Overexpression of Epidermal Growth Factor Like Domain 7 Using an Inducible Piggybac Vector

Overexpression of Epidermal growth factor like domain 7 using an inducible PiggyBac vector

Jakob Jakobsson

Líf- og umhverfisvísindadeild Háskóli Íslands

2017i

Overexpression of Epidermal growth factor like domain 7 using an inducible PiggyBac vector

Jakob Jakobsson

15 eininga ritgerð sem hluti af Baccalaureus Scientiarum gráðu í sameindalíffræði

Leiðbeinandi

Guðrún Valdimarsdóttir

Faculty of life and environmental sciences School of engineering and Natural sciences University of Iceland Reykjavík, May 2017

Overexpression of Epidermal growth factor like domain 7 using an inducible PiggyBac vector 15 eininga ritgerð sem hluti af Baccalaureus Scientiarum gráðu í sameindalíffræði

Líf- og umhverfisvísindadeild Verkfræði- og náttúruvísindasvið Háskóli Íslands Askja, Sturlugötu 7 101 Reykjavík

Sími: 525 4000

Skráningarupplýsingar: Jakob Jakobsson, 2017, Overexpression of Epidermal growth factor like domain 7 using an inducible PiggyBac vector, BS ritgerð, Líf- og umhverfisvísindadeild, Háskóli Íslands, 23 bls.

Útdráttur

Æðamyndun er ferli sem að æðaþelsfrumur fara í gegnum til að mynda nýjar æðar útfrá þeim eldri. Óvenjuleg æðamyndun á þátt í fjölda sjúkdóma og í æxlisvexti krabbameina. Rannsóknir á æðamyndun og æðaþelsfrumum auka skilning á þessum flóknu ferlum sem gefur leið að nýjum meðferðum gegnsúk dómum. Epidermal growth factor like domain 7 (EGFL7) er þekkt sem mikilvægur þáttur í æðamyndun en virkni hans er ekki skilin að fullu. Markmið þessa verkefnis er að meta hvort að hægt sé að innskeyta EGFL7-PiggyBac genaferju í æðaþelsfrumur úr mönnum (HUVEC) og hvort að virkni genaferju gæti verið stjórnað með cumate títrunum. Annað markmið var að rannsaka hver áhrif yfirtjáningar EGFL7 væri á æðamyndun og á genatjáningu nokkura þátta tengdu utanfrumuefninu. Til að ná genaferju inn í frumurnar þurfti að nota nokkrar ólíkar aðferðir áður en loksins tókst að tjá EGFL7. Þrátt fyrir að tekist hafi að koma genaferju inn og að tjá genið tókst ekki að stjórna því ennfrekar með cumate titrunum. Engar breytingar sáust á tjáningu VE-cadherin en bæling varð á tjáningu elastins með yfirtjáningu á EGFL7 og við örvun með BMP9. Yfirtjáning EGFL7 jók einnig á fjarlægð milli greina æða.

Abstract

Angiogenesis is the process where endothelial cells form new blood vessels from existing vessels. Aberrant angiogenesis is a cause of many diseases as well as being involved in cancer growth. Research on angiogenesis and endothelial cells increases our understanding of these complex processes and gives new insights on possible treatments for diseases related to angiogenesis. Epidermal growth factor like domain 7 (EGLF7) is known to be a key factor in angiogenesis but much of its exact function is still to be uncovered. The aim of the project was to evaluate whether or not an unproven EGFL7-PiggyBac vector could be used to successfully transfect HUVECs and if its expression could be controlled using cumate titrations. A secondary aim was to study what effects EGFL7 overexpression had on angiogenesis and certain ECM related factors. To achieve this several transfection attempts were made using different reagents and protocols, until successful induction of EGFL7 expression in transfected cells was achieved. However, EGFL7 expression could not be controlled upon tritration of cumate. No changes were seen in the expression of VE-cadherin but the downregulation of the ECM gene elastin was seen in cells overexpressing EGFL7 and those treated with BMP9. The effect of EGFL7 and BMP9 on angiogenesis was studied using a tube-like formation assay. The overexpression of EGFL7 and BMP9 treatment did increase the branching interval in tubes.

iii

Fyrir Elísu

Table of contents

Figures ...... viii

Tables ...... ix

Abbreviations ...... x

Acknowledgements ...... xi

1 Introduction ...... 1 1.1 The vascular system and blood vessel formation ...... 1 1.1.1 Vasculo and angiogenesis ...... 1 1.1.2 The role af blood vessel formation in tumorigenesis ...... 2 1.2 The TGF β signaling pathway ...... 2 1.2.1 TGF-β subfamilies ...... 3 1.2.2 The BMP subfamily ...... 3 1.3 The extracellular matrix and cell junctions ...... 4 1.3.1 Elastin and Collagen ...... 4 1.3.2 Cell-Cell and Cell-Matrix adhesion ...... 5 1.4 Epidermal growth factor-like domain 7 ...... 5 1.4.1 EGFL7 and angiogenesis ...... 6 1.4.2 EGLF7 and the Notch pathway ...... 6 1.4.3 EGFL7 and cancer ...... 7

2 Aim of the project ...... 8

3 Materials and methods ...... 8 3.1 Cell culture ...... 8 3.1.1 Cell stimulation ...... 9 3.2 Transfections ...... 9 3.2.1 Transpass D1 ...... 10 3.2.2 Lipofectamine 3000 ...... 10 3.2.3 Fugene HD ...... 10

3.3 Nucleic acids ...... 10 3.3.1 RNA extraction ...... 10 3.3.2 cDNA synthesis ...... 10 3.3.3 Polymerase chain reaction ...... 10 3.4 Western Blot ...... 11 3.4.1 Protein preperation ...... 11 3.4.2 SDS page ...... 11 3.4.3 Transfer ...... 12 3.4.4 Antibody staining...... 12 3.5 Tube-like formation assay and immunofluorescence ...... 13 3.5.1 Tube-like formation assay ...... 13 3.5.2 Immunofluorescent staining ...... 13

4 Results ...... 14 4.1 EGFL7 overexpression ...... 14 4.1.1 Transfection ...... 14 4.1.2 Confirmation of cumate induced gene expression ...... 15 4.2 Effects of EGFL7 and BMP9 on gene expression ...... 16 4.3 Tube-like formation assay ...... 17 4.3.1 Analysis of tube-like formation ...... 18

5 Discussion ...... 20

Bibliography ...... 22

vii

Figures

Figure 1: Schematic representation of he processes of vasculo and angiogenesis...... 2

Figure 2: A simplified overview of the TGF-β family ...... 3

Figure 3: A summary of the effects of EGFL7 expression during angiogenesis...... 6

Figure 4: The hypothetical model of the effect of EGFL7 on the Notch pathway ...... 7

Figure 5: A flowchart representation of the project...... 8

Figure 6: The EGFL7-PB plasmid...... 9

Figure 7: An example of a Western blot transfer stack...... 12

Figure 8: prRL-GFP transfected cells exhibiting GFP expression ...... 15

Figure 9: EGFL7 is expressed in EGFL7-PB HUVECs but not in EV-PB HUVECs ...... 16

Figure 10: EGFL7 and BMP9 downregulate elastin...... 17

Figure 11: EGFL7 and BMP9 seem to increase branching interval ...... 18

Figure 12: Tube-like formations show little difference in branching length ...... 19

Figure 13: EGFL7 overexpression causes greater branching interval ...... 19

viii

Tables

Table 1: PCR primers...... 11

Table 2: Primary antibodies for western blotting...... 13

Table 3: Secondary antibodies for western blotting ...... 13

Table 4: Primary antibodies for immunofluorescent staining ...... 14

Table 5: Secondary antibodies for immunofluorescent staining ...... 14

Abbreviations

ALK Activin receptor-like kinase

BMP Bone morphogenic protein

DLL4 Delta-like 4

ECM Extracellular matrix

EGLF7 Epidermal growth factor-like domain 7

EV Empy vector

GFP Green fluorescent protein

HUVEC Human Umbilical Vein Endothelial Cells

LOX Lysyl oxidase

PB PiggyBac

RNA Ribonucleic acid

TGF-β Transforming growth factor Beta

VE-cad Vascular endothelial cadherin

VEGF Vascular endothelial growth factor cDNA Copy deoxyribonucleic acid

Acknowledgements

I would like to thank Guðrún Valdimarsdóttir for the chance to work on this project and Zophonias O. Jónsson for reviewing the thesis. I would also like to thank everyone at the biomedical center who aided me in my work. A special thanks to Dr. Halldórsson for the neverending supply of HUVECs.

xii

1 Introduction

1.1 The vascular system and blood vessel formation

The cardiovascular system has the important role to transport nutrients and vital molecules to the tissues of the body as well as removal of waste. The transduction of hormonal signals also happens through the bloodstream. The system is made of interconnected vessels, filled with blood, that form a circulation. The flow of blood is powered by pressure made by the beating of the heart. A lot of effort is put into research on the cardiovascular system but diseases affecting it kill more people than anything else in Western countries (Dimmeler, 2011).

1.1.1 Vasculo and angiogenesis

Blood vessel formation occurs through two processes, vasculogenesis and angiogenesis (Figure 1). In vasculogenesis mesoderm derived cells become angioblasts which are the progenitors for the endothelial cells. These cells then differentiate and form vessels. Angiogenesis mostly happens during fetal development but is also seen in inflammation responses, wound healing and tumor growth (Nichol & Stuhlmann, 2012).

In angiogenesis vessels form from a growth cone that sprouts from an existing vessel. This process involves cell divison and reorganization of the extracellular matrix (ECM). The growth cone consists of two cell types, the tip cells and stalk cells (Figure 3). Tip cells do not divide but sense and move towards a VEGF gradient. This VEGF gradient induces only one cell to become a tip cell for each growth cone. These cells start to express the Notch ligand DLL4 that binds to the Notch receptors on nearby cells and causes them to become stalk cells. These stalk cells do not move towards the VEGF gradient but do on the other hand multiply which causes the vessel to grow. This process continues until two tip cells connect and go through a process called anastomosis. They then lose the ability to move but form a continous vessel with a lumen. When the endothelial cells stop dividing they gain a quiescent phenotype. Finally the new vessel is stabilized with pericytes and smooth muscle cells. Together these two processes yield a complex network of vessels and many individual factors play a role therein (Cai, Pardali, Sanchez-Duffhues, & ten Dijke, 2012; Nichol & Stuhlmann, 2012).

Figure 1 Schematic representation of the processes of vasculo and angiogenesis. Adapted from (Takuwa et al., 2010)

1.1.2 The role af blood vessel formation in tumorigenesis When tumors grow bigger than 2-3mm in diameter the passive flow of nutrition and oxygen is no longer enough to support them and they require vessels for continued growth. Angiogenesis can form new vessels that grow in the direction of the tumor, supplying it with nutrition and oxygen. The newly formed vessels also form a path for the tumor cells to enter the circulatory system where they can metastasize. Metastatic tumors are more dangerous than primary tumors. The process of angioenesis can be combatted using monoclonal antiobodies such as Bevacizumab which is used as a tumor drug in cancer therapy (Cai et al., 2012). With a better understanding of the molecular processes behind blood vessel formation the chances of new succesful treatments for cardiovascular diseases and tumour progression increase.

1.2 The TGF β signaling pathway

The TGF-β superfamily is made up of 33 protein ligands that control various processes (Figure 2). This family has an important role in cell migration, cell survival, differentiation and growth. All of these proteins function through enzyme coupled, membrane bound receptors with serine/threonine kinases on the cytosolic side of the membrane. Two main types of these receptors exist, type I and type II proteins. These types are structurally similar monomers and there are seven type I and four type II proteins known. When a ligand binds to the receptor, the two types form dimers and the type I receptor becomes phosphorylated. Every member of the TGF-β superfamily binds to a specific combination of type I and II receptors. The different affinity of TGF-β ligands for different pairs of receptors controls the specificity of the ligands. Upon type I receptor phosphorylation it can bind to and phosphorylate a transcription factor of the Smad family (Horbelt, Denkis, & Knaus, 2012).

1.2.1 TGF-β subfamilies The TGF-β family can be divided into two groups depending on what Smads are activated intracellularly. The TGF-β /activin subfamily uses Smad2 and Smad3 but the BMP subfamily uses Smad1, 5 and 8. These Smads are called R-Smads (Restricted Smads). When activated, the R-Smads from a complex with Smad4, also known as co-Smad and other activated R-Smads. Depending on the compostion of this complex, target genes are activated. The compostion of intracellular Smads varies between cell types so the signal can have different effects depending on the cell type. The TGF-β receptors can also activate different pathways that do not use Smads such as MAPK (Figure 2) (Horbelt et al., 2012). All of these pathways show a dose dependent effect that allows cells to show varied responses to the strength and duration of the signal. The pathways are controlled at every level which gives cells the opportunity to react to signals according to the context of the cell. The best defined role of TGF-β in adult organisms is as a tumor supressor (Massague, 2012).

Figure 2 A simplified overview of the TGF-β family (Horbelt et al., 2012).

1.2.2 The BMP subfamily

The Bone Morphogenetic Proteins (BMPs) were first known for their ability to induce bone growth but are now known as pleiotropic controllers of development and tissue homeostasis. Genetic research has shown that defects in BMP signaling can lead to diseases in the cardiovascular system and cancer. The BMP subfamily is the largest subset of the TGF-β

superfamily composing over 20 proteins. BMPs are usually not secreted in an inactive state like the TGF-β which has to be activated by cutting off the LAP protein. BMPs have the greatest affinity for BMP type I receptors but can also bind to Activin kinases. Based on structural similarites the BMP type I receptors can be categorized into two main groups, the ALK1/2 group and the ALK3/6 group. ALK1 is mainly expressed in endothelial cells but the other ALKs are more commonly expressed. Several modulators exist for BMP receptors that themselves do not have signaling domains but can nonetheless increase BMP signaling. The most notable among these modulators is Endoglin (Lowery & de Caestecker, 2010).

BMPs and blood vessel formation

BMPs have an important role in vascular modeling. Mutant mice with any part of the BMP signalling pathway inactive have defective cardiovascular systems and die at the embryonic stage. BMP9 is an interesting example of how BMPs can have context dependent effects. BMP9 has been shown to impede cell migration and growth of endothelial cells at high concentrations but can actually induce angiogenesis at lower concentrations (Cai et al., 2012).

The ALK1 receptor and tumors The ALK1, type I receptor for BMP9 and BMP10 has received a lot of attention in the past few years but it is highly upgregulated in the vessels of tumours. ALK1 is highly expressed in the arteries in fetal development but its expression is reduced in fully grown vessels. The expression of ALK1 is controlled by several pro-angiogenic factors such as VEGF but BMP9 mediated angiogenesis can be reduced by antibodies for ALK1. This makes the receptor and related factors interesting as possible drug targets (Cai et al., 2012).

1.3 The extracellular matrix and cell junctions

The extracellular matrix (ECM) is a complex collection of large molecules that cells secrete to their near environment. These molecules are largely proteins and sugars that interconnect, forming a complex and stable net. This net contributes to the stability and tensile strength of tissues but the ECM also has a large role in the specialized function of tissues such as when the ECM calcifies in teeth and bone formation. The ECM is not technically alive but it can rapidly change. These changes are important in many stages of development when cells remodel their surroundings. This is especially important in processes such as angiogenesis where the ECM plays a key role in the organization, growth and migration of endothelial cells. Mammals are thought to have around 300 matrix proteins and many enzymes that can change the function and composition of these proteins through degradation and crosslinking. The ECM can bind cytokines and signaling molecules and store them until something activates them. The ECM is much more than just a foundation for cells to grow on and plays an active role in the life and development of cells and tissues (Alberts, 2015).

1.3.1 Elastin and Collagen

The most stable part of the ECM are elastic fibers, that give organs such as the skin and arteries the ability to stretch. Elastin is the main component of elastic fibers. It is secreted by many cell types, notably endothelial cells. Elastin is secreted as a soluble precursor protein called tropoelastin. Tropoelastin is polymerized in a process called elastogenesis where enzymes of the lysyl oxidase family (LOX) crosslink the tropoelastin molecules to collagen,

forming elastic fibers. This process is important for standard vascular modeling. Mice with inactive LOX enzymes die shortly after birth from ruptured aortas (Lelievre et al., 2008).

1.3.2 Cell-Cell and Cell-Matrix adhesion

Animal cells mostly use the protein integrin to connect to the ECM. Integrins are transmembrane proteins that connect the ECM to the cytoskeleton. Integrin receptors consist of two glycoprotein subunits that bind certain amino acid sequences that are found on ECM proteins. On the cytosolic side of the membrane the integrin dimer binds to a complex of several proteins that together form a link to the cytoskeleton. Integrins create more than attachment for cells, they are also necessary for cell growth and proliferation in many cell types including epithelial cells. When cells lose contact with the ECM they undergo apoptosis. Mutations that cause defects in this control are found in cancer cells which enables them to proliferate where they should not (Desgrosellier & Cheresh, 2010).

The cadherin family

The cadherin family is a group of calcium dependent transmembrane glycoproteins that have an important role in cell adhesion and communication. A few different types of cadherins exist such as E-cad, N-cad nad VE–cad and they have different expression patterns in various cell types like E-Cadherin which is found mostly in epithelial tissue. Cadherins bind to other cadherins of the same type and contribute to the ability of cells to adhere together under various types of stress. Changes in the expression of cadherins plays a role in cell migration and is one of the hallmarks of EMT (Angst, Marcozzi, & Magee, 2001). VE-cadherin is similar to E-cad but congregates at the adherens junction. VE-cad is important for angiogenesis and remodeling because it forms complex with the VEGF receptor which aids in its function. Mice with VE-cadherin KOs die at the fetal stage because their endothelial cells lose the ability to respond to VEGF-A gradients (Benn, Bredow, Casanova, Vukicevic, & Knaus, 2016).

The claudins

All endothelial tissue works as a selective membrane that seperates liquid phases on each sides of the membrane. For this to be possible the cells need to be tightly bound to each other. This is accomplished by the proteins that make up the tight junctions. When viewed in an electron microscope fibers can be seen covering the apical end of each cell. The main constituent of these fibers are the claudin proteins. In humans there are 24 claudins (Alberts, 2015).

1.4 Epidermal growth factor-like domain 7

Epidermal growth factor-like domain 7 (EGFL7), also known as VE-Statin is a secreted proangiogenic protein that has a unique expression pattern. Unlike many other angiogenic factors such as VEGF, EGFL7 is mostly expressed in and acts on endothelial cells. EGFL7 is expressed more in active, growing endothelium such as during angiogenesis in embryonic development and in wound healing. EGFL7 is believed to act as a chemoattractant on endothelial cells and is important for tubulogenesis. The EGFL7 gene is composed of eleven exons. Within the gene, between exon 7 and 8 is microRNA 126 (miR-126) that is believed to have a major role vessel development (Nikolic, Plate, & Schmidt, 2010).

1.4.1 EGFL7 and angiogenesis

EGFL7 promotes cell adhesion but does it less robustly than molecules such as collagen and fibronectin. This suggests that EGFL7 creates an environment where cells can easily reorganize themselves during vascular remodeling. A second role for EGFL7 is to regulate the Lysyl oxidase (LOX) enzymes (Lelievre et al., 2008). This changes the composition of the ECM by reducing the amount of elastin and making the environment more favorable for cell migration and invasion during angiogenesis (Figure 3). Knockdown of EGFL7 in zebrafish causes defective vessels that form irregular lumens. EGFL7 also seems to have an important role in repair of damaged vessels or as a response to hypoxic conditions. The process behind the increase in EGFL7 expression in hypoxia is unknown but the EGFL7 promoter has possible binding sites for hypoxia inducible factor 1alpha (HiF1α). Increased concentrations of EGFL7 seem to increase vascular density which would aid blood flow to important organs such as the brain during hypoxia (Nichol & Stuhlmann, 2012).

Figure 3 A summary of the effects of EGFL7 expression during angiogenesis. (A) EGFL7 aids in cell migration and the sprouting process. (B) EGFL7 hinders the function of LOX enzymes thus decreasing the rigidity of the ECM. Adapted from (Nichol & Stuhlmann, 2012)

1.4.2 EGLF7 and the Notch pathway

EGFL7 is suggested to function at least in part through modulation of the Notch pathway. This pathway is known to affect processes that control development and cell differentiation. The signaling process happens through a membrane bound Notch receptor. When a ligand binds to this receptor it releases the Notch intracellular domain. This released domain moves to the nucleus and activates the transcription of genes such as HES and HEY. It has been shown that EGFL7 can bind to the Notch receptors and and DLL4, thus hindering the activation of the Notch pathway (Figure 4). Interestingly, EGFL7 has also been shown to have an activating effect on the Notch pathway (Massimiani et al., 2015). The mechanism

behind EGFL7 mediated activation and deactivation of Notch is not fully understood but it is likely that the composition of the ECM and the different expression levels of Notch and its ligands in different cell types have their role in the effect of EGFL7 (Nichol & Stuhlmann, 2012).

Figure 4 The hypothetical model of the effect of EGFL7 on the Notch pathway. EGFL7 binds to Notch receptors and ligands inhibiting the Notch pathway (Nichol & Stuhlmann, 2012).

1.4.3 EGFL7 and cancer

EGFL7 has been investigated as a theraputic target for cancer treatment. It is expressed in many cancer cell lines and is highly elevated in many human tumors. This most likely stimulates tumor angiogenesis and studies using antibodies against EGFL7 have shown inhibited tumor growth. EGFL7 may also reduce expression of tumor specific adhesion molecules thus preventing immune cell infiltration (Johnson et al., 2013).

2 Aims of the project

My project is a part of a bigger project of the research group focusing on the role of EGFL7 during human embryonic stem cell differention. In this project we want to be able to control the expression of EGFL7 at differrent stages of vascular development in human embryonic stem cells. Therefore my aim was to study whether the expression of EGFL7 can be controlled using cumate titrations in HUVECs transfected with an EGFL7-PiggyBac vector. The second aim was to investigate the effect of EGFL7 on HUVECs and ECM related factors (Figure 5) as well as the effect of BMP9. The research group has shown that BMP9 induces EGFL7 expression (Ricther et al,. Unpublished).

Figure 5 A flowchart representation of the project

3 Materials and methods

3.1 Cell cultures

All cell work was done using human umbilical vein endothelial cells (HUVEC) in a sterilised environment. Fresh HUVECs were isloated from umbilical cords by Dr. Halldorsson at the Landspitali University Hospital with permission from the Health and Research committee (Application no. 35/2013). Cells were cultured in EC medium (Peprotech) in gelatin coated plates (Sigma). The medium was changed every 2-3 days and the cells were kept in an incubator at 37°C and 5% CO2. Cell passaging was done at 80-90% confluency using TrypLE (Gibco) for dissociation.

3.1.1 Cell Stimulation

Transfected cells were incubated with cumate (Cambridge biosciences, 10.000X; 300mg/ml) added to the EC medium at a final concentration of 5X, for at least 48 hours to induce the vector. BMP9 (1 ng/ml) (R&D systems) or BMP10 was added to medium (10 ng/ml) for at least four hours before cell harvest. For transfection selection the cells were incubated with puromycin. At first the the concentration 0,3 μg/ml was used but it was raised to 0,5 μg/ml after the negative control failed to die.

3.2 Transfections

All transfections that were performed used PiggyBac transposase with either EGFL7-PB or EV-PB. The transfection efficiency was estimated by measuring the GFP fluorescence using a EVSO-FL micrsoscope (Life technologies). The transfected cells were selected using puromycin (Gibco) in medium changed every other day. The PB plasmids had been previously designed and made by T. Wachsmann in the lab using Gibson assembly cloning. The construction of the EGFL7-PB is demonstrated in figure 6.

Figure 6: The EGFL7-PB plasmid. Designed using SnapGene viewer

3.2.1 Transpass D1

Cells were seeded in six well plates and grown to about 70% confluency. 3μg of plasmids were added to 250μL serum free medium with 7μL of Transpass D1 transfection Reagent and incubated for 30 min to form the transfection complex. The mixture was then added to the cells and incubated for 24 hours, after which the medium was changed to EC medium.

3.2.2 Lipofectamine 3000

Cells were seeded in six well plated and grown to about 70% confluency. 2,5μg of construct DNA were mixed in 150μL of serum free medium with 5μL of Plus reagent. 8μL of Lipofectamine reagent was diluted in 150μL of serum free medium and then added to the DNA mixture and incubated for 5min. 250μL of the DNA lipid contruct was then added to cells for transfection and incubated for 24 hours, after which the medium was changed to EC medium.

3.2.3 Fugene HD

Cells were seeded in six well plates and grown to about 70% confluency. A protocol was established using an online calculator for Fugene HD (Promega FugeneHdTool) for MCF7 cells since HUVECs were not an option in the online calculator. 3μg of the constructs were mixed with 150μL of starvation medium and 20μL of Fugene HD reagent and incubated for 10 min to form the transfection complex. The mixture was added to cells and incubated for 24 hours, after which the medium was changed to EC medium.

3.3 Nucleic acids

3.3.1 RNA extraction

Total RNA was extracted from cultured cells using Trizol reagent (Ambion) according to the protocol supplied by Ambion. All RNA was kept at -80°C until used. All RNA samples were measured using spectroscopic methods with NanoDrop one (Thermo Fisher).

3.3.2 cDNA synthesis

Optimal amounts of RNA were used according to the protocol supplied by invitrogen and mixed on ice with 1µL of Oligo (dT), 1µL dNTP (10mM) and water up to 12µL. The mixture was heated at 65°C for 5min. After that 4µL of 5X First strand buffer was added with 2µL of DTT and the contents mixed and incubated for 2min at 45°C. After that 1µL of Superscript™ II reverse transcriptase was added and incubated at 42°C for 50min. The reaction was inactivated by heating at 70°C for 15min.

3.3.3 Polymerase chain reaction

PCR on target genes was performed in a 96 well thermal cycler (Veriti) in a 25μL reaction volume consisting of 0,5μL of forward, 0,5 μL reverse primer (Table 1), 1,5 μL MgCl (25mM), 2,5μL of DreamTaq buffer, 0,5μL dNTP (2mM), 0,06 μL DreamTaq polymerase,

1μL DNA and water up to 25μL. PCR product was run on agarose (Applichem) gels using PowerPac-300 (Bio-Rad) and imaged in a Chemi Doc (Bio-Rad).

Table 1 - PCR primers. Primer sequence, Annealing temperature and product size.

Gene Primer sequence Annealing temperature (°C) hARP F:CACCATTGAAATCCTGAGTGATGT 60 R:TGACCAGCCCAAAGGAGAAG

LOX F:GGACGGCCGGCTCATCTGG 55

R:GGAATATCTTGGTCGGCTGGGTAA

Elastin F:AGCGGGCTGGGGCATTTCTCC 63 R:TGCAGCAGCGTCAGCCACTCCA

EGFL7 F:CCTGCAGGATGGCGGGGTGACA 64 R:GCGGCCGAGCTGCTGGAAGGAG

VE-Cadherin F:GGCATCTTCGGGTTGATCCT 54 R:CCGACAGTTGTAGGCCCTGTT

3.4 Western Blot

3.4.1 Protein preperation

Protein was extracted from cell cultures at around 70% confluency. Cells were washed with PBS and lysed with 300µL of a cocktail of lysis buffer (20mM Tris, 150mM NaCL, 1% Triton X-100, 10% Glycerol) and sample buffer ( 7ml UTB buffer (60,6g 0,5M Tris, 40ml 10% SDS adjusted to 1L ph 8,8), 3ml Glycerol, 1g SDS, 0,93g DTT and 1,2mg Bromophenol blue). A pipette tip was used to scrape cells off the surface and the lysate was collected into eppendorf tubes that were kept on ice. The samples were sonicated in an ice cold water bath for five minutes and heated at 95°C for five minutes before loading on gels.

3.4.2 SDS page

Running buffer (144g of glycine, 10g SDS and 30g Tris adjusted to a volume of 1 liter of water) was used for SDS-page. The gel was loaded with 30µL of protein sample and 2µL of protein ladder (Thermo Fisher 26616). The gel was then ran on 100V for 40min using Power Pac 300 (Bio-Rad) until the proteins had gone through the stacking gel and then at 120V until the proteins had reached the end of the separating gel.

3.4.3 Transfer

Transfer buffer (3,03g Tris, 14,4g Glycine and 200ml of methanol with water to a final volume of 1L). A blotting stack was prepared placing a sponge on the sandwich anode and three Whatman papers on the sponge (Figure 7). A PVDF membrane (Thermo Fisher) was activated in methanol. The gel was carefully removed from the running apparatus and the excess wells removed. The membrane was placed on the opposite side of the sandwich and the membrane placed on top of it. The sandwich was closed and placed in the transfer chamber with transfer buffer covering it. The transfer was done overnight at 20V and 4°C.

Figure 7: An example of a Western blot transfer stack (Adapted from Abcam online protocol)

3.4.4 Antibody staining

The membrane was placed in a box and blocked using 1:1 mix of blocking buffer (Odyssey) and TBST for one hour. The membrane was then incubated with a primary antibody (Table 2) overnight at 4°C. After that the membrane was washed three times with TBST for 15 mins and incubated with a secondary antibody (Table 3) in a 1:4 mix of Odyssey blocking buffer and TBST. After secondary incubation the membrane was again washed three times using TBST. The membrane was then analysed using an Odyssey CLX.

Table 2: Primary antibodies for western blotting

Antibody Species Company Catalogue# Dilution

EGFL7 Goat R&D systems AF3638 1:2000

Actin Mouse Millipore 2653087 1:20.000 pSmad1 Rabbit LICR na 1:250

NotchICD Rabbit Abcam 8926 1:100

ID1 Rabbit Santa Cruz B1306 1:1000

Table 3: Secondary antibodies for western blotting

Species Company Catalogue# Wavelength

α-Mouse Invitrogen A11003 800

α-Goat Licor 925-32214 800

α-Rabbit Invitrogen A11070 680

3.5 Tube-like formation assay and immunofluorescence

HUVECs were seeded on 8-chamber slides (B&D) coated with matrigel. Cell were counted using Cell Countess (invitrogen) to seed 50.000 cell per chamber. Chambers were incubated at 37°C.

3.5.1 Tube-like formation assay

For tube-like formation cells were incubated for 24 hours in the chamber slides. Every chamber was imaged using a LEICA DM-IRB microscope. The chambers were compared using the ImageJ addon angiogenesis analyzer.

3.5.2 Immunofluorescent staining

For immunofluorescence, chambers were washed with PBS and fixated with 4% PFA for 30min. After that the chambers were washed three times with PBS. The cells were perforated with 250 µL of 0,1% Triton per chamber for 8min. The chambers were blocked with 250μL of 4% Goat serum for 45min. The chambers were incubated overnight with a proper dilution of primary antibody (Table 4) and then washed with 0,05% PBS-Tween three times. The

chambers were then incubated with a secondary antibody (Table 5) for 1 hour and washed three times before imaging with a confocal microscope (Olympus FV1200).

Table 4: Primary antibodies for immunofluorescent staining

Antibody Species Company Catalogue Dilution

NotchICD Rabbit Abcam 8926 1:100

EGFL7 Mouse Abcam 50254 1:2000

Table 5: Secondary antibodies for immunofluorescent staining

Species Company Catalogue Wavelength

α-Mouse Invitrogen A11003 546

α-Rabbit Invitrogen A11070 488

4 Results

4.1 EGFL7 overexpression

As was previously mentioned the EGFL7 PiggyBac plasmids had already been generated by Tassilo Wachsmann in the lab using the Gibson assembly method. To confirm the correct function of the PiggyBac plasmids, HUVECs were transfected using the EGFL7-PB or EV- PB together with PB-transposase plasmids and the expression induced using cumate. From these transfected cells protein and RNA was extracted to assess the efficacy of the expression system.

4.1.1 Transfection

Because of difficulties with transfections, several different transfection reagents and protocols were needed (Transpass D1, Lipofectamine 3000 and FuGENE HD). The transfection efficiency of these different methods in HUVECs was measured using prRL- GFP plasmid, constitutively expressing the green fluorescent protein. The transfection efficiency was low when using TranspassD1 and Lipofectamine but FuGENE HD showed the best results (Figure 8). Puromycin selection was used to select for the transfected cells. Succesfully transfected cells were used for further work and research.

Figure 8 prRL-GFP transfected cells exhibiting GFP expression.

4.1.2 Confirmation of cumate induced gene expression

Transfected cells were grown in EC medium containing 5X cumate concentration for at least 48 hours. and then harvested. Protein samples isolated from these cell cultures were run on a 12,5% SDS gel, transferred to a PVDF membrane and stained with antibodies. Figure 9 shows the western blot analysis of EGFL7-PB and EV-PB. The protein bands for EGFL7-PB cell at 29kDa, same as the positive control show that the gene is overexpressed compared to the empty vector. Although the expression system had been proven to be inducible using 5X cumate the expression could not be controlled using titrations.

Figure 9 EGFL7 is expressed in EGFL7-PB HUVECs but not in EV-PB HUVECs.

4.2 Effects of EGFL7 and BMP9 on gene expression

To investigate the effects of EGFL7 on several ECM factors, RNA was extracted from transfected cells and cDNA was generated by reverse transcription. PCR was performed in a 96 well thermal cycler. The PCR products were imaged using ethidium bromide. The overexpression of EGFL7 was confirmed in the EGFL7-PB but the expression was also seen, albeit at a lower level in EV-PB cells. The PCR showed two bands possibly due to nonspecific binding or the gene splice variants. To study if EGFL7 and BMP9 had any effect on the expression of ECM related factors or vascular permeability the expression of elastin and VE-Cadherin was analysed. The expression of VE-Cadherin seemed to be unaffected in EGFL7 overexpressed HUVECs or BMP9 treated cells but the expression of elastin was downregulated. This correlates with the role of EGFL7 as a proangiogenic factor (Figure 10).

Figure 10 EGFL7 and BMP9 downregulate elastin but have no noticable effect on VE- cadherin

4.3 Tube-like formation assay

Tube-like assays are one of the most commonly used methods to measure endothelial cell sprouting. To investigate the effects of EGFL7 and the ALK1 binding BMP9 and BMP10 on this key step of angiogenesis, cells were seeded on matrigel and incubated for 24 hours. The cell slides were imaged after incubation (Figure 11) and analysed using the ImageJ software addon angiogenesis analyzer. There are many different ways to quantify tube formation but the most common ones are to measure number, length of tubes or number of nodes (DeCicco- Skinner et al., 2014).

Figure 11 EGFL7 and BMP9 increase branching interval but BMP10 decreases it.

4.3.1 Analysis of tube-like formation

When analysed the tubes show little difference in the total branching length (Figure 12) or number of nodes. The branching interval is the mean distance separating two branches in the trees in the analyzed area. The EGFL7-PB cells showed greater branching interval (Figure 13) than the EV-PB cells. BMP9 induction seemed to have a similar effect to the EGFL7 overexpression but BMP10 the opposite. Since the BMP9 treated samples are more similar to the EGFL7-PB untreated samples it is likely that BMP9 is actually inducing EGFL7 expression.

16000 14000 EV untreated 12000 EV untreated 10000 EV B9 8000 E7 B9 6000 EV B10 4000

Total Branching Total length E7 B10 2000 0

Figure 12 There was no difference in total branching length

180

160

140 EV untreated 120 E7 untreated 100 EV B9

80 E7 B9 EV B10

Branchinginterval 60 E7 B10 40

Figure 13 The branching interval was greater with EGFL7 overexpression and BMP9 treatment but BMP10 the opposite.

5 Discussion

Epidermal growth factor like domain 7 (EGFL7) has received a lot of attention as an important factor in the process of angiogenesis. The most prominent roles attributed to it are the regulation of the ECM through inhibition of the LOX enzymes and modulation of the Notch pathway through binding to the Notch receptor. The project was a part of a bigger study too see whether the expression of EGFL7 could be controlled during different stages of human embryonic stem cell differentiation into endothelial cells.

The aims of the project were to see whether the expression of EGFL7 in PiggyBac could be controlled using titrations of cumate and to investigate the effect of EGFL7 expression on angiogenesis. These aims relied on the succesful transfection of HUVECs using the PiggyBac vectors. This proved to be a difficult and time consuming process as primary cells are known to be difficult to transfect (Hunt, Currie, Robinson, & Dachs, 2010). After the transfected cells had been proven to overexpress EGFL7 upon cumate induction, the expression system could not be controlled. Neither in dose dependent manner of cumate nor turning off the EGFL7 expression after it had been induced. There are other options to express EGFL7 in a dose dependent manner such as Tet-ON systems where the induction is controlled using tetracycline or derivatives of it such as doxycycline. A possible future project could be to clone the EGFL7 construct to generate a tetracycline dependent expression system and test it in a similar manner.

After that the transfected cells were used to achieve the secondary aim of the study. EGFL7–PB HUVECs were induced with BMP9 and BMP10 to investigate the effect on the expression of several ECM factors and on angiogenesis. Attempts were made for antibody staining of factors such as the Notch intercellular domain, the factor released upon ligand binding to Notch receptors to investigate the activity of the Notch pathway during EGFL7 overexpression but neither immunofluorescence nor western blots showed any conclusive results. However unpublished research from the lab has shown that knockdown of EGFL7 caused upregulation of genes induced by the Notch pathway such as HES1 and HEY1. When induced with BMP9 a downregulation of these same factors was seen. These results indicate that BMP9 could be inducing the expression og EGFL7 (Richter et al., unpublished results)

The effect of EGFL7 overexpression and BMP9 induction on the expression of candiate genes was studied using PCR. Since EGFL7 is known to be a proangiogenic factor it was interesting to see which if any effects it had on the expression of certain ECM factors. Elastin is a key component of elastic fibers that give arteries the ablity to stretch but EGFL7 has been shown to inhibit the function of the LOX enzymes that are important for elastin crosslinking (Lelievre et al., 2008). This means that although elastin is important for arteries its function is downregulated during angiogenesis. The PCR results from this study showed that EGFL7 and BMP9 downregulate the expression of elastin. This correlates with the proangiogenic role of these factors.

VE-cadherin is one of the main components of the endothelial adherens junction and has a role in the barrier function of the endothelium. Several vascular disorders are caused by hyperpermeability due to distortion of the adherens junction often caused by defects in BMP signalling (Benn et al., 2016). VE-cadherin has also been shown to regulate BMP signaling by forming complexes with their receptors. No changes in the expression of VE-Cadherin were seen in cells overexpressing EGFL7 or when treated with BMP9.

The tube like formation analysis showed that EGFL7 expression and BMP9 or BMP10 induction did not affect the total branching length or number of nodes but seemed to increase the branching interval, meaning that the cells seemed to form fewer but longer total branches during angiogenesis.

When induced by BMP10 on the other hand, the cells seemed to have shorter branching intervals. BMP10 is known to be a ligand for the ALK1 receptor, like BMP9 although with weaker affinity. It is also mainly expressed in the embryo and has an important role in heart development.

Although the transfection proved difficult, the expression system works and can be used for further research. Much time was spent on the first step of the project (Figure 5) leaving less time than optimal for the second aim. These results are prelimanary and need to be repeated. The process of angiogenesis is important for development, wound healing and even cancer. EGFL7 is one of many important factors in angiogenesis but with a working expression system the molecular function of EGFL7 can be investigated and better understood which could aid in research in the treatment of vascular diseases and even for cancer (Johnson et al., 2013).

Bibliography

Alberts, B. (2015). Molecular biology of the cell (Sixth edition. ed.). New York, NY: Garland Science, Taylor and Francis Group. Angst, B. D., Marcozzi, C., & Magee, A. I. (2001). The cadherin superfamily: diversity in form and function. J Cell Sci, 114(Pt 4), 629-641. Benn, A., Bredow, C., Casanova, I., Vukicevic, S., & Knaus, P. (2016). VE-cadherin facilitates BMP-induced endothelial cell permeability and signaling. J Cell Sci, 129(1), 206-218. doi:10.1242/jcs.179960 Cai, J., Pardali, E., Sanchez-Duffhues, G., & ten Dijke, P. (2012). BMP signaling in vascular diseases. FEBS Lett, 586(14), 1993-2002. doi:10.1016/j.febslet.2012.04.030 DeCicco-Skinner, K. L., Henry, G. H., Cataisson, C., Tabib, T., Gwilliam, J. C., Watson, N. J., . . . Wiest, J. S. (2014). Endothelial cell tube formation assay for the in vitro study of angiogenesis. J Vis Exp(91), e51312. doi:10.3791/51312 Desgrosellier, J. S., & Cheresh, D. A. (2010). Integrins in cancer: biological implications and therapeutic opportunities. Nat Rev Cancer, 10(1), 9-22. doi:10.1038/nrc2748 Dimmeler, S. (2011). Cardiovascular disease review series. EMBO Mol Med, 3(12), 697. doi:10.1002/emmm.201100182 Horbelt, D., Denkis, A., & Knaus, P. (2012). A portrait of Transforming Growth Factor beta superfamily signalling: Background matters. Int J Biochem Cell Biol, 44(3), 469-474. doi:10.1016/j.biocel.2011.12.013 Hunt, M. A., Currie, M. J., Robinson, B. A., & Dachs, G. U. (2010). Optimizing transfection of primary human umbilical vein endothelial cells using commercially available chemical transfection reagents. J Biomol Tech, 21(2), 66-72. Johnson, L., Huseni, M., Smyczek, T., Lima, A., Yeung, S., Cheng, J. H., . . . Hegde, P. S. (2013). Anti-EGFL7 antibodies enhance stress-induced endothelial cell death and anti-VEGF efficacy. J Clin Invest, 123(9), 3997-4009. doi:10.1172/JCI67892 Lelievre, E., Hinek, A., Lupu, F., Buquet, C., Soncin, F., & Mattot, V. (2008). VE- statin/egfl7 regulates vascular elastogenesis by interacting with lysyl oxidases. EMBO J, 27(12), 1658-1670. doi:10.1038/emboj.2008.103 Lowery, J. W., & de Caestecker, M. P. (2010). BMP signaling in vascular development and disease. Cytokine Growth Factor Rev, 21(4), 287-298. doi:10.1016/j.cytogfr.2010.06.001 Massague, J. (2012). TGFbeta signalling in context. Nat Rev Mol Cell Biol, 13(10), 616-630. doi:10.1038/nrm3434 Massimiani, M., Vecchione, L., Piccirilli, D., Spitalieri, P., Amati, F., Salvi, S., . . . Campagnolo, L. (2015). Epidermal growth factor-like domain 7 promotes migration and invasion of human trophoblast cells through activation of MAPK, PI3K and NOTCH signaling pathways. Mol Hum Reprod, 21(5), 435-451. doi:10.1093/molehr/gav006 Nichol, D., & Stuhlmann, H. (2012). EGFL7: a unique angiogenic signaling factor in vascular development and disease. Blood, 119(6), 1345-1352. doi:10.1182/blood- 2011-10-322446 Nikolic, I., Plate, K. H., & Schmidt, M. H. (2010). EGFL7 meets miRNA-126: an angiogenesis alliance. J Angiogenes Res, 2(1), 9. doi:10.1186/2040-2384-2-9

Takuwa, Y., Du, W., Qi, X., Okamoto, Y., Takuwa, N., & Yoshioka, K. (2010). Roles of sphingosine-1-phosphate signaling in angiogenesis. World J Biol Chem, 1(10), 298- 306. doi:10.4331/wjbc.v1.i10.298