Antidesma Bunius L

Int.J.Curr.Microbiol.App.Sci (2017) 6(4): 253-264 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 4 (2017) pp. 253-264 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.604.029 Biochemical, Nutritional Profiling and Optimization of an Efficient Nucleic Acid Isolation Protocol from Recalcitrant Tissue of Wild Edible Fruit Antidesma bunius L. Spreng Sushma Khomdram1,2*, Shyamananda Arambam2, Sharmistha Barthakur2 and Guruaribam Shantibala Devi1 1Department of Life Sciences, Manipur University, Canchipur 795003, Manipur, India 2National Research Centre on Plant Biotechnology, Pusa Campus, New Delhi 110012, India *Corresponding author: ABSTRACT K e yw or ds Antidesma bunius known as ‘currant tree’ is a popular fruit in several Asian countries. Biochemical During our exploration of wild fruits of Manipur, India, we identified this edible fruit analysis, DNA, growing naturally in their wild habitat. An exhaustive biochemical analyses revealed very high concentration of mineral contents relative to other well known fruits. Correlation Antidesma bunius, Wild fruit . analysis showed significant relationship between ascorbic acid content and antioxidant oxidant activity. A protocol for isolation of high quality DNA from mature leaves of the Article Info fruit tree which is very rich in polyphenols and secondary metabolites was also Accepted: standardized for the very first time with high purity and quality genomic DNA amenable to 02 March 2017 downstream initiation of any molecular work in this species. Our results bring further Available Online: potential and necessity of popularizing this fruit amongst general consumers. 10 April 2017 Introduction Wild fruit plant Antidesma bunius of are about 100 species and the highest number phyllanthaceae family is naturally distributed is in South-East Asia, of which 18 species are throughout Southeast Asia. The fruit is called native to Thailand (Hoffmann, 1999). bignay in Philippines, berunai in Malaya, hooni in Indonesia, mao luang in Thailand, Combating malnutrition and hidden hunger is kho lien tu in Laos, choi moi in Vietnam, moi- a growing issue in today’s contemporary kin and chunka by the Queensland (Australia). world. Fruits and vegetable are excellent In English the fruit tree is known as -Chinese source of vitamins and mineral nutrition. To laurel, currant tree, nigger's cord, and tackle malnutrition among infants, children’s salamander tree. The fruit is native and as well as adults one approach is making common in wild form in the lower Himalayas locally available affordable sources of in India, Southeast Asia, northern Australia, vitamins and mineral popular and familiar Sri Lanka, Burma, Indo-China, China, among the consumers. The fruits and leaves Thailand, and Indonesia. It thrives in Java of Antidesma bunius are consumed as dietary from sea-level 0 to 4,000 ft (1,200 m). There supplement in certain countries viz. Malaysia, 253 Int.J.Curr.Microbiol.App.Sci (2017) 6(4): 253-264 Indonesia, Philippines and Thailand. The procedure for the isolation of DNA should fruits can be made into jam or jelly, or yield adequate and intact DNA of reasonable fermented into wine with good physiological purity (Puchooa, 2004). The degree of purity properties (Ma et al., 2013). The leaves are and quantity varies between applications. eaten as vegetable and used as a traditional Polysaccharides and polyphenols are the medicine for the treatment of skin disorder, major components that hinder DNA syphilis and snakebites (Sosef and extraction processes. They are not completely Prawirohatmodjo, 1998; Antony et al., 2010; removed during classical extraction protocols Hazarika et al., 2012). The leaves and barks and remain as contaminants in the final DNA of this fruits contain anti-toxins which are preparations thereby causing non- amplifiable used in tribal areas as human herbal DNA in PCR reactions by inhibiting Taq medication and also as traditional remedies activity and also interfere with restriction for animals like sheep and goats in West Java digestion (Porebski et al., 1997). Although (Tri, 1991; Jethro et al., 2011). The fruits tree various methods for DNA isolation from plant was also used in treatment of different having high levels of secondary metabolites illnesses from colds to cancer (Magsino, have been reported; we were not successful 2003). The fruits are considered a rich source with these protocols. We have developed the of phenolics, organic acids, anthocyanins and present method by introducing several other flavonoids (Samappito and Butkhup, modifications in the CTAB method which 2008b). The isolation of biflavone elucidated good quality DNA. amentoflavone and the C glycoside viccinin II of phenolic compounds was listed for the first Manipur state of India is one of the mega time from Antidesma bunius species (Mona et biodiversity hot-spots regions of the world al., 2013). Contain of a possible substances (Myer et al., 2000). The state is endowed with having cytotoxic activity from the fruits and various wild fruit species distributed leaves of currant trees was also reported (Jose naturally. Antidesma bunius known locally as et al., 2005). Studies on plants species of this heiyen are grown in wild environment in the fruits collected from Vietnam showing Manipur valley with elevation of 750 to cytotoxicity against the HT-29 human colon 900mMSL during the rainy season from July cancer line and against MCF-7 human breast to October. The fruit has single flat seed and cancer cell lines were also reported (Li et al., is sour in taste when ripe. Except for a few 2011, Anas et al., 2012). Genetic divergence reports in recent times there has been no taste responsiveness for phenylthiocarbamide systematic exploration of these fruit (Sushma was confirmed in this fruit tree (Henkin and and Shantibila, 2010; Haripyaree et al., 2010). Gillis, 1997). Some of the constituents from Comprehensive bio chemical evaluation of this berry plant have been patented by Avon Antidesma bunius and standardization of for skin care products that stimulate genomic DNA isolation is perhaps the first production of micro fibril-associated report from this region. This will be a prelude glycoprotein 1(Edward, 2012). Recent study to further molecular and various phytonutrient indicates that Antidesma bunius fruit extract explorations of wild edible Antidesma bunius can serve as a novel alternative source of organic pesticide effective against the Materials and Methods ladybird pest (Rosario et al., 2014). The wild fruit sample and leaves of For molecular profiling of any organism, Antidesma bunius were collected from the isolation of pure, intact and high quality DNA valley region of Manipur and identified at is the first crucial steps. A good extraction Botanical Survey of India (BSI), Eastern 254 Int.J.Curr.Microbiol.App.Sci (2017) 6(4): 253-264 Regional Central, Woodlands, Laitumkhrah, ammonium bromide) extraction method Shillong, Meghalaya, India. (Murray and Thompson, 1980). In brief, 2g of leaf tissue was ground in liquid nitrogen into Biochemical estimations powder form. Freshly prepared 2% extraction buffer (1M Tris-HCL; pH 8.0, 5M NaCL, The proximate biochemical analyses were 0.25 M EDTA; pH 8.0, 2% CTAB) carried out using standard protocols for containing 8% β-mercaptoethanol and 3% estimation of total soluble protein using BSA PVP was added. as standard (Lower et al., 1951) total soluble sugar by anthrone reagent and reducing and The suspension was incubated at 650C for1 h non-reducing sugar (Dudois et al., 1951, with intermittent mixing. A 6 layers muslin Nelson, 1944, Malhotra and Sarkar, 1979). cloth was used for filtration of the extract. The moisture content of the fruit was Then equal volume of chloroform: determined by AOAC (1970)method and isoamylalcohol (24:1) was added and mixed ascorbic acid protocol using 4% oxalic acid as and centrifuged at 14000rpm at 20 0C for 10 extraction medium and 2, 6- dichlorophenol min. To the aqueous phase 1 /10th 3M indophenol dye chemical assay (Thimmaiah, NaOAc was added along with 2 volume of ice 1999). cold ethanol and incubated at -20°C O/N. DNA from aqueous layer was precipitated by Antioxidant activity (AOA) was carried out adding 10 ml chilled 95% ethanol. The by DPPH assay (Krings and Berger, 2001). mixture was centrifuged at 14000rpm at 20oC For correlation analysis between Ascorbic for 10 min to collect the DNA pellet. The acid content (AAC) and antioxidant activity pellet was washed with 70% ethanol and (AOA) of the fruit samples, Pearson centrifuged at 14000 rpm at 20oC for 10 min. Correlation Coefficient was used. Elemental After drying the pellet at 37°C it was Mg, Fe, Mn, Cu, Zn, Co were analysed by dissolved in 50 µl Tris-Cl-EDTA (pH 8.0) using Atomic absorption spectrophotometer buffer and checked in 0.8% agrose gel. (AAS) and K by flame photometry. The determination of pH was calibrated with pH PCR amplification of DNA with meter using standard buffer solution after housekeeping Actin gene primers from rice fruits were finely minced. For each point of was carried out in a final 50ul volume of estimation, three biological samples with reaction mixture. Each reaction contained three replicates were used. 50ng DNA, 1ul of taq DNA polymerase, 10mM dNTP mix, 1X Taq DNA polymerase Standardization of DNA isolation, buffer and 10pmol each forward restriction and PCR analysis 5’AGCGAGTCTTCATAGGGCGATTGT 3’ and reverse primer 5’ TAGCTCTGGGTTC Chemicals for molecular biology work were GAGTGGCATTT 3’. The reaction conditions obtained from Sigma (USA) and Bio Basic were 950C-3 min; 35 cycles at 940C-50sec, (Canada), restriction enzymes, Taq DNA 68°C-50 sec, and 720C-2 min; and a final Polymerases; DNA Ladders were obtained extension at 720C for 10min. PCR products from New England Bio Lab (USA), RNaseA were subjected to 1.2% agarose gel from Invitrogen (USA). electrophoresis in 0.5XTBE buffer, stained with ethidium bromide and photographed in a DNA was isolated from fresh matured leaf gel documentation system (Alpha imager).

Load more