates. Moreover, the effect of temperature and pH on the enzyme activity was also explored, and the mechanism of 001D involved in pyrethroids resistance is further discussed.

2. Results

2.1. Cloning and Sequence Analysis Thecarboxylesterase gene 001D was cloned from a cDNA library of the midgut of H. armigera from the susceptible Wuhan (WH) strain. The novel cDNA sequence of 001D (GenBank® accession number KT345935) has an open reading frame of 1665 nucleotides, encoding 554 amino acid residues with a molecular weight of 62.6 kDa, and an isoelectric point of 5.27. It includes a signal peptide containing a cleavage site between the 16th and 17th amino acids. The alignment showed that carboxylesterase 001D has highly conserved residues of a catalytic triad (S202-H443-E330) and a pentapeptide termed the nucleophilic elbow (G200-S201-S202-A203-G204) (Figure1). 001D also contains the other three subsites, including the leaving group pocket (M333-R334-I133), acyl pocket (F235-T287-F309), and Int. J. Mol. Sci. 2016, 17, 493 3 of 13

Int. J. Mol. Sci. 2016, 17, 493 3 of 13 Int.oxyanion J. Mol. Sci. hole 2016 (G136-G137-A203), 17, 493 [18]. The characterization of the enzyme active site thus indicates3 of 13 activethat carboxylesterase site thus indicates 001D that may carboxyleste have hydrolyticrase 001D function. may BLAST have hydrolytic search with function. the amino BLAST acid sequence search active site thus indicates that carboxylesterase 001D may have hydrolytic function. BLAST search with(Figure the2 amino) showed acid that sequence the carboxylesterase (Figure 2) showed shared that 98% the similaritycarboxylesterase to the carboxylesteraseshared 98% similarity 001D ofto with the amino acid sequence (Figure 2) showed® that the carboxylesterase shared 98% similarity to thethe carboxylesterase pyrethroid-susceptible 001D of GR the strain pyrethroid-susceptible (GenBank accession GR number strain ADF43460)(GenBank® fromaccession Australia number [28]. the carboxylesterase 001D of the pyrethroid-susceptible GR strain (GenBank® accession number ADF43460)Additionally, from the aminoAustralia acid [28]. sequence Additionally, showed 96%the andamino 97% acid similarity sequence to the showed carboxylesterase 96% and of97% the ADF43460) from Australia [28]. Additionally, the amino acid® sequence showed 96% and 97% similaritypyrethroid-susceptible to the carboxylesterase YG and resistant of the YGF pyre strainthroid-susceptible (GenBank accession YG and numbers resistant ADE05550 YGF strain and similarity to the carboxylesterase of the pyrethroid-susceptible YG and resistant YGF strain (GenBankADE05555)® accession from China, numbers respectively ADE05550 [23]. and ADE05555) from China, respectively [23]. (GenBank® accession numbers ADE05550 and ADE05555) from China, respectively [23].

Figure 1. Alignment of the deduced amino acid sequences of 001D (GenBank®® accession number Figure 1 1.. Alignment of thethe deduceddeduced aminoamino acidacid sequencessequences of 001D001D (GenBank(GenBank® accession number KT345935) from the H. armigera Wuhan (WH) strain with the previously reported insect KT345935) fromfrom the theH. armigeraH. armigeraWuhan Wuhan (WH) strain (WH) with strain the previously with the reported previously insect reported carboxylesterase insect carboxylesterase® E7 (GenBank® accession number AAD29685) from Musca domestica® , аE7 (GenBank® carboxylesteraseE7 (GenBank accession E7 (GenBank number® accession AAD29685) number from AAD29685)Musca domestica from, aE7 Musca (GenBank domesticaaccession, аE7 (GenBank number® accession number NP_524261) from Drosophila melanogaster and ®the E3 (GenBank® accession number accessionNP_524261) number from DrosophilaNP_524261) melanogaster from Drosophilaand themelanogaster E3 (GenBank and theaccession E3 (GenBank number® accession AAB67728) number from AAB67728)L. cuprina from L. cuprina. The signal peptide sequences of 001D are underlined, the catalytic triad AAB67728). from The signalL. cuprina peptide. The sequencessignal peptide of 001D sequences are underlined, of 001D are the underlined, catalytic triadthe catalytic residues triad are residuesvertically are boxed vertically in blue boxed color, in blue the highly color, the conserved highly conserved pentapeptide pentapeptide residue are residue boxed are with boxed red with color, residues are vertically boxed in blue color, the highly conserved pentapeptide residue are boxed with reddark color, triangles dark indicatetriangles the indicate anionic the site, anionic red asterisks site, red indicate asterisks the indicate acyl-binding the acyl-binding pocket, green pocket, arrows red color, dark triangles indicate the anionic site, red asterisks indicate the acyl-binding pocket, greenmean arrows the oxyanion mean the hole. oxyanion hole. green arrows mean the oxyanion hole.

10 12 56 113 119 142 143 247 255 270 271 310 320 322 329 333 352 358 366 384 447 470 494 523 545 552 10 12 56 113 119 142 143 247 255 270 271 310 320 322 329 333 352 358 366 384 447 470 494 523 545 552 GR ADF43460 AADNYMDAN I SSVLMMFKDNSNWAKS GR ADF43460 AADNYMDAN I SSVLMMFKDNSNWAKS WH KT345935 ·····N·T·VP·L·····EDTK·PT· WH KT345935 ·····N·T·VP·L·····EDTK·PT· YG ADE05550 VT·QC·Y·····LVTI·M·DTKA··N YG ADE05550 VT·QC·Y·····LVTI·M·DTKA··N YGF ADE05555 ··H·····H··T····S········N YGF ADE05555 ··H·····H··T····S········N

Figure 2. Comparison of amino acid differences of 001D from H. armigera between the WH, GR, YG, Figure 2. Comparison of amino acid differences of 001D from H. armigera between the WH, GR, YG, andFigure YGF 2. strainsComparison (GenBank of amino® accession acid differences numbers KT345935, of 001D from ADF43460,H. armigera ADE05550,between and the WH,ADE05555). GR, YG, and YGF strains (GenBank® accession numbers KT345935, ADF43460, ADE05550, and ADE05555). Aminoand YGF acids strains the same (GenBank as thataccession of the GR numbers strain are KT345935, indicated ADF43460, with a dot. ADE05550, Numbering and indicates ADE05555). the Amino acids the same as that of the GR strain are indicated with a dot. Numbering indicates the alignmentAmino acids number the same of diffe asrent that residue of the GRamino strain acids. are indicated with a dot. Numbering indicates the alignment number of diffe differentrent residue amino acids. 2.2. Purification of Recombinant Carboxylesterases and Western Blot Assay 2.2. Purification of Recombinant Carboxylesterases and Western Blot Assay The coding sequence of the 001D gene without signal peptide was inserted in three types of The coding sequence of the 001D gene without signal peptide was inserted in three types of expression vectors, pE1, pET30a, and pET32a, and expressed in the E. coli BL21 (DE3) strain. Three expression vectors, pE1, pET30a, and pET32a, and expressed in the E. coli BL21 (DE3) strain. Three

Int. J. Mol. Sci. 2016, 17, 493 4 of 13

2.2. Puriﬁcation of Recombinant Carboxylesterases and Western Blot Assay

Int. J. Mol.The Sci. coding 2016, 17 sequence, 493 of the 001D gene without signal peptide was inserted in three4 types of 13 of expression vectors, pE1, pET30a, and pET32a, and expressed in the E. coli BL21 (DE3) differentstrain. Threefusion differentproteins, fusion6×His/001D proteins, (pE1), 6 ˆ6×His/S-tag/001DHis/001D (pE1), (pET30a), 6ˆHis/S-tag/001D and Trx/6×His/S-tag/001D (pET30a), and (pET32a)Trx/6ˆHis/S-tag/001D were purified (pET32a) using Ni were2+-Nitrilotriacetic purified using Niacid2+-Nitrilotriacetic (NTA) resin acid(Figure (NTA) 3). resinThe (Figurepurified3). recombinantThe purified enzyme recombinant 001D from enzyme pET32a 001D and from pE1 pET32a showed and poor pE1 purity showed after pooraffinity purity chromatography after affinity andchromatography gave more than and two gave bands, more but than the two purified bands, 001D but the from purified pET30a 001D showed from only pET30a a single showed band only of approximatelya single band of67 approximatelykDa on the SDS-PAGE, 67 kDa on in thegood SDS-PAGE, agreement in with good the agreement theoretical with molecular the theoretical mass of 6×His/S-tag/001Dmolecular mass of (Figure 6ˆHis/S-tag/001D 3A). The antibody (Figure 3recognizedA). The antibody a single recognized band from a single all three band frompurified all recombinantthree purified proteins recombinant as shown proteins in Western as shown blotresu in Westernlt (Figure blotresult 3B). By (Figurecontrast3 B).with By the contrast 001D withband fromthe 001D pET30a band vector, from a pET30a weak Western vector, a signal weak was Western detected signal for was recombinant detected forenzyme recombinant produced enzyme from pET32aproduced and from pE1 pET32a vectors, and which pE1 vectors,should be which the shouldtarget bands, be the targetas it is bands, identical as it with is identical the theoretical with the moleculartheoretical weight molecular of the weight fusion of proteins, the fusion Trx/6×His/S-tag/001D proteins, Trx/6ˆHis/S-tag/001D and 6×His-tag/001D and 6ˆ His-tag/001D(79 and 63 kDa), (79 respectively.and 63 kDa), respectively.The concentration The concentration of the purified of the 001D purified from 001DpET30a from is pET30a70 mg·L is−1 70based mg¨ Lon´1 Bradfordbased on assay,Bradford and assay, it is andpure it as is purea single as aband. single The band. concentration The concentration of both of 001D both 001Dfrom frompET32a pET32a and pE1 and pE1are estimatedare estimated from from the theWestern Western blot blot by by using using GelQuantNET GelQuantNET software software from from Biochem-Lab Biochem-Lab Solutions (University(University of of California, California, San San Francisco, CA, USA).

FigureFigure 3. 3. SDS-PAGESDS-PAGE and and Western Western blot blot analysis analysis of expr of expressionession and purification and purification of recombinant of recombinant 001D. (001D.A) The (A )samples The samples were wereseparated separated on 12% on 12% gels; gels; and and (B) ( BWestern) Western blot blot analysis analysis of of recombinantrecombinant carboxylesterasecarboxylesterase using using anti-His anti-His tag antibody.antibody. Lane Lane 11:: Protein Protein ladder, ladder, Lane Lane 22:: purified purified Trx/6×His/S-tag/001DTrx/6ˆHis/S-tag/001D from from pET32a, pET32a, Lane Lane 3:3 :purified purified 6×His-tag/001D 6ˆHis-tag/001D from from pE1, pE1, Lane Lane 44: :purified purified 6×His/S-tag/001D6ˆHis/S-tag/001D from from pET30a. pET30a.

2.3.2.3. Enzymatic Enzymatic Activity Activity of of 001D 001D to towardswards an an Artificial Artificial Carboxylester Carboxylester ActivitiesActivities of of the the purified purified recombinant enzymes enzymes towards towards the the 1-naphthyl 1-naphthyl acetate acetate (1-NA) (1-NA) were were determineddetermined and and shown shown in in Table Table 11.. All three fusion proteins showed esterase activity towards 1-NA. AmongAmong thethe threethree fusion fusion proteins, proteins, the the recombinant recombinant enzyme enzyme of 001D of 001D from pET32afrom pET32a exhibited exhibited the highest the highestcatalytic catalytic efficiency efficien towardscy towards 1-NA, with1-NA, a Kwithm of a 7.61Km ofµM 7.61 and μM a kandcat ofa k 2.29cat of s´ 2.291, showing s−1, showing it has it a hashigh a affinityhigh affinity and turn-overand turn-over to the to substrate the substrate compared compared to those to those of the of recombinantthe recombinant 001D 001D from from pE1 pE1and and pET30a. pET30a. The The fusion fusion protein protein of 001D of 001D from from pE1 pE1 had had a very a very poor poor affinity affinity and and low low turn-over turn-over to the to thesubstrate. substrate. In contrast, In contrast, the purifiedthe purified protein protei of 001Dn of from001D pET30afrom pET30a showed showed moderate moderate esterase esterase activity activitytowards towards 1-NA with 1-NA a specificwith a specific activity activity of 0.57 µofM 0.57¨ s´ 1μ¨M·s(µM−1´·(1μ¨ Mprotein).−1·protein). The The results results suggest suggest that that the thethree three types types of fusion of fusion tags tags have have different different effects effe oncts enzymatic on enzymatic activity activity of the of carboxylesterase the carboxylesterase 001D, 001D,among among them, thethem, larger the fusionlarger tag,fusion Trx-tag, tag, Trx-tag, has strongest has strongest enhancing enhancing effect on theeffect esterase on the activity esterase of activity001D towards of 001D the towards model the substrate. model substrate.

Table 1. Kinetic parameters for the purified carboxylesterases towards the 1-naphthyl acetate.

Enzyme Specific Activity Km kcat pET32a-001D 2.24(0.14) 7.61(0.63) 2.29(0.08) pE1-001D 0.34(0.14) 19.72(6.69) 0.35(0.05) pET30a-001D 0.57(0.07) 12.51(2.14) 0.60(0.06) Specific activities (at 200 μM substrate) (μM·s−1·(μM−1·protein)) and estimates of Km (μM) and kcat (s−1) are shown. Estimates are based on an average of three replicates, and standard errors for these estimates are given in brackets.

Int. J. Mol. Sci. 2016, 17, 493 5 of 13

Table 1. Kinetic parameters for the puriﬁed carboxylesterases towards the 1-naphthyl acetate.

Enzyme Speciﬁc Activity Km kcat pET32a-001D 2.24(0.14) 7.61(0.63) 2.29(0.08) pE1-001D 0.34(0.14) 19.72(6.69) 0.35(0.05) pET30a-001D 0.57(0.07) 12.51(2.14) 0.60(0.06) Speciﬁc activities (at 200 µM substrate) (µM¨ s´1¨ (µM´1¨ protein)) and estimates of Km (µM) and kcat (s´1) are shown. Estimates are based on an average of three replicates, and standard errors for these estimates are given in brackets.

2.4. Hydrolysis Activity of 001D towards Pyrethroid Insecticides The specific activities of all the three purified recombinant enzymes against the pyrethroids were determined. As shown in Table2, all three fusion proteins had low but measurable activities towards both the β-cypermethrin and fenvalerate substrates. The purified fusion proteins of 001D from pET32a showed relatively lower hydrolase activity towards the two real insecticides, as compared to the protein from pET30a. However, the specific activities of 001D from pET30a are higher, 0.41 and 0.67 µM¨ min´1¨ µM´1 towards the two pyrethroid substrates, respectively. For the β-cypermethrin substrate, the hydrolysis rate is 2-fold higher than that from pET32a and pE1. For the fenvalerate substrate, the hydrolysis rate is 2- and 5-fold higher than that from pET32a and pE1, respectively (Table2). Although the specific activities varied when the 001D was tagged with different fusion tags, the results reveal that all of the three fusion proteins can metabolize the two real insecticides, thus indicating that the carboxylesterase 001D is involved in detoxification of pyrethroid insecticides in the susceptible WH strain.

Table 2. Speciﬁc activities of puriﬁed fusion carboxylesterases expressed in E. coli towards pyrethroid insecticides.

Enzyme β-Cypermethrin Fenvalerate pET32a-001D 0.15(0.02) 0.32(0.02) pE1-001D 0.19(0.02) 0.13(0.06) pET30a-001D 0.41(0.04) 0.67(0.17) Control 0.10(0.01) 0.03(0.02) The values shown are micromoles of substrate hydrolyzed per micromole of enzyme per minute under the conditions of the assay. They are means with standard error sbased on an average of four replicates. For all substrates, control reactions were performed with the puriﬁed enzyme of pET30a-001D inactivated by boiling for 10 min.

2.5. Effects of Temperature and pH on the Enzyme Activity As shown in Figure4A, the optimal temperature for enzyme activity was 35 ˝C. The relative activities were more than 69.9% in the temperature range of 20 ˝C–45 ˝C. The thermo stability assay revealed that the enzyme was stable up to 40 ˝C, and 46.8% of residual activity remained at 45 ˝C (Figure4B). The enzyme lost activity when it was incubated at 60 ˝C for 1 h. The pH also had marked effects on the enzymatic activity. The enzyme showed the best activity at pH 7.0, which declined to 50.6% when the pH increased to 9.0 (Figure4C). However, 001D was stable within the pH range from 6.0 to 11.0, and the remaining enzyme activity was more than 70% after 1 h (Figure4D). Int. J. Mol. Sci. 2016, 17, 493 5 of 13

2.4. Hydrolysis Activity of 001D towards Pyrethroid Insecticides The specific activities of all the three purified recombinant enzymes against the pyrethroids were determined. As shown in Table 2, all three fusion proteins had low but measurable activities towards both the β-cypermethrin and fenvalerate substrates. The purified fusion proteins of 001D from pET32a showed relatively lower hydrolase activity towards the two real insecticides, as compared to the protein from pET30a. However, the specific activities of 001D from pET30a are higher, 0.41 and 0.67 μM·min−1·μM−1 towards the two pyrethroid substrates, respectively. For the β-cypermethrin substrate, the hydrolysis rate is 2-fold higher than that from pET32a and pE1. For the fenvalerate substrate, the hydrolysis rate is 2- and 5-fold higher than that from pET32a and pE1, respectively (Table 2). Although the specific activities varied when the 001D was tagged with different fusion tags, the results reveal that all of the three fusion proteins can metabolize the two real insecticides, thus indicating that the carboxylesterase 001D is involved in detoxification of pyrethroid insecticides in the susceptible WH strain.

Table 2. Specific activities of purified fusion carboxylesterases expressed in E. coli towards pyrethroid insecticides.

Enzyme β-Cypermethrin Fenvalerate pET32a-001D 0.15(0.02) 0.32(0.02) pE1-001D 0.19(0.02) 0.13(0.06) pET30a-001D 0.41(0.04) 0.67(0.17) Control 0.10(0.01) 0.03(0.02) The values shown are micromoles of substrate hydrolyzed per micromole of enzyme per minute under the conditions of the assay. They are means with standard error sbased on an average of four replicates. For all substrates, control reactions were performed with the purified enzyme of pET30a-001D inactivated by boiling for 10 min.

2.5. Effects of Temperature and pH on the Enzyme Activity As shown in Figure 4A, the optimal temperature for enzyme activity was 35 °C. The relative activities were more than 69.9% in the temperature range of 20–45 °C. The thermo stability assay revealed that the enzyme was stable up to 40 °C, and 46.8% of residual activity remained at 45 °C (Figure 4B). The enzyme lost activity when it was incubated at 60 °C for 1 h. The pH also had marked effects on the enzymatic activity. The enzyme showed the best activity at pH 7.0, which declined to 50.6% when the pH increased to 9.0 (Figure 4C). However, 001D was stable within the pH range from 6.0 to 11.0, and the remaining enzyme activity was more than 70% after 1 h Int. J. Mol. Sci. 2016, 17, 493 6 of 13 (Figure 4D).

A B 120 120

100 100

80 80

60 60

40 40

20 20 Relative activity(%) Relative activity (%) 0 0 Int. J. Mol. Sci. 201615, 17 20, 493 25 30 35 40 45 50 55 60 15 20 25 30 35 40 45 50 55 60 6 of 13 Temperature (℃ ) Temperature (℃ )

C D 120 Figure 4. Cont.120

100 100

80 80

60 60

40 40

20 20 Relative activity (%) Relative activity (%) 0 0 4567891011 4567891011

pH pH

FigureFigure 4.4. EffectEffect of of temperature temperature and and pH pH on onenzyme enzyme activity activity of purified of puriﬁed 001D 001D from from pET32a. pET32a. (A) (TemperatureA) Temperature optimum; optimum; (B) Thermostability; (B) Thermostability; (C) pH (C optimum;) pH optimum; and (D and) pH ( Dstability.) pH stability. In each case, In each the case,highest the activity highest was activity set at was 100%. set atEach 100%. treatment Each treatment was done was in triplicate. done in triplicate.

3.3. Discussion Discussion ThereThere isis aa greatgreat interestinterest inin carboxylesterasescarboxylesterases duedue toto theirtheir criticalcritical rolerole inin thethe detoxificationdetoxification ofof xenobioticxenobiotic compounds,compounds, includingincluding OPOP andand pyrethroidpyrethroid insecticidesinsecticides [9[9–11,18].–11,18]. To understandunderstand thethe catalyzationcatalyzation functionfunction of of carboxylesterase, carboxylesterase, it isit essentialis essential to yield to yield the highly the highly pure proteinpure proteinin vitro inor vitroin vivo or. Althoughin vivo. Although the E. coli thesystem E. coli is asystem very convenient is a very expressionconvenient systemexpression to obtain system purified to obtain recombinant purified proteinrecombinantin vitro protein, it is usually in vitro unsuitable, it is usually to beunsuitable used for to the be expression used for the of expression the recombinant of the proteinrecombinant from mostprotein eukaryotes, from most such eukaryotes, as insects, such plants, as andinsects, animals, plants, because and animals, of highly because divergent of codonhighly usagedivergent and proteincodon usage misfolding and protein [38]. A varietymisfolding of techniques [38]. A variety were usedof techniques to overcome were problems used to associatedovercome withproblems poor proteinassociated solubility with poor [38– 40protein]. In our solu presentbility work,[38–40]. a novel In our carboxylesterase present work, genea novel 001D carboxylesterase from the susceptible gene H.001D armigera from WHthe strainsusceptible was cloned. H. armigera The deduced WH strain amino was acid cloned. sequence The compriseddeduced amino the highly acid conserved sequence catalyticcomprised triad, the indicatinghighly conserved that 001D catalytic can function triad, in asdicating an active that esterase. 001D can However, function other as an subsites active aroundesterase. the However, catalytic triadother are subsites more variable around in differentthe catalytic insects triad [41, 42are]. Wemore further variable demonstrated in different that carboxylesteraseinsects [41,42]. 001DWe further can be heterologouslydemonstrated expressedthat carboxylesterase with different 001D fusion can proteins be heterologously in the E. coli cells.expressed All three with purifieddifferent fusion fusion proteins proteins were in the active, E. coli and cells. displayed All three hydrolase purified activitiesfusion proteins against were the modelactive, substrateand displayed and two hydrolase real insecticide activities substrates. against Thethe resultsmodel suggestsubstrate that and carboxylesterase two real insecticide 001D wassubstrates. successfully The results expressed suggest in the thatE. colicarboxylessystem.terase This is 001D the first was production successfully of expressed active carboxylesterase in the E. coli insystem. this insect This speciesis the first with production the E. coli system. of active Our ca workrboxylesterase will be useful in this in the insect future species to naturally with the produce E. coli activesystem. proteins Our work for further will be three-dimensional useful in the future structure to naturally studies of produce carboxylesterases active proteins in this species.for further three-dimensionalIn this work, the structure results ofstudies pyrethroid of carboxylesterases hydrolysis analysis in this show species. that the purified proteins of 001D can metabolizeIn this work, the the two results real insecticide of pyrethroid substrates, hydrolysisβ-cypermethrin analysis show and that the fenvaleratethe purifiedin proteins vitro, and of it001D thus can indicates metabolize that thethe carboxylesterasetwo real insecticide 001D substrates, is involved β-cypermethrin in detoxification and inthe the fenvalerate susceptible in vitro WH, strain.and it Inthus our indicates earlier report, that the eight carboxylesterase carboxylesterases, 001D including is involved the 001Din detoxification from the susceptible in the susceptible GR strain, wereWH strain. shown In to our not increaseearlier report, the pyrethroid eight carboxyles hydrolysisterases, by mutation including in the active001D from sites (oxyanionthe susceptible hole andGR acyl-bindingstrain, were shown pocket) to of not the enzymeincrease [29the,30 pyrethro], suggestingid hydrolysis that pyrethroid by mutation resistance in the in H.active armigera sites may(oxyanion not occur hole through and acyl-binding the first mechanism. pocket) Ourof the results enzyme show [29,30], the 001D suggesting can catalyze that the pyrethroidpyrethroid substratesresistance within H. a armigera slow velocity, may not which occur probably through suggests the first the mech overexpressionanism. Our ofresults the carboxylesterase show the 001D can catalyze the pyrethroid substrates with a slow velocity, which probably suggests the overexpression of the carboxylesterase genes is indispensable to allow carboxylesterases to confer resistance to pyrethroid insecticides in H. armigera. However, among the three fusion proteins, the fusion protein 6×His/S-tag/001D (pET30a) was expressed at a higher level compared to other two fusion proteins, Trx/6×His/S-tag/001D (pET32a) and 6×His/001D (pE1), and after a single step of Ni2+-NTA affinity purification, pET30a-001D showed a high purity as only a single band was observed in the SDS-PAGE and Western blot assay (Figure 3). Its hydrolytic activities towards pyrethroid insecticides are also higher compared to the other two fusion proteins (Table 2). The results suggest that S-tag has significantly improved expression of the esterase, but the larger fusion protein Trx-tag has little effect on improving expressionof the esterase in E. coil. In addition, the larger Trx-tag fused with the 001D may also hinder the carboxylesterase’s catalysis of the real insecticides, as the pyrethroid hydrolase activity

Int. J. Mol. Sci. 2016, 17, 493 7 of 13 genes is indispensable to allow carboxylesterases to confer resistance to pyrethroid insecticides in H. armigera. However, among the three fusion proteins, the fusion protein 6ˆHis/S-tag/001D (pET30a) was expressed at a higher level compared to other two fusion proteins, Trx/6ˆHis/S-tag/001D (pET32a) and 6ˆHis/001D (pE1), and after a single step of Ni2+-NTA affinity purification, pET30a-001D showed a high purity as only a single band was observed in the SDS-PAGE and Western blot assay (Figure3). Its hydrolytic activities towards pyrethroid insecticides are also higher compared to the other two fusion proteins (Table2). The results suggest that S-tag has significantly improved expression of the esterase, but the larger fusion protein Trx-tag has little effect on improving expressionof the esterase in E. coil. In addition, the larger Trx-tag fused with the 001D may also hinder the carboxylesterase’s catalysis of the real insecticides, as the pyrethroid hydrolase activity of 001D from PET32a was lower than the 001D from PET30a. For each fusion protein, the variation between the esterase activity towards the model substrate (1-NA) and the hydrolytic activity towards the real insecticides (pyrethroids) are mainly due to the differences in their chemical structure between the model substrate and the real insecticides [15,16,43]. In most cases, enzyme activity can be easily influenced by the variation of temperature and pH value due to each enzyme only functioning efficiently within a suitable temperature and pH range. In the present study, the purified enzyme 001D showed high activity and stability over a broad range of temperatures. Its residual activity was 46.8% when it was incubated at 45 ˝C for 1h. It appears more stable than the carboxylesterase CpCE-1 from Cydia pomonella [36]. However, the esterase activity significantly decreased at a pH lower than 7.0. The effects of pH were similar to another esterase [44]. We also noted that the pyrethroid hydrolase activities of the carboxylesterase 001Dof the susceptible H. armigera WH strain expressed in E. coli are different from those of the carboxylesterase 001D of the susceptible GR strain from Australia and the susceptible YG strain from China, expressed in the baculovirus system [29–31]. By comparison, the hydrolase activity of 001D from the WH strain against β-cypermethrin is lower than that of the 001D from the GR strain, but it is to some extent closer to that of 001D from the YG strain (the specific activity is about 0.76 and 2.60 µM¨ min´1¨ (µM´1¨ protein)) towards the insecticidal pyrethroid isomers, 1R trans-αS and 1R cis-αS, respectively [31]. For the fenvalerate substrate, the specific activity of 001D from WH strain is 0.67 µM¨ min´1¨ (µM´1¨ protein),which is between the GR strain (0.81 µM¨ min´1¨ (µM´1¨ protein)) and the YG strain (0.0 µM¨ min´1¨ (µM´1¨ protein)) [31]. The variations of the pyrethroid hydrolase activity may be due to the recombinant esterase produced in different expression systems. In previous studies, the recombinant esterases were not tagged and expressed in insect cells by using a baculovirus system, and the assays were done with insect cell free extracts (cell lysis without purification) [29,31]. In the present study, the carboxylesterase was tagged and expressed in the E. coli cells, and the activity assays were performed using highly purified fusion proteins. We further observed that different fusion strategies have effects on protein expression and enzymatic activity. Furthermore, in previous work, the insecticides used in the hydrolytic activity assay were single isomers of cypermethrin and fenvalerate, but in this work both β-cypermethrin and fenvalerate substrates are in a complex of four isomers.

4. Materials and Methods

4.1. Chemicals and Plasmids The insecticides β-cypermethrin (comprising: 1S trans-αR, 1S cis-αR, 1R trans-αS, 1R cis-αS) and fenvalerate (Figure5) were of analytical standard and provided by Aladdin Industrial Corporation (Shanghai, China). 1-naphthyl acetate and Fast Blue RR salt were also purchased from Aladdin Industrial Corporation. Protein molecular mass marker was purchased from Takara (Kusatsu, Japan) and Sangon (Shanghai, China). The pGEM-T easy vector was provided by Promega (Madison, WI, Int. J. Mol. Sci. 2016, 17, 493 7 of 13 of 001D from PET32a was lower than the 001D from PET30a. For each fusion protein, the variation between the esterase activity towards the model substrate (1-NA) and the hydrolytic activity towards the real insecticides (pyrethroids) are mainly due to the differences in their chemical structure between the model substrate and the real insecticides [15,16,43]. In most cases, enzyme activity can be easily influenced by the variation of temperature and pH value due to each enzyme only functioning efficiently within a suitable temperature and pH range. In the present study, the purified enzyme 001D showed high activity and stability over a broad range of temperatures. Its residual activity was 46.8% when it was incubated at 45°C for 1h. It appears more stable than the carboxylesterase CpCE-1 from Cydia pomonella [36]. However, the esterase activity significantly decreased at a pH lower than 7.0. The effects of pH were similar to another esterase [44]. We also noted that the pyrethroid hydrolase activities of the carboxylesterase 001Dof the susceptible H. armigera WH strain expressed in E. coli are different from those of the carboxylesterase 001D of the susceptible GR strain from Australia and the susceptible YG strain from China, expressed in the baculovirus system [29–31]. By comparison, the hydrolase activity of 001D from the WH strain against β-cypermethrin is lower than that of the 001D from the GR strain, but it is to some extent closer to that of 001D from the YG strain (the specific activity is about 0.76 and 2.60 μM·min−1·(μM−1·protein)) towards the insecticidal pyrethroid isomers, 1R trans-αS and 1R cis-αS, respectively [31]. For the fenvalerate substrate, the specific activity of 001D from WH strain is 0.67 μM·min−1·(μM−1·protein),which is between the GR strain (0.81 μM·min−1·(μM−1·protein)) and the YG strain (0.0 μM·min−1·(μM−1·protein)) [31]. The variations of the pyrethroid hydrolase activity may be due to the recombinant esterase produced in different expression systems. In previous studies, the recombinant esterases were not tagged and expressed in insect cells by using a baculovirus system, and the assays were done with insect cell free extracts (cell lysis without purification) [29,31]. In the present study, the carboxylesterase was tagged and expressed in the E. coli cells, and the activity assays were performed using highly purified fusion proteins. We further observed that different fusion strategies have effects on protein expression and enzymatic activity. Furthermore, in previous work, the insecticides used in the hydrolytic activity assay were single isomers of cypermethrin and fenvalerate, but in this work both β-cypermethrin and fenvalerate substrates are in a complex of four isomers.

4. Materials and Methods

(Shanghai,Int. J. Mol. Sci. China).2016, 17 , 4931-naphthyl acetate and Fast Blue RR salt were also purchased from Aladdin8 of 13 Industrial Corporation. Protein molecular mass marker was purchased from Takara (Kusatsu, Japan) and Sangon (Shanghai, China). The pGEM-T easy vector was provided by Promega (Madison, WI,USA), USA),pEASY pEASY®-Blunt®-Blunt E1 vectorE1 vector (pE1) (pE1) was obtainedwas obtained from TransGenfrom TransGen Biotech Biotech (Beijing, (Beijing, China), China), pET30a pET30aand PET32a and PET32a were purchased were purchased from Novagen from Novagen (Darmstadt, (Darmstadt, Germany Germany ). ).

Cl O O

Cl O CN Int. J. Mol. Sci. 2016, 17, 493 β-cypermethrin 8 of 13 1-naphthyl acetate Figure 5. Cont. O

CN O

O Cl Fenvalerate

Figure 5. Structures of 1-naphthyl acetate, fenvalerate, and β-cypermethrin used in this paper.

4.2. Insects 4.2. Insects The susceptible H. armigera strain from the Wuhan region of China (WH strain) was originally The susceptible H. armigera strain from the Wuhan region of China (WH strain) was originally collected from the Wuhan region of the Hubei Province in China over 30 years ago and was collected from the Wuhan region of the Hubei Province in China over 30 years ago and was maintained maintained on an artificial diet without outcrossing at 28 ± 1 °C, 60% ± 10% relative humidity, and on an artiﬁcial diet without outcrossing at 28 ˝C ˘ 1 ˝C, 60% ˘ 10% relative humidity, and a a photoperiod of 16:8 (Light:Dark). Adult moths were held under the same temperature and photoperiod of 16:8 (Light:Dark). Adult moths were held under the same temperature and supplied supplied with a 5% sugar solution. with a 5% sugar solution.

4.3. Sequencing of 001D from the H. armigera Wuhan (WH) Strain Total RNA was extracted from the midguts of fifth-instarlarvaefifth-instarlarvae by using the SV Total RNA Isolation SystemSystem Kit Kit (Promega). (Promega). First-strand First-strand cDNA cDNA was was synthesized synthesized from from 1 µg 1 of μ DNA-freeg of DNA-free total RNA,total usingRNA, RevertAidusing RevertAid M-MuL M-MuL V Reverse V Reverse Transcriptase Transcri (Thermoptase (Thermo Scientific, Scientific, Waltham, Waltham, MA, USA). MA, Primers USA). (HdF1:Primers 5 1CTGTATTAACTGGACTAGC3(HdF1: 5′CTGTATTAACTGGACTAGC31; HdR1: 51CGTTGCGCAGATAACTC3′; HdR1: 5′CGTTGCGCAGATAACTC31) for amplifying′) thefor openamplifying reading the frame open (ORF) reading of theframe gene (ORF) were of designed the gene based were on designed the sequence based deposited on the sequence in NCBI databasedeposited (GenBank in NCBI® databaseaccession (GenBank number FJ997295).® accession The number 50 µL PCRFJ997295). reaction The mixture 50 μL contained PCR reaction 2 µL ofmixture template contained cDNA, 2 3.0μLµ ofL template of 10 µM cDNA, of each 3.0 primers, μL of 10 4.0 μMµL of of each 2.5 mMprimers, dNTP, 4.0 0.5 μLµ ofL 2.5 of PrimeSTARmM dNTP, HS0.5 DNAμL of Polymerase,PrimeSTAR andHS 10DNAµL ofPolymerase, 5ˆ PrimeSTAR and Buffer10 μL (Takara).of 5× PrimeSTAR The thermocycler Buffer (Takara). program wasThe 98thermocycler˝C for 30 s, program followed was by 3098 cycles°C for of3098 s, ˝followedC for 12 by s, 60 30˝ cyclesC for25 of s,98 72 °C˝ Cfor for 12 2 s, min, 60 °C and for with 25 s, a 72 final °C extensionfor 2 min, and of 72 with˝C fora final 10 min.extension The PCRof 72 products°C for 10 min. were The gel-purified, PCR products ligated were into gel-purified, the pGEM-T ligated easy vectorinto the after pGEM-T an adenine easy vector was added afterat an the adenine 31 terminus, was added and used at the to transform3′ terminus, JM109 and cells.used Whiteto transform clones wereJM109 sequenced cells. White (Invitrogen clones ™were, Shanghai, sequenced China) (Invitrogen™, and were found Shanghai, to contain China) a 001D andcDNA were that found differed to bycontain 11 amino a 001D acidcDNA residues that from differed the closest by 11 homologueamino acid in residues the database. from Thethe sequenceclosest homologue of this new in allele the ® wasdatabase. deposited The sequence in the NCBI of this database new allele (GenBank was ®depositedaccession in number the NCBI KT345935). database (GenBank accession number KT345935). 4.4. Sequence Analysis 4.4. Sequence Analysis The sequences of carboxylesterase from H. armigera were aligned using CLUSTALW2 software [45]. SignalThe peptides sequences for secretion of carboxylesterase were detected withfrom the H. Signal armigera P 4.1 serverwere [aligned46]. The molecularusing CLUSTALW2 weight and theoreticalsoftware [45]. isoelectric Signal pointpeptides were for predicted secretion using were the detected ExPASy with web toolthe [Signal47]. P 4.1 server [46]. The molecular weight and theoretical isoelectric point were predicted using the ExPASy web tool [47].

4.5. Cloning and Expression of Recombinant Proteins The carboxylesterase ORF encoding the mature enzyme lacking a signal peptide sequence was amplified with specific primer sequences (HdF2: 5′CCGGAATTCATGGACGACGAGTGGCG CGAGGTGAGGACT3′; HdR2: 5′GCGCTCGAGATTCTACAACTCGCTGCGTGGTCTGGGCGG3′) containing EcoRI and XhoI restriction endonuclease recognition sites (underlined). The amplicons were purified using the Universal DNA Purification Kit (Tiangen Biotech, Beijing, China), digested with the corresponding endonuclease and ligated into either pET30a or PET32a using T4 DNA ligase. Plasmids were verified by restriction digestion and DNA sequencing (Invitrogen™). The amplicons were also directly ligated into pE1 Expression Vector according to the manufacturer’s protocol, and then verified by sequencing. The plasmids (Figure 6) were transformed into the E. coli BL21 (DE3) to produce recombinant proteins, each containing a 6×His-tag at N-terminus for purification.

Int. J. Mol. Sci. 2016, 17, 493 9 of 13

4.5. Cloning and Expression of Recombinant Proteins The carboxylesterase ORF encoding the mature enzyme lacking a signal peptide sequence was amplified with specific primer sequences (HdF2: 51CCGGAATTCATGGACGACGAGTGGCG CGAGGTGAGGACT31; HdR2: 51GCGCTCGAGATTCTACAACTCGCTGCGTGGTCTGGGCGG31) containing EcoRI and XhoI restriction endonuclease recognition sites (underlined). The amplicons were purified using the Universal DNA Purification Kit (Tiangen Biotech, Beijing, China), digested with the corresponding endonuclease and ligated into either pET30a or PET32a using T4 DNA ligase. Plasmids were verified by restriction digestion and DNA sequencing (Invitrogen™). The amplicons were also directly ligated into pE1 Expression Vector according to the manufacturer’s protocol, and then verified by sequencing. The plasmids (Figure6) were transformed into the E. coli BL21 (DE3) to Int.produce J. Mol. Sci. recombinant 2016, 17, 493 proteins, each containing a 6ˆHis-tag at N-terminus for purification. 9 of 13

A pET32a Trx-Tag 6 × His-Tag S-Tag 001D

B pE1 6 × His-Tag 001D

C pET30a 6 × His-Tag S-Tag 001D

FigureFigure 6. 6.GeneGene maps maps of offusion fusion recombinant recombinant plasmids plasmids harboring harboring truncated truncated (A ()A Trx/6×His/S-tag/001D) Trx/6ˆHis/S-tag/001D fromfrom pET32a; pET32a; (B) ( B6×His-tag/001D) 6ˆHis-tag/001D fromfrom pE1; pE1; and and (C) ( C6×His/S-tag/001D) 6ˆHis/S-tag/001D fromfrom pET30a. pET30a.

ForFor protein protein expression, expression, a colony a colony from from freshly freshly transformed transformed E. E.coli coli waswas used used to toinoculate inoculate 5 mL 5 mL of of −1 Luria-BertaniLuria-Bertani (LB) (LB) broth broth medium medium containing containing 50 50 μµg·mLg¨ mL ´kanamycin.1 kanamycin. Ce Cellslls were were cultured cultured overnight overnight at at37 37°C˝ withC with shaking shaking at at220 220 rpm. rpm. 4 mL 4 mL cell cell susp suspensionension was was used used to toinoculate inoculate 400 400 mL mL of ofLB LB medium medium containing 1% casein hydrolysate (Oxoid, Basingstoke, UK), 17 mM KH2PO4 and 72 mM K2HPO4, containing 1% casein hydrolysate (Oxoid, Basingstoke, UK), 17 mM KH2PO4 and 72 mM K2HPO4, −1 5050 μg·mLµg¨ mL kanamycin´1 kanamycin [48], [48 and], and induced induced with with 0.2 0.2 mM mM isopropyl isopropyl β-Dβ-thiogalactopyranoside-D-thiogalactopyranoside (IPTG) (IPTG) forfor 48 48 h hat at18 18 °C˝ Cwith with shaking shaking at at200 200 rpm. rpm. Ce Cellslls were were harvested harvested when when cell cell growth growth reached reached the the exponential phase (OD600 = 0.5−0.6). exponential phase (OD600 = 0.5–0.6).

4.6.4.6. Purification Purification of ofExpr Expressedessed Carboxylest Carboxylesteraseserases and and Western Western Blot Blot Analysis Analysis BacterialBacterial cells cells were were harvested harvested by by centrifugation centrifugation and and stored stored at at−70´ 70°C˝ untilC until further further processing. processing. CellCell pellets pellets were were re-suspended re-suspended in in25 25mM mM Tris-HCl Tris-HCl (pH (pH 8.0) 8.0) at ata concentration a concentration of of1 mL 1 mL per per 200 200 mg mg cellcell wet wet weight weight and and then then lysed lysed by by sonication. sonication. Supe Supernatantrnatant was was harvested harvested after after centrifugation centrifugation at at 17,400×17,400 gˆ (Himacg (Himac CR22G, CR22G, Hitachi Hitachi Ltd., Ltd., Tokyo, Tokyo, Japan) Japan) at at4 4°C˝ Cfor for 30 30 min min and and further further clarified clarified by by passingpassing through through a a0.22 0.22 μmµm filter. filter. For For purification purification of of 6×His-ta 6ˆHis-taggedgged recombinant recombinant proteins, proteins, 1 mL 1 mL of of NiNi2+-NTA2+-NTA agarose agarose gel gel column column (TransGen (TransGen Biotech) Biotech) was was equilibrated equilibrated with with 10 10mL mL of ofbalance balance buffer buffer (10(10 mM mM Tris-HCl, Tris-HCl, pH pH 8.0, 8.0, 300 300 mM mM NaCl, NaCl, 50 50 mM mM NaH NaH2PO2PO4, 4and, and 10 10 mM mM imidazole). imidazole). Supernatant Supernatant waswas added added to tothe the column column and and then then washed washed with with 6 6mL mL of of balance balance buffer. buffer. Bound Bound proteins proteins were were elutedeluted from from the the affinity affinity resin resin with with 5 mL 5 mL elution elution buffer buffer (balance (balance buffer buffer containing containing a linear a linear gradient gradient of of 50–25050–250 mM mM imidazole). imidazole). Fractions Fractions were were collected collected and and analyzed analyzed on ona 12% a 12% SDS-PAGE SDS-PAGE gel gel and and stained stained withwith Coomassie Coomassie Blue Blue R250 solutionsolution (Aladdin (Aladdin Industrial Industrial Corporation). Corporation). The The recombinant recombinant fusion fusion protein proteinwas then was dialyzedthen dialyzed against against 25 mM 25 Tris-HCl mM Tris-HCl (pH 8.0), (pH and 8.0), aliquots and aliquots (50–100 (50–100µL) were μL) storedwere stored at ´70 at˝ C −70for °C later for use.later The use. purified The purified target proteinstarget proteins were verified were verified via Western via Western blot analysis blot withanalysis anti-6 withˆHis anti-6×Hismonoclonal monoclonal antibody antibody (Protein Tech,(Protein Chicago, Tech, IL,Chicago, USA), IL, followed USA), byfollowed staining by with staining goat with anti-mouse goat anti-mouseIgG horseradish IgG horseradish peroxides pero (HRP)xides conjugate (HRP) conjugate (Pierce Biotechnology, (Pierce Biotechnology, Rockford, Rockford, IL, USA). IL, Antibody USA). Antibodybinding wasbinding detected was withdetected a diaminobenzidine with a diaminob kit accordingenzidine kit to theaccording manufacturer’s to the protocolmanufacturer’s (OriGene, protocol (OriGene, Beijing, China). Protein concentrations were determined using the Bradford method with bovine serum albumin as a standard [49].

Int. J. Mol. Sci. 2016, 17, 493 10 of 13

Beijing, China). Protein concentrations were determined using the Bradford method with bovine serum albumin as a standard [49].

4.7. Assay of Enzymatic Activity The kinetics of carboxylesterase activities against 1-naphthyl acetate were determined by the method of Han et al. [12] and Teese et al. [29] with a modification. Reactions were carried out in a 96-well microplate at 30 ˝C in a final volume of 200 µL in 0.1 M sodium phosphate buffer (pH 7.0), unless otherwise described. Each well contained 100 µL of appropriately diluted purified enzyme (0.6–1.75 µg) in buffer, 100 µL of 1-naphthyl acetate in buffer containing 2% (v/v) ethanol and 3 mM Fast Blue RR salt at a range of substrate concentrations (16–400 µM¨ L´1) spanning the Km (based on preliminary assays). Formation of 1-naphthol was monitored by recording the change in absorbance at 450 nm for 10 min in a microplate reader (M200 PRO, Tecan, Männedorf Switzerland) and quantified using 1-naphthol standard curves. Values for kcat and Km were estimated using “Hyper32” hyperbolic regression software [50]. Assays for the hydrolysis of β-cypermethrin and fenvalerate were carried out by monitoring substrate loss by a reversed-phase high performance liquid chromatography unit (HPLC 600 Controller, Waters Co., Milford, MA, USA) attached to a dual λ absorbance detector (Waters 2487) as described by Teese et al. [29] with some modification. The reaction mix contained 50 µL of 200 µM¨ L´1 β-cypermethrinorfenvalerate and 50 µL of diluted purified enzyme (1.75–2.4 µg). Reactions were stopped by the addition of 100 µL of acetonitrile and vortexing. Samples were then prepared by passing through a 0.22 µm filter before transferring into a 2 mL brown sample vial (Agilent, Santa Clara, CA, USA). An aliquot (10 µL) of each reaction was injected on a Symmetry C18 column (4.6 mm ˆ 250 mm, 5 µm) and monitored at 210 nm, the mobile phase contained a mixture of acetonitrile and water (77:23, v/v) with a 1.0 mL¨ min´1 flow rate. For all substrates, control reactions were performed with the purified enzyme of 001D from pET30a inactivated by boiling for 10 min.

4.8. Thermostability and pH Stability The optimal temperature of the enzyme was investigated by incubating the enzyme and substrate (1-naphthyl acetate) at different temperatures (15 ˝C–60 ˝C) in 100 mM phosphate buffer (pH 7.0) for 5 min. The thermostability of the enzymes was determined by incubating the puriﬁed recombinant protein at temperatures from 15 to 60 ˝C for 1 h. The residual activity was measured and expressed as a percentage of the highest activity obtained in this case. The optimal pH of the enzyme activity was determined using the following 25 mM buffers: citric acid buffer (pH 4.0–6.0), phosphate buffer (pH 7.0) and Tris-HCl buffer (pH 8.0–11.0). The determination of pH stability was performed by pre-incubating the enzyme in a corresponding buffer for 1 h at 30 ˝C. Then, enzyme activity was measured as above in 100 mM phosphate buffer (pH 7.0). The fusion protein 6ˆHis/S-tag/001D (pET30a) was used in all above assays. The highest activity obtained in this casewas used as the control (100%).

5. Conclusions Here we cloned the carboxylesterase 001D gene from the susceptible H. armigera WH strain, and it contains the highly-conserved residues of catalytic triad and other active subsites in its amino acid sequence. We successfully expressed the carboxylesterase 001D fused with three different solubility/affinity tags in the E. coli cells. We purified the fusion proteins and evaluated their hydrolytic activities towards a model substrate and two pyrethroid insecticides. The results showed that carboxylesterase 001D was active and involved in detoxification, which probably implicated that overexpression of the genes to allow for effective sequestration of the insecticides is necessary to allow carboxylesterases to confer resistance to these insecticides in H. armigera. Int. J. Mol. Sci. 2016, 17, 493 11 of 13

Acknowledgments: We thanks Kunyan Zhu at Kansas State University and Mark G. Teese at Westfälische Wilhelms-Universität Münster for their critical comments on this manuscript. This work was supported jointly by the National Natural Sciences Foundation of China (number 31201517) and the Natural Science Basic Research Plan in Shaanxi Province of China (number 2015JM3077). Author Contributions: Yongqiang Li, Jianwei Liu, Mei Lu and Yonghong Wang conceived and designed the experiments; Yongqiang Li, Mei Lu, Chongling Cai and Zhiqing Ma performed the experiments; Yongqiang Li, Jianwei Liu and Yonghong Wang analyzed the data; Jianwei Liu and Xing Zhang contributed reagents/materials/analysis tools; Yongqiang Li, Jianwei Liu and Yonghong Wang wrote the paper. Conﬂicts of Interest: The authors declare no conﬂict of interest.

Abbreviations

1-NA 1-naphthyl acetate OP Organophosphate CCE Carboxy/cholinesterase(E.C.3.1.1) PAGE Polyacrylamide gel electrophoresis pE1 pEASY®-Blunt E1 vector

References

1. Forrester, N.W.; Cahill, M.; Bird, L.J.; Layland, J.K. Management of pyrethroid and endosulfan resistance in Helicoverpa armigera (Lepidoptera: Noctuidae) in Australia. In Bulletin of Entomological Research; International Institute of Entomology: Wallingford, Oxon, UK, 1993. 2. Martin, T.; Chandre, F.; Ochou, O.G.; Vaissayre, M.; Fournier, D. Pyrethroid resistance mechanisms in the cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae) from West Africa. Pestic. Biochem. Phys. 2002, 74, 17–26. [CrossRef] 3. Bues, R.; Bouvier, J.C.; Boudinhon, L. Insecticide resistance and mechanisms of resistance to selected strains of Helicoverpa armigera (Lepidoptera: Noctuidae) in the south of France. Crop. Prot. 2005, 24, 814–820. [CrossRef] 4. Abd El-Latif, A.O.; Subrahmanyam, B. Pyrethroid resistance and esterase activity in three strains of the cotton bollworm, Helicoverpa armigera (Hubner). Pestic. Biochem. Phys. 2010, 96, 155–159. [CrossRef] 5. Glenn, D.C.; Hoffmann, A.A.; Mcdonald, G. Resistance to pyrethroids in Helicoverpa armigera (Lepidoptera: Noctuidae) from corn: Adult resistance, larval resistance, and ﬁtness effects. J. Econ. Entomol. 1994, 87, 1165–1171. [CrossRef] 6. Armes, N.J.; Jadhav, D.R.; DeSouza, K.R. A survey of insecticide resistance in Helicoverpa armigera in the Indian subcontinent. Bull. Entomol. Res. 1996, 86, 499–514. [CrossRef] 7. Djihinto, A.C.; Katary, A.; Prudent, P.; Vassal, J.M.; Vaissayre, M. Variation in resistance to pyrethroids in Helicoverpa armigera from Benin Republic, West Africa. J. Econ. Entomol. 2009, 102, 1928–1934. [CrossRef] [PubMed] 8. Yang, Y.H.; Li, Y.P.; Wu, Y.D. Current status of insecticide resistance in Helicoverpa armigera after 15 years of Bt cotton planting in China. J. Econ. Entomol. 2013, 106, 375–381. [CrossRef][PubMed] 9. Wheelock, C.E.; Shan, G.; Ottea, J. Overview of carboxylesterases and their role in the metabolism of insecticides. J. Pestic. Sci. 2005, 30, 75–83. [CrossRef] 10. Li, X.C.; Schuler, M.A.; Berenbaum, M.R. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 2007, 52, 231–253. [CrossRef][PubMed] 11. Farnsworth, C.A.; Teese, M.G.; Yuan, G.R.; Li, Y.Q.; Scott, C.; Zhang, X.; Wu, Y.D.; Russell, R.J.; Oakeshott, J.G. Esterase-based metabolic resistance to insecticides in heliothine and spodopteran pests. J. Pestic. Sci. 2010, 35, 275–289. [CrossRef] 12. Han, Y.C.; Wu, S.W.; Li, Y.P.; Liu, J.W.; Campbell, P.M.; Farnsworth, C.; Scott, C.; Russell, R.J.; Oakeshott, J.G.; Wu, Y.D. Proteomic and molecular analyses of esterases associated with monocrotophos resistance in Helicoverpa armigera. Pestic. Biochem. Phys. 2012, 104, 243–251. [CrossRef] 13. Gong, Y.J.; Wang, Z.H.; Shi, B.C.; Kang, Z.J.; Zhu, L.; Jin, G.H.; Wei, S.J. Correlation between pesticide resistance and enzyme activity in the diamondback moth, Plutella xylostella. J. Insect Sci. 2013, 13.[CrossRef] [PubMed] Int. J. Mol. Sci. 2016, 17, 493 12 of 13

14. Oakeshott, J.G.; Farnsworth, C.A.; East, P.D.; Scott, C.; Han, Y.C.; Wu, Y.D.; Russell, R.J. How many genetic options for evolving insecticide resistance in heliothine and spodopteran pests? Pest Manag. Sci. 2013, 69, 889–896. [CrossRef][PubMed] 15. Newcomb, R.D.; Campbell, P.M.; Ollis, D.L.; Cheah, E.; Russell, R.J.; Oakeshott, J.G. A single amino acid substitution converts a carboxylesterase to an organophosphorus hydrolase and confers insecticide resistance on a blowfly. Proc. Natl. Acad. Sci. USA 1997, 94, 7464–7468. [CrossRef][PubMed] 16. Campbell, P.M.; Newcomb, R.D.; Russell, R.J.; Oakeshott, J.G. Two different amino acid substitutions in the ali-esterase, E3, confer alternative types of organophosphorus insecticide resistance in the sheep blowfly, Lucilia cuprina. Insect Biochem. Mol. 1998, 28, 139–150. [CrossRef] 17. Claudianos, C.; Russell, R.J.; Oakeshott, J.G. The same amino acid substitution in orthologous esterases confers organophosphate resistance on the house fly and a blowfly. Insect Biochem. Mol. 1999, 29, 675–686. [CrossRef] 18. Oakeshott, J.G.; Claudianos, C.; Newcomb, R.B.; Russell, R.J. Biochemical Genetics and Genomics of Insect Esterases; Elsevier: Amsterdam, The Netherlands, 2005. 19. Field, L.M.; Devonshire, A.L. Evidence that the E4 and FE4 esterase genes responsible for insecticide resistance in the aphid Myzus persicae (Sulzer) are part of a gene family. Biochem. J. 1998, 330, 169–173. [CrossRef][PubMed] 20. Chevillon, C.; Raymond, M.; Guillemaud, T.; Lenormand, T.; Pasteur, N. Population genetics of insecticide resistance in the mosquito Culex pipiens. Biol. J. Linn. Soc. 1999, 68, 147–157. [CrossRef] 21. Small, G.J.; Hemingway, J. Molecular characterization of the amplified carboxylesterase gene associated with organophosphorus insecticide resistance in the brown planthopper, Nilaparvata lugens. Insect Mol. Biol. 2000, 9, 647–653. [CrossRef][PubMed] 22. Cui, F.; Qu, H.; Cong, J.; Liu, X.L.; Qiao, C.L. Do mosquitoes acquire organophosphate resistance by functional changes in carboxylesterases? FASEB J. 2007, 21, 3584–3591. [CrossRef][PubMed] 23. Wu, S.W.; Yang, Y.H.; Yuan, G.R.; Campbell, P.M.; Teese, M.G.; Russell, R.J.; Oakeshott, J.G.; Wu, Y.D. Overexpressed esterases in a fenvalerate resistant strain of the cotton bollworm, Helicoverpa armigera. Insect Biochem. Mol. 2011, 41, 14–21. [CrossRef][PubMed] 24. Gunning, R.V.; Moores, G.D.; Devonshire, A.L. Esterases and esfenvalerate resistance in Australian Helicoverpa armigera (Hubner) Lepidoptera: Noctuidae. Pestic. Biochem. Phys. 1996, 54, 12–23. [CrossRef] 25. Gunning, R.V.; Moores, G.D.; Devonshire, A.L. Esterases and fenvalerate resistance in a field population of Helicoverpa punctigera (Lepidoptera: Noctuidae) in Australia. Pestic. Biochem. Phys. 1997, 58, 155–162. [CrossRef] 26. Campbell, B.E. The Role of Esterases in Pyrethroid Resistance in Australian Polulations of the Cotton Bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae); Australian National University: Canberra, Australia, 2001. 27. Achaleke, J.; Martin, T.; Ghogomu, R.T.; Vaissayre, M.; Brevault, T. Esterase-mediated resistance to pyrethroids in field populations of Helicoverpa armigera (Lepidoptera: Noctuidae) from Central Africa. Pest Manag. Sci. 2009, 65, 1147–1154. [CrossRef][PubMed] 28. Teese, M.G.; Campbell, P.M.; Scott, C.; Gordon, K.H.J.; Southon, A.; Hovan, D.; Robin, C.; Russell, R.J.; Oakeshott, J.G. Gene identification and proteomic analysis of the esterases of the cotton bollworm, Helicoverpa armigera. Insect Biochem. Mol. 2010, 40, 1–16. [CrossRef][PubMed] 29. Teese, M.G.; Farnsworth, C.A.; Li, Y.Q.; Coppin, C.W.; Devonshire, A.L.; Scott, C.; East, P.; Russell, R.J.; Oakeshott, J.G. Heterologous expression and biochemical characterisation of fourteen esterases from Helicoverpa armigera. PLoS ONE 2013, 8, e65951. [CrossRef][PubMed] 30. Li, Y.Q.; Farnsworth, C.A.; Coppin, C.W.; Teese, M.G.; Liu, J.W.; Scott, C.; Zhang, X.; Russell, R.J.; Oakeshott, J.G. Organophosphate and pyrethroid hydrolase activities of mutant esterases from the cotton bollworm Helicoverpa armigera. PLoS ONE 2013, 8, e77685. [CrossRef][PubMed] 31. Yuan, G.; Li, Y.; Farnsworth, C.A.; Coppin, C.W.; Devonshire, A.L.; Scott, C.; Russell, R.J.; Wu, Y.; Oakeshott, J.G. Isomer-specific comparisons of the hydrolysis of synthetic pyrethroids and their fluorogenic analogues by esterases from the cotton bollworm Helicoverpa armigera. Pestic. Biochem. Phys. 2015, 121, 102–106. [CrossRef][PubMed] Int. J. Mol. Sci. 2016, 17, 493 13 of 13

32. Liu, S.H.; Yangb, B.J.; Go, J.H.; Yao, X.M.; Zhang, Y.X.; Song, F.; Liu, Z.W. Molecular cloning and characterization of a juvenile hormone esterase gene from brown planthopper, Nilaparvata lugens. J. Insect Physiol. 2008, 54, 1495–1502. [CrossRef][PubMed] 33. Rai, M.; Padh, H. Expression systems for production of heterologous proteins. Curr. Sci. India 2001, 80, 1121–1128. 34. Cheesman, M.J.; Traylor, M.J.; Hilton, M.E.; Richards, K.E.; Taylor, M.C.; Daborn, P.J.; Russell, R.J.; Gillam, E.M.J.; Oakeshott, J.G. Soluble and membrane-bound Drosophila melanogaster CYP6G1 expressed in Escherichia coli: Purification, activity, and binding properties toward multiple pesticides. Insect Biochem. Mol. 2013, 43, 455–465. [CrossRef][PubMed] 35. Liu, X.N.; Zhang, L.; Zhang, X.T.; Xiwu, G. Molecular cloning and recombinant expression of cytochrome P450 CYP6B6 from Helicoverpa armigera in Escherichia coli. Mol. Biol. Rep. 2013, 40, 1211–1217. [CrossRef] [PubMed] 36. Yang, X.Q.; Zhang, Y.L. Effect of temperature and sorbitol in improving the solubility of carboxylesterases protein CpCE-1 from Cydia pomonella and biochemical characterization. Appl. Microbiol. Biot. 2013, 97, 10423–10433. [CrossRef][PubMed] 37. Yuan, G.R.; (Southwest University, Chongqing, China). Personal communiation, 23 May 2015. 38. Baneyx, F.; Mujacic, M. Recombinant protein folding and misfolding in Escherichia coli. Nat. Biotechnol. 2004, 22, 1399–1408. [CrossRef][PubMed] 39. Liu, J.W.; Boucher, Y.; Stokes, H.W.; Ollis, D.L. Improving protein solubility: The use of the Escherichia coli dihydrofolate reductase gene as a fusion reporter. Protein Expr. Purif. 2006, 47, 258–263. [CrossRef][PubMed] 40. Liu, J.W.; Hadler, K.S.; Schenk, G.; Ollis, D. Using directed evolution to improve the solubility of the C-terminal domain of Escherichia coli aminopeptidase P—Implications for metal binding and protein stability. FEBS J. 2007, 274, 4742–4751. [CrossRef][PubMed] 41. Harel, M.; Kryger, G.; Rosenberry, T.L.; Mallender, W.D.; Lewis, T.; Fletcher, R.J.; Guss, J.M.; Silman, I.; Sussman, J.L. Three-dimensional structures of Drosophila melanogaster acetylcholinesterase and of its complexes with two potent inhibitors. Protein Sci. 2000, 9, 1063–1072. [CrossRef][PubMed] 42. Pezzementi, L.; Johnson, K.; Tsigelny, I.; Cotney, J.; Manning, E.; Barker, A.; Merritt, S. Amino acids defining the acyl pocket of an invertebrate cholinesterase. Comp. Biochem. Phys. B 2003, 136, 813–832. [CrossRef] 43. Devonshire, A.; Heidari, R.; Bell, K.; Campbell, P.; Campbell, B.; Odgers, W.; Oakeshott, J.; Russell, R. Kinetic efficiency of mutant carboxylesterases implicated in organophosphate insecticide resistance. Pestic. Biochem. Phys. 2003, 76, 1–13. [CrossRef] 44. Ruan, Z.Y.; Zhai, Y.; Song, J.L.; Shi, Y.H.; Li, K.; Zhao, B.; Yan, Y.C. Molecular cloning and characterization of a newly isolated pyrethroid-degrading esterase gene from a genomic library of Ochrobactrum anthropi YZ-1. PLoS ONE 2013, 8, e77329. [CrossRef][PubMed] 45. Larkin, M.A.; Blackshields, G.; Brown, N.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [CrossRef][PubMed] 46. Petersen, T.N.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat. Methods 2011, 8, 785–786. [CrossRef][PubMed] 47. Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [CrossRef][PubMed] 48. Coppin, C.W.; Jackson, C.J.; Sutherland, T.; Hart, P.J.; Devonshire, A.L.; Russell, R.J.; Oakeshott, J.G. Testing the evolvability of an insect carboxylesterase for the detoxification of synthetic pyrethroid insecticides. Insect Biochem. Mol. 2012, 42, 343–352. [CrossRef][PubMed] 49. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [CrossRef] 50. Xie, J.; Zhao, Y.; Zhang, H.; Liu, Z.; Lu, Z. Improving methyl parathion hydrolase to enhance its chlorpyrifos-hydrolysing efficiency. Lett. Appl. Microbiol. 2014, 58, 53–59. [CrossRef][PubMed]

© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).