Diabetes Page 2 of 75
Manipulation of dietary amino acids prevents and reverses obesity in mice through multiple mechanisms that modulate
energy homeostasis
Chiara Ruocco,1 Maurizio Ragni,1 Fabio Rossi,1 Pierluigi Carullo,2 Veronica Ghini,3 Fabiana
Piscitelli,4 Adele Cutignano,4 Emiliano Manzo,4 Rafael Maciel Ioris,5,6 Franck Bontems,5,6 Laura
Tedesco,1 Carolina Greco,2 Annachiara Pino,7 Ilenia Severi,8 Dianxin Liu,9 Ryan P. Ceddia,9
Luisa Ponzoni,1,10 Leonardo Tenori,11,12 Lisa Rizzetto,13 Matthias Scholz,13 Kieran Tuohy,13
Francesco Bifari,1,14 Vincenzo Di Marzo,4 Claudio Luchinat,3,15 Michele O. Carruba,1 Saverio
Cinti,8 Ilaria Decimo,7 Gianluigi Condorelli,2 Roberto Coppari,5,6 Sheila Collins,9 Alessandra
Valerio,16 and Enzo Nisoli1
1Center for Study and Research on Obesity, Department of Biomedical Technology and
Translational Medicine, University of Milan, Milan, Italy; 2Humanitas University, Rozzano,
Italy; 3Interuniversity Consortium for Magnetic Resonance, Sesto Fiorentino, Italy; 4Institute of
Biomolecular Chemistry, Consiglio Nazionale delle Ricerche, Pozzuoli, Italy; 5Department of
Cell Physiology and Metabolism, University of Geneva, Geneva, Switzerland; 6Diabetes Center
of the Faculty of Medicine, University of Geneva, Geneva, Switzerland; 7Department of
Diagnostics and Public Health, University of Verona, Verona, Italy; 8Department of
Experimental and Clinical Medicine, University of Ancona (Politecnica delle Marche), Ancona,
Italy; 9Division of Cardiovascular Medicine, Department of Medicine, Vanderbilt University
Medical Center, Nashville, Tennessee, USA; 10Umberto Veronesi Foundation, Milan, Italy;
11FiorGen Foundation, Sesto Fiorentino, Italy; 12Center of Magnetic Resonance, University of
Diabetes Publish Ahead of Print, published online August 19, 2020 Page 3 of 75 Diabetes
Florence, Sesto Fiorentino, Italy; 13Department of Food Quality and Nutrition, Research and
Innovation Center, Fondazione Edmund Mach, San Michele all'Adige, Italy; 14Laboratory of Cell
Metabolism and Regenerative Medicine, Department of Medical Biotechnology and
Translational Medicine, University of Milan, Milan, Italy; 15Department of Experimental and
Clinical Medicine, University of Florence, Florence, Italy; 16Department of Molecular and
Translational Medicine, Brescia University, Brescia, Italy
Corresponding author:
Enzo Nisoli
Department of Biomedical Technology and Translational Medicine
University of Milan, Milan – 20129 (Italy)
Telephone number: +30 02 50316956; Email: [email protected]
C.R. and M.R. contributed equally to this work.
Short title: Dietary amino acids and energy metabolism
The manuscript contains: 6,689 words, 8 figures, 13 supplementary figures, and 10
supplementary tables.
Tweet:
A designer protein-deprived diet enriched in essential amino acids promotes brown fat
thermogenesis, stimulates uncoupling protein 1-independent respiration in white fat, changes the
gut microbiota composition and prevents and reverses obesity, extending healthspan.
Figure 3A best summarizes our article
2 Diabetes Page 4 of 75
Reduced activation of energy metabolism increases adiposity in humans and other mammals. Thus, exploring dietary and molecular mechanisms able to improve energy metabolism is of paramount medical importance, as such mechanisms can be leveraged as a therapy for obesity and related disorders. Here, we show that a designer protein-deprived diet enriched in free essential amino acids can i) promote the brown fat thermogenic program and fatty acid oxidation, ii) stimulate uncoupling protein 1 (UCP1)- independent respiration in subcutaneous white fat, iii) change the gut microbiota composition, and iv) prevent and reverse obesity and dysregulated glucose homeostasis in multiple mouse models, prolonging the healthy lifespan. These effects are independent of unbalanced amino acid ratio, energy consumption, and intestinal calorie absorption. A brown fat-specific activation of the mechanistic target of rapamycin complex 1 seems involved in the diet-induced beneficial effects, as also strengthened by in vitro experiments.
Hence, our results suggest that brown and white fat may be targets of specific amino acids to control UCP1-dependent and -independent thermogenesis, thereby contributing to the improvement of metabolic health.
3 Page 5 of 75 Diabetes
Although debatable, chronic consumption of diets with a high ratio of saturated to unsaturated
fatty acids (SFA diets) increases body adiposity, impairs glucose homeostasis, raises the
cardiovascular risk, and reduces the healthy disease-free lifespan in animals and humans (1,2).
These diets negatively affect the proper secretion and action of key hormones—insulin, leptin, and
adiponectin—underlying metabolic homeostasis and energy balance (3). The increased
consumption of high-calorie, low-fiber diets has contributed significantly to the staggering rise in
overweight, obesity, and type 2 diabetes prevalence in the past few decades (4). Likewise, high-
protein diets have been advocated since the 1960s as a means of weight loss and to prevent obesity
and its metabolic sequelae (5). However, the long-term safety of such diets has been recently
questioned by increasing evidence of raised cardiovascular risk (6). Accordingly, great excitement
was built by the demonstration that protein-restricted diets (7), or diets with lower concentrations
of single or multiple essential amino acid (e.g., leucine, methionine, or tryptophan; EAAs), were
correlated to improved energy balance and decreased overweight or obesity, in mice and humans
(8,9). In contrast, several studies have also shown the efficacy of central or peripheral
supplementation of a single amino acid (e.g., glycine, leucine, or tryptophan) in modulating energy
metabolism and/or body weight (10,11). However, not all of these findings were confirmed by
others (12).
To investigate these conflicting results, we conducted in-depth analyses on metabolic
effects, in normal-weight and obese mice, caused by acute and chronic consumption of two
customized diets. Specifically, the protein content (i.e., casein) of the SFA diet (10 % fat) and
high-fat diet (HFD, 60 % fat) was substituted with an original formula composed by EAAs (SFA-
EAA and HFD-EAA) (for nutrient compositions see below). The EAA mixture was
stoichiometrically similar to the formula we previously showed to promote mitochondrial
biogenesis in skeletal and cardiac muscles of middle-aged mice and to ameliorate health, especially
4 Diabetes Page 6 of 75
in older adults, when consumed as a dietary supplement with drinking water (13,14). The metabolic effects of SFA-EAA and HFD-EAA diets were compared to those owed to two isocaloric, isolipidic, and isonitrogenous diets, identical to SFA or HFD diet except for casein replacement by the purified amino acid mixture designed on the amino acid profile of casein (SFA-
CAA and HFD-CAA diets), in addition to those induced by a chow diet. In particular, drinking supplementation of the EAA mixture was found to prevent oxidative stress in metabolically active cells (14–16), ameliorating muscle and cognitive performance in diverse animal models and humans (17,18). Moreover, a relevant rejuvenation was observed in the gut microbiota of ageing mice supplemented with the EAA mixture (19). This observation seems to be of relevance because diet composition may affect energy balance also through intestinal microbiota. For example, dietary amino acid intake increases the relative abundance of Bacteroidetes (20), and EAA-derived short-chain fatty acids modulate the overall lipid balance and glucose metabolism (21). Also, the gut microbiota controls adiposity (22) and can activate adaptive thermogenesis in mice (23).
Adaptive thermogenesis refers to the generation of heat by the body in response to external stimuli (e.g., cold temperature, ingestion of high-calorie foods). It includes shivering and non- shivering thermogenesis (NST) The activation of brown adipocytes, in brown adipose tissue
(BAT), and beige adipocytes, in visceral and subcutaneous fat depots, contributes substantially to
NST (24). These thermogenic adipocytes express uncoupling protein 1 (UCP1), a protein that uncouples respiration and leads to energy dissipation in the form of heat. Ablation of brown or beige adipocytes predisposes mice to develop obesity and type 2 diabetes (25,26), as does deletion of the Ucp1 gene (27). Conversely, increasing the number or activity of thermogenic adipocytes protects against body weight gain and metabolic disease (28). Mechanistic target of rapamycin complex 1 (mTORC1) activation is required for BAT recruitment and metabolic adaptation to cold
(29,30). Additional mechanisms activate thermogenesis in an UCP1-independent manner: the
5 Page 7 of 75 Diabetes
glycerol phosphate shuttle, calcium-dependent ATP hydrolysis, and creatine-dependent substrate
cycling (31–33). Also, N-acyl amino acids stimulate uncoupled mitochondrial respiration in white
adipocytes, independently of UCP1, and their systemic administration activates the whole-body
energy expenditure (34).
Here we show that almost complete substitution of the casein in standard rodent diets with
a unique amino acid mixture modulated energy homeostasis in diet-induced obesity or a model of
genetic obesity. Our results reveal multiple thermogenic mechanisms by which designer diets
could be used to combat obesity and type 2 diabetes.
6 Diabetes Page 8 of 75
RESEARCH DESIGN AND METHODS
Animals, diets, and treatments
Male C57BL/6N mice (8 weeks old), from Charles River (Calco, Italy), were weight-matched and fed ad libitum for different periods of time with normal chow diet (CD: V1534-300, Ssniff
Spezialdiäten GmbH, Soest, Germany), SFA diet (20 % protein namely casein , 70 % carbohydrate, and 10 % fat, half of which was lard (D12450H), HFD diet [20 % protein, 10 % carbohydrate, and 60 % fat (D12492)], or two isocaloric, isolipidic, and isonitrogenous diets, identical to SFA or HFD diet except for protein which was almost completely (93.5 %) replaced by defined free EAAs (SFA-EAA, D14032501 or HFD-EAA, D17073104) or a purified amino acid mixture designed on the amino acid profile of casein (SFA-CAA diet, A17092801, or HFD-
CAA, A20040601) all from Research Diets Inc. (Brogaarden, Gentofte, Denmark) (Supplementary
Table 1).
Body weight and food intake were recorded twice a week in mice housed individually
(except for the survival study); A cohort of C57BL6/N (8 weeks old) and ob/ob (6 weeks old,
C57BL/6J background) male mice were kept and examined at thermoneutrality (30 °C) for the entire treatment period. For norepinephrine (NE) turnover analysis mice fed for 6 weeks with SFA-
CAA and SFA-EAA diets were i.p. treated with -methyl-para-tyrosine (AMPT, Sigma Aldrich) at time 0 (300 mg/kg BW) and after 2 h (150 mg/kg BW). Mice were sacrificed after 4 h and NE content was determined on iBAT with the Noradrenaline High Sensitive ELISA kit (Diagnostika
GMBH, Hamburg, Germany), following manufacturer’s instructions. For selective inhibition of mTORC1, mice were i.p. injected with rapamycin (Rapa, 2.5 mg/kg body weight) or vehicle (Veh,
0.2 % carboxymethylcellulose, 0.25 % Tween 80 in sterile water) (all from Sigma Aldrich), 5 days per week for 6 weeks, starting with diets. All mice used have a C57BL/6N background, that does
7 Page 9 of 75 Diabetes
not exhibit defects of insulin release and mitochondrial dysfunction relative to C57BL/6J mice
(35). Body composition were determined using the EchoMRI-100 system (Houston, TX, USA) ,
as previously described (36). Tissue samples for molecular analysis were snap-frozen in liquid
nitrogen and prepared as described below.. All animal procedures were conducted in accordance
with the European Community Guidelines and those of the Italian Ministry of Health, complied
with the National Animal Protection Guidelines.
Caloric absorption and gut motility
At the end of treatments, feces were collected from each mouse, and energy content was measured
by calorimetric bomb analysis (LECO AC-350, Milan, Italy). To monitor gut motility, whole gut
transit time was measured as described (37). As parameters of absorbent capacity and epithelial
morphology, the villi length of jejunum from frozen sections of intestine was determined by the
Nikon Lucia IMAGE (v. 4.61) image analysis software (37).
Glucose homeostasis and biochemical analysis
Glucose (GTT) and pyruvate (PTT) tolerance test were performed after overnight fasting by i.p.
injection of glucose or pyruvic acid (each 1.5 g/kg body weight) (Sigma Aldrich). Insulin tolerance
test (ITT) was performed after 4 h daytime fast, with 0.5 U/kg body weight insulin i.p. injection
(Sigma Aldrich). Glucose levels were measured in tail-vein blood using a Glucometer MyStar
Extra (Sanofi, Milan, Italy) and test strips, at different time points after bolus. Plasma biochemistry
and thyroxine levels were provided by Charles River Laboratories Service (Charles River Clinical
Pathology/Immunology Laboratories, Wilmington, MA, USA). Metabolites and hormones were
measured by commercial kits (Supplementary Table 2). Mean lipid droplet density and area in
8 Diabetes Page 10 of 75
iBAT were measured by the Nikon Lucia IMAGE (v. 4.61) image analysis software and calculated in 25 brown adipocytes for each sample.
Behavioral tests
The social dominance tube test and the elevated plus-maze test were carried out with mice fed with
SFA, SFA-CAA, and SFA-EAA diet for 20 months, as described (38). Spontaneous motor activity was evaluated using an activity cage (Ugo Basile, Varese, Italy) placed in a sound-attenuating room, while an object recognition test was conducted in an open plastic arena.
Indirect calorimetry, locomotor activity, and temperature measurements
Metabolic efficiency was calculated as the ratio between body weight gain and the total energy intake over five days, 2 or 6 weeks. For in vivo indirect calorimetry analysis, mice were transferred in a Phenomaster System (TSE Systems GmbH, Bad Homburg, Germany) 1 week before the study started for acclimatization, followed by three weeks of continued measurements, as previously described (36). Core body temperature was obtained with a rectal probe (Physitemp Instruments
Inc., Clifton, NJ, USA). Shaved back temperature was measured to estimate the level of iBAT thermogenesis, by infrared thermography, with a thermo-electrically cooled Thermocam P25 (Flir
Systems Inc., Wilsonville, OR, USA) (37). In vivo images were captured and analyzed using the
Flir quick report software according to the manufacturer’s specifications.
Mass spectrometry analysis
Plasma samples and iBAT were extracted from mice after night-feeding, and their amino acid content was quantitated using the ACCQ·Tag derivatization reagent provided by Waters
Chromatography Europe BV (Etten-Leur, The Netherlands). All amino acids were acquired in
9 Page 11 of 75 Diabetes
positive polarity, in both TOF MS and Product Ion mode, according to the m/z values reported in
Supplementary Table 3.
Fecal microbiota analysis
Fresh feces were collected, immediately frozen and stored. After extraction of total DNA
(FastDNA™ SPIN Kit for Feces, MP Biomedicals, USA), 16S rRNA sequencing analysis was
performed. Alpha and beta-diversity were determined using Quantitative Insight into Microbial
Ecology (QIIME). Data are accessible at the European Nucleotide Archive with the accession
number PRJEB25686.
Primary brown adipocytes
Mouse brown fat precursor cells were enzymatically isolated from iBAT of C57BL/6N male mice
and differentiated in culture for nine days as previously described (39). Primary brown adipocytes
maintained in amino-acid free DMEM (US Biological Life Science, DBA, Milan, Italy) for 16 h,
were pretreated with rapamycin (1.0 nM) or vehicle (DMSO, Sigma Aldrich) for 1 h and
subsequently supplemented for further 24 h with one of two different amino acid combinations,
precisely reproducing the iBAT aminograms resulting from consumption of SFA-CAA or SFA-
EAA diet (Supplementary Table 4). Cellular oxygen consumption rates (OCRs) were determined
using a Seahorse XF24 Extracellular Flux Analyzer (Agilent, Santa Clara, CA, USA). Before
analysis, the culture medium was changed to respiration medium. After basal respiration,
uncoupled and maximal respiration was determined following the addition of oligomycin (1 μM)
and subsequently carbonyl cyanide-4-trifluoromethoxy phenylhydrazone (FCCP, 0.2 μM).
Rotenone (3 μM) was used to abolish mitochondrial respiration. All reagents were purchased from
Sigma-Aldrich.
10 Diabetes Page 12 of 75
Gene expression and mitochondrial physiology
Quantitative RT-PCR reactions were performed as described (32) and run with the iQSybrGreenI
SuperMix (Bio-Rad; Segrate, Italy) on an iCycler iQ Real-Time PCR detection system (Bio-Rad). mtDNA was amplified using primers specific for the mitochondrial cytochrome b gene and normalized to genomic DNA (gDNA). Primers were designed using Primer3 (version 0.4.0) software and are shown in Supplementary Table 5. Immunoblot analysis was performed as described (32). The antibodies (each at 1:1,000 dilution) are reported in Supplementary Table 2.
Citrate synthase activity was measured spectrophotometrically in gastrocnemius as described (32).
Carnitine palmitoyltransferase I (CPT1) activity was measured spectrophotometrically in iBAT mitochondria, as previously described (40). Electron microscopy analysis was conducted in thin sections of iBAT stained with lead citrate and examined with a CM10 transmission electron microscope (Philips, Eindhoven, Netherlands). Mitochondrial OCR was measured in a gas-tight vessel equipped with a Clark-type oxygen electrode (Rank Brothers Ltd., Cambridge, UK).
Briefly, mitochondria from iWAT and iBAT were isolated, and respiration was measured as described (34). Liver and gastrocnemius mitochondria respiration was assessed in 137 mM KCl,
10 mM HEPES pH 7.2, 2.5 mM MgCl2, 0.1% BSA, and 2 mM K2HPO4. iBAT OCR was measured by sequential addition of 2.5 mM malate, 30 μM palmitoyl-CoA plus 5 mM carnitine, 2 mM GDP,
100 M ADP, 0.01 mg/mL oligomycin, and FCCP (500 nM), all from Sigma Aldrich. UCP1- dependent respiration was calculated as the amount of ADP-independent respiration that was inhibited by GDP, as described (24). For iWAT, liver, and gastrocnemius the same substrates, except GDP, were used.
11 Page 13 of 75 Diabetes
N-acyl amino acid and acylcarnitine measurements by LC-HRMS
N-acyl amino acids were synthesized and measured, as previously described (34). Targeted
quantitative analysis was carried out on extracted ion chromatograms corresponding to the
molecular ion m/z values [M-H]- for N-acyl amino acid and [M+H]+ for long-chain acylcarnitines
(LCACs). Quantitation of N-acyl amino acid and LCACs was performed by integrating the area
under the peak of each natural compound and normalizing to the corresponding internal standard
area value.
Statistical analyses
Statistical analysis was performed by unpaired Student’s t-test for two-group analysis or one-way
ANOVA with Tukey correction or two-way ANOVA with Bonferroni correction for multiple
group comparisons. Kaplan–Meier survival curves were created with the log-rank test equal to the
Mantel–Haenszel test. A P value < 0.05 was considered statistically significant. Correlations were
determined by nonparametric Spearman correlation test using the computer program GraphPad
Prism (version 6.04).
Data and Resource Availability
The data sets generated and analyzed during the current study are available from the corresponding
author upon reasonable request.
12 Diabetes Page 14 of 75
RESULTS
Effects on body weight, body composition, and adipose tissue
The subacute (6-week) and chronic (80-week) consumption of SFA diet increased body weight and adiposity independently of body length and lean mass, with higher circulating leptin levels compared to mice fed a chow diet (Fig. 1A-D and Supplementary Fig. 1A). Feeding mice with
SFA-EAA diet prevented obesity development, maintaining lower fat mass and circulating leptin levels, without affecting lean mass or the normal growth of mice (Fig. 1A-D and Supplementary
Fig. 1A and B). Notably, after 44 weeks mice fed with SFA-EAA diet weighed less than mice fed with a chow diet, with reduced body weight and adiposity until sacrifice (Fig. 1A and C). In addition to this preventive anti-obesity action, our designer diet exerted a potent therapeutic effect in which mouse body weight dropped after the switch from the SFA diet to the SFA-EAA diet
(Fig. 1A). Body weight of the SFA-fed mice that were switched to the SFA-EAA diet indeed decreased to the level of chow-fed mice in ~2.5 months (Fig. 1A). Notably, the specific EAA substitution for casein entirely prevented the body weight gain, fat mass accumulation, and adiposity also induced by HFD consumption (Supplementary Fig. 2A-C). Similarly, the HFD-EAA diet strongly reduced body weight in already obese mice (Supplementary Fig. 2A, left). By contrast, both CAA-substituted diets were unable to prevent the obesity development or reduce body weight in already obese animals (Fig. 1A-D, Supplementary Fig. 2A-C).
The experiments mentioned above were conducted at room temperature (i.e., at ~ 22 °C), a condition known to cause an increase of food intake and metabolism in small rodents to maintain body temperature (41). Thus, to determine the contribution of environmental thermal stress, we tested the metabolic effect of our engineered diets in C57BL6/N and leptin-deficient ob/ob mice
13 Page 15 of 75 Diabetes
at thermoneutrality (41). Our additional experiments confirmed the heathy effects of SFA-EAA
diet under this condition (Supplementary Fig. 2D).
Effects on glucose homeostasis and adipokines
Mice fed with the SFA-EAA diet for either six weeks or 11 months at room temperature had
improved glucose and pyruvate tolerance and insulin-induced glycemia-lowering response
compared to those of mice fed with either the SFA or SFA-CAA diets (Fig. 1F and Supplementary
Fig. 1C-G). Fasting blood glucose and insulin concentrations did not differ among mice fed with
different diets (Supplementary Table 6). These phenotypes were also observed when the SFA-
EAA diet was consumed at 30 °C in C57BL6/N (Fig. 1G) and ob/ob mice (Supplementary Fig.
2E), and in HFD-EAA-fed mice at room temperature (Supplementary Fig. 2F and G). These results
were confirmed by the circulating levels of adiponectin (89 ± 15 % higher, P < 0.05) in mice fed
with the SFA-EAA diet compared to mice fed with the SFA-CAA diet (Fig. 1H). Accordingly to
its inverse association to adiponectin in type 2 diabetes (42), insulin-like growth factor 1 (IGF1)
was reduced in plasma of SFA-EAA-fed mice as compared to SFA-CAA-fed animals (Fig. 1I).
Effects on the whole body and hepatic lipid metabolism
Management of dyslipidemia is a crucial approach to reduce cardiovascular risk in obese and
diabetic patients. Plasma nonesterified fatty acid (NEFA) levels, higher after consumption of the
obesogenic diets (SFA and HFD), were reduced in both SFA-EAA- and HFD-EAA-fed mice, to
values observed in mice on chow diet (Supplementary Fig. 3A). Total cholesterol plasma levels
were increased in HFD-treated mice, whereas circulating triglycerides were similar between
groups (Supplementary Fig. 3B and C). Unlike HFD-CAA, the HFD-EAA diet statistically
prevented cholesterol increase induced by HFD (Supplementary Fig. 3B). These systemic effects
14 Diabetes Page 16 of 75
were mirrored by the ability of both SFA-EAA and HFD-EAA diet to prevent the increased NEFA,
triglyceride and cholesterol levels of the liver in SFA- and HFD-fed mice (Supplementary Fig. 3D-
F). Accordingly, macroscopic liver appearance and liver weight confirmed these results
(Supplementary Fig. 3G and H). Mitochondrial respiration with palmitoyl carnitine as substrate
suggested that EAA substitution promoted fat oxidation in the liver of both SFA- and HFD-fed
mice (Supplementary Fig. 3I). Both CAA-substituted diets were ineffective.
Plasma amino acids
Next, we evaluated the effects of diets on amino acids in plasma. Alanine, glutamine, lysine, and
threonine were higher with both EAA- and CAA-substituted diets than with SFA diet, though
threonine was much more increased in SFA-EAA- than SFA-CAA-fed mice (Supplementary Fig.
4). In addition to threonine, the SFA-EAA diet increased histidine and valine levels over both SFA
and SFA-CAA diet (Supplementary Fig. 4). Glycine and serine levels, which were markedly
augmented in the SFA-CAA mice, with the SFA-EAA diet were similar to those observed in the
SFA-fed mice (Supplementary Fig. 4). Notably, the levels of valine, histidine, and threonine were
inversely correlated to the body weight and adiposity, isoleucine was inversely correlated to the
body weight but not adiposity, while leucine was correlated with neither (Supplementary Table
7). Moreover, tyrosine was positively correlated to fat accumulation, while an inverse correlation
was observed between plasma levels of histidine and the liver weight and liver mitochondrial
respiration (Supplementary Table 7). Of note, under our experimental conditions, no statistical
correlation was observed with insulin sensitivity. SFA-EAA consumption did not affect liver and
kidney function parameters (Supplementary Table 6).
15 Page 17 of 75 Diabetes
SFA-EAA diet extends healthy lifespan
Next, we investigated the effects of SFA-EAA diet on mouse life span. The median lifespan for
chow diet-fed mice was 800 days; it was extended from 650 days for SFA mice and 680 days for
SFA-CAA mice to 797 days for SFA-EAA mice (+ 23 % versus SFA and +17 % versus SFA-
CAA) (Fig. 1J). Maximal lifespan was 899 days for chow, 800 days for SFA, 806 days for SFA-
CAA, and 863 days for SFA-EAA mice. While mice fed with the SFA and SFA-CAA diet
exhibited submissive/lethargic behavior after 20 months, mice fed with the SFA-EAA diet
preserved energetic behavior; this was demonstrated by a test for social dominance, with a positive
trend toward less fearful behavior, measured in the elevated plus-maze, and in spontaneous motor
activity (Supplementary Fig. 5A-C). There was no apparent difference in novel object recognition
memory test among dietary groups (Supplementary Fig. 5 D).
Effects on food intake and energy absorption
We then assessed energy input and output. As our mice drank only water and thus did not consume
any calories through drinking, energy input was measured as food intake and energy absorption.
During the first 2 or 5 days of the dietary challenge, mice fed with the EAA-substituted diets
decreased their food intake compared to the respective controls; nevertheless, these differences
vanished at later time points (Fig. 2A and Supplementary Fig. 6A-C ). Similarly, the SFA-CAA-
and HFD-CAA-fed mice decreased their food intake during the first days (Fig. 2A and
Supplementary Fig. 6A). As these mice gained a comparable amount of body weight as SFA- and
HFD-fed mice (Fig. 1B and Supplementary Fig. 3A), SFA-CAA- and HFD-CAA-fed mice served
as pair-fed control to SFA-EAA- or HFD-EAA-fed mice, respectively; henceforward, the SFA-
CAA and HFD-CAA diets were considered the proper control diets.
16 Diabetes Page 18 of 75
Given changes in the ratio of EAAs and nonessential amino acids (NEAAs) in both SFA-
EAA and HFD-EAA versus casein- or CAA-containing diets, we investigated whether some of
the results obtained with the SFA-EAA and HFD-EAA diets are mediated by the detection of a
perturbed amino acid balance by liver or brain. We studied the activity of the critical regulator of
cellular responses under amino acid deficiency sensor, the kinase general control nonderepressible
2 kinase (GCN2). When activated by accumulation of uncharged tRNAs, GCN2 phosphorylates
the subunit of eukaryotic translation initiation factor 2 (eIF2), inhibiting general protein
synthesis and mitigating the cellular stress (43). We found that the SFA-EAA diet did not change
the Ser51-phosphorylation of eIF2 in both hypothalamus and liver when compared to SFA and
SFA-CAA diets (Supplementary Fig. 6D), suggesting that the effects of EAA-substituted diets
are unlikely caused by detection of a dietary amino acid unbalance.
Next, we assessed the gut size and absorptive capacity of the different dietary regimens.
Both SFA-EAA- and SFA-CAA-fed mice had increased transit time and jejunum villi length
compared to SFA-fed animals (Fig. 2B and C); their percentage of food mass excretion was lower compared to SFA-fed mice, with only a trend to decreased amount of feces excretion (Fig. 2D),
suggesting that both substituted diets may cause malabsorption, albeit they affect differently body
weight. Thus, we investigated whether the SFA-EAA and SFA-CAA exposure led to changes in
calorie uptake, by measuring the fecal caloric content with bomb calorimetry. This analysis
revealed a comparable energy content in the fecal material of mice fed with SFA-EAA or SFA-
CAA diet (Fig. 2E), resulting in similar daily energy excretion in both groups, as compared with
SFA-fed mice (Fig. 2F), also when expressed as a percentage of the food intake. These data
indicate that food malabsorption is unlikely to be the underlying cause of the SFA-EAA diet’s
anti-obesity action.
17 Page 19 of 75 Diabetes
Effects on energy expenditure and physical activity
Next, we sought to understand whether energy expenditure was responsible for the observed
phenotypes in mice fed with the different diets. The metabolic efficiency decreased in the SFA-
EAA- and HFD-EAA-fed mice compared to SFA-CAA- and HFD-CAA-fed animals, respectively,
starting at day 5 of treatment (Fig. 3A and Supplementary Fig. 7A), suggesting that the EAA-
designer diets may target energy homeostasis to reverse the obesity-disturbed metabolism
favourably. Oxygen consumption (VO2) and energy expenditure (EE) were measured in the
different dietary groups (Supplementary Table 8). Of note, while no difference was observed in
mice treated for two weeks, VO2 and EE were higher in mice fed with the EAA-substituted diets
for six weeks (Fig. 3B, Supplementary Fig. 7B, and Supplementary Table 8). Locomotor activity,
which is a contributor to total energy expenditure, was normal in mice fed with all of the substituted
diets (Supplementary Table 8). The respiratory exchange ratio (RER) was reduced in SFA-EAA-
and HFD-EAA-fed mice compared to SFA-CAA- and HFD-CAA-fed mice at both time treatment
(Fig. 3C and Supplementary Fig. 7C ). This result is consistent with preferential oxidation of lipid
fuels in SFA-EAA and HFD-EAA mice. Moreover, the increase of core body temperature was
evident only after six weeks of SFA-EAA feeding (Fig. 3D) and was independent of circulating
levels of thyroid hormones, thyroxine (total T4) and thyroid-stimulating hormone (Supplementary
Table 6). Similar results were also observed in HFD-EAA compared to HFD-CAA mice (data not
shown).
Effects on gut microbiota
No significant difference in microbial richness between diets was evident with three different -
diversity estimators (Fig. 4A). The unsupervised multivariate statistical analysis—based on Bray-
Curtis dissimilarity distance (PCoA)—showed that the gut microbiota of SFA-EAA group
18 Diabetes Page 20 of 75
represented a structural shift mainly along with the second principal component (PC2) (Fig. 4B).
In contrast, the gut microbiota of SFA and SFA-CAA groups were not separated (Fig. 4B).
Moreover, the Bray-Curtis dissimilarity index between SFA and SFA-EAA groups was significantly higher compared to each within-group dissimilarity and compared to that between
SFA and SFA-CAA groups (FDR P < 0.001, Fig. 4C). Despite taxon-based analysis revealed small
effects, the SFA-EAA diet consumption promoted an enrichment of Allobaculum and Sutterella
relative abundance compared to SFA (FDR P = 0.029) and SFA-CAA (FDR P = 0.032) diet; in
turn, the SFA diet enriched Lactococcus compared to SFA-CAA diet (FDR P = 0.029) (Fig. 4D
and E and Supplementary Table 9). Furthermore, Allobaculum, Sutterella, and Lactococcus were
shown as the most discriminant bacterial taxa between SFA- and SFA-EAA-fed mice by Random
Forest analysis (Fig. 4F). Notably, Allobaculum relative abundance inversely correlated with the
body weight (Spearman’s r = –0.381, P < 0.05), insulin tolerance (Spearman’s r= –0.529, P <
0.005), and glucose metabolism (Spearman’s r = –0.704, P < 0.01). Similarly, Sutterella inversely
correlated with the insulin tolerance (Spearman’s r = –0.671, P < 0.01) and glucose metabolism
(Spearman’s r = –0.532, P < 0.05), as well as Akkermansia with a reduced body weight
(Spearman’s r = –0.613, P < 0.05).
Effects on thermogenic white adipocytes
To assess the role of adaptive thermogenesis in the action of SFA-EAA diet, we investigated
whether the EAA-substituted diets were able to promote the differentiation of beige adipocytes
within inguinal white adipose tissue (iWAT). Gene expression profiling after treatment did not
find a statistical increase of markers of beige adipocytes in iWAT, as well as of the thermogenic
genes UCP1 and PR domain containing 16 (PRDM16), the positive inducer of mitochondrial
biogenesis endothelial nitric oxide synthase (eNOS) (39), or the mitochondrial biogenesis markers
19 Page 21 of 75 Diabetes
in mice fed with SFA-EAA diet (Supplementary Fig. 8A-C). Moreover, the expression of genes
involved in lipolysis and fatty acid oxidation remained unchanged, while NEFA levels were
decreased in iWAT of SFA-EAA mice compared to controls (Supplementary Fig. 8D). The
histological analysis confirmed these results, suggesting that browning is unlikely to play an
important role in the metabolic actions of SFA-EAA diet (Supplementary Fig. 8E).
By contrast, we found that the uncoupled respiration was higher in iWAT mitochondria of
wild-type or ob/ob mice fed with the SFA-EAA than SFA-CAA diet at 30 °C—a condition in
which there is no expression of UCP1. This result suggested that the SFA-EAA diet could promote
specific UCP1-independent thermogenic processes by which body temperature is increased (Fig.
5A and B and Supplementary Fig. 9A). Although not directly investigated at a biochemical level,
gene expression analysis suggested that futile cycling, including glycerol phosphate shuttle,
calcium release and reuptake, and creatine-driven substrate cycling (44) remained unchanged after
consuming the SFA-EAA diet (Supplementary Fig. 10A-C ), as well as mitochondrial biogenesis
and function in skeletal muscle (Supplementary Fig. 10D-F). Because N-acyl amino acids
stimulate uncoupled mitochondrial respiration in white adipocytes, independently of UCP1 (34),
we also measured the levels of N-lipidated amino acids in both the plasma and iWAT of SFA-
CAA- and SFA-EAA-fed mice, housed at 30 °C. The circulating and adipose levels of specific
C18:1-amino acids were higher in SFA-EAA than SFA-CAA mice (Fig. 5C). The N-acyl amino
acids were undetectable in the interscapular adipose tissue (iBAT) of mice fed with both diets. The
mRNA levels of Pm20d1 (peptidase M20 domain-containing 1), the enzyme secreted by
thermogenic adipose cells that regulates N-acyl amino acids were unaltered in iWAT, iBAT, and
liver of SFA-CAA- and SFA-EAA-fed mice (Fig. 5D).
20 Diabetes Page 22 of 75
Effects on brown adipocytes
Next, by using infrared thermography, we found that after 6 weeks of dietary treatment, iBAT temperature was higher in mice fed with the SFA-EAA diet compared to those fed with the SFA-
CAA diet (Fig. 6A). Interestingly, already at day 5 of treatment, the SFA-EAA diet promoted an uncoupled respiration and the UCP1 protein expression in iBAT mitochondria compared to the control diet (Fig. 6B and C). These effects were also maintained after six weeks of treatment (Fig.
6D and E). Although thermogenic genes type 2 iodothyronine deiodinase (Dio2) and PRDM16 were unaffected, we found an increased expression of nuclear-encoded respiratory complex genes and of mitochondrial DNA amount, in addition to UCP1 and eNOS, in iBAT of mice fed with the
SFA-EAA diet (Supplementary Fig. 11A-C). Moreover, the expression level of the lipolysis- related gene adipose triglyceride lipase (Atgl) was higher in iBAT of mice fed with the SFA-EAA diet than with the SFA-CAA diet (Supplementary Fig. 11D). This was accompanied by a greater preponderance of small lipid droplets (Supplementary Fig. 11E) and a higher level of NEFAs in iBAT of SFA-EAA mice (Supplementary Fig. 11F). These results suggested that fatty acid oxidation was increased in iBAT; accordingly, RER was decreased (Fig. 3C) while carnitine palmitoyltransferase 1 (CPT1) activity was increased in iBAT of mice consuming the SFA-EAA diet (Supplementary Fig. 11G).
The mitochondrial respiratory electron transport chain cytochrome c oxidase subunit IV
(COX IV) and cytochrome c (Cyt c) protein levels were higher in iBAT of SFA-EAA than SFA-
CAA mice (Fig. 6E), suggesting increased mitochondrial biogenesis. In accordance, the density of the mitochondrial cristae was augmented (SFA-EAA diet: 23.64 ± 0.48 m-2 versus SFA-CAA diet: 17.83 ± 0.43 m-2; n = 600 mitochondria for each sample, P < 0.0001), although mitochondrial density was similar in both diets (SFA-EAA: 8.9 over 10 m2 versus SFA-CAA:
21 Page 23 of 75 Diabetes
8.1 over 10 m2, ns) and mitochondrial area was reduced (SFA-EAA diet: 0.58 ± 0.017 m2 versus
SFA diet-CAA: 0.71 ± 0.018 m2, P < 0.0001) by the SFA-EAA diet (Fig. 6F). Congruently,
iBAT was activated in obese ob/ob mice (Supplementary Fig. 9B-D). Overall, our findings suggest
that the SFA-EAA diet was able to activate an iBAT thermogenic program, in which utilization
(i.e., oxidation) of fatty acids is increased.
Effects on brown adipocyte activators
Thus, we investigated how the SFA-EAA diet activates thermogenic program in iBAT. Fibroblast
growth factor 21 (FGF21) that promotes sympathetic nerve activity in brown fat, browning of
iWAT, and energy expenditure in diet-induced obese mice (45), was lower in plasma of the SFA-
EAA-fed mice, accordingly to reduced FGF21 gene expression in liver and adipose. These
observations may be of interest, since elevated circulating FGF21 is noted in impaired glucose
tolerance and type 2 diabetes and correlates with muscle and hepatic insulin resistance (46), and
not only with increased thermogenesis and metabolic homeostasis improvement (38).
(Supplementary Fig. 12A and B). Analogously, long-chain acylcarnitines, synthesized in the liver
in response to cold exposure or treatment with 3-adrenergic receptor agonists, and providing fuel
for iBAT thermogenesis (47), were unchanged in plasma of mice fed with either diet, similarly to
the expression of genes involved in their metabolism in the liver, iBAT (except for CrAT), and
muscle (Supplementary Fig. 12C and D).
Also, there was no apparent difference of norepinephrine turnover—a direct neurochemical
measure of sympathetic nervous system (SNS) activity and a proxy of sympathetic innervation
(48)—in iBAT of SFA-EAA mice versus SFA-CAA mice, as well as of tyrosine hydroxylase and
3-adrenoceptor expression, markers of noradrenergic innervation (Fig. 7A and B). Given that
22 Diabetes Page 24 of 75
sympathetic denervation of iBAT—both surgical and chemical—has limitations, especially when used to study the involvement of SNS in systemic effects of chronic treatments, we chose to develop an in vitro system to confirm that the SFA-EAA diet may act directly on brown adipocytes independently of SNS. In particular, we exposed primary brown adipocytes differentiated in culture to one of two different amino acid combinations, precisely reproducing the iBAT aminograms resulting from consumption of either SFA-CAA or SFA-EAA diets (Fig. 7C and
Supplementary Table 4). Notably, the EAA mixture increased both UCP1 mRNA and protein levels and, accordingly, the uncoupled respiration when compared to vehicle-treated cells (Fig.
7D-F). Conversely, the CAA mixture failed to promote either UCP1 expression or oxygen consumption. Together, these findings seem to suggest that the effects of SFA-EAA diet on iBAT depends mainly on a brown adipocyte autonomous process.
Effects on thermogenic signaling
We next aimed to investigate the molecular mechanism of iBAT activation by studying the role of the mechanistic target of rapamycin (mTOR) signaling pathway activated by amino acids and required for brown fat recruitment and metabolic adaptation to cold exposure (29,30). The exposure of primary brown adipocytes in culture to EAA mixture markedly promoted mTOR activation—as shown by the phosphorylation of the mTOR complex 1 (mTORC1)-downstream target ribosomal protein S6 (S6) (Fig. 7G). Despite a partial efficacy of CAA mixture in the mTOR activation, however, this effect was not associated with stimulation of the UCP1-dependent thermogenic program. In turn, rapamycin—the macrolide antibiotic that selectively inhibits mTORC1, fully antagonized the stimulatory effect of EAA mixture on the expression of UCP1 and markers of mitochondrial biogenesis (Fig. 7E). These results were confirmed in vivo, in
C57BL6/N and ob/ob mice (Fig. 8 and Supplementary Fig. 13). Already at day 1 of treatment,
23 Page 25 of 75 Diabetes
SFA-EAA diet consistently increased S6 phosphorylation in iBAT (Fig. 8A). Our data showed that
this effect was iBAT-specific, without any phosphorylation of S6 and 4E-BP1 (or eukaryotic
translation initiation factor 4E-binding protein 1) in iWAT and gastrocnemius muscle after 6-
weeks feeding with the SFA-EAA diet (Supplementary Fig. 13B). The systemic administration of
rapamycin entirely blocked oxygen consumption, and S6 and 4E-BP1 phosphorylation in iBAT of
SFA-EAA-fed mice (Fig. 8B and C); these effects were accompanied by a blockade of action of
this diet on core and iBAT temperature, UCP1 expression in brown fat, as well as on body weight
and adiposity, without affecting food intake (Fig. 8D and E and Supplementary Fig. 13C and D).
24 Diabetes Page 26 of 75
DISCUSSION
Collectively, our data reveal that customized diets, in which a precise formula of EAAs substitutes for protein content—without changing calorie content and macronutrient percentage—exert preventive and therapeutic anti-obesity effects, with amelioration of body adiposity, insulin resistance, and fatty liver, beyond promoting a longer and healthier life span. The beneficial effects of either SFA-EAA or HFD-EAA diet on longevity and metabolic homeostasis can be secondary to reduced adiposity, even if the ability of our particular amino-acid combination to play a primary action cannot be excluded.
Although with the EAA-substituted diets certain EAAs (i.e., histidine, isoleucine, leucine, lysine, threonine, and valine) were consumed in a higher amount, while others (i.e., methionine, phenylalanine, and tyrosine) in lower amounts that those recommended for mice by the U.S.
National Research Council (Supplementary Table 10), the circulating levels of EAAs and NEAAs do not seem to exceed tolerable upper and lower levels for individual amino acids. Though few studies report on the side effects of chronic intake of specific amino acid supplements, and there is no adequate dose–response data from human or animal studies to base accepted limits, our results with life-long consumption of markedly changed amino acid combination are conversely reassuring. They show that diets with very restricted—yet not wholly lacking—amounts of
NEAAs (i.e., the SFA-EAA and HFD-EAA diets) are healthy and do not alter animal growth.
Traditionally viewed as amino acids that can be synthesized de novo in adequate amounts by the animal organism to meet the requirements for growth and maintenance, the nutritionally NEAAs are currently considered, in a correct way, necessary for multiple roles in physiology. NEAAs participate in gene expression, cell signalling pathways, antioxidative responses, in addition to regulate neurotransmission and immunity; thus, their non-essentiality has been questioned (42).
25 Page 27 of 75 Diabetes
Reduction of food intake and gut energy absorption do not appear to play relevant roles in
the healthy effects of our substituted diets. This conclusion seems to be confirmed by the absence
in mice fed with SFA-EAA or HFD-EAA diets of the physiological adjustments which animals
usually exhibit to maintain energy balance when subjected to a decrease in resource availability
(e.g., increased exploratory activities and intestinal energy absorption (49), or reduced basal
metabolic rate and NST). The NST is indeed increased in SFA-EAA- and HFD-EAA-fed mice.
While browning of iWAT is not induced, a UCP1’s independent uncoupling of respiration is
evident in iWAT of SFA-EAA-fed mice and potentially may promote thermogenesis. Despite the
possibility that the observed increase of lipidated amino-acid levels in iWAT could be responsible
for this higher uncoupled respiration, their relative contribution to the overall phenotype of SFA-
EAA (and also of HFD-EAA) mice remains to be addressed. Most significantly, the SFA-EAA
and HFD-EAA diets promote a marked iBAT activation in both normal weight and obese mice,
irrespective of the environmental temperature. FGF21, acylcarnitines, NE, and thyroid hormones,
well-known activators of brown fat (38,40), are not responsible for the beneficial effects of the
SFA-EAA diet. Similarly, other thermogenic mechanisms, including the UCP1-independent futile
cycling and muscle mitochondrial biogenesis, are not promoted by the SFA-EAA diet.
Conversely, iBAT thermogenesis could be directly activated by the specific combination
of amino acids in this tissue. The EAA mixture, unlike CAA mixture—that were designed on the
profiles of amino acids identified in iBAT of SFA-EAA- and SFA-CAA-fed mice (iBAT
aminograms), respectively—promotes a thermogenic program in cultured brown adipocytes,
through activation of mTORC1 signaling. Notably, the iBAT aminograms differ between mice fed
with the two dietary regimens: arginine, isoleucine, leucine, proline, threonine, and valine are
statistically higher in SFA-EAA- then in SFA-CAA-fed mice while, on the contrary, glycine,
lysine, and serine are lower. From the literature, isoleucine, leucine, and valine (namely, the
26 Diabetes Page 28 of 75
branched-chain amino acids) supplementation ameliorates some metabolic dysfunction caused by obesity or diabetes, without impairing glucose metabolism, in some studies (50), but not in others
(51,52). Arginine, as a substrate of nitric oxide synthase, produces nitric oxide (NO) for signaling purposes—including mitochondrial biogenesis and thermogenic program in iBAT (39). Increasing evidence has shown that dietary supplementation of arginine can effectively improve BAT thermogenesis via the mTOR signaling pathway (53), with reduced obesity and diabetes, in addition to improved obesity-linked dyslipidemia and blood hypertension in mammals, including humans (54). Similarly, proline supplementation improves NO bioavailability and counteracts the blood pressure (55). By contrast, the SFA-EAA diet reduced the NEAA glycine levels in iBAT compared to SFA-CAA diet, and accordingly, the glycine precursor threonine was increased. Of note, neuronal glycine has been found to inhibit sympathetic activation of BAT (56), and although circulating glycine is low in obese subjects, and its supplementation was proposed as a treatment of obesity (57), no clear role has been found in brown fat. Also for serine, which was similarly reduced in SFA-EAA mice, further studies are needed to confirm and extend our findings.
Additionally, we observed some interesting differences in microbiota composition. There was an enrichment of Allobaculum and Sutterella in the gut of mice fed with SFA-EAA diet compared to SFA and SFA-CAA diet, which might play some role in light of the inverse correlation we observed with body weight and insulin resistance, in agreement with previous observations (58). Several studies have demonstrated that the HFD reduces the relative abundance of both taxa in the gut of mice, while multiple dietary interventions, such as prebiotics, probiotics, and berberine—that ameliorate insulin resistance and adipose inflammation—promote the relative abundance of both Allobaculum and Sutterella (59,60). Again, mounting evidence suggests that gut microbiota can stimulate brown fat thermogenesis in mice (29,54,55). Further studies,
27 Page 29 of 75 Diabetes
therefore, are warranted to establish metabolic links between gut bacteria such as Allobaculum and
Sutterella and the iBAT activation by our diets.
Similarly, additional work is necessary to understand whether the pro-longevity effects of
SFA-EAA are simply due to the reduced adiposity or to a direct action of our peculiar amino-acid
combination. Remarkably, reducing NEAA concentration has been found to promote replicative
lifespan extension in yeast (61); as in turn increasing EAA concentration prolongs the lifespan,
not only in yeast, but also in Caenorhabditis elegans and, most importantly, in mammals
(14,62,63). The increased chronological life span extension of yeast promoted by EAA
supplementation was found to be accompanied by lower oxidative damage and notably by the
activation, not inhibition as often reported with other life span prolonging methods, of TOR
signaling pathway (61). Yang et al. (19) have moreover reported that an amino acid formula
similar to the amino acid combination in our EAA-substituted diets, slowed the age-related
changes of gut microbiota, without affecting body weight, suggesting that the dietary
supplementation might promote healthy aging independently of its effects on adiposity.
Since our EAA-substituted diets are deficient of some EAA compared to controls, one
could claim that detection of amino acid unbalance or, alternately, a restriction of specific amino
acids may be relevant intermediaries to the beneficial effects of both SFA-EAA and HFD-EAA
diets. These possibilities were proposed to interpret previous findings. For example, mice fed with
diets lacking the single EAA tryptophan had increased resistance to surgical stress, as well as
improved longevity, metabolic fitness and stress resistance (64). However, detection of dietary
amino acid imbalance seems improbable in our case since there is no apparent change of the GCN2
activity, the critical regulator of cellular responses under amino acid deficiency or imbalance, in
both hypothalamus and liver of mice under the different dietary regimens. Moreover, previous
studies have shown that diets deficient in EAAs can influence food intake and increase FGF21
28 Diabetes Page 30 of 75
levels (65). Consuming SFA-EAA diet, conversely, does not change feeding and decreases circulating and hepatic FGF21 levels. Also, feeding rodents survival-promoting methionine- restricted diets comprising purified amino acids as the sole source of nitrogenous content causes some of the phenotypes described here, including protection from weight gain (mostly in adiposity), improved glucose homeostasis, increased energy expenditure, and activation of iBAT
(66). However, the abundance of cysteine in SFA-EAA and HFD-EAA diets rules out methionine- restriction as the key mechanism behind the present findings.
In summary, the present study indicates that specific manipulation of dietary amino acids prevents and reverses obesity in mice through multiple modes to stimulate thermogenesis.
Reasonably, taken separately each other, these multiple modes would be unable to explain the overall observed results. If extended to humans, such dietary manipulation could potentially have a positive impact on metabolic health favoring the prevention and treatment of obesity and type 2 diabetes regardless of calorie consumption.
29 Page 31 of 75 Diabetes
Acknowledgments. The authors thank M. Rossato (Department of Medicine, University of Padua,
Padua, Italy) for experiments with the Flir camera; Mariaelvina Sala and Daniela Braida
(Department of Medical Biotechnology and Translational Medicine, University of Milan, Milan,
Italy) for behavioral experiments; Annapaola Andolfo and Cinzia Magagnotti (Protein
Microsequencing Facility, San Raffaele Scientific Institute, Milan, Italy) for mass spectrometry
analysis, and Alessandra Micheletti (Department of Environmental Sciences and Politics,
University of Milan, Milan, Italy) and Marika Vezzoli (Department of Molecular and Translational
Medicine, Brescia University, Brescia, Italy) for statistical analysis.
Funding. This work was supported by Fondazione Umberto Veronesi to C.R., University of Milan
to F.R. (Research Fellowship grant 1280/2016), Professional Dietetics (Milan, Italy) to E.N.
(support to laboratory), Cariplo Foundation to E.N. and to A.V. (grant 2016-1006), and Louis-
Jeantet Foundation grant to R.C.
Duality of Interests. No potential conflicts of interest relevant to this article were reported.
Author Contributions. C.R. and M.R. designed and performed molecular biology, metabolic,
oxygen consumption, and animal experiments; P.C., C.G., D.L., and R.P.C. designed and
performed experiments in animals; V.G., L.Tenori, and C.L. designed and analyzed experiments
on metabolites; R.M.I., F.Bontems, and R.C. designed, performed, and analyzed indirect
calorimetry experiments; A.C., F.P. and V.D. designed, performed, and analyzed liquid
chromatography-mass spectroscopy experiments for N-acyl-amino acid and acylcarnitine
measurements; E.M. synthesized N-acyl-amino acids; L.Tedesco and F.R. performed in vitro
experiments and qRT-PCR analysis; A.P. and I.D. performed experiments at thermoneutrality;
30 Diabetes Page 32 of 75
L.P. designed, performed, and analyzed behavioral experiments; L.R., M.U.S., and K.T. performed microbiota analysis; I.S. and S.Cinti designed, performed, and analyzed electron microscopy and histological experiments; F.B., M.O.C, G.C., R.C., S.Collins, and A.V. assisted with experimental design and co-edited the manuscript; E.N. conceived the study, designed experiments, and provided advice; C.R., M.R., and E.N. wrote the manuscript with suggestions from all authors, all of whom read and approved the final version. E.N. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.
31 Page 33 of 75 Diabetes
Figure Legends
Figure 1 — EAA, unlike CAA substitution for protein content of rodent diets prevents and
reverses obesity, with the improvement of glucose homeostasis and extension of average lifespan.
A: Body weight of mice fed with chow, SFA, SFA-EAA, and SFA-CAA diet at room temperature
(n = 7-10 mice per group). After maximal body weight was reached (11 months, dashed line), mice
fed with SFA were switched to either SFA-EAA diet (SFA > SFA-EAA) or SFA-CAA diet (SFA
> SFA-CAA) (n = 5 mice per group). B: Body weight of mice at room temperature (n = 9-10 mice
per group). C: Body composition at the end of treatment: fat mass (left) and lean mass (right) (n =
6 mice per group). D: Plasma leptin levels at different time points at room temperature (n = 5 mice
per group). E: Body weight of mice at thermoneutrality (30 °C) (n = 10 mice per group). F and
G: Glucose tolerance tests (GTT) in mice at room temperature (n = 5 mice per group) (F) or at
thermoneutrality (G) (n = 7 mice per group). Mice were fed with different diets for six weeks. H
and I: Plasma levels of adiponectin (H) and IGF-1 (I) in mice fed with SFA-CAA and SFA-EAA
diet for six weeks at room temperature (n = 5 mice per group). J: Kaplan-Meier survival curves
for chow, SFA, SFA-EAA, and SFA-CAA-fed mice (n = 35 mice per group). All data (except J)
are presented as mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. SFA diet, #P < 0.05,
##P < 0.01, and ###P < 0.001 vs. SFA-CAA diet, §P < 0.05, §§P < 0.01, and §§§P < 0.001 vs. chow
diet.
Figure 2 — Food intake and energy absorption in mice on different dietary regimens. A: Food
intake of mice fed with chow, SFA, SFA-EAA, and SFA-CAA diets for different time intervals (n
= 5-7 mice per group). B: Gut transit time. C: hematoxylin and eosin staining of jejunum villi.
Scale bar, 90 m. D: energy excretion: the mean amount of feces excreted per mouse in 24 h
32 Diabetes Page 34 of 75
(mg/24 h) (left) and food excreted (dry mass of fecal pellets, collected over 72 h and expressed as
the percentage of food intake) (right). E: mean energy content in feces (kcal/g). F: daily energy
excretion (kcal/mouse) calculated using the previous values (n = 3–5 mice per group). B-F: mice
were fed with SFA, SFA-CAA, and SFA-EAA diets for six weeks. All data are presented as mean
± SEM. **P < 0.01 and ***P < 0.001 vs. SFA diet; ###P < 0.001 vs. SFA-CAA; §§§P < 0.001 vs.
chow diet.
Figure 3 — Energy metabolism in mice on different dietary regimens. A: Metabolic efficiency
was calculated as the body weight gain to the energy intake ratio (i.e., total food consumed during
five days or 2 or 6 weeks). B and C: Energy expenditure (B) and respiratory exchange ratio (RER)
(C) during one 24 h cycle. D: Whole-body temperature measured with a digital rectal thermometer.
Measurements were performed in two separate experiments, after 2 or 6 weeks (n = 5-7 mice per
group). All data are presented as mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. SFA-
CAA diet.
Figure 4 — SFA-EAA diet changes gut microbiota composition. A: Chao index, Shannon entropy index, and alpha-diversity calculated on the number of observed OTUs. B: Principal coordinates analysis (PCoA) of bacterial beta-diversity based on the Bray-Curtis dissimilarity index. Each symbol represents a single sample of feces after six weeks of treatment. C: Box-and-whisker plot
of intercommunity beta-diversity determined by Bray-Curtis dissimilarity index. D: Phylum/order
level relative abundance expressed as geometric mean. E: Allobaculum, Sutterella, and
Lactococcus relative abundance. F: Random Forest analysis. For box-and-whisker plots, boxes
show median, first and third quartiles. The whiskers extend from the quartiles to the last data point
33 Page 35 of 75 Diabetes
within 1.5× IQR, with outliers beyond represented as dots (n = 10 mice per group). *P < 0.05, **P
< 0.01, and ***P< 0.001 as shown.
Figure 5 — SFA-EAA diet promotes uncoupled respiration in inguinal WAT (iWAT) without
browning stimulation. A: Uncoupled (i.e., with oligomycin) and maximal (i.e., with FCCP)
oxygen consumption rates (OCR) in iWAT mitochondria; respiration was normalized to
mitochondrial protein amount (n = 5 mice per group). B: Western blot analysis of UCP1 and
HSP60 protein levels in adipose tissues (n = 4 mice per group). One experiment representative of
three reproducible ones is shown. iBAT of mice fed with chow diet at room temperature was used
as control. C: Thermogenic N-acyl amino acids in plasma (left) and iWAT (right) (n = 4-5 mice
per group). D: Relative mRNA levels of Pm20d1 gene in different tissues (n = 5 mice per group).
A-D, mice were fed with SFA-CAA and SFA-EAA diet for six weeks at thermoneutrality. All data
are presented as mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. SFA-CAA diet.
Figure 6 — SFA-EAA diet increases the thermogenic function of iBAT. A: iBAT temperature was
measured with thermographic Flir camera in mice fed with SFA-CAA and SFA-EAA diet for six
weeks at room temperature (n = 5 mice per group). B: Uncoupled (i.e., ΔGDP, UCP1-dependent
respiration calculated as the amount of ADP-independent respiration that was inhibited by GDP)
and maximal (FCCP) oxygen consumption rates (OCR) in iBAT mitochondria; respiration was
normalized to mitochondrial protein amount (n = 5 mice per group). C: Western blot analysis of
UCP1 and GAPDH protein levels in iBAT. One experiment representative of three reproducible
ones is shown (n = 3-5 mice per group). Mice in B and C were fed with SFA-CAA and SFA-EAA
diet for 1, 5, or 20 days at room temperature. D: Uncoupled (ΔGDP) and maximal (FCCP) OCR
in iBAT mitochondria (n = 6 mice per group). E: Western blot analysis of UCP1, COX IV, Cyt c,
34 Diabetes Page 36 of 75
and GAPDH protein levels in iBAT. One experiment representative of three reproducible ones (n
= 4 mice per group). F: Electron microscopy analysis of iBAT. Scale bar, 0.5 m (n = 2 mice per
group). Mice in D-F were fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature. All data are presented as mean ± SEM. *P < 0.05 and **P < 0.01 vs. SFA-CAA diet.
UCP1, uncoupling protein 1; COX-IV, cytochrome c oxidase subunit IV; Cyt c, cytochrome c;
GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Figure 7 — SFA-EAA diet activates brown adipocytes. A: Norepinephrine (NE) turnover (NETO) in iBAT of mice fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature. NETO was assessed by NE synthesis inhibition with α-methyl-p-tyrosine (n = 5 mice per group). B:
Relative mRNA levels of noradrenergic innervation markers in iBAT of mice fed with SFA-CAA
and SFA-EAA diet for six weeks. C: Scheme of in vitro experiment in primary brown adipocytes
isolated from mice fed with chow diet. After 16 h incubation in amino acid-free medium, brown
adipocytes were pretreated with rapamycin (Rapa, 1.0 nM) or Veh (DMSO) for one h. Then, the
cells were supplemented with Veh (PBS) or CAAm or EAAm, specifically reproducing the iBAT
aminograms resulting from consumption of either SFA-CAA or SFA-EAA diets, respectively, as
reported in Supplementary Table 4 (n = 3 experiments performed in triplicate). D: UCP1 mRNA
levels in differentiated brown adipocytes, treated as in C. E and G: Western blot analysis of UCP1
and GAPDH (E), and (Ser 235/236) phosphorylated S6 and S6 (G) protein levels in differentiated
brown adipocytes, treated as in C. One immunoblot experiment representative of three reproducible ones. F: Oxygen consumption rates (OCR) of differentiated brown adipocytes,
treated as in C. OCR was measured with Seahorse XF24 Extracellular Flux Analyzer (n = 3
readings in quadruplicate/group). All data are presented as mean ± SEM. **P < 0.01 and ***P <
0.001 vs. Veh; #P < 0.05, ##P < 0.01, and ###P < 0.001 vs. CAAm; §P < 0.05 and §§§P < 0.001 vs.
35 Page 37 of 75 Diabetes
EAAm + Rapa. TH, tyrosine hydroxylase; 3AR, 3-adrenergic receptor; CAAm, casein amino-
acid mixture; EAAm, essential amino-acid mixture; UCP1, uncoupling protein 1; GAPDH,
glyceraldehyde 3-phosphate dehydrogenase; S6, ribosomal protein S6.
Figure 8 — mTORC1 signaling contributes to iBAT thermogenesis induced by SFA-EAA diet.
A: Western blot analysis of (Ser 235/236) phosphorylated S6 and S6 protein levels in iBAT of
mice fed with SFA-CAA and SFA-EAA diet for different time intervals at room temperature. One
immunoblot experiment representative of three reproducible ones (n = 3-5 mice per group). B:
Western blot analysis of the mTORC1 pathway in iBAT of mice fed with SFA-CAA and SFA-
EAA diet, with vehicle (Veh) or rapamycin (Rapa) (n = 4 mice per group). C: UCP1-dependent
(ΔGDP) and maximal (FCCP) oxygen consumption rates (OCR) in iBAT mitochondria. OCR was
normalized to mitochondrial protein amount (n = 5 mice per group). D: Rectal and thermographic
measurement of iBAT temperature (n = 5 mice per group). E: Western blot analysis of UCP1
protein levels in iBAT. Mice in B-E were fed with SFA-CAA and SFA-EAA diet for six weeks at
room temperature, with or without rapamycin (i.p. 2.5 mg/kg body weight) delivered in 200 μl, 5
days per week for six weeks, starting with diets (n = 5-6 mice per group). All data are presented
as mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. SFA-CAA diet; #P < 0.05 vs. SFA-
EAA diet. S6, ribosomal protein S6; 4E-BP1, eukaryotic initiation factor 4E-binding protein 1
phosphorylation; UCP1, uncoupling protein 1.
36 Diabetes Page 38 of 75
References
1. Koska J, Ozias MK, Deer J, Kurtz J, Salbe AD, Harman SM, et al. A human model of dietary saturated fatty acid induced insulin resistance. Metabolism 2016;65:1621–8 2. Vasilopoulou D, Markey O, Kliem KE, Fagan CC, Grandison AS, Humphries DJ, et al. Reformulation initiative for partial replacement of saturated with unsaturated fats in dairy foods attenuates the increase in LDL cholesterol and improves flow-mediated dilatation compared with conventional dairy: the randomized, controlled REplacement of. Am J Clin Nutr 2020;1–10 3. Scherer PE. The many secret lives of adipocytes: implications for diabetes. Diabetologia 2019;62:223–32 4. Hall KD, Ayuketah A, Brychta R, Cai H, Cassimatis T, Chen KY, et al. Ultra-Processed Diets Cause Excess Calorie Intake and Weight Gain: An Inpatient Randomized Controlled Trial of Ad Libitum Food Intake. Cell Metab 2019;30:67–77 5. Gardner CD, Kiazand A, Alhassan S, Kim S, Stafford RS, Balise RR, et al. Comparison of the Atkins, Zone, Ornish, and LEARN diets for change in weight and related risk factors among overweight premenopausal women: The A to Z weight loss study: A randomized trial. J Am Med Assoc 2007;297:969–77 6. Lagiou P, Sandin S, Lof M, Trichopoulos D, Adami HO, Weiderpass E. Low carbohydrate- high protein diet and incidence of cardiovascular diseases in Swedish women: Prospective cohort study. BMJ 2012;345:7864 7. Huang X, Hancock DP, Gosby AK, McMahon AC, Solon SMC, Le Couteur DG, et al. Effects of dietary protein to carbohydrate balance on energy intake, fat storage, and heat production in mice. Obesity (Silver Spring) 2013;21:85–92 8. Fontana L, Cummings NE, Arriola Apelo SI, Neuman JC, Kasza I, Schmidt BA, et al. Decreased Consumption of Branched-Chain Amino Acids Improves Metabolic Health. Cell Rep 2016;16:520–30 9. Anthony TG, Morrison CD, Gettys TW. Remodeling of lipid metabolism by dietary restriction of essential amino acids. Diabetes 2013;62:2635–44 10. Binder E, Bermúdez-Silva FJ, André C, Elie M, Romero-Zerbo SY, Leste-Lasserre T, et al. Leucine supplementation protects from insulin resistance by regulating adiposity levels. PLoS One 2013;8:e74705 11. Serra F, LeFeuvre RA, Slater D, Palou A, Rothwell NJ. Thermogenic actions of tryptophan in the rat are mediated independently of 5-HT. Brain Res 1992;578:327–34 12. Nairizi A, She P, Vary TC, Lynch CJ. Leucine Supplementation of Drinking Water Does Not Alter Susceptibility to Diet-Induced Obesity in Mice. J Nutr. 2009 Apr;139(4):715–9. 13. Bifari F, Nisoli E. Branched-chain amino acids differently modulate catabolic and anabolic states in mammals: a pharmacological point of view. Br J Pharmacol. 2017;174(11). 14. D’Antona G, Ragni M, Cardile A, Tedesco L, Dossena M, Bruttini F, et al. Branched-chain amino acid supplementation promotes survival and supports cardiac and skeletal muscle mitochondrial biogenesis in middle-aged mice. Cell Metab 2010;12:362–72 15. D’Antona G, Tedesco L, Ruocco C, Corsetti G, Ragni M, Fossati A, et al. A Peculiar Formula of Essential Amino Acids Prevents Rosuvastatin Myopathy in Mice. Antioxidants Redox Signal 2016;25:11 16. Bifari F, Dolci S, Bottani E, Pino A, Di Chio M, Zorzin S, et al. Complete neural stem cell (NSC) neuronal differentiation requires a branched chain amino acids-induced persistent metabolic shift towards energy metabolism. Pharmacol Res 2020;158:104863
37 Page 39 of 75 Diabetes
17. Brunetti D, Bottani E, Segala A, Marchet S, Rossi F, Malavolta M, et al. Targeting multiple mitochondrial processes by a metabolic modulator prevents sarcopenia and cognitive decline in SAMP8 mice. Front Pharmacol. 2020;11:1171 18. Buondonno I, Sassi F, Carignano G, Dutto F, Ferreri C, Pili FG, et al. From mitochondria to healthy aging: The role of branched-chain amino acids treatment: MATeR a randomized study. Clin Nutr 2020;39:2080–91 19. Yang Z, Huang S, Zou D, Dong D, He X, Liu N, et al. Metabolic shifts and structural changes in the gut microbiota upon branched-chain amino acid supplementation in middle- aged mice. Amino Acids 2016;48:2731–45 20. Ridaura VK, Faith JJ, Rey FE, Cheng J, Duncan AE, Kau AL, et al. Gut microbiota from twins discordant for obesity modulate metabolism in mice. Science 2013;341:1241214 21. Sharon G, Garg N, Debelius J, Knight R, Dorrestein PC, Mazmanian SK. Specialized metabolites from the microbiome in health and disease. Cell Metab 2014;20:719–30 22. Cox LM, Yamanishi S, Sohn J, Alekseyenko A V., Leung JM, Cho I, et al. Altering the intestinal microbiota during a critical developmental window has lasting metabolic consequences. Cell 2014;158:705–21 23. Li B, Li L, Li M, Lam SM, Wang G, Wu Y, et al. Microbiota Depletion Impairs Thermogenesis of Brown Adipose Tissue and Browning of White Adipose Tissue. Cell Rep 2019;26:2720–37 24. Shabalina IG, Petrovic N, de Jong JMA, Kalinovich AV, Cannon B, Nedergaard J. UCP1 in Brite/Beige Adipose Tissue Mitochondria Is Functionally Thermogenic. Cell Rep 2013;5:1196–203 25. Cohen P, Levy JD, Zhang Y, Frontini A, Kolodin DP, Svensson KJ, et al. Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch. Cell 2014;156:304–16 26. Lowell BB, S-Susulic V, Hamann A, Lawitts JA, Himms-Hagen J, Boyer BB, et al. Development of obesity in transgenic mice after genetic ablation of brown adipose tissue. Nature 1993;366:740–2 27. Feldmann HM, Golozoubova V, Cannon B, Nedergaard J. UCP1 ablation induces obesity and abolishes diet-induced thermogenesis in mice exempt from thermal stress by living at thermoneutrality. Cell Metab 2009;9:203–9 28. Seale P, Conroe HM, Estall J, Kajimura S, Frontini A, Ishibashi J, et al. Prdm16 determines the thermogenic program of subcutaneous white adipose tissue in mice. J Clin Invest 2011;121:96–105 29. Liu D, Bordicchia M, Zhang C, Fang H, Wei W, Li J-L, et al. Activation of mTORC1 is essential for β-adrenergic stimulation of adipose browning. J Clin Invest 2016;126:1704– 16 30. Labbé SM, Mouchiroud M, Caron A, Secco B, Freinkman E, Lamoureux G, et al. MTORC1 is Required for Brown Adipose Tissue Recruitment and Metabolic Adaptation to Cold. Sci Rep 2016;6: 37223 31. Brown LJ, Koza RA, Everett C, Reitman ML, Marshall L, Fahien LA, et al. Normal thyroid thermogenesis but reduced viability and adiposity in mice lacking the mitochondrial glycerol phosphate dehydrogenase. J Biol Chem 2002;277:32892–8 32. Ikeda K, Kang Q, Yoneshiro T, Camporez JP, Maki H, Homma M, et al. UCP1-independent signaling involving SERCA2b-mediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasis. Nat Med 2017;23:1454–65 33. Kazak L, Chouchani ET, Lu GZ, Jedrychowski MP, Bare CJ, Mina AI, et al. Genetic
38 Diabetes Page 40 of 75
Depletion of Adipocyte Creatine Metabolism Inhibits Diet-Induced Thermogenesis and Drives Obesity. Cell Metab 2017;26: 660-671 34. Long JZ, Svensson KJ, Bateman LA, Lin H, Kamenecka T, Lokurkar IA, et al. The Secreted Enzyme PM20D1 Regulates Lipidated Amino Acid Uncouplers of Mitochondria. Cell 2016;166:424–35 35. Fontaine DA, Davis DB. Attention to background strain is essential for metabolic research: C57BL/6 and the international knockout mouse consortium. Diabetes 2016;65:25–33 36. Ramadori G, Fujikawa T, Fukuda M, Anderson J, Morgan DA, Mostoslavsky R, et al. SIRT1 deacetylase in POMC neurons is required for homeostatic defenses against diet- induced obesity. Cell Metab 2010;12:78–87 37. Chevalier C, Stojanović O, Colin DJ, Suarez-Zamorano N, Tarallo V, Veyrat-Durebex C, et al. Gut Microbiota Orchestrates Energy Homeostasis during Cold. Cell 2015;163:1360– 74 38. Lister RG. The use of a plus-maze to measure anxiety in the mouse. Psychopharmacology (Berl) 1987;92:180–5 39. Nisoli E. Mitochondrial Biogenesis in Mammals: The Role of Endogenous Nitric Oxide. Science 2003;299:896–9 40. Bieber LL, Abraham T, Helmrath T. A rapid spectrophotometric assay for carnitine palmitoyltransferase. Anal Biochem 1972;50:509–18 41. Gordon CJ. The mouse thermoregulatory system: Its impact on translating biomedical data to humans. Physiol Behav 2017;179:55–66 42. Kanazawa I, Yamaguchi T, Sugimoto T. Serum insulin-like growth factor-I is negatively associated with serum adiponectin in type 2 diabetes mellitus. Growth Horm IGF Res 2011;21:268–71 43. Dever TE, Feng L, Wek RC, Cigan AM, Donahue TF, Hinnebusch AG. Phosphorylation of initiation factor 2α by protein kinase GCN2 mediates gene-specific translational control of GCN4 in yeast. Cell 1992;68:585–96 44. Chouchani ET, Kazak L, Spiegelman BM. New Advances in Adaptive Thermogenesis: UCP1 and Beyond. Cell Metab 2019;29:27–37 45. Kliewer SA, Mangelsdorf DJ. A Dozen Years of Discovery: Insights into the Physiology and Pharmacology of FGF21. Cell Metab 2019;29:246–53 46. Chavez AO, Molina-Carrion M, Abdul-Ghani MA, Folli F, Defronzo RA, Tripathy D. Circulating fibroblast growth factor-21 is elevated in impaired glucose tolerance and type 2 diabetes and correlates with muscle and hepatic insulin resistance. Diabetes Care 2009;32:1542–6 47. Simcox J, Geoghegan G, Maschek JA, Bensard CL, Pasquali M, Miao R, et al. Global Analysis of Plasma Lipids Identifies Liver-Derived Acylcarnitines as a Fuel Source for Brown Fat Thermogenesis. Cell Metab 2017;26:509-522 48. Vaughan CH, Zarebidaki E, Ehlen JC, Bartness TJ. Analysis and measurement of the sympathetic and sensory innervation of white and brown adipose tissue. Methods Enzymol 2014;537:199–225 49. Peña-Villalobos I, Casanova-Maldonado I, Lois P, Sabat P, Palma V. Adaptive Physiological and Morphological Adjustments Mediated by Intestinal Stem Cells in Response to Food Availability in Mice. Front Physiol 2018;9:1821 50. Woo S-L, Yang J, Hsu M, Yang A, Zhang L, Lee R-P, et al. Effects of branched-chain amino acids on glucose metabolism in obese, prediabetic men and women: a randomized, crossover study. Am J Clin Nutr 2019;109:1569–77
39 Page 41 of 75 Diabetes
51. Newgard CB, An J, Bain JR, Muehlbauer MJ, Stevens RD, Lien LF, et al. A branched-chain amino acid-related metabolic signature that differentiates obese and lean humans and contributes to insulin resistance. Cell Metab 2009;9:311–26 52. Zhou M, Shao J, Wu CY, Shu L, Dong W, Liu Y, et al. Targeting BCAA catabolism to treat obesity-associated insulin resistance. Diabetes 2019;68:1730–46 53. Ma X, Han M, Li D, Hu S, Gilbreath KR, Bazer FW, et al. l-Arginine promotes protein synthesis and cell growth in brown adipocyte precursor cells via the mTOR signal pathway. Amino Acids 2017;49:957–64 54. McKnight JR, Satterfield MC, Jobgen WS, Smith SB, Spencer TE, Meininger CJ, et al. Beneficial effects of L-arginine on reducing obesity: Potential mechanisms and important implications for human health. Vol. 39, Amino Acids. Springer-Verlag Wien; 2010. p. 349– 57. 55. Leal J, Teixeira-Santos L, Pinho D, Afonso J, Carvalho J, de Lourdes Bastos M, et al. L- proline supplementation improves nitric oxide bioavailability and counteracts the blood pressure rise induced by angiotensin II in rats. Nitric Oxide - Biol Chem 2019;82:1–11 56. Conceição EPS da, Madden CJ, Morrison SF. Glycinergic inhibition of BAT sympathetic premotor neurons in rostral raphe pallidus. Am J Physiol Regul Integr Comp Physiol 2017;312:R919–26 57. Alves A, Bassot A, Bulteau AL, Pirola L, Morio B. Glycine metabolism and its alterations in obesity and metabolic diseases. Nutrients 2019;11:1356 58. Schneeberger M, Everard A, Gómez-Valadés AG, Matamoros S, Ramírez S, Delzenne NM, et al. Akkermansia muciniphila inversely correlates with the onset of inflammation, altered adipose tissue metabolism and metabolic disorders during obesity in mice. Sci Rep 2015;5:16643 59. Everard A, Matamoros S, Geurts L, Delzenne NM, Cani PD. Saccharomyces boulardii administration changes gut microbiota and reduces hepatic steatosis, low-grade inflammation, and fat mass in obese and type 2 diabetic db/db mice. MBio 2014; 5:e01011- 14 60. Zhang X, Zhao Y, Zhang M, Pang X, Xu J, Kang C, et al. Structural changes of gut microbiota during berberine-mediated prevention of obesity and insulin resistance in high- fat diet-fed rats. PLoS One 2012;7:e42529 61. Jiang JC, Jaruga E, Repnevskaya M V, Jazwinski SM. An intervention resembling caloric restriction prolongs life span and retards aging in yeast. FASEB J 2000;14:2135–7 62. Aris JP, Alvers AL, Ferraiuolo RA, Fishwick LK, Hanvivatpong A, Hu D, et al. Autophagy and leucine promote chronological longevity and respiration proficiency during calorie restriction in yeast. Exp Gerontol 2013;48:1107–19 63. Edwards C, Canfield J, Copes N, Brito A, Rehan M, Lipps D, et al. Mechanisms of amino acid-mediated lifespan extension in Caenorhabditis elegans. BMC Genet. 2015;16(1):1–24. 64. Gallinetti J, Harputlugil E, Mitchell JR. Amino acid sensing in dietary-restriction-mediated longevity: roles of signal-transducing kinases GCN2 and TOR. Biochem J 2013;449:1–10 65. De Sousa-Coelho AL, Marrero PF, Haro D. Activating transcription factor 4-dependent induction of FGF21 during amino acid deprivation. Biochem J 2012;443:165–71 66. Wanders D, Burk DH, Cortez CC, Van NT, Stone KP, Baker M, et al. UCP1 is an essential mediator of the effects of methionine restriction on energy balance but not insulin sensitivity. FASEB J 2015;29:2603–15
40 Diabetes Page 42 of 75
Figure 1
180x159mm (300 x 300 DPI) Page 43 of 75 Diabetes
Figure 2
135x150mm (300 x 300 DPI) Diabetes Page 44 of 75
Figure 3
180x70mm (300 x 300 DPI) Page 45 of 75 Diabetes
Figure 4
179x135mm (567 x 567 DPI) Diabetes Page 46 of 75
Figure 5
180x111mm (300 x 300 DPI) Page 47 of 75 Diabetes
Figure 6
155x143mm (300 x 300 DPI) Diabetes Page 48 of 75
Figure 7
137x165mm (300 x 300 DPI) Page 49 of 75 Diabetes
Figure 8
152x177mm (300 x 300 DPI) Diabetes Page 50 of 75
Online Supplemental Materials
Manipulation of dietary amino acids prevents and reverses obesity in mice through multiple mechanisms that modulate energy homeostasis Chiara Ruocco, Maurizio Ragni, Fabio Rossi, Pierluigi Carullo, Veronica Ghini, Fabiana Piscitelli, Adele Cutignano, Emiliano Manzo, Rafael Maciel Ioris, Franck Bontems, Laura Tedesco, Carolina Greco, Annachiara Pino, Ilenia Severi, Dianxin Liu, Ryan P. Ceddia, Luisa Ponzoni, Leonardo Tenori, Lisa Rizzetto, Matthias Scholz, Kieran Tuohy, Francesco Bifari, Vincenzo Di Marzo, Claudio Luchinat, Michele O. Carruba, Saverio Cinti, Ilaria Decimo, Gianluigi Condorelli, Roberto Coppari, Sheila Collins, Alessandra Valerio, and Enzo Nisoli Page 51 of 75 Diabetes
Supplementary Figure 1 — EAA unlike CAA substitution reduces fat accumulation maintaining the healthy effect on glucose homeostasis also after a long period of treatment. A: Body length as nasal-to-anal distance (n = 8 mice per group) of mice fed with different dietary regimens for 6 and 80 weeks. B : Weight of different fat pads expressed as mg over whole-body weight C-G: Insulin tolerance tests (ITT) (C and F), pyruvate tolerance tests (PTT) (D and G), and glucose tolerance tests (E) in mice fed with chow, SFA, SFA-CAA, and SFA-EAA diets for 6 weeks or 11 months. iBAT, interscapular brown fat; iWAT, inguinal fat; eWAT, epididymal fat; mWAT, mesenteric fat. All data are presented as mean ± SEM. *P < 0.05, **P < 0.01 and ***P < 0.001 vs. SFA diet; #P < 0.05, ##P < 0.01, and ###P < 0.001 vs. SFA-CAA diet; §P < 0.05, §§P < 0.01, and §§§P < 0.001 vs. chow diet.
2 Diabetes Page 52 of 75
Supplementary Figure 2 — EAA-substituted diet prevents and reverses obesity and glucose imbalance induced either by consumption of HFD diet or in ob/ob mice. A: (Left) Body weight of mice fed with chow, HFD, HFD-EAA, and HFD-CAA diet at room temperature (n = 7-10 mice per group). After nine weeks (dashed line), mice fed with HFD were switched to either HFD-EAA diet (HFD > HFD-EAA) or HFD-CAA diet (HFD > SFA-CAA) (n = 5 mice per group). (Right) Body weight of mice fed with chow, HFD, HFD-EAA, and HFD-CAA diet for 18 weeks (n = 5 mice per group). B: Body composition: fat mass (left) and lean mass (right). C: Weight of different fat pads expressed as mg over whole-body weight. Mice in B and C were fed with HFD, HFD-EAA, and HFD-CAA for six weeks (n = 5-6 mice per group). D and E: Body weight (D) and glucose tolerance tests (GTT) (E) in ob/ob mice, housed at thermoneutrality (30 °C) and fed with SFA, SFA-EAA, and SFA-CAA for six weeks (n = 6 mice per group). F and G: Glucose homeostasis in HFD groups. GTT (F) and insulin tolerance tests (ITT) in mice fed with chow, HFD, HFD-EAA, and HFD-CAA diets for six weeks (n = 5 mice per group). All data are presented as mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. SFA or HFD diet; #P < 0.05, ##P < 0.01, and ###P < 0.001 vs. SFA-CAA diet and HFD-CAA; §P < 0.05, §§P < 0.01, and §§§P < 0.001 vs. chow diet.
3 Page 53 of 75 Diabetes
Supplementary Figure 3 — Effects on lipid homeostasis. A-C: Plasma concentrations of nonesterified fatty acids (NEFAs) (nmol/l) (A), cholesterol (mg/dl) (B), and triglycerides (mg/dl) (C). D-F: Hepatic content of NEFAs (nmol/mg protein) (D), total cholesterol (nmol/mg tissue) (E), and triglycerides (nmol/mg tissue) (F). G: Representative macroscopic pictures of the liver. H: Liver weight (mg/BW). I: Oxygen consumption rates (OCR) were normalized to mitochondrial protein content. Mitochondria were isolated from liver of mice fed with different dietary regimens for 6 weeks at room temperature. Data are presented as means ± SEM (n = 5-8 mice per group). *P < 0.05, **P < 0.01, and ***P < 0.001 vs. SFA-fed mice; §P < 0.05, §§P < 0.01, and §§§P < 0.001 vs. chow diet-fed mice; #P < 0.05, ##P < 0.01, ###P < 0.001 vs. SFA-CAA-fed mice; ¶¶P < 0.01 and ¶¶¶P < 0.001 vs. HFD-fed mice; †P < 0.05 and †††P < 0.001 vs. HFD-CAA-fed mice.
4 Diabetes Page 54 of 75
Supplementary Figure 4 — Plasma amino acid profile. A-R: Amino acid concentrations in plasma samples of mice fed with SFA, SFA-EAA, and SFA-CAA diet for six weeks at room temperature. Box plots, with center hinge representing the mean, and the upper and lower hinges representing the first and third quartiles; whiskers represent 1.5 times the interquartile range. All data are presented as mean ± SEM (n = 5 mice per group). *P < 0.05, **P < 0.01, and ***P < 0.001 vs. SFA diet; #P < 0.05, ##P < 0.01, and ###P < 0.01 vs. SFA-CAA.
5 Page 55 of 75 Diabetes
Supplementary Figure 5 — SFA-EAA diet consumption preserved energetic behavior. Mice fed with SFA, SFA-CAA, and SFA-EAA for 20 months at room temperature. A: Energetic behavior, as demonstrated by the percentage of winning in the tube test for social dominance, was preserved in mice fed with SFA-EAA compared to SFA and SFA-CAA diets. B: Anxiety-like behaviour, C: Motor activity and D: Episodic memory were similar in all dietary groups. Mice were subjected to familiarization (T1) and novel object recognition (T2). The novel object recognition task was performed using a delay time of 120 min. The performance was evaluated by calculating a discrimination index (N−F / N+F), where N = time spent exploring the new object during T2, F = time spent exploring the familiar object during T2. Mean ± SEM are reported (n = 5 mice per group). ***P < 0.001 vs. SFA- and SFA-CAA-fed mice (Student t-test) and ##P < 0.01 vs. SFA-and SFA- CAA-fed mice (Chi-square test).
6 Diabetes Page 56 of 75
Supplementary Figure 6 — Both EAA and CAA substitution does not affect food intake and stress response pathway linked to amino acid balance in both SFA and HFD diet. A-D: Food intake was measured twice a week in different models of obesity (n = 5-10 mice per group). E: Western blot analysis of (Ser51) phosphorylation of subunit of eukaryotic translation initiation factor 2 (eIF2)—a marker of kinase general control nonderepressible 2 (GCN2) kinase activity, the critical regulator of cellular responses under amino acid deficiency sensor—in hypothalamus and liver of mice fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature. One experiment representative of three reproducible ones is shown. CTRL+, internal positive control (i.e., amino acid starved HeLa cells). All data are presented as mean ± SEM.
7 Page 57 of 75 Diabetes
Supplementary Figure 7 — Energy metabolism in mice on HFD diets. A: Metabolic efficiency was calculated as the ratio between the body weight gain and the energy intake (i.e., total food consumed during five days or 2 weeks or 6 weeks). B and C: Energy expenditure (EE) (B) and respiratory exchange ratio (RER) (C) during one 24 h cycle. Mice in B and C were fed with HFD-CAA and HFD- EAA diets in two separate experiments for 2 or 6 weeks. All data are presented as mean ± SEM. *P < 0.05, and ***P < 0.001 vs. HFD-CAA diet.
8 Diabetes Page 58 of 75
Supplementary Figure 8 — SFA-EAA diet does not promote browning of iWAT. A: Relative mRNA levels of UCP1 and browning genes. B: Relative mRNA levels of eNOS and mitochondrial biogenesis genes. C: Mitochondrial DNA amount. D: Relative mRNA levels of lipolysis and fatty acid oxidation genes (left) and non-esterified fatty acid (NEFA) levels (right). The experiments were repeated at least three times. E: Hematoxylin and eosin staining of semithin sections (3 m) of iWAT. Scale bar, 50 m. All data are presented as mean ± SEM (n = 5 mice per group). *P < 0.05 vs. SFA- CAA diet.
9 Page 59 of 75 Diabetes
Supplementary Figure 9 — SFA-EAA diet confirms its thermogenic effects on iWAT and iBAT of ob/ob mice. A: Uncoupled (i.e., with oligomycin) and maximal (i.e., with FCCP) oxygen consumption rates (OCR) in mitochondria isolated from iWAT; respiration was normalized to mitochondrial protein content (n = 5 mice per group). B: iBAT temperature measurement with Flir camera (n = 6 mice per group). C: Western blot analysis of UCP1 and vinculin protein expression in iBAT. One experiment representative of three reproducible ones (n = 5 mice per group). D: UCP-1-dependent (i.e., ΔGDP) and maximal (i.e., with FCCP) OCR in iBAT mitochondria (n = 6 mice per group); respiration was normalized to mitochondrial protein content. ob/ob mice in A-D were fed with SFA- CAA and SFA-EAA diet for six weeks at thermoneutrality. All data are presented as mean ± SEM. *P < 0.05 and ***P < 0.001 vs. SFA-CAA diet.
10 Diabetes Page 60 of 75
Supplementary Figure 10 — SFA-EAA diet does not promote futile cycle activation or mitochondrial biogenesis stimulation in adipose and muscle. A-C: Relative mRNA levels of futile cycles genes, including glycerol phosphate shuttle in iWAT and gastrocnemius (A), creatine-driven substrate cycle in iWAT and iBAT (B), and calcium release and reuptake cycle in gastrocnemius (ATPase Sarcoplasmic/Endoplasmic Reticulum Calcium Transporting 1 - ATP2A1) (C) of mice fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature. D-F: Mitochondrial biogenesis and function in gastrocnemius muscle of mice fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature. Relative mRNA levels of mitochondrial biogenesis genes (D), citrate synthase activity (normalized to protein content) (E), and oxygen consumption rates (OCR) (normalized to mitochondrial protein content) (F). All data are presented as mean ± SEM (n = 5-6 mice per group).
11 Page 61 of 75 Diabetes
Supplementary Figure 11 — SFA-EAA diet increases expression of genes involved in mitochondrial biogenesis, thermogenesis, lipolysis, and fatty acid oxidation in iBAT of mice fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature. A: Relative mRNA levels of thermogenic genes. B: Relative mRNA levels of mitochondrial biogenesis genes. C: Mitochondrial DNA (mtDNA) amount. D: Relative mRNA levels of lipolysis and fatty acid oxidation (FAO). The experiments were repeated at least three times. E: Lipid droplets in iBAT slices (toluidine blue staining) and lipid droplet area and density. Scale bar, 25 m. F: Non-esterified free fatty acid (NEFA) levels. G: Carnitine palmitoyltransferase I (CPT1) activity in iBAT mitochondria. All data are presented as mean ± SEM (n = 5-6 mice per group). *P < 0.05 and **P < 0.01 vs. SFA-CAA diet.
12 Diabetes Page 62 of 75
Supplementary Figure 12 — SFA-EAA diet does not induce production of thermogenic FGF21 and long-chain acylcarnitines. A: Relative mRNA levels of Fgf21 gene in different tissues of mice fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature. B: Plasma FGF21 concentrations in mice fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature. C: Serum long-chain acylcarnitine levels of mice fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature analyzed using tandem mass spectrometry. D: Relative mRNA levels of genes implicated in acylcarnitine synthesis in different tissues of mice fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature. The experiments were repeated at least three times. CrAT, carnitine acetyltransferase; Cact, carnitine-acylcarnitine translocase; CPT1a, carnitine palmitoyltransferase 1a; CPT1b, carnitine palmitoyltransferase 1b; Octn2, organic cation transporter type 2. All data are presented as mean ± SEM (n = 5 mice per group). *P < 0.05 and **P < 0.01 vs. SFA-CAA diet.
13 Page 63 of 75 Diabetes
Supplementary Figure 13 — mTORC1 signaling contributes to iBAT thermogenesis induced by SFA-EAA diet under different experimental settings. A: Western blot analysis of (Ser 235/236) phosphorylated S6 and S6 protein levels in iBAT of ob/ob mice fed with SFA-CAA and SFA-EAA diet for six weeks at thermoneutrality. One immunoblot experiment representative of three reproducible ones (n = 3-5 mice per group). B: Western blot analysis of mTORC1 pathway in iBAT, iWAT, and muscle of mice fed with SFA, SFA-CAA, and SFA-EAA diet for six weeks at room temperature (n = 4 mice per group). C: Body weight (left) and fat depots (expressed as mg over whole-body weight) (right). D: Food intake (expressed as kcal per mouse per day). Mice in C and D were fed with SFA-CAA and SFA-EAA diet for six weeks at room temperature, with or without Rapa (i.p. 2.5 mg/kg body weight) delivered in 200 μl, 5 days per week for six weeks, starting with diets (n = 5-6 mice per group). All data are presented as mean ± SEM. *P < 0.05 and **P < 0.01 vs. Veh- treated mice fed with SFA-CAA diet.
14 Diabetes Page 64 of 75
Supplementary Table 1 — Diet compositions
Dietary interventions % kcal from SFA SFA-EAA SFA-CAA HFD HFD-EAA HFD-CAA Protein 20 20 20 20 20 20 Carbohydrate 70 70 70 20 20 20 Fat 10 10 10 60 60 60 kcal/g 3.8 3.8 3.8 5.2 5.2 5.2 Amino acid sources SFA SFA-EAA SFA-CAA HFD HFD-EAA HFD-CAA Amino acids (g) caseina caseinb EAAmc caseinb CAAmd caseina caseinb EAAmc caseinb CAAmd Leucine 18 1.17 58.6 1.17 16.8 18 1.17 58.6 1.17 16.8 Valine 10.6 0.69 29.22 0.69 9.91 10.6 0.69 29.22 0.69 9.91 Lysine 15 0.98 30.34 0.98 14.03 15 0.98 30.34 0.98 14.03 Isoleucine 8.6 0.56 29.22 0.56 8.04 8.6 0.56 29.22 0.56 8.04 Threonine 8.2 0.53 16.48 0.53 7.67 8.2 0.53 16.48 0.53 7.67 Histidine 5.2 0.34 7.12 0.34 4.86 5.2 0.34 7.12 0.34 4.86 Cysteine 3.4 0.09 7.12 0.09 1.31 3.4 0.09 7.12 0.09 1.31 /cystinee Phenylalanine 9.6 0.62 4.68 0.62 8.98 9.6 0.62 4.68 0.62 8.98 Methionine 5.8 0.38 2.44 0.38 5.42 5.8 0.38 2.44 0.38 5.42 Tyrosine 10.4 0.68 1.31 0.68 9.72 10.4 0.68 1.31 0.68 9.72 Tryptophan 2.4 0.17 0.94 0.17 2.24 2.4 0.17 0.94 0.17 2.24 Alanine 5.8 0.4 - 0.4 5.42 5.8 0.4 - 0.4 5.42 Arginine 6.8 0.44 - 0.44 6.36 6.8 0.44 - 0.44 6.36 Aspartic acid 13.8 0.9 - 0.9 12.9 13.8 0.9 - 0.9 12.9 Glutamic acid 43.4 2.82 - 2.82 40.58 43.4 2.82 - 2.82 40.58 Glycine 3.4 0.22 - 0.22 3.18 3.4 0.22 - 0.22 3.18 Proline 20.2 1.31 - 1.31 18.89 20.2 1.31 - 1.31 18.89 Serine 11.4 0.74 - 0.74 10.66 11.4 0.74 - 0.74 10.66 Caloric amino acid intakef Δ Δ caloric caloric Δ caloric HFD- Δ caloric kcal/day SFA SFA-EAA intake SFA-CAA intake HFD HFD-EAA intake CAA intake Leucine 1.041 3.425 2.384 1.042 0.001 1.027 3.326 2.299 1.029 0.003 Valine 0.585 1.709 1.125 0.620 0.035 0.577 1.660 1.084 0.612 0.036 Lysine 0.864 1.785 0.921 0.871 0.007 0.852 1.733 0.882 0.860 0.009 Isoleucine 0.497 1.704 1.207 0.498 0.001 0.490 1.655 1.165 0.492 0.002 Threonine 0.474 0.973 0.500 0.481 0.008 0.467 0.945 0.478 0.476 0.009 Histidine 0.296 0.419 0.123 0.296 0.000 0.292 0.407 0.115 0.292 0.000 Cysteine 0.192 0.405 0.213 0.189 0.393 0.204 0.077 -0.113 /cystinee 0.078 -0.114 Phenylalanine 0.563 0.307 -0.256 0.560 -0.003 0.555 0.299 -0.257 0.553 -0.002 Methionine 0.348 0.152 -0.196 0.329 -0.019 0.343 0.148 -0.195 0.325 -0.018 Tyrosine 0.591 0.110 -0.481 0.606 0.015 0.582 0.106 -0.476 0.598 0.016 Tryptophan 0.147 0.067 -0.080 0.141 -0.006 0.145 0.065 -0.080 0.140 -0.006 Alanine 0.329 - - 0.343 0.013 0.325 - - 0.338 0.014 Arginine 0.386 - - 0.389 0.003 0.380 - - 0.384 0.004 Aspartic acid 0.781 - - 0.807 0.026 0.770 - - 0.797 0.027 Glutamic acid 2.205 - - 2.499 0.294 2.174 - - 2.469 0.294 Glycine 0.192 - - 0.201 0.009 0.189 - - 0.199 0.010 Proline 1.147 - - 1.180 0.033 1.131 - - 1.165 0.035 Serine 0.647 - - 0.667 0.020 0.638 - - 0.659 0.021
15 Page 65 of 75 Diabetes
aSingle amino acid amount in 200 g of casein (composition provided by Research Diets); bsingle amino acid amount in 13 g of casein; csingle amino acid amount of EAAm [the specific amino acid formula is stoichiometrically similar to a mixture we previously found to promote mitochondrial biogenesis in cardiac and skeletal muscle when administered via drinking water (32)]; and dCAAm, purified amino acid mixture designed on the amino acid profile of casein. The amount of EAA and CAA mixture in the substituted diets was calculated as 93.5 % casein content (187 g out 200 g); ereported amount is equal to the cysteine/cystine ratio typically present in 200 g casein (i.e., 1.4 g) added with further 3.0 g cystine; fcaloric amino acid intakes (kcal/day) were determined on average kcal/day consumed by mice fed with SFA (14.44 ± 0.61 kcal/day), SFA-EAA (14.29 ± 0.45 kcal/day), SFA-CAA (14.54 ± 0.61 kcal/day), HFD (14.24 ± 0.45 kcal/day), HFD-EAA (13.88 ± 0.73 kcal/day), and HFD-CAA (14.36 ± 0.33 kcal/day). The optimal amino acid amounts in the diets were assessed by preliminary experiments, in which different percentages of casein were substituted with the EAA mixture.
16 Diabetes Page 66 of 75
Supplementary Table 2 — Antibodies and assay kits
REAGENT SOURCE CAT. # SAMPLE TYPE Assay kits Leptin (mouse) ELISA Kit Enzo Life Sciences ADI-900-019A Plasma Mouse Adiponectin ELISA Kit Abcam ab108785 Plasma Mouse/Rat FGF-21 Quantikine R&D Systems MF2100 Plasma, iWAT, iBAT, liver ELISA Kit TSH (Rodent) ELISA Kit Abnova KA2336 Plasma Free Fatty Acid Quantification BioVision K612-100 Plasma, iWAT, iBAT, liver Colorimetric/Fluorometric Kit Mouse Ultrasensitive Insulin Alpco 80-INSMSU-E01 Plasma ELISA kit Mouse IGF-1 ELISA Kit Thermo Fisher Scientific EMIGF1 Plasma Cholesterol Assay Kit Abcam ab65390 Plasma, Liver Triglyceride Assay Kit Abcam ab65336 Plasma, Liver Antibodies iWAT, iBAT, gastrocnemius, anti-p-S6 (Ser235/236) Cell Signaling 2211 primary brown adipocytes iWAT, iBAT, gastrocnemius, anti-S6 Cell Signaling 2217 primary brown adipocytes anti-p-4EBP1 (Thr37/46) Cell Signaling 2855 iWAT, iBAT, gastrocnemius anti-4EBP1 Cell Signaling 9644 iWAT, iBAT, gastrocnemius anti p-eIF2α Cell Signaling 3398 Hypotalamus, Liver anti eIF2α Cell Signaling 5324 Hypotalamus, Liver anti-COX IV Cell Signaling 4844 iBAT anti-Cyt c Cell Signaling 4280 iBAT iWAT, iBAT, anti-UCP1 Abcam ab23841 primary brown adipocytes iBAT, anti-GAPDH Cell Signaling 2118 primary brown adipocytes anti-HSP60 Cell Signaling 4870 iWAT anti-vinculin Sigma Aldrich V9131 iBAT
17 Page 67 of 75 Diabetes
Supplementary Table 3 — Mass spectrometry parameters
Amino acid RT (min) m/z Calibration curve r Alanine 2.86 260.1 y = 13573.47x 0.99 Glycine 2.51 246.1 y = 11700.40x 0.99 Isoleucine 5.88 302.1 y = 11676.90x 0.97 Phenylalanine 6.53 336.1 y = 6553.14x 0.96 Valine 4.06 288.1 y = 16128.62x 0.97 Threonine 2.74 290.1 y = 8556.89x 0.99 Serine 2.46 276.1 y = 8505.54x 0.99 Tyrosine 3.62 352.1 y = 2392.91x 0.97 Glutamine 2.44 317.1 y = 3891.44x 0.93 13 Arginine- C6 2.33 351.2 y = 476.85x 0.98 Lysine-D4 3.81 321.1 y = 1637.19x 0.98 Proline 2.98 286.1 y = 10992.47x 0.98 Aspartic acid 2.57 304.1 y = 4061.32x 0.92 Glutamic acid 2.65 318.1 y = 3228.65x 0.97 Histidine 1.91 326.1 y = 220.13x 0.98 Methionine 3.89 320.1 y = 5644.93x 0.96 Asparagine 2.29 303.1 y = 3236.46x 0.99 Leucine 6.18 302.1 y = 13907.29x 0.98 Tryptophan 6.57 375.1 –
18 Diabetes Page 68 of 75
Supplementary Table 4 — Levels of free amino acids in iBAT of mice fed with SFA-CAA or SFA-EAA diet (iBAT aminograms)
SFA-CAA SFA-EAA
pmol/mg iBAT % pmol/mg iBAT % Fold change P Leucine 15.11 0.65 1.3 29.77 1.12 2.5 1.97 0.03 Lysine 68.61 1.06 6.0 23.84 1.51 1.9 0.35 0.04 Isoleucine 15.97 0.92 1.4 34.90 2.06 3.0 2.19 0.04 Valine 10.85 1.73 0.9 31.18 0.78 2.6 2.87 0.03 Threonine 21.84 1.81 1.9 157.88 2.81 13.0 7.23 0.02 Cysteine/cystine ------Histidine ------Phenylalanine 23.99 1.78 2.1 22.25 1.23 1.8 0.93 0.95 Methionine ------Tyrosine 31.10 3.72 2.7 29.22 2.20 2.4 0.94 0.98 Tryptophan ------Alanine 285.14 36.52 24.9 260.51 52.36 21.4 0.91 0.97 Arginine 37.56 1.42 3.3 70.73 2.12 5.8 1.88 0.04 Aspartic acid 20.73 2.34 1.8 19.22 3.73 1.6 0.93 0.62 Glutamic acid 371.08 25.40 32.4 343.99 26.84 28.3 0.93 0.92 Glycine 124.19 18.95 10.8 91.57 13.56 7.5 0.74 0.04 Proline 4.85 1.75 0.4 87.79 1.43 7.2 18.12 0.03 Serine 114.27 9.64 10.0 13.13 1.22 1.1 0.11 0.03
Amino acid levels in iBAT were measured with UPLC-MS/MS (in technical triplicates) after night consumption of SFA-CAA or SFA-EAA diets (6 weeks of treatment) (n = 5 mice per group). Increased amino acids in SFA-EAA- vs SFA-CAA-fed mice (in red); decreased amino acids in SFA- EAA- vs SFA-CAA-fed mice (in blue); undetected amino acid (in grey). The amino acid percentages (w/V) (grey shadow) were used to prepare EAA and CAA mixtures for the in vitro experiments. Values are expressed as mean ± SEM.
19 Page 69 of 75 Diabetes
Supplementary Table 5 — Primers for qRT-PCR
PCR Gene Primer Sense (5'-3') Primer Antisense (5'-3') Product Ta (°C) (bp) Acadl TGGGGACTTGCTCTCAACA GGCCTGTGCAATTGGAGTA 62 58 Atgl CAGCACATTTATCCCGGTGTAC AAATGCCGCCATCCACATAG 76 61 ATP2A1 TGCTGCTTTGCTCGTGTGGA CGGCCTTCTTCAGAGCAGGG 124 63 Cact GGTGGCTGTCCAGACAAACT TCCGTTTAAGAACCTCCTGG 122 59 CD137 CGTGCAGAACTCCTGTGATAAC GTCCACCTATGCTGGAGAAGG 103 60 CKMT2 GCATGGTGGCTGGTGATGAG AAACTGCCCGTGAGTAATCTTG 146 61 COX IV TGGGACTATGACAAGAATGAGTGG TTAGCATGGACCATTGGATACGG 113 63 CPT1a CGTTACTTCAAGGTCTGGCTCTAC GCTGCGGCTCTGAGGTGTC 103 62 CPT1b TGCCAGCCACAATTCACC GTCACTCACATAGTTAGTTGCC 167 58 CrAT GTTTCACCTGGGCCGCACTG TCAGTGTAGGCTCGGTGGGC 146 65 Cyt c ATAGGGGCATGTCACCTCAAAC GTGGTTAGCCATGACCTGAAAG 172 61 DIO2 GTCCGCAAATGACCCCTTT CCCACCCACTCTCTGACTTTC 65 59 eNOS CCTTCCGCTACCAGCCAGA CAGAGATCTTCACTGCATTGGCTA 105 61 FGF21 CTGCTGCTGGCTGTCTTCC GTCTTGGTCGTCATCTGTGTAG 124 60 GAMT GCACCTACCCTGCCTGACGG CCCCGGTCTTCAGCAAGCG 130 64 GAPDH AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA 183 60 GATm GACCTGGTCTTGTGCTCTCC GGGATGACTGGTGTTGGAGG 103 60 gDNA CGTGATCGTAGCGTCTGGTT GGTCGCGGTGTGGGCATTTG 108 62 Hsl GCTGGAGGAGTGTTTTTTTGC AGTTGAACCAAGCAGGTCACA 63 60 mGPDH TGCCCGGATACTACAGCCCT GCGTATCAGTGGTGCCAGCA 117 63 mtDNA ACATGCAAACCTCCATAGACCGG TCACTGCTGAGTCCCGTGGG 131 63 NRF-1 ACAGATAGTCCTGTCTGGGGAAA TGGTACATGCTCACAGGGATCT 99 61 Octn2 AAGACCTGCAGGAAGCTGAA TCCTTGTTTTTCGTGGGTGT 127 57 PGC-1α ACTATGAATCAAGCCACTACAGAC TTCATCCCTCTTGAGCCTTTCG 148 61 Pm20d1 GGCTTCATCTATGGCCGGGG ACACCTCCTCATCATGGCCCA 139 63 PRDM16 CTACAGGGTAGAAAAGCGGAAGG TGGTTTCTATGGCTGACATCTGG 110 63 Tbp CCCACAACTCTTCCATTCTCAAAC ACAGCCAAGATTCACGGTAGATAC 174 65 Tbx1 GGCAGGCAGACGAATGTTC TTGTCATCTACGGGCACAAAG 101 60 Tfam AAGACCTCGTTCAGCATATAACATT TTTTCCAAGCCTCATTTACAAGC 104 60 TFIIb TGGAGATTTGTCCACCATGA GAATTGCCAAACTCATCAAAACT 66 56 Tmem26 ACCCTGTCATCCCACAGA TGTTTGGTGGAGTCCTAA 119 55 UCP1 ACAGTACCCAAGCGTACCAAGC TGTTCAAAGCACACAAACATGATG 135 63
Ta, temperature of annealing; Acadl, acyl-coenzyme A dehydrogenase, long-chain; Atgl, adipose triglyceride lipase; ATP2A1, ATPase, Ca++ transporting, cardiac muscle, fast twitch 1; Cact, mitochondrial carnitine/acylcarnitine translocase; CD137, tumor necrosis factor receptor superfamily, member 9; CKMT2, creatine kinase, mitochondrial 2; COX IV, cytochrome c oxidase subunit IV; CPT1a, carnitine palmitoyltransferase 1a; CPT1b, carnitine palmitoyltransferase 1b; CrAT, carnitine acetyltransferase; Cyt c, cytochrome c; DIO2, type 2 iodothyronine deiodinase; eNOS, endothelial nitric oxide synthase; FGF21, fibroblast growth factor 21; GAMT, guanidinoacetate methyltransferase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GATm, glycine amidinotransferase; gDNA, genomic DNA (chromosome 5 Actb); mGPDH, glycerol phosphate dehydrogenase 2; mtDNA, mitochondrial DNA; NRF1, nuclear respiratory factor 1; Octn2, organic cation transporter 2; PGC-1, peroxisome proliferator-activated receptor coactivator 1; Pm20d1, peptidase M20 domain containing 1; PRDM16, PR domain containing 16; Tbp, TATA box binding protein; Tbx1, T-box 1; Tfam, transcription factor A; TFIIb, general transcription factor IIB; Tmem26, transmembrane protein 26; UCP1, uncoupling protein 1. 20 Diabetes Page 70 of 75
Supplementary Table 6 — Plasma analysis in mice fed with SFA-CAA and SFA-EAA diet for 6 weeks at room temperature
SFA-CAA SFA-EAA U mean SEM mean SEM P Alanine amino transferase (ALT) IU/L 46.5 6.0 27.0 6.5 0.16 Aspartate amino transferase IU/L 104.0 25.0 98.0 26.0 0.88 (AST) γ-Glutamyl transferase (GGT) IU/L 3.0 0.4 3.2 0.3 0.62 Alkaline phosphatase (ALK) IU/L 5.0 0.1 5.1 0.5 0.23 Creatin kinase (CK) IU/L 1713.5 716.5 644.5 112.5 0.28 Glucose mg/dL 151.5 9.5 159.0 36.0 0.86 P mg/dL 6.7 0.4 4.6 0.3 0.06 Ca mg/dL 4.0 0.2 4.3 0.1 0.08 Total bilirubin mg/dL 0.3 0.1 0.2 0.1 0.49 Total protein g/dL 5.0 0.5 5.2 0.2 0.33 Albumin g/dL 3.1 0.1 3.2 0.1 0.70 Urea nitrogen (BUN) mg/dL 18.5 1.5 15.5 0.5 0.20 Creatinine mg/dL 0.2 0.1 0.2 0.1 0.10 Na mEq/L 211.0 1.0 218.0 2.0 0.50 K mEq/L 6.4 0.6 5.6 0.4 0.38 Na/K ratio - 33.3 3.0 39.1 2.8 0.29 Cl mEq/L 79.0 1.0 81.0 1.0 0.29 Amylase IU/L 333.5 3.5 327.5 16.5 0.76 Total bile acids µmol/L 8.2 2.4 12.0 1.1 0.29 Insulin ng/mL 0.5 0.01 0.48 0.06 0.10 TSH pg/mL 352.5 50.3 376.2 48.6 0.12 Thyroxine (T4) ng/mL 57.2 1.8 47.8 0.8 0.06
Blood samples were collected by submandibular venipuncture, during the same time interval after a fasting period of 5 h. Clinical chemistry parameters and hormone levels in mice fed with SFA-CAA or SFA-EAA for 6 weeks at room temperature. Values are expressed as the mean ± SEM. P values are show as differences between dietary regimens (n = 4 mice per group).
21 Page 71 of 75 Diabetes
Supplementary Table 7 — Spearman’s correlation analysis
BW Adiposity GTT Liver weight Liver OCR Spearman P Spearman P Spearman P Spearman P Spearman P Alanine -0.11 0.70 -0.16 0.56 0.07 0.81 -0.32 0.25 0.35 0.20 Arginine 0.47 0.08 0.57 0.03 -0.26 0.35 0.45 0.089 -0.51 0.054 Aspartate 0.03 0.92 -0.05 0.86 -0.13 0.64 -0.20 0.48 0.24 0.39 Asparagine 0.08 0.79 0.20 0.47 0.08 0.77 -0.16 0.58 0.24 0.38 Glutamate -0.70 0.004 -0.54 0.04 -0.02 0.95 -0.74 0.002 0.58 0.02 Glutamine -0.02 0.940 0.13 0.64 0.19 0.50 -0.14 0.62 0.30 0.27 Glycine 0.22 0.44 0.27 0.33 0.06 0.84 -0.18 0.53 0.06 0.82 Histidine -0.77 0.001 -0.64 0.01 0.08 0.79 -0.85 0.0001 0.61 0.02 Isoleucine -0.55 0.03 -0.44 0.101 0.34 0.22 -0.19 0.51 0.24 0.40 Leucine -0.47 0.08 -0.52 0.05 0.12 0.67 -0.17 0.55 0.19 0.49 Lysine -0.29 0.30 -0.06 0.83 0.05 0.86 -0.47 0.08 0.41 0.13 Methionine 0.18 0.52 0.32 0.24 -0.39 0.15 0.13 0.65 -0.26 0.35 Phenylalanine -0.07 0.80 0.04 0.88 -0.52 0.16 -0.08 0.77 -0.11 0.70 Proline 0.17 0.54 -0.01 0.96 -0.33 0.24 0.05 0.86 -0.10 0.71 Serine 0.14 0.63 0.13 0.64 0.13 0.65 -0.27 0.33 0.08 0.77 Threonine -0.67 0.006 -0.69 0.0048 0.07 0.81 -0.40 0.14 0.45 0.09 Tyrosine 0.49 0.06 0.68 0.005 -0.22 0.43 0.19 0.50 -0.45 0.10 Valine -0.61 0.016 -0.63 0.0125 -0.04 0.88 -0.30 0.28 0.18 0.53
Amino acid plasma levels were correlated with body weight (BW), adiposity [i.e., epididymal white adipose tissue (eWAT) weight], glucose homeostasis [i.e., glucose tolerance test (GTT)], and liver parameters [liver weight and mitochondrial oxygen consumption rates (OCR)] measured after consumption of diets for six weeks. Positively and negatively Spearman correlation coefficient (r) with P values are shown.
22 Diabetes Page 72 of 75
Supplementary Table 8 — Influence of diets on energy metabolism
2 weeks 6 weeks SFA-CAA SFA-EAA SFA-CAA SFA-EAA
n = 7 n = 7 n = 6 n = 6 P P
VO2 (mL/h) 99.54 2.75 94.59 1.38 0.13 75.83 1.55 87.75 1.77 0.001
VO2 BW (mL/h/kg) 3691.33 128.13 3714.70 40.13 0.87 3341.69 36.69 3677.50 49.52 0.001
VO2 LM (mL/h/kg) 4946.10 125.13 4697.21 77.21 0.12 4307.04 56.77 4652.97 81.41 0.009 EE (kcal/h) 0.44 0.03 0.45 0.01 0.51 0.38 0.01 0.44 0.01 0.001
EEBW (kcal/h/kg) 18.21 0.64 18.18 0.20 0.97 17.20 0.29 18.08 0.22 0.042
EELM (kcal/h/kg) 24.40 0.62 22.99 0.40 0.08 22.87 0.40 25.45 0.59 0.007 Movement (counts/h) 14368.0 1131.9 15243.8 1549.1 0.65 21291.4 1369.9 19331.0 1148.7 0.334 HFD-CAA HFD-EAA HFD-CAA HFD-EAA
n = 5 n = 6 n = 5 n = 6 P P
VO2 (mL/h) 115.10 5.92 108.07 3.56 0.32 104.41 3.29 117.80 4.10 0.04
VO2 BW (mL/h/kg) 2463.27 76.77 2548.40 125.01 0.58 2281.02 60.83 2569.29 95.39 0.04
VO2 LM (mL/h/kg) 4836.70 149.38 4655.35 111.35 0.36 4401.70 87.59 5060.49 201.82 0.02 EE (kcal/h) 0.57 0.03 0.51 0.02 0.18 0.50 0.02 0.58 0.02 0.02
EEBW (kcal/h/kg) 11.89 0.37 12.16 0.60 0.71 11.76 0.42 13.56 0.53 0.03
EELM (kcal/h/kg) 23.34 0.74 22.21 0.53 0.25 20.92 0.48 23.02 0.52 0.02 Movement (counts/h) 12648.6 1766.2 14106.7 1362.8 0.55 16573.9 3628.7 15348.0 3088.3 0.80
Average 24 h oxygen consumption (VO2) and energy expenditure (EE) of mice fed for 2 or 6 weeks with SFA-CAA, SFA-EAA, HFD-CAA, or HFD-EAA. VO2 is expressed as mL/h/mouse, while EE is expressed as EE kcal/mouse/h. VO2 BW, VO2 LM, EEBW, and EELM are normalized by body weight (BW) and lean mass (LM), respectively. Average 24 h total movement is reported as activity number of x and y-axis infrared photobeam breaks (counts) per h. Values are reported as mean ± SEM. A separate experiment of indirect calorimetry was performed for each diet type (SFA or HFD) and time interval (2 or 6 weeks); thus P values are shown as differences between the single diet at the same time interval.
23 Page 73 of 75 Diabetes
Supplementary Table 9 — Relative abundance of microbial taxa at the genus level in gut microbiota of mice fed with SFA, SFA-CAA, and SFA-EAA diets for 6 weeks
SFA SFA-CAA SFA-EAA SFA vs SFA-CAA SFA vs SFA-EAA SFA-EAA vs SFA-CAA Taxa (Genus) mean SD mean SD mean SD P FDR P P FDR P P FDR P Acinetobacter 0.00160 0.00237 0.00605 0.00712 0.00122 0.00176 0.1545 0.6018 0.8398 1.0000 0.2257 0.4657 Actinomyces 0.00071 0.00189 0.00022 0.00065 0.00000 0.00000 0.8072 0.9213 0.2636 0.5979 0.3173 0.4657 Adlercreutzia 0.17391 0.12530 0.17204 0.07809 0.07314 0.04231 0.7898 0.9213 0.3284 0.6408 0.0963 0.3627 AF12 0.00200 0.00530 0.00000 0.00000 0.00000 0.00000 0.2636 0.6018 0.2636 0.5979 0.9422 1.0000 Akkermansia 14.8044 12.7593 22.3752 12.8806 29.2526 14.5437 0.2481 0.6018 0.0129 0.2420 0.0413 0.2913 Allobaculum 3.37911 4.59730 2.75129 3.48290 13.48335 5.82501 0.9292 0.9969 0.0005 0.0299 0.0003 0.0322 Anaerobacillus 0.00302 0.00660 0.00021 0.00063 0.00040 0.00120 0.3384 0.6129 0.4119 0.6808 0.9422 1.0000 Anaerofustis 0.00391 0.00544 0.00101 0.00162 0.00000 0.00000 0.4273 0.6615 0.0402 0.3788 0.0682 0.3279 Anaeroplasma 0.00000 0.00000 0.00000 0.00000 0.38383 1.15148 0.9352 1.0000 0.3711 0.6408 0.3173 0.4657 Anaerotruncus 0.03695 0.02349 0.06746 0.04771 0.02135 0.00710 0.1974 0.6018 0.8590 1.0000 0.0821 0.3436 Bacillus 0.00098 0.00170 0.00461 0.00975 0.00168 0.00504 0.5740 0.7814 0.4941 0.7567 0.3043 0.4657 Bacteroides 22.5826 9.78316 15.1754 12.7729 9.58613 7.19427 0.1309 0.6018 0.1551 0.5979 0.4057 0.5659 Bifidobacterium 0.00048 0.00128 0.00065 0.00141 3.55909 5.40134 0.6816 0.8710 0.0033 0.0919 0.0021 0.0705 Bilophila 0.03123 0.02346 0.04572 0.03626 0.02270 0.02689 0.3743 0.6129 0.3711 1.0000 0.2899 0.4657 Blautia 0.00026 0.00069 0.00045 0.00135 0.00037 0.00112 0.9352 0.9969 0.9352 1.0000 0.9422 1.0000 Brachybacterium 0.00084 0.00222 0.00000 0.00000 0.00000 0.00000 0.2636 0.6018 0.2636 0.5979 0.9422 1.0000 Brevundimonas 0.00227 0.00410 0.00000 0.00000 0.00033 0.00099 0.1037 0.6018 0.3384 0.6408 0.3173 0.4657 Candidatus arthromitus 0.08854 0.23426 0.00000 0.00000 0.00261 0.00782 0.2636 0.6018 0.8072 0.9915 0.3173 0.4657 Chryseobacterium 0.00212 0.00231 0.00191 0.00451 0.00195 0.00226 0.3408 0.6129 0.7758 0.9915 0.2143 0.4657 Citrobacter 0.00000 0.00000 0.00133 0.00205 0.00000 0.00000 0.1008 0.6018 0.3711 1.0000 0.0682 0.3279 Coprobacillus 0.00026 0.00069 0.00986 0.01145 0.01212 0.02616 0.0262 0.4632 0.1772 0.5979 0.4673 0.6362 Coprococcus 0.99149 0.48498 0.89902 0.51838 1.39069 1.62534 0.3743 0.6129 0.2863 0.6105 0.0821 0.3436 Corynebacterium 0.00084 0.00222 0.00000 0.00000 0.00000 0.00000 0.2636 0.6018 0.2636 0.5979 0.9422 1.0000 Curvibacter 0.00000 0.00000 0.00000 0.00000 0.00037 0.00112 0.9352 1.0000 0.3711 0.6408 0.3173 0.4657 Dehalobacterium 0.74957 0.39910 0.93851 0.51006 0.36417 0.26029 0.3284 0.6129 0.1551 0.5979 0.0696 0.3279 Delftia 0.00198 0.00212 0.00510 0.00374 0.00171 0.00157 0.0237 0.4632 0.2646 0.5979 0.1455 0.3797 Desulfovermiculus 0.00073 0.00193 0.00021 0.00063 0.00000 0.00000 0.8072 0.9213 0.2636 0.5979 0.3173 0.4657 Desulfovibrio 0.06065 0.16047 0.06638 0.13276 0.00000 0.00000 0.7844 0.9213 0.2636 0.5979 0.1468 0.3797 Dorea 0.11502 0.04637 0.22963 0.29937 0.07852 0.10686 0.2863 0.6105 0.1097 0.5392 0.0588 0.3279 Diabetes Page 74 of 75
Enterobacter 0.00088 0.00233 0.00083 0.00166 0.00000 0.00000 0.7844 0.9213 0.2636 0.5979 0.1468 0.3797 Enterococcus 0.02707 0.02873 0.07036 0.07258 0.01009 0.00541 0.0263 0.4632 0.7223 0.9490 0.0025 0.0705 Exiguobacterium 0.00000 0.00000 0.00135 0.00405 0.00000 0.00000 0.3711 0.6129 0.3711 1.0000 0.3173 0.4657 Facklamia 0.00000 0.00000 0.00086 0.00173 0.00000 0.00000 0.1931 0.6018 0.3711 1.0000 0.1468 0.3797 Flexispira 0.00052 0.00138 0.00000 0.00000 0.00000 0.00000 0.2636 0.6018 0.2636 0.5979 0.9422 1.0000 Helicobacter 2.03057 3.76863 0.05608 0.16305 0.64017 1.55791 0.4915 0.7006 0.7328 0.9518 0.2494 0.4657 Kocuria 0.00212 0.00240 0.00445 0.00515 0.00134 0.00236 0.3140 0.6129 0.6860 0.9252 0.1826 0.4128 Lactobacillus 0.72554 1.34432 0.69220 0.53928 4.34119 5.90851 0.0410 0.4632 0.0045 0.1009 0.0082 0.1316 Lactococcus 4.00347 6.68594 0.18356 0.10794 0.17767 0.37243 0.0004 0.0429 0.0019 0.0705 0.0963 0.3627 Leuconostoc 0.00044 0.00116 0.00175 0.00216 0.00069 0.00119 0.1772 0.6018 0.4278 0.6808 0.5946 0.7576 Microbacterium 0.00000 0.00000 0.00000 0.00000 0.00060 0.00121 0.9352 1.0000 0.1931 0.5979 0.1468 0.3797 Mitsuokella 0.00084 0.00222 0.00000 0.00000 0.00000 0.00000 0.2636 0.6018 0.2636 0.5979 0.9422 1.0000 Mucispirillum 0.16651 0.28652 1.17904 1.33989 0.83264 1.28583 0.1662 0.6018 0.0907 0.4917 0.9397 1.0000 Ochrobactrum 0.00210 0.00555 0.00043 0.00086 0.00037 0.00112 0.7844 0.9213 0.8072 0.9915 0.6267 0.7782 Odoribacter 1.77718 2.90161 6.42061 5.90189 1.58773 1.40149 0.0209 0.4632 0.2481 0.5979 0.0963 0.3627 Oscillospira 10.68389 5.36761 9.71479 4.11254 4.71619 3.33414 0.4772 0.6913 0.1826 0.5979 0.0821 0.3436 Parabacteroides 22.55795 16.67867 17.79957 9.94875 12.68725 6.17695 0.7898 0.9213 0.8590 1.0000 0.6501 0.7986 Paracoccus 0.00000 0.00000 0.00041 0.00124 0.00026 0.00079 0.3711 0.6129 0.3711 0.6408 0.9422 1.0000 Paraprevotella 0.00000 0.00000 0.07330 0.15711 0.00000 0.00000 0.1931 0.6018 0.0907 1.0000 0.1468 0.3797 Prevotella 0.00000 0.00000 0.00000 0.00000 0.00470 0.00986 0.9352 1.0000 0.1931 0.5979 0.1468 0.3797 Propionibacterium 0.00000 0.00000 0.00112 0.00270 0.00000 0.00000 0.1931 0.6018 0.0907 1.0000 0.1468 0.3797 Pseudomonas 0.00084 0.00222 0.00157 0.00340 0.00205 0.00231 0.6816 0.8710 0.1249 0.5880 0.1558 0.3828 Pseudoxanthomonas 0.00000 0.00000 0.00071 0.00153 0.00000 0.00000 0.1931 0.6018 0.0907 1.0000 0.1468 0.3797 Rhodococcus 0.00000 0.00000 0.00078 0.00175 0.00034 0.00101 0.1931 0.6018 0.3711 0.6408 0.6267 0.7782 Roseburia 0.00000 0.00000 0.07609 0.18854 0.00019 0.00056 0.1931 0.6018 0.3711 0.6408 0.4656 0.6362 Rothia 0.00084 0.00222 0.00000 0.00000 0.00000 0.00000 0.2636 0.6018 0.2636 0.5979 0.9422 1.0000 Ruminococcus 3.52180 2.12668 4.36248 2.04570 2.51037 2.05136 0.4772 0.6913 0.7898 0.9915 0.5453 0.7166 Salana 0.00071 0.00189 0.00000 0.00000 0.00026 0.00079 0.2636 0.6018 0.9352 1.0000 0.3173 0.4657 Serratia 0.00674 0.00730 0.01162 0.00746 0.00393 0.00279 0.1301 0.6018 0.5901 0.8286 0.1735 0.4000 SMB53 0.00942 0.01527 0.00168 0.00361 0.00267 0.00414 0.0689 0.6018 0.5690 0.8139 0.2257 0.4657 Sphingobacterium 0.00000 0.00000 0.00100 0.00299 0.00000 0.00000 0.3711 0.6129 0.0907 1.0000 0.3173 0.4657 Staphylococcus 0.01643 0.01300 0.02407 0.01899 0.00347 0.00406 0.4499 0.6870 0.0725 0.4494 0.0182 0.1884 Streptococcus 0.02200 0.03673 0.01224 0.00764 0.00430 0.00477 0.3733 0.6129 0.5264 0.7736 0.1478 0.3797 Sutterella 0.81837 1.05663 3.53592 7.35599 6.87912 6.33044 0.2481 0.6018 0.0005 0.0299 0.0041 0.0920 Turicibacter 1.69882 3.94318 0.29104 0.58247 1.44283 2.06308 0.0854 0.6018 0.6877 0.9252 0.0692 0.3279 Other 4.50579 3.64642 5.96632 3.69171 3.50317 4.03575 0.9352 0.9969 0.1059 0.9915 0.9422 0.1884
25 Page 75 of 75 Diabetes
[Prevotella] 0.51313 1.16283 0.89861 0.25728 0.68826 0.98051 0.0179 0.4632 0.2431 0.5979 0.1730 0.4000 [Ruminococcus] 2.46031 0.66873 2.98674 3.69159 1.07346 0.92375 0.9292 0.9969 0.0330 0.3387 0.0233 0.1884 Unassigned 0.12355 0.31389 2.87607 2.19429 0.20738 0.25575 0.1309 0.6018 0.1059 0.9915 0.1124 0.3797
Data are presented as percentage (mean ± SD). The non-parametric Kruskal Wallis test was used for the comparison of relative abundances of microbial taxa between groups, and the resulting P values were corrected (Bonferroni correction) for multiple testing controlling the false discovery rate (FDR P value).
26 Diabetes Page 76 of 75
Supplementary Table 10 — Amino acid amounts in SFA-EAA diet compared to the amino acid requirements of mice
SFA-EAA (RD number: D14032501) NRC Amino Grams Guidelines Ingredients g/kg diet acids in formulaa (g/kg diet)b Protein Leucine 59.77 7.0 Casein 200 Valine 29.91 5.0 Lysine 31.32 4.0 Carbohydrates Isoleucine 29.78 4.0 Corn Starch 452 Threonine 17.01 4.0 Maltodextrin 75 Histidine 7.46 2.0 Sucrose 173 Cysteine/cystine 7.21 Cellulose 50 Phenylalanine 5.3 7.6 Methionine 2.82 5.0 Fat Tyrosine 1.99 Soybean oil 25 Tryptophan 1.11 1.0 Lard 20 Alanine 0.4 Mineral Mix S10026 10 Arginine 0.44
CaHPO4 13 Aspartic acid 0.9
CaCO3 5.5 Glutamic acid 2.82 Potassium Citrate 16.5 Glycine 0.22 Vitamin Mix 10 Proline 1.31 Choline Bitartrate 2 Serine 0.74 aTotal amino acid amount derived from casein (13 g) and EAAm; bessential amino acid amounts for mice as recommended by the U.S. National Research Council (NRC) (Nutrient Requirements of Laboratory Animals. Fourth Revised Edition, 1995).