Nrg4 and Gpr120 Signalling in Brown Fat Anthony Chukunweike OKOLO

Nrg4 and Gpr120 Signalling in Brown Fat

Anthony Chukunweike OKOLO

Institute of Reproductive and Developmental Biology

Department of Surgery and Cancer

Faculty of Medicine

Imperial College London

A thesis submitted in fulfilment of the requirements for award of the

degree of Doctor of Philosophy

Statement of Originality

All experiments included in this thesis were performed by me unless otherwise stated in the text.

The copyright of this thesis rests with the author and is made available under a Creative

Commons Attribution Non-Commercial No Directive Licence. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, and they do not use it for commercial purposes, and they do not alter, transform or build upon it. For any re-use or re-distribution, researchers must make clear to others the licence terms of this work.

Acknowledgments

I would like to thank my supervisors Dr Aylin Hanyaloglu and Dr Mark Christian for giving me the great opportunity to work in their labs. Aylin put in a great deal of effort especially in area of Gpr120 signalling, including having to guide me through the critical imaging procedures. Aylin and Mark contributed a great deal towards the final edition of this thesis. I would also like to thank Dr Mark Christian for bringing me to Imperial College London to start off my PhD in his laboratory, and for being a great mentor and a continuous source of knowledge for me. I am grateful for your enduring patience in trying to bring out the best in me and ensuring that I develop the ‘critical thinking’ that is needed as a scientist. My special thanks go to Prof Malcolm Parker, who has always put in his special professorial touch to my work, and to Prof Ilpo Huhtaniemi for setting up my admission, and indeed my sojourn in

Imperial College.

I would especially like to thank Dr Kunal Shah and Dr Evanthia Nikolopoulou who were my senior PhD students. They took the pains to teach me the rudiment of Laboratory practices. I will also like to appreciate Dr David Barneda-Ciurana for guiding me through the rough beginning of my laboratory work. My special thanks also go to Dr Olayiwola Oduwole for our long friendly and scientific conversations, Dr Usi Oboh and Mr and Mrs Andy Evans for happily receiving me in the UK. I would also like to thank my lab mates Dr Jenny Steel, Dr

Kim Jonas, Camilla West, Camilla Larson, Natarin Caegprasath, and Silvia Sposini for the years working and sharing together as a real team.

Finally, I would like to express my appreciation to my Love, friend and confidant, Modupe and my jewels, Oyiye, Chineme, Okuolise and Chimamaka for their enduring love and affection.

This acknowledgement will not be complete without mentioning ETF, Nigerian for initiating the funding for my PhD, and the department of Surgery and Cancer, Imperial College

London, for ensuring that my PhD was completed.

Abstract

Brown adipose tissue (BAT) dissipates energy, whereas white adipose tissue (WAT) is an energy storage site. The worldwide increase in obesity and its associated metabolic complications represents a growing challenge for health care systems. With the recent demonstration of significant deposits of adult human BAT, and that WAT is dynamic and can gain BAT characteristics, there is therefore a possibility for manipulative control of energy homeostasis via the induction of specific genes to enhance BAT levels. Nrg4 and Gpr120 are two genes we identified to be highly expressed in BAT and regulated in a temperature- dependent manner. Nrg4 is a member of the Neuregulin family that activates the ErbB-4

(HER4) tyrosine kinase receptor. Nrg4 was secreted from brown adipocytes and promoted neurite outgrowth, a function that may improve BAT thermogenesis by enhancing sympathetic innervation.

Gpr120 is a member of the superfamily of G protein-coupled receptors that is activated by long chain fatty acids. Although Gpr120 is known to mediate anti-inflammatory and insulin- sensitizing effects in humans and mice, its role in BAT is unknown. In order to identify the signalling pathways and downstream functions activated by this receptor in brown adipocytes, distinct known and novel Gpr120 ligands, GW9508, TUG891 and TUG1096, were employed. These ligands increased expression of genes associated with glucose and fatty acid metabolism and reduced inflammatory gene markers. All of these effects were reversed in Gpr120 knockout cells. However, the levels of gene expression varied considerably with each ligand.

Although Gpr120 is a known Gαq/11-coupled receptor in other cell systems, these distinct ligands exhibited various degrees of bias towards Gαq/11 and distinct signalling pathways.

These findings could provide insight into the requirements for Gpr120 function in BAT, the

exploitation of which could generate ligands for therapeutic benefit and represents a promising opportunity to develop safer and more efficacious drugs.

Table of content

Statement of Originality ...... 2 Copyright statement ...... 3 Acknowledgments...... 4 Abstract ...... 6 List of Figures…………………………………………………………………………………………………………………………………..14

List of Tables……………………………………………………………………………………………………………………………………17

List of Abbreviations ...... 148 Chapter 1 ...... 23 Introduction ...... 23 Introduction ...... 24 1.1 Adipose tissue and adipocytes...... 24 1.1.2 White adipose tissue (WAT) ...... 24 1.1.3 Brown adipose tissue (BAT) ...... 25 1.2 Development of adipose tissues ...... 27 1.3 Beige/brite ...... 28 1.4 Dynamic nature of adipose tissue...... 30 1.5 Human BAT ...... 31 1.6 Measurement of BAT ...... 33 1.7 BAT Thermogenesis ...... 33 1.7.1 Role of UCP1 in BAT thermogenesis ...... 34 1.7.2 Role of adrenergic signalling in thermogenesis ...... 35 1.8 Transcriptional control of brown fat development and function ...... 38 1.9 BAT and obesity...... 39 1.10 Free fatty acids (FFAs) ...... 42 1.11 Fatty acid metabolism ...... 42 1.11.1 Lipogenesis ...... 42 1.11.2 Lipolysis ...... 43 1.11.3 Regulation of fatty acid metabolism ...... 45 1.12 Free fatty acid receptors ...... 46 1.13 G-proteins ...... 49

1.14 Diversification and specification/regulation of GPCR signalling ...... 51 1.15 Role of β-arrestins in GPCR signalling ...... 52 1.16 G-protein-coupled receptor 120 (Gpr120) ...... 54 1.17 Signalling pathways activated by Gpr120 ...... 56 1.18 Development of selective ligands for Gpr120...... 56 1.19 Hypothesis and Aims of the study...... 60 Chapter 2 ...... 62 Materials and Methods ...... 62 2.1 Materials ...... 63 2.1.1 Antibodies ...... 63 2.1.2 Plasmids ...... 63 2.1.3 Chemicals and Reagents ...... 64 2.1.4 Kits...... 66 2.1.5 Cell culture Materials ...... 67 2.1.6 Cell lines ...... 67 2.1.7 Mouse tissues ...... 68 2.1.8 Buffers and solutions ...... 68 2.1.9 Bacterial strains and Media ...... 75 2.1.10 Competent Cells ...... 76 2.1.11 SDS gels ...... 76 2.2 Methods ...... 79 2.2.1 Cell culture ...... 79 2.2.2 Generation of immortalized cell lines...... 80 2.2.3 Culture and differentiation of IMBAT cells ...... 80 2.2.4 Oil Red O staining ...... 81 2.2.5 Immunostaining of PC12/HER4 cell: ...... 82 2.2.6 Western Blotting: ...... 82 2.2.7 Determination of protein concentration (BCA assay) ...... 82 2.2.8 SDS-polyacrylamide gel electrophoresis: ...... 83 2.2.9 RNA preparation: ...... 83 2.2.10 cDNA preparation: ...... 84 2.2.11 Primer design ...... 85 2.2.12 q-RT-PCR: ...... 85

2.2.13 Bacterial propagation of plasmids ...... 86 2.2.14 Small-scale preparation of plasmid DNA (Miniprep) ...... 87 2.2.15 Large-scale plasmid DNA preparation (Maxiprep) ...... 87 2.2.16 Cloning ...... 88 2.2.17 Restriction digests...... 90 2.2.18 PCR for cloning ...... 90 2.2.19 DNA agarose gel electrophoresis ...... 90 2.2.20 PCR purification ...... 91 2.2.21 DNA sequencing...... 92 2.2.22 siRNA transfection of IMBAT cells ...... 92 2.2.23 Reporter Gene assays ...... 93 2.2.24 Calcium mobilisation assay ...... 93 2.2.25 cAMP Accumulation Assays ...... 94 2.2.26 β-arrestin recruitment assays ...... 94 2.2.27 Phospho-kinase array ...... 95 2.2.28 Microarray experiments ...... 96 2.2.29 Statistical Ananlysis ...... 96 Chapter 3 Results ...... 97 Adipose Tissue: Cold-induced changes in gene expression ...... 97 3.1 Introduction ...... 98 3.2 Cold stimulation causes changes in gene expression ...... 99 3.3 Validation of the gene expression on a mouse tissue panel ...... 103 3.4 Discussion ...... 107 Chapter 4 Results ...... 109 Neuregulin 4 (Nrg4) and its Functional Characterization in Brown Adipose Tissue ...... 109 4.1 Introduction ...... 110 4.2 Nrg4 is a brown fat–enriched adipokine ...... 111 4.3 Immortalized brown adipocytes (IMBAT cells) system and Nrg4 expression ...... 112 4.3.1 Immortalized brown adipocytes (IMBAT cells) system differentiate efficiently under standard differentiation protocol ...... 113 4.3.2 Nrg4 expression increases during brown adipocyte differentiation ...... 115 4.3.3 Nrg4 is expressed early during brown adipocyte differentiation...... 118 4.3.4 Nrg4 expression in IMBAT cells is activated by β3-AR...... 120 4.4 Functional role Nrg4 in BAT ...... 123

4.4.1 Nrg4 is secreted by brown adipocytes...... 123 4.4.2 Nrg4 promotes neurite outgrowth ...... 124 4.4.3 HER4 receptor is expressed in BAT and upregulated in differentiated IMBAT cells ...... 127 4.4 Regulation of Nrg4 expression ...... 129 4.4.1 Nrg4 expression in IMBAT cells is regulated by PPARγ...... 129 4.4.2 Nrg4 regulatory region is found in PPARγ binding sites...... 132 4.5 Discussion ...... 135 Chapter 5 Results ...... 139 Gpr120: Regulation of Expression in BAT ...... 139 5.1 Introduction ...... 140 5.2 Gpr120 is regulated in a temperature-dependent manner ...... 141 5.3 Gpr120 is more highly expressed in Brown Adipose Tissue ...... 143 5.3 Regulation of Gpr120 expression in brown adipocytes ...... 146 5.3.1 Gpr120 expression is detectable in early phase of brown adipocyte differentiation ...... 147 5.3.2 Gpr120 expression in brown adipocyte is regulated by β3-AR activation ...... 149 5.4 Gpr120 agonist, GW9508, induced lipid droplet formation in IMBAT cells ...... 151 5.5 Discussion ...... 153 Chapter 6 Results ...... 155 The role of Gpr120 in BAT via Gpr120 knockout models ...... 155 6.1 Introduction ...... 156 6.2 Gene expression analysis of BAT in Gpr120 KO mice ...... 157_Toc417650845 6.2.2 Effect of Gpr120 KO on brown fat associated genes ...... 163 6.2.2 The role of Gpr120 in inflammation in BAT ...... 165 6.2.3 Gpr120 is essential for lipogenesis ...... 167 6.2.4 Gpr120 KO impairs lipolysis in BAT...... 169 6.2.5 Gpr120 is involved in the regulation of glucose metabolism ...... 171 6.3 siRNA-mediated Gpr120 Knockdown in IMBAT cells is associated with increase in inflammatory gene expression and reduction in metabolic gene expression ...... 174 6.4 Discussion ...... 178 Chapter 7 Results ...... 183 Assessment of novel Gpr120- specific ligand-induced cellular events in the differentiation and function of BAT ...... 183

7.1 Introduction ...... 184 7.1.1 Effect of Gpr120 agonists on Gpr120 and aP2 gene expression ...... 186 7.1.2 Effect of Gpr120 agonists on expression of metabolic genes ...... 188 7.2 Effects of Gpr120 ligands on Gpr120 KO IMBAT cells ...... 191 7.2.1 Gpr120 ligands induce lipid droplets formation in IMBAT cells via Gpr120 ...... 191 7.2.2 Gpr120 KO attenuates the Gpr120 ligand-induced expression of metabolic genes...... 194 7.2.3 Gpr120 ligand activation reduces inflammatory gene expression in IMBAT cells ...... 196 7.3 Regulation of Gpr120 expression in brown adipocytes by Gpr120 ...... 198 7.3.1 GW9508-induced activation of Gpr120 and aP2 in brown adipocytes is dependent on PPARγ and PPARα ...... 198 7.3.2 Gpr120 activation by TUG891 and TUG1096 occurs via a PPARγ-dependent mechanism ...... 202 7.4 Discussion ...... 204 Chapter 8 Results ...... 206 Profiling Gpr120 signalling pathways and their downstream roles in IMBAT cells ...... 206 8.1 Introduction ...... 207 8.2 Agonist-induced calcium mobilization ...... 208 8.2.1 Agonist activation of Gpr120 increases intracellular Ca2+ mobilization in a ligand specific manner ...... 208 8.2.2 Differential activation of calcium signalling by TUG891 and TUG1096 in IMBAT cells ...... 210 8.3 GW9508, but not TUG891-mediated Gpr120 Ca2+signalling is via a Gαq/11 pathway ...... 212 8.4 Gpr120 ligands stimulate β-arrestin recruitment in IMBAT cells ...... 214 8.5 TUG1096 does not activate Gαs or Gαi signalling ...... 218 8.6 Effects of Gpr120 ligands on ERK activation ...... 220 8.6.1 GW9508 stimulation causes ERK Phosphorylation in IMBAT cells...... 220 8.6.2 Treatment of IMBAT cells with TUG891 and TUG1096 activates ERK with distinct temporal profiles ...... 222 8.7 Gpr120 agonists may activate multiple downstream signalling pathways in IMBAT cells...... 224 8.8 Agonist stimulation of Gpr120 activates AMPK in the IMBAT cells ...... 226 8.9 Role of Gαq/11 signalling in Gpr120 function ...... 228

8.9.1 GW9508-induced ERK signalling is via Gαq/11 activation in IMBAT cells...... 228 8.9.2 Role of Gαq/11 inhibition on Gpr120-agonist induced gene signalling in IMBAT ...... 230 8.9.3 Inhibition of Gαq/11 attenuates TUG1096-induced activation of Gpr120 and aP2 expression ...... 232 8.10 Discussion ...... 234 Chapter 9 ...... 239 General Discussion ...... 239 Discussion ...... 240 References ...... 247 Appendix I: Publication ...... 2669 Appendix II: List of Primers ...... ……..26761

List of Figures

Chapter 1

Figure 1.1: White beige and brown adipocytes morphology……………………………29

Figure 1.2: Anatomical distribution of BAT and WAT in an adult human…………….32

Figure 1.3: Mechanism of UCP1 (thermogenin) activation……………………………..37

Figure 1.4: The intracellular pathways regulating lipogenesis and lipolysis……………44

Figure 1.5: Receptor activation of GPCR ………………………………………………50

Figure 1.6: GPCRs can signal through both G-protein and arrestin pathways………….53

Chapter 3

Figure 3.1: mRNA expression levels of genes upregulated by cold exposure…………..101

Figure 3.2: mRNA expression levels of Nnat downregulated by cold exposure………..102

Figure 3.3: mRNA levels of genes across a panel of mouse tissues…………………….106

Chapter 4

Figure 4.1: Immunohistochemical staining of BAT and gonadal WAT………………..111

Figure 4.2.1: IMBAT cells showing differentiation capacity…………………………..114

Figure 4.2.2: Gene expression following a differentiation time-course………………..117

Figure 4.2.3: mRNA levels of aP2 and Nrg4 throughout differentiation……………....119

Figure 4.2.4: mRNA levels of Nrg4 in IMBAT treated with β3-AR agonist…………..122

Figure 4.3.1: Nrg4 levels in IMBAT cell determined by ELISA……………………..123

Figure 4.3.2: PC12/HER4 cells showing neurite outgrowth…………………………...126

Figure 4.3.3: mRNA levels of HER4 across a panel of mouse tissues…………………128

Figure 4.4.1: mRNA levels of aP2 and Nrg4 in cells treated with PPARγ ligands…….131

Figure 4.4.2: Nrg4 transcription start site………………………………………………132

Figure 4.4.3: A and B: Binding sites for Nrg4…………………………………………133

Chapter 5

Figure 5.1: Gene expression of Gpr120 induced by cold exposure……………………142

Figure 5.2: mRNA levels of Fatty acid receptors across a panel of mouse tissues……145

Figure 5.3.1: mRNA levels of Gpr120 and aP2 throughout differentiation…………...148

Figure 5.3.2: mRNA levels Gpr120 in IMBAT cell treated with β3 AR ligand………150

Figure 5.4: ORO showing GW9508 induction of lipid droplet formation……………152

Chapter 6

Figure 6.1: Microarray-based gene expression analysis in Gpr120 knockout mice…...158

Figure 6.2.1: mRNA expression of BAT-associated genes in GPR120KO/WT BAT...164

Figure 6.2.2: mRNA expression of inflammatory genes in GPR120KO/WT BAT…...166

Figure 6.2.3: mRNA expression of lipogenic genes in GPR120KO/WT BAT………..168

Figure 6.2.4: mRNA expression of lipogenic genes in GPR120 KO/WT BAT……….170

Figure 6.2.5: Expression of glucose metabolic genes in GPR120KO/WT BAT………173

Figure 6.3: Gene expression following downregulation of Gpr120 in IMBAT cells….177

Chapter 7

Figure 7.1.1: Gene expression following treatment with Gpr120 agonists……………187

Figure 7.1.2: Gene expression following treatment with Gpr120 agonists……………190

Figure 7.2.1: Oil Red O showing lipid droplet formation induced by all ligands……..193

Figure 7.2.2: Metabolic gene expression in Gpr120 Het and KO IMBAT cells………195

Figure 7.2.3: Inflammatory gene expression in Gpr120 Het and KO IMBAT cells…..197

Figure7.3.1: Role of PPARs in the regulation of Gpr120 expression………………….201

Figure 7.3.2: Role of PPARs in the regulation of Gpr120 expression. ………………203

Chapter 8

Figure 8.1: Intracellular calcium levels induced by GW9508………………………...209

Figure 8.2: Intracellular calcium levels induced by TUG891…………………………211

Figure 8.3: Effect of Gαq inhibitor on intracellular calcium accumulation……………213

Figure 8.4.1: Gpr120 ligand-mediated recruitment of β-arrestin-1 in IMBAT cells…..216

Figure 8.4.2: Gpr120 ligand-mediated recruitment of β-arrestin-2 in IMBAT cells…..217

Figure 8.5 Gpr120 ligands-induced changes in cAMP accumulation…………………219

Figure 8.6.1: GW9508 activates ERK1/2 signalling…………………………………..221

Figure 8.6.2: TUG891 and TUG1096-mediated ERK1/2 activation………………….223

Figure 8.7: Phospho-kinase array ‘hits’ following Gpr120 ligand stimulation………..225

Figure 8.8: Agonist-mediated AMPK activation………………………………………227

Figure 8.9.1: Gαq/11 inhibition of GW9508-induced ERK phosphorylation…………229

Figure 8.9.2: mRNA level of Gpr120, aP2, Ucp1, and PPARγ in IMBAT cells………231

Figure 8.9.3: mRNA expression levels of Gpr120 and aP2 in IMBAT cells………….233

List of Tables

Table 1.1: Differences between brown and white adipose tissues……………………26

Table 1.2: GPCRs that are activated by FFAs………………………………………..48

Table 3.1: Gene expression profile across a panel of mouse tissues …………………107

Table 5.1: Gene expression profile of GPCRs across a panel of mouse tissues………146

Table 6.1: Summary of up- and downregulated genes in Gpr120 knockout BAT…...157

Table 6.2: Genes upregulated in Gpr120 KO BAT using microarray………………...159

Table 6.3: Genes downregulated in Gpr120 KO BAT using microarray…………….161

Table 6.4: Genes downregulated in Gpr120 knockout BAT using q-RT-PCR………174

Table 6.5: Genes upregulated in Gpr120 knockout BAT using q-RT-PCR….………175

List of Abbreviations

AC Adenylyl cyclase

ACC Acetyl CoA caeboxylase

ACS Acetyl CoA synthetase

AMPK 5’ adenosine monophosphate-activated protein kinase

APS Ammonium persulfate aP2 Adipocyte protein 2 (also known as FABP4)

AT Adipose tissue

ATGL Adipose triglyceride lipase

BAT Brown adipose tissue

BMI Body mass index

BMP Bone morphogenic protein

Bp Base pair(s)

BSA Bovine serum albumin

Ca2+ Calcium cAMP Cyclic adenosine monophosphate cDNA Complementary DNA

C/EBP CCAAT-enhancer binding protein

CIDEA Cell-death inducing DNA fragment factor alpha-like effector A

CL3 CL-316,243 (a β-3-adrenoceptor agonist)

DAG Diacylglycerol

DAPI 4′, 6-diamidino-2-phenylindole

DEPC Diethylpyrocarbonate

DMEM Dulbecco’s Modified Eagle Medium

DMEM/F-12 Dulbecco’s Modified Eagle Medium and Ham’s F-12 nutrient mixture

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic acid

DNAse Deoxyribonuclease dNTP Deoxyribonucleotide triphosphate

DTT Dithiothreitol

ECL Enhanced chemilumiscence

EDTA Ethylenediaminetetraacetic acid

ERK Extracellular-signal regulated kinase

FA Fatty acid

FABP4 Fatty acid binding protein 4

FAS Fatty acid synthase

FFAs Free fatty acids

FBS Fetal bovine serum

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

Gi Inhibitory G-protein

Gs Stimulatory G-protein

GLUT1 Glucose transporter 1

GLUT4 Glucose transporter 4

GPCR G-protein coupled receptor

G-protein Guanine nucleotide-binding protein

Gpr120 G-protein-coupled receptor 120

Gpr40 G-protein-coupled receptor 40

Gpr41 G-protein-coupled receptor 41

Gpr43 G-protein-coupled receptor 43

GW9508 An agonist for Gpr120 and GPR40

Gyk Glycerol kinase

HEPES 4-(2-Hydroxyethil)-1-piperazineethanesulfonic acid

HFD High fat diet

HLS Hormone Sensitive Lipase

IBMX 3-isobutyl-1-methylxanthine

IMBAT Immortalised brown adipose tissue

IP3 Inositol 1,4,5 triphosphate

IPTG Isopropyl β-D-1-theogalactopyranoside

KO Knock out

LCFA Long chain fatty acid

LD Lipid droplet

LPL Lipoprotein lipase

MAPK Mitogen activated protein kinase

MAPK Mitogen-activated protein kinase

MEK MAPK kinase mRNA Messenger RNA

MgCl2 Magnesium Chloride

M-MLV Moloney Murine Leukaemia Virus

Myf5 Myogenic factor 5

NP-40 Nonidet P-40

OD Optical Density

PAQR Progestin and adipoQ-receptor

PET Positron emission tomography

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PDL Polylysin-D

PFA Paraformaldehyde

PGC-1α PPAR gamma coactivator 1α

PKA Protein kinase A

PKC Protein kinase C

PPARγ Peroxisome proliferator-activated receptor gamma

PPRE PPAR response element

PRDM16 PR domain containing 16

P/S Penicillin-streptomycin

PVDF Polyvinlyidene difluoride q RT-PCR Quantitative real-time polymerase chain reaction

RIPA buffer Radio immune precipitation assay buffer

RNA Ribonucleic acid

ROX Reference dye for q RT-PCR

RPM Rotation per minute

RT Room temperature

RT-PCR Reverse transcription polymerase chain reaction

SDS Sodium dodecyl sulphate

SDS-PAGE SDS-polyacrylamide gel electrophoresis

SEM Standard error of the mean shRNA Short hairpin RNA

SiRNA Small interfering RNA

SNS Sympathetic nervous system

Srebp1c Sterol regulatory element binding protein 1c

STAT5a Signal transducer and activator of transcription 5a

SVF Stromal vascular fraction

TBE Tris borate EDTA

TBS Tris-buffered saline

TBS-T Tris-buffered saline and tween 20

TE Tris-EDTA

TEMED N,N,N’,N’-tetraethylmethylethane-1,2-diamine

Tris Tris(hydroxymethly)methylamine

TUG891 Gpr120 agonist

TUG1096 Gpr120 agonist

UCP1 Uncoupling protein 1

β3-AR Beta-3 adrenergic receptor

WT Wild type

ω3 FA Omega-3 fatty acid

18F-FDG [18F]-2-fluoro-D-2-deoxy-D-glucose

Chapter 1

Introduction

1.1 Adipose tissue and adipocytes Adipose tissue or fatty tissue is the major site of energy storage in the form of triacylglycerols. In adult mammals, the major bulk of adipose tissue is a loose connective tissue of lipid-filled cells called adipocytes, which are held in a framework of collagen fibres.

It is the biggest endocrine organ in humans, comprising up to 20% of body weight in healthy individuals (Cinti, 2005). It exerts a profound influence on whole body homeostasis, and plays a vital role in the regulation of energy balance. Energy homeostasis is crucial since excess fat storage leads to obesity, obesity-associated vasculopathy and cardiovascular risks

(Berg and Scherer, 2005). Adipose tissue is found in two forms: white adipose tissue (WAT) and brown adipose tissue (BAT) (Cannon and Nedergaard, 2004), both of which are innervated by the sympathetic nervous system (Collins et al., 2010; Germack et al., 2000).

1.1.2 White adipose tissue (WAT) Histologically, white adipocytes are spherical with a single large lipid droplet surrounded by a thin layer of cytoplasm containing the nucleus, and few mitochondria. The WAT depots can be classified into three main groups: subcutaneous, visceral and intramuscular (Gesta et al.,

2007). Adipocyte size varies in relation to the cell lipid content, ranging from about 30–

130 μm in diameter. The volume of an adipocyte is a determinant of the cell's functionality, with larger adipocytes generally exhibiting higher metabolic activity and secreting more chemoattractants for immune cells (Skurk et al., 2007). White adipose tissue is a major secretory and endocrine organ involved in a range of functions beyond simple fat storage.

These functions include secretion of cell-signalling molecules (adipokines), cytokines such as

TNFα, Plasminogen activator inhibitor 1 (PAI-1), IL-6, (Pond, 2005), and hormones such as leptin, adiponectin, oestradiol, and resistin (Trayhurn, 2007). It is innervated mainly by the

sympathetic nervous system (SNS) with nerve fibres accompanying arteries and arterioles

(Bartness and Song, 2007). However, the use of anterograde tracing technique in Siberian hamster revealed the existence of sensory nerve fibres originating in inguinal WAT (Song et al., 2009), which provide the brain information on the lipolytic activity of the adipose tissue depots, and by affecting SNS output may provide negative feedback control of lipid mobilization (Bartness et al., 2010a).

1.1.3 Brown adipose tissue (BAT) BAT differs considerably from WAT in morphology and function (Table 1.1). Histologically, brown adipocytes are much smaller than the white adipocytes. They contain multiple small lipid droplets dispersed throughout the cytosol, with the nuclei being centrally located. They are equipped with numerous mitochondria. The major function of BAT is to transfer energy from food into heat. This heat production and the recruitment process in the tissue are under sympathetic control (Cannon and Nedergaard, 2004). BAT is characterized by the expression of a discrete set of genes which include Cell death-inducing DFFA (DNA fragmentation factor-alpha)-like effector A (CIDEA) (Hallberg et al., 2008; Zhou et al., 2003) and peroxisome proliferator-activated receptor co activator 1α (PGC-1α) (Finck and Kelly, 2007).

The major BAT depots in rodents are in the interscapular region (interscapular, axillary and cervical pads) embedded in and around deep back muscles. Following cold exposure, the induction of Uncoupling Protein 1 (UCP1) in BAT mediates a ‘proton’ leak thereby uncoupling oxidative phosphorylation from ATP generation to produce heat (Cannon and

Nedergaard, 2004). Expression of Ucp1 is highly regulated by the SNS, through the activation of β3-adrenergicrReceptor (β3-AR) (Klaus et al., 1994). All adipocytes express β3-

AR (Robidoux et al., 2004), and are involved in the epinephrine and the norepinephrine-

induced activation of adenylyl cyclase via receptor coupling to Gαs protein, which acutely regulates adipose triglyceride lipase in BAT (Deiuliis et al., 2010).

Table1.1: Differences between brown and white adipose tissues

BAT WAT Cellular Morphology  Size 15-60µm 25-200µm  Shape Polygonal or ellipsoid Spherical  Cytoplasm Large volume Small amount in the periphery of the cell

 Mitochondria Numerous, large Few, elongated

 Lipid droplets Multiple small droplets Large single

Tissue organization and function  Vascularity Highly vascularized Less dense

 Innervation Dense sympathetic Less dense innervation innervation  General function Thermogenesis, storage of Storage of triglycerides, triglycerides for use in BAT secretion of hormones and adipokines

Table Adapted from (Fenzl and Kiefer, 2014).

BAT: Brown adipose tissue

WAT: White adipose tissue

1.2 Development of adipose tissues Adipogenesis is the process of cell differentiation by which pre-adipocytes become adipocytes. It is characterized by sequential changes in the expression of specific genes that determine the specific adipocyte phenotype of the cells reflected by the appearance of various early, intermediate and late mRNA and protein markers, and triglyceride accumulation

(Niemela et al., 2007). Although both white and brown adipocytes are derived from mesenchymal stem cells originating in the mesoderm (Billon et al., 2008), they are generated through different developmental pathways (Seale et al., 2008). The brown adipocytes in BAT develop from myogenic factor 5 (Myf5)-expressing precursor cells (Seale et al., 2008), which are also muscle precursors. However, PRDM16, together with C/EBPβ form a lineage- switching transcriptional complex that promotes brown fat differentiation and suppresses muscle cell differentiation (Kajimura et al., 2009; Seale et al., 2009).

The differentiation of pre-adipocytes into adipocytes is a complex process characterized by changes in cell morphology, gene expression, hormone sensitivity, and secretory capacity

(Perera et al., 2006), and is regulated by an elaborate network of transcription factors. At the centre of this network of changes in gene expression are two principal adipogenic factors,

PPARγ and C/EBPα (Farmer, 2006), interacting with different corepressors and coactivators to determine adipocyte function (Leonardsson et al., 2004). Alongside the identification of an increasing number of transcription factors controlling adipogenesis, several new mechanisms regulating their function have also been described recently including histone modification, microRNAs, and ubiquitin modification (Lowe et al., 2011). However, there seems to be a unified pathway by which PPARγ and CEBPs control adipogenesis (Rosen et al., 2002).

1.3 Beige/brite It has been known for many years that some white adipose tissues contain cells that can express high levels of UCP1 and take on a multilocular appearance upon prolonged stimulation by cold or pathways that elevate intracellular cyclic AMP (cAMP) (Cousin et al.,

1992). These adipocytes have been named beige, 'brite' (brown in white), iBAT (inducible), recruitable BAT and wBAT (Harms and Seale, 2013). The bona fide white and brown adipose depots are located in anatomically different regions in both rodents and humans.

Development from Myf5-positive muscle precursors is not the only way to generate brown adipocytes. Interspersed within white adipose tissue are brown adipocytes that appear following cold exposure.

Cinti et al., 2010 demonstrated that several UCP1-immunoreactive brown adipocytes occurring in WAT after cold acclimatization had a mixed morphology (paucilocular adipocytes). Recently, an inter-organ crosstalk between skeletal muscle and WAT was shown to promote browning by a factor called irisin, which is regulated by PGC1-α, secreted from muscle into blood and activates thermogenic function in adipose tissues (Bostrom et al.,

2012). Beige cells morphologically appear to be an intermediate between BAT and WAT

(Figure 1.1).

Myf5 Mesenchymal precursor Mesenchymal precursor

White adipocyte Beige adipocyte Brown adipocyte

PRDM16

PRDM16 Ucp1 β3-adrenergic stimulation Chronic PPARγ induction Cold exposure

Lipid droplet Nucleus Mitochondria

Figure 1.1: White beige and brown adipocytes are derived from distinct precursor cells and have distinct morphological characteristics. Adapted from Kelesha Sarjeant, and Jacqueline M. Stephens Cold Spring Harb Perspect Biol 2012;4:a008417 (Sarjeant and Stephens, 2012).

1.4 Dynamic nature of adipose tissue The developmental relationship between brown and white adipocytes is not clear; the anatomical location of BAT and WAT depots is distinct (Hansen and Kristiansen, 2006). In rodents, BAT depots persist into adulthood whereas in larger mammals, BAT depots are replaced partially or completely shortly after birth. In order to explain their coexistence the hypothesis of reversible physiological transdifferentiation was developed, i.e. they are able to convert, one into the other. In effect, if needed the brown component of the organ could increase at the expense of the white component and vice versa (Cinti et al., 2010). As noted by Cinti et al., 2010, this plasticity is important because the brown phenotype of the organ is associated with resistance to obesity and its related disorders.

Humans are also susceptible to browning of their WAT as shown by the anecdotal evidence that omental WAT biopsies obtained from patients affected by pheochromocytoma, a cathecholamine secreting tumour, are enriched in brite cells (Frontini et al., 2013), but browning capacity can vary in different WAT depots (Wu et al., 2012). This discrepancy may simply reflect that when the first BAT lineage-tracing with Myf5-cre was performed, only a few of the adipose tissue depots were analysed, resulting in an underestimation of Myf5 lineage contribution to the whole fat organ development (Shan et al., 2013). But whether the

Myf5-positive cells found in the WAT depot gave rise to bona fide BAT remains to be proven. Conditional genetic knockout of phosphatase and tensin homolog (PTEN) in Myf5- expressing cells caused a partial lipodystrophic phenotype, suggesting that Myf5+ progenitors contribute in a region-specific manner to WAT depots, which may explain the heterogeneity in the metabolic phenotypes of distinct adipose tissue depots (Lee et al.,

2014b).

1.5 Human BAT Until recently, human brown fat deposits were considered to be present only in newborns, where it serves as a protective measure during the initial hours following birth into a cold environment (Farmer, 2008). However, PET scans, coupled with tissue sampling, have conclusively identified brown adipose depots, notably between the shoulder blades and around kidneys, in adult humans (Cypess et al., 2009; van Marken Lichtenbelt et al., 2009;

Virtanen et al., 2009). The activities of these depots are increased in cold exposure and blunted in obesity (van Marken Lichtenbelt et al., 2009). Chronic cold exposure in outdoor workers or the presence of pheochromocytoma was associated with a prolonged BAT presence in humans (Kuji et al., 2008; Medeiros et al., 1985; Ricquier et al., 1983).

Moreover, histological analysis demonstrated UCP1 immunostaining in the perithyroid fat of

30% of patients undergoing thyroidectomy (van Marken Lichtenbelt et al., 2009), suggesting the presence of BAT around the thyroid.

According to a recent report by (Sacks and Symonds, 2013), human BAT is distributed in the following regions: Visceral BAT, including perivascular BAT around the aorta, common carotid artery, and brachiocephalic artery; in anterior mediastinum (paracardial) fat, and around epicardial coronary artery and cardiac veins as well as medium-sized muscular arteries and veins including the internal mammary and the intercostal artery branches from the subclavian and aorta. Viscus BAT, defined as BAT surrounding a hollow muscular organ other than blood vessels, situated in variable amounts in the epicardium around the heart and in the eosophago-tracheal groove, as well as greater omentum and transverse mesocolon in the peritoneal cavity. BAT is also found around solid organs, namely, kidney, adrenal, pancreas, liver, and splenic hilum including paravertebral fat. Subcutaneous BAT includes depots lying between the anterior neck muscles and in the supraclavicular fossa posterior to the brachial plexus, under the clavicles, in the axilla, in the anterior abdominal wall, and in

the inguinal area. Importantly, BAT is present in all the aforementioned sites in infants and children under 10 years old and its distribution decreases in variable amounts with increasing age so that by 80 years old, few individuals have BAT at any site. The most metabolically active BAT region is the supraclavicular fossa and axilla followed by the mediastinal, thoracic paravertebral, perinephric, and adrenal loci (Sacks and Symonds, 2013).

Figure 1.2: Schematic representation of the anatomical distribution of BAT and WAT in an adult human (Nedergaard et al., 2007).

1.6 Measurement of BAT The most popular method of mapping brown fat located under the skin has been to scan the body using combined positron-emission tomography and computed tomography (PET-CT).

Detecting BAT is typically confirmed by the uptake of the injected radioactive tracer (18) F-

Fluorodeoxyglucose ((18)F-FDG) into adipose tissue depots, as measured by PET-CT scans after exposing the subject to cold stimulus. This technique produces highly detailed images of the body's interior but requires a costly and invasive procedure. The use of magnetic resonance imaging (MRI) to detect brown fat does not require the use of radioisotopes

(Holstila et al., 2013). Another relatively inexpensive and noninvasive option is thermal imaging, which identifies hotspots of brown fat under the skin by monitoring the temperature of the overlying skin. Reliably differentiating BAT from other tissues using a non-invasive imaging method is an important step toward studying BAT in humans. To date, the only noninvasive way to examine the presence of brown adipose tissue has been 18F-fluoro-deoxyglucose PET scans performed in the cold. FDG-PET/CT is currently considered the gold standard for measuring BAT activity in humans, which correlates positively with intracellular glucose uptake (Fenzl and Kiefer, 2014; Lee et al., 2010).

1.7 BAT Thermogenesis Thermogenesis refers to heat generation through metabolic processes. This can be obligatory or adaptive (facultative) thermogenesis. The heat normally resulting from sustaining vital functions is called obligatory thermogenesis (Silva, 2006). Adaptive thermogenesis can be shivering or non-shivering, and is recruited when heat generation is needed for survival

(Himms-Hagen, 2001). BAT thermogenesis is facilitated by multilocular lipid stores, the extremely high mitochondrial content of brown adipocytes and the extensive vascular and nerve supply to this tissue.

Adaptive non-shivering thermogenesis can be cold-induced or diet-induced and requires the presence of BAT to be activated (Feldmann et al., 2009). Thermogenesis is controlled by futile cycles, such as the simultaneous occurrence of lipogenesis and lipolysis or glycolysis and gluconeogenesis. The high energy demands of thermogenesis mean that free fatty acids draw, for the most part, on lipolysis as the method of substrate production. Non-shivering thermogenesis is regulated mainly by thyroid hormone and the SNS. Rising insulin levels after eating may be responsible for diet-induced thermogenesis.

Brown fat thermogenesis is a target of continued interest for attenuating nutrient efficiency and counteracting obesity and insulin resistance since future strategies could involve the conversion of white fat cells into thermogenic brown-fat-like adipocytes (Nubel and Ricquier,

2006). Recent studies have demonstrated the potential for transplanted BAT to reverse obesity by improving thermogenesis (Liu et al., 2015). Thermogenesis in BAT is due to

UCP1, also called thermogenin or SLC25A7. The uncoupling activity of UCP1 is explained by its ability to transport protons across the inner mitochondrial membrane, in particular when FFAs bind to the protein (Brondani et al., 2012).

1.7.1 Role of UCP1 in BAT thermogenesis UCPs 1, 2, 3, 4, and 5 are members of an anion-carrier protein family, and are located in the inner mitochondrial membrane. These proteins have similarities in their structures, but different tissue expression in mammals. The original UCP, UCP1, is mainly expressed in

BAT (Dalgaard and Pedersen, 2001). UCP2 is widely distributed, whereas UCP3 is mainly restricted to the skeletal muscle, while UCP4 and UCP5 are mainly expressed in the brain.

The coupling of respiration to ATP synthesis is not 100% efficient, and some of the energy is dissipated as heat. Partial uncoupling of respiration from ATP synthesis, also known as

proton leak, can be mediated by UCP1 and by other mitochondrial inner membrane proteins, such as adenine nucleotide translocase (ANT) (Dalgaard and Pedersen, 2001).

UCP1 is a transmembrane protein that decreases the proton gradient generated in oxidative phosphorylation by increasing the permeability of the inner mitochondrial membrane, allowing protons that have been pumped into the intermembrane space to return to the mitochondrial matrix. UCP1-mediated heat production causes a decrease in efficiency of oxidative phosphorylation leading to increased fat oxidation and to diminution in feed efficiency (ratio of weight gain to food intake) (Klingenspor, 2003). UCP1 ablated mice gained weight at a higher rate than the control (Feldmann et al., 2009). The “short circuit” in the proton gradient caused by UCP1 means that fuel oxidation can be accelerated and is not limited by saturating concentrations of ATP. Hence, all of the biochemical steps of mitochondrial fuel oxidation (Krebs cycle and ETC) are accelerated, and the inherent inefficiencies in their reactions result in heat production (Wu et al., 2013)

1.7.2 Role of adrenergic signalling in thermogenesis β-adrenergic receptors (β-AR) belong to the superfamily of G-protein-coupled receptors

(GPCRs). β3-AR is the adipocyte specific adrenergic receptor and is expressed in both brown and white in rodents and mainly BAT in humans (Zhao et al., 1994). Treatment of human white adipocytes cells with a specific β3-AR agonist CL-316,243 leads to the appearance of brite characteristics, similar to the phenotype following cold exposure (Barbatelli et al., 2010;

Himms-Hagen et al., 2000). β3-AR activates a thermogenic pathway through lipolysis.

Moreover, in the absence of β-adrenergic signalling, mice are unable to maintain their core temperature (Bachman et al., 2002).

β2-adrenergic receptors are not expressed in the brown adipocytes but are expressed in the tissue (Bengtsson et al., 2000), as binding sites can be measured in membrane preparations from BAT. These β2-adrenergic receptors are probably predominantly localized to the vascular system (Cannon and Nedergaard, 2004). Thermogenesis is β3-AR but not β1-AR mediated in rat brown fat cells, even after cold acclimation (Zhao et al., 1998). β-Adrenergic receptors normally couple to the Gαs subfamily of heterotrimeric G proteins leading to activation of adenylyl cyclase, increasing the levels of cAMP, and protein kinase A (PKA) activation, a pathway that mediates the thermogenic signal. The fatty acids are directed to the mitochondria for combustion. The adrenergic stimulation also leads to synthesis and release of lipoprotein lipase (LPL), which breaks down the triglycerides in the lipoproteins/chylomicrons in the circulation to supply further fatty acids for combustion in the mitochondria. Additionally, glucose uptake is stimulated. After cytosolic conversion to pyruvate, the glucose is also combusted in the mitochondria. The heat produced is rapidly transported out to the body by the blood. The mechanism of thermogenesis is summarized in figure 1.2.

Norepinephrine

G-protein Adenylyl cyclase

ATP +ve

β-adrenergic receptor Protein cAMP kinase A Ucp1 Heat ATP

HSL ADP + H TAGs

Fatty acids +VE

Mitochondria

Figure 1.3: Mechanism of UCP1 (thermogenin) activation: Sympathetic nervous system terminals release norepinephrine onto a β3 adrenergic receptor on the plasma membrane. This activates adenylyl cyclase, which catalyses the conversion of ATP to cAMP. cAMP activates protein kinase A which in turn, phosphorylates a triacylglycerol lipase (HSL), thereby activating it. The lipase converts triacylglycerols into free fatty acids, which activate UCP1, overriding the inhibition caused by purine nucleotides GDP and ADP. At the termination of thermogenesis, the mitochondria oxidize away the residual fatty acids, UCP1 inactivates and the cell resumes its normal energy-conserving mode (Adapted from Fedorenko et al., 2012).

1.8 Transcriptional control of brown fat development and function Multiple transcriptional regulatory cascades have been reported to control BAT development and thermogenic function. Peroxisome proliferator activated receptor gamma (PPARγ) is the master transcription factor that is unconditionally required for white and brown adipogenesis.

However, the transcriptional activity of PPARγ can be regulated at multiple levels, enabling brown adipocyte-specific target gene expression (Floyd and Stephens, 2012).

Although WAT and BAT have different developmental origins and functions, they both require the transcription factors PPARγ and members of the C/EBP transcription factor family (C/EBPα, C/EBPβ, and C/EBPδ) for their development and function (Wu et al., 2013).

It was earlier observed that mice with a dominant-negative mutation of PPARγ (P465L) have defects in BAT but not white adipose tissue (WAT) function (Gray et al., 2006). PGC-1α expression is activated by the PKA–CREB pathway, which is downstream from the β- adrenergic receptor signalling pathway (Herzig et al., 2001). PGC-1α is a dominant regulator of mitochondrial biogenesis and oxidative metabolism (Lin et al., 2005) by inducing Ucp1 expression leading to thermogenesis.

PRDM16 is key factors enriched in classical brown fat relative to WAT (Seale et al., 2007).

PRDM16 was shown to be sufficient and necessary for the brown fat phenotype in cell culture models and sufficient to promote browning in visceral fat under β-adrenergic stimulation. Further studies showed that PRDM16 binds and coactivates PGC-1α, PGC-1β, and PPARγ (Seale et al., 2008) and together with C/EBPβ, form a lineage-switching transcriptional complex that promotes brown fat differentiation and suppresses muscle cell differentiation (Kajimura et al., 2009; Seale et al., 2009). Recently, PRDM16 was identified as a molecular switch between myocytes and brown adipocytes and it is considered as a classical brown adipocyte lineage marker (Lee et al., 2014b).

There are other factors which have been reported to regulate BAT activity. Some of them have been identified to regulate both classical and beige cells in a similar way. These include brown- and beige-fat recruiters and activators Irisin (Bostrom et al., 2012), Fibroblast growth factor 21 (FGF21) (Chartoumpekis et al., 2011), Atrial natriuretic peptide and brain-type natriuretic peptide (Chainani-Wu et al., 2010), Bmp8b, produced by mature brown fat cells and functions to amplify the thermogenic response of brown adipocytes to adrenergic activators (Whittle et al., 2012), Interleukin 6 (IL-6) (Cannon et al., 1998), and thyroid hormone, which directly induces the expression of thermogenic genes in brown adipocytes through the actions of thyroid receptors and also functions centrally to activate BAT.

1.9 BAT and obesity The capacity to accumulate fat has been a major adaptive feature of our species, but is now increasingly maladaptive in the modern environment where fluctuations in energy supply have been minimised, and productivity is dependent on mechanisation rather than physical effort (Wells, 2006). Since 1980, the global prevalence of obesity has doubled and billions of people are overweight and obese. Obesity is a risk factor for a variety of chronic conditions including diabetes, hypertension, high cholesterol, stroke, heart disease, certain cancers, and arthritis (Malnick and Knobler, 2006). Of these obesity-related conditions, diabetes may be the most closely linked to obesity, and the increasing incidence of diabetes worldwide is of considerable concern (McKinlay and Marceau, 2000). WHO reports that >65% of the world's population die of diseases related to being overweight rather than underweight (Johnson and

Makowski, 2015).

The most common method of measuring obesity is the Body Mass Index (BMI) which is calculated by dividing body weight (kilograms) by height (metres) squared, with a healthy man being 18.59kg/m2 to 24.9kg/m2. An adult BMI below 18.59kg/m2 is classified as

underweight, between 25.9kg/m2 and 29.99kg/m2 is classified as overweight and a BMI of

30kg/m2 or over is classified as obese. Although BMI is the most widely used approach it is not a direct measure of body fat mass or distribution, and BMI measures may be skewed by very high muscle mass. The relationship between BMI and health also varies with ethnicity.

Worldwide, the proportion of adults with a body-mass index (BMI) of 25 kg/m²or greater increased between 1980 and 2013 from 28·8% to 36·9% in men, and from 29·8% to 38·0% in women. Prevalence has increased substantially in children and adolescents in developed countries; 23·8% of boys and 22·6% of girls were overweight or obese in 2013. The prevalence of overweight and obesity has also increased in children and adolescents in developing countries, from 8·1% to 12·9% in 2013 for boys and from 8·4% to 13·4% in girls (Ng et al., 2014).

The obesity epidemic is attributable to high calorie diets, unhealthy lifestyles and behavioural trends acting on a person's genetic makeup to determine body mass and susceptibility to obesity-related disease (Lyon and Hirschhorn, 2005; Wells, 2006). The increasing prevalence of obesity in our society has focused attention on many aspects of adipose tissue biology.

Despite intensive research, current efforts to reduce obesity by diet, exercise, education, surgery and drug therapies are failing to provide effective long-term solutions to this epidemic (Herrera et al., 2011). The use of anti-obese drugs that reduce food intake and improve hypercholesterolemia and cardiovascular disease has been assessed in obesity, with drug therapy closely involved either in the prevention or induction of obesity, and non- alcoholic fatty liver disease in man. Fundamentally, the obesity epidemic is explained by a dysregulation of energy balance in our ‘obesogenic’ environment.

Drugs that inhibit fat absorption or digestion (pancreatic lipase inhibitors) such as gut based hormone treatments which target many pathways involved in the regulation of energy balance

(Derosa and Maffioli, 2012), sympathomimetic drugs which act as an appetite suppressant by

increasing fullness and delaying food intake (Li and Cheung, 2011) have all been tested.

Unfortunately, attempts to prevent obesity have had limited success thus far. The individualistic lifestyle approach of advising people to eat less and exercise more has been ineffective as a preventive measure for obesity (Kirk et al., 2012). Effective management of obesity therefore goes beyond obesity being thought of as mere food related disorder but may be influenced by genetics, psychology, society and public policy (Kirk et al., 2010), and

‘obesogenic’ environment. The ‘obesogenic’ environment is characterised by decreased physical activity and increased intake of high caloric food and drink , and also other factors such as the ingestion of novel medications, the presence of pollutants, the reduction of the variability in seasonal temperature due to the presence of almost ubiquitous air conditioning

(Tam and Ravussin, 2012).

Different genes have been associated with obesity and the regulation of body weight. The heritability of obesity has been associated with more than 40 genetic variants (Herrera et al.,

2011). Genome-wide association studies (GWAS), have confirmed that monogenic mutations affecting the hypothalamic leptin–melanocortin system is critical for energy balance in humans, because disruption of these pathways causes the most severe obesity phenotypes and fat mass, and obesity associated gene polymorphisms appears to have the most important effects on obesity susceptibility (Xia and Grant, 2013).

In finding new therapies to combat the present obesity pandemic, it is essential to elucidate the cellular and molecular mechanisms regulating energy balance, by characterizing the signalling pathways involved in brown fat induction and metabolism, which plays a central role in this energy metabolism and homeostasis. This will help to identify novel drug targets and design more effective management programs.

1.10 Free fatty acids (FFAs) Lipid homeostasis reflects a balance of processes, designed to generate fatty acids (FAs) and lipids, deliver them from their site of origin to target tissues, and catabolize them for metabolic purposes (Zechner et al., 2009). Fatty acids are carboxylic acids with long aliphatic tail, which is either saturated or unsaturated. Fatty acids are usually derived from either triglycerides or phospholipid. They are known as free fatty acids (FFA) when they are not bound to other molecules. They are important sources of fuel, and when metabolized they yield high amount of ATP. Unsaturated and saturated fatty acids differ in length, categorized as short chain fatty acids (SCFAs), medium chain fatty acids (MCFAs), long chain fatty acids

(LCFAs), and very long chain fatty acids (VLCFAs). Unsaturated fatty acids have one or more double bonds between carbon atoms. Saturated fatty acids are long chain of between 12 and 24 carbon atom and without double bonds between them. Free fatty acids act on 4 different GPCRs (FFARs).

1.11 Fatty acid metabolism

1.11.1 Lipogenesis This is the creation of fatty acids from acetly-CoA and malonyl-Coa precursors through action of enzymes called fatty acid synthase. Lipogenesis occurs in the cytoplasm of adipose tissue. It is the process by which acety-CoA is converted to fatty acids. Excess energy ingested as fat is stored in adipose tissue. In addition, dietary carbohydrates and proteins can be converted and stored as fat in adipose tissue. Triaclyglycerides are the most significant source of fatty acids. Through lipogenesis and subsequent triglyceride synthesis, the energy can be efficiently stored in the form of fats.

1.11.2 Lipolysis Lipolysis is defined as a process in which triacylglycerols (TAGs) a major source of energy reserve in adipocytes are hydrolyzed to generate fatty acids and glycerol. The hydrolytic cleavage of TAG generates non-esterified fatty acids, which are subsequently used as energy substrates, essential precursors for lipid and membrane synthesis, or mediators in cell signalling processes (Lass et al., 2011). Mature adipocytes undergo lipolysis in an orderly manner with lipolytic enzymes acting sequentially at each step. The complete hydrolysis of

TAG depends on the activity of three enzymes, adipose triglyceride lipase (ATGL), hormone- sensitive lipase (HSL) and monoacylglycerol lipase, each of which possesses a distinct regulatory mechanism.

β-adrenergic receptor stimulation causes the phosphorylation of perillipin-1 by PKA.

Perillipin-1 interacts with a coactivator, called comparative gene identification-58 (CGI-58).

CGI-58 then dissociates from perillipin-1 and interacts with adipose triglyceride lipase

(ATGL) which is the main TAG hydrolase. Expression of ATGL is induced by PPAR agonists, glucocorticoids, and fasting. CGI-58 acts as a coactivator for ATGL which gains full activity and cleaves the first ester bond in a TAG to yield a DAG and a non-esterified

FA. HSL is also phosphorylated by PKA and interacts with perillipin-1 to gain access into the lipid droplet. Then, HSL hydrolyses DAGs into monoacylglycerols (MGs). It has recently been shown that HSL and ATGL can be activated simultaneously, such that the mechanism that enables HSL to access the surface of lipid droplets also permits the stimulation of ATGL.

HSL phosphorylation and translocation coupled with ATGL activation by CGI-58 increases the TAG hydrolysis more than 100-fold.

The last step of lipolysis is the hydrolysis of MGs by MG lipase leading to the liberation of

FFAs (Zechner et al., 2012). The FFAs liberated by lipolysis are either channelled further within the cell or exit the adipocyte to be oxidised in other tissues such as liver and muscle.

In the cytosol, TAGs are probably bound to fatty acid-binding proteins. Similar to other adipocytes, brown adipocytes possess the adipocyte form of the fatty acid binding protein,

FABP4 (aP2). The intracellular pathways regulating lipogenesis and lipolysis are summarized in Figure1.4.

Figure 1.4: Intracellular pathways of factors regulating adipogenesis, lipogenesis, and lipolysis in the adipocyte. Triglycerides (TG) circulate in blood in the form of lipoproteins. Free fatty acids (FFA) that are released from lipoproteins, catalyzed by lipoprotein lipase (LPL), diffuse into the adipocyte. Lipolysis occurs via a cAMP-mediated cascade, which results in the phosphorylation of hormone-sensitive lipase (HSL), an enzyme that hydrolyzes TG into FFA and glycerol. These FFA are then free to diffuse into the blood. Insulin enhances the storage of fat as TG by increasing LPL and lipogenic enzyme activities. It also facilitates the transport of glucose by stimulating GLUT4 glucose transporter. Insulin binding to its receptor (InsR) induces receptor tyrosine autophosphorylation and activation of insulin receptor substrate (IRS)/phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt/PKB) signalling pathways (Adapted from Lukaszewski et al., 2013).

1.11.3 Regulation of fatty acid metabolism Lipolysis and lipogenesis are highly regulated processes releasing or re-esterify FAs in a futile cycle in order to avoid detrimental effects associated with non-physiological increases in FA concentrations (Duncan et al., 2007). In brown adipose tissue, lipolysis is induced by norepinephrine, and stimulated via β3-ARs (Chaudhry and Granneman, 1999). Alterations in lipolysis are frequently associated with obesity, including an increase in basal rates of lipolysis that may contribute to the development of insulin resistance, as well as an impaired responsiveness to stimulated lipolysis (Large et al. 1999). Several agents contribute to the control of lipolysis in adipocytes by modulating the activity of HSL and ATGL (Chaves et al., 2011).

Both lipolysis and thermogenesis occur downstream of cAMP formation as they can be induced by cAMP agonists (Cannon and Nedergaard, 2004). The classical pathway of lipolysis activation in adipocytes is cAMP-dependent. The production of cAMP is modulated by G-protein-coupled receptors of the Gαs and Gαi/o family and cAMP degradation is regulated by phosphodiesterases. There is also evidence that increased lipolytic activity in adipocytes occurs after stimulation of the mitogen activated protein kinase (MAP) pathway or after cGMP accumulation and activation of protein kinase G. Hormonal control of lipolysis can also be achieved by the Gαq/11 family of G-proteins.

Adipose HSL activity is controlled in response to β-adrenergic stimulation. First, HSL is phosphorylated by cAMP-dependent PKA. This leads to an increase of the intrinsic enzyme activity. Besides PKA, other protein kinases, such as ERK and glycogen synthase kinase have also been shown to phosphorylate HSL and regulate enzyme activity. Phosphorylated HSL interacts with perilipin-1 which itself is a target of PKA phosphorylation (Lass et al., 2011).

The activation of HSL by PKA-dependent phosphorylation increases the release of fatty acids into the blood. The activity of HSL is also affected via phosphorylation by AMPK (Zechner

et al., 2009). Remarkably, mice lacking HSL exhibited normal thermogenesis (Osuga et al.,

2000) and were not cold sensitive despite a lipolytic defect that resulted in brown adipocyte hypertrophy due to TAG and DAG accumulation. Apparently, in the absence of HSL, sufficient amounts of FAs are mobilized for mitochondrial heat production. In contrast,

ATGL-knockout mice are extremely cold sensitive and die after cold exposure of more than 6 hours, indicating that the enzyme is essential for the provision of FA as substrate for thermogenesis (Haemmerle et al., 2006).

Insulin and insulin-like growth factor represent the most potent inhibitory hormones in lipolysis (Degerman et al., 2001). Other factors involved in the regulation of fatty acid metabolism include tumour necrosis factor-α (TNFα), growth hormone and the CIDE domain-containing proteins family of proteins (CIDE-A, -B, and –C).

1.12 Free fatty acid receptors The free fatty acid receptors (FFARs) area a family of G protein-coupled receptors (GPCRs) activated by free fatty acids (FFAs). They play vital roles as essential nutritional components and as signalling molecules in numerous physiological processes. FFARs appear to act as physiological sensors for food-derived FFAs and digestion products in the gastrointestinal tract. They are also considered to be involved in the regulation of energy metabolism mediated by the secretion of insulin and incretin hormones and by the regulation of the SNS, taste preferences, and inflammatory responses related to insulin resistance. FFARs have been targeted in therapeutic strategies for the treatment of metabolic disorders including type 2 diabetes and metabolic syndrome.

Following a deorphanization project in the early 2000s (Wise et al., 2004), a few GPCRs were identified whose endogenous ligands are FFAs (Table 1.2). The first was Gpr40 (also

known as free fatty acid receptor 1 or FFAR1). Subsequently, Gpr41 (FFAR3), Gpr43

(FFAR2) and Gpr120 (FFAR4) were deorphanized (Wise et al., 2004). Medium- and long- chain FFAs activate FFA1/GPR40 and FFA4/GPR120. Short-chain FFAs activate

FFA2/GPR43 and FFA3/GPR41. However, only medium-chain FFAs, and not long-chain

FFAs, activate GPR84 receptor (Wang et al., 2006).

GPCRs form the largest family of signalling receptors. They modulate diverse physiological and behavioural signalling pathways by virtue of changes in receptor activation and inactivation states. These membrane proteins are comprised of seven transmembrane regions

(TM), an extracellular amino-terminus and an intracellular carboxyl-terminal domain. GPCRs were originally identified as receptors capable of coupling to specific guanine nucleotide- binding proteins (G proteins), thereby transducing an extracellular signal to an intracellular effector (Drake et al., 2006). The exact size of the GPCR superfamily is unknown. However, comprehensive phylogenetic analysis of the GPCRs in human and mouse predicted nearly

800 human GPCRs (Bjarnadottir et al., 2006).

Table 1.2: GPCRs that are activated by FFAs

Gpr401,2 Tissue Localization Pancreatic β-cells Ligands Medium and long chain saturated and unsaturated fatty acids, PPARγ agonists Functions Mediates insulin secretion by β-cells Gpr411 Tissue Localization Adipose tissue endothelial cells Ligands Short chain fatty acids (C2-C4) Functions Leptin and Peptide YY secretion. Gpr431 Tissue Localization White adipose tissue and intestine, leukocytes Ligands Short chain fatty acids (C2-C4) Functions Peptide YY secretion and 5-HT Gpr1201 Tissue Localization Brown adipose tissue, lung, intestine, taste buds Ligands Medium and long chain saturated and unsaturated fatty acids. Functions Taste buds: Lipid sensing Immune cells: anti-inflammation and anti-apoptosis Adipose tissue: insulin sensitivity, adipogenesis Intestine: GLP-1 and CCK secretion.

1. (Miyauchi et al., 2009a);

2. (Itoh et al., 2003)

Gpr40: G-protein coupled receptor 40 Gpr41: G-protein coupled receptor 41 Gpr43: G-protein coupled receptor 43 Gpr120: G-protein coupled receptor 120

1.13 G-proteins G proteins are also known as guanine nucleotide-binding proteins. There are two classes of

G-proteins: Heterotrimeric G-proteins and monomeric small GTPases. The Heterotrimeric G- proteins are made up of α, β and γ subunits. These heterotrimeric G-proteins are classified into four families based on the signalling pathway of their Gα subunits. These are Gαs

(stimulatory), Gαi/o (inhibitory), Gαq/11 and Gα12/13. Although G-proteins respond differently in recognition of effector molecule, they share similar mechanism of activation

(Kobilka, 2007).

Classically, the binding of specific ligands to a GPCR causes activation of the receptor, which leads to signal transmission into the cell via a conformational change in the receptor.

This conformational change results in the activation of the bound G protein by promoting the exchange of bound GDP for GTP on the α -subunit. This is the rate-limiting step in G protein activation. The binding of GTP changes the conformation of ‘switch’ regions within the α- subunit, which allows the bound trimeric G protein (inactive) to be released from the receptor and the α-subunit (GTP-bound) dissociates from the βγ dimer. The α subunit and the βγ dimer go on to activate distinct downstream effectors, such as adenylyl cyclase, phosphodiesterases, phospholipase C, and ion channels. These effectors in turn regulate the intracellular concentrations of secondary messengers, such as cAMP, cGMP, diacylglycerol,

IP3, DAG, arachidonic acid, sodium, potassium or calcium cations, ultimately leading to a physiological response, usually via the downstream regulation of gene transcription. The cycle is completed by the hydrolysis of a subunit-bound GTP to GDP, due to the intrinsic

GTPase activity of the Gα subunit, resulting in the re-association of the α- and βγ- subunits and their binding to the receptor, which terminates the signal (Figure 1.4).

Specifically, Gαs activates cAMP-dependent pathway by stimulating the production of cAMP from ATP, catalysed by adenylyl cyclase. Gαi subunit inhibits adenylyl cyclase activity thus

the production of cAMP from ATP is reduced. The Gαq/11 pathway is the pathway that stimulates PLC-β to hydrolyse phosphatidylinositol 4,5-bisphosphate (PIP2) in to the intracellular messengers, inositol trisphosphate (IP3) and diacylglycerol (DAG). IP3 triggers the release of calcium from intracellular stores, and DAG recruits protein kinase C (PKC) to the membrane and with calcium, activates it. Gα12/13 is involved in the Rho family GTPase signalling. Figure 1.4 summarizes G-protein mediated signalling events.

Figure 1.5: Receptor activation of GPCR. Agonist binding triggers a conformational change in the receptor, which catalyses the dissociation of GDP from the α-subunit followed by GTP- binding to Gα and the dissociation of Gα from Gβγ subunits. Typically Gαs stimulates adenylyl cyclase and increases levels of cyclic AMP (cAMP), whereas Gαi inhibits adenyly cyclase and lowers cAMP levels, and members of the Gαq family bind to and activate phospholipase C

(PLC), which cleaves phosphatidylinositol bisphosphate (PIP2) into diacylglycerol and inositol triphosphate (IP3). The Gβγ subunits function as a dimer to activate many signalling molecules, including phospholipases, ion channels and lipid kinases (Dorsam and Gutkind, 2007; Leurs et al., 2005).

1.14 Diversification and specification/regulation of GPCR signalling The GPCR-G-protein linear pathway is a model that does not explain all the jobs GPCRs have to do in vivo. GPCRs can activate signalling pathways independent of heterotrimeric G- proteins to diversify signalling, such as homo and heterodimerization. In some cases dimerization has been shown to have a primary role in correct transport of GPCRs from the endoplasmic reticulum to cell surface. They simultaneously activate multiple proteins, and a single agonist can activate multiple receptor subtypes, with different G-protein coupling specificities. Some receptor genes also have multiple exons resulting in alternative splicing of the receptor genes. Once at the plasma membrane, dimers can be regulated by ligand binding.

Heterodimerization leads to positive and negative ligand binding cooperativity, as well as promoting co-internalization of two receptors after stimulation of only one. This has a clinical implication as it can result in altered pharmacology and function, requiring variable combinations of drugs to effect the desired response. The regulation of signalling is important in specific signal responses and allows cells to decode complex signals. Mechanisms that regulate and specify GPCR signalling include receptor desensitization, endocytosis post- endocytic sorting and recycling balance. An important feature of agonist-stimulated GPCRs is their waning responsiveness to repeated stimulation with agonists, which is accomplished by a coordinated series of events leading to receptor desensitization, sequestration and downregulation (Luttrell and Lefkowitz, 2002). Desensitization/re-sensitization and trafficking are one way to do this. β-arrestins are part of the desensitization machinery but also way of diversifying signalling by being a signal scaffold.

1.15 Role of β-arrestins in GPCR signalling Three families of proteins mediate the function of the receptors: the heterotrimeric G- proteins, the G-protein–coupled receptor kinases (GRKs), and the β-arrestins. β-arrestins have emerged as remarkably versatile adaptor molecules that regulate receptor endocytosis and also serve as signal transducers in their own right. β-arrestins shuttle between nucleus and cytoplasm. Desensitization is initiated by phosphorylation of the receptor. Second- messenger-dependent protein kinases, including cyclic-AMP-dependent protein kinase (PKA) and protein kinase C (PKC), phosphorylate serine and threonine residues within the cytoplasmic loops and C-terminal tail domains of many GPCRs. Phosphorylation of these sites is sufficient to impair receptor G-protein coupling efficiency in the absence of β- arrestins. Apart from function interactions with GPCRs, β-arrestins also act as scaffold proteins that interact with several cytoplasmic proteins and link GPCRs to intracellular signalling pathways such as MAPK cascades.

Agonist-induced internalization of GPCRs is a well-characterized phenomenon that is believed to contribute to receptor desensitization. Upon agonist activation there is redistribution of the receptor-protein away from the cell surface into internal cellular compartments through a process of endocytosis known as internalization (Fukunaga et al.,

2006). The propensity for a receptor to respond to an agonist can be a function of not only the agonist-receptor interaction but also the context of the system β-arrestins. Different ligands have distinct activation property. Individual ligands can differ remarkably in their effects on the regulated endocytic sorting trafficking of the same GPCR, suggesting the existence of unanticipated diversity among ligands (Hanyaloglu and von Zastrow, 2008). Both GRK- mediated GPCR phosphorylation and binding of β-arrestin to the receptor facilitate the agonist-promoted endocytosis of many GPCRs (Luttrell and Lefkowitz, 2002).

Figure 1.6: GPCRs can signal through both G-protein and arrestin pathways. Upon agonist binding to receptor, GPCR is activated leading to the dissociation of G-proteins into activated α subunit and βγ dimer. This triggers the activation of various effectors such as adenyly cyclase and PLC. The agonist-occupied GPCR is phosphorylated by GRKs, leading to signal desensitization, binding of β-arrestin to the activated phosphorylated GPCR and subsequent endocytosis of the receptor (Adapted from Ma and Pei, 2007; Ritter and Hall, 2009).

1.16 G-protein-coupled receptor 120 (Gpr120) Gpr120 is a membrane bound receptor. member of the family of GPCRs and binds both saturated and unsaturated fatty acids (Hirasawa et al., 2005), where it has a critical role in various physiological homeostatic mechanisms such as adipogenesis, regulation of appetite and food preference (Gotoh et al., 2007a). Gpr120 was originally described as an orphan receptor until a recent GPCR deorphanising process identified its endogenous ligands, poly- unsaturated long-chain free fatty acids (FFAs) (Chung et al., 2008). In humans, the gene is encoded on chromosome 10, and in mouse on chromosome 19. Human Gpr120 has two splice variants. Gpr120 belongs to the class A (Rhodopsin-like) family, that has only limited homology to other family members, but has been highly conserved among species and represents the most studied subfamily of GPCRs (Fredriksson et al., 2003).

There is a wide variation in the tissue expression of Gpr120. Gpr120 protein was found to be highly and widely expressed on the plasma membrane of adipocytes which increased during adipogenesis (Miyauchi et al., 2009b). In terms of gene expression, Gpr120 is the only lipid sensing GPCR which is highly expressed in adipose tissue, proinflammatory CD11c+ macrophages (BMDCs), mature adipocytes, and monocytic RAW 264.7 cells (Oh et al.,

2010). Its mRNA has been found at high levels in taste buds (Galindo et al., 2012), where it may be functioning as a dietary sensor. Gpr120 expression has been reported to increase in

WAT of mice on high fat diet and high levels also detected in human differentiated adipocytes (Gotoh et al., 2007b). Although Gpr120 expression was found to be higher in obese individuals than in lean controls, Gpr120 knockout mice fed a high fat diet gained more weight, had decreased energy expenditure, but with decreased insulin sensitivity (Ichimura et al., 2012b). A preliminary micro array data showed that Gpr120 is expressed in brown adipose tissue and induced upon cold exposure giving a potential role of this receptor by linking dietary fat sensing to energy homeostasis and metabolic control.

The function of Gpr120 in adipose tissue is not entirely understood. It is known to be a nutrient-sensing receptor, which may have an important role in the activation of metabolic pathways that control energy utilisation of adipocytes, including β-oxidation and glucose uptake (Gotoh et al., 2007). It has been found to promote secretion of cholecytokinin and glucagon-like peptide from intestinal luminal cells in response to stimulation by unsaturated long chain fatty acids (Tananka et al 2008a/b). Gpr120 activation in primary adipose tissue and 3T3-L1 adipocytes led to an increase in glucose transport and translocation of GLUT4 to the plasma membrane, and this effect was abolished upon Gpr120- and Gαq/11 knockdown

(Talukdar et al., 2011). Stimulation of Gpr120 with ω-3 fatty acid also causes broad anti- inflammatory effects in monocyte 264.7 cells and in primary intraperitoneal macrophages

(Olefsky et al., 2010). Gpr120 dysfunction has been reported to be involved in the development of obesity in mice and humans (Ichimura et al., 2012a; Waguri et al., 2013). By sequencing Gpr120 exons in obese individuals Ichimura et al reported a deleterious nonsynonymous mutation (p.R270H) that inhibits Gpr120 signalling activity. They reported that agonist-induced calcium response was reduced in cells expressing the p.R270H mutation compared to cells expressing wild type. Furthermore, the p.R270H variant was reported to increase the risk of obesity in European populations (Ichimura et al., 2012b).

The important role Gpr120 plays in the control of inflammation raises the possibility that targeting this receptor could have therapeutic potential in many inflammatory diseases including obesity and type 2 diabetes (Talukdar et al., 2011). Targeting Gpr120 may therefore be useful in addressing obesity and its associated complications.

1.17 Signalling pathways activated by Gpr120 In many in vitro models, Gpr120 couples to Gαq/11 and activates PKC and MAP kinase pathways. In 3T3-L1 adipocytes ligand activation of Gpr120 caused an increase in glucose uptake through coupling to Gαq/11 pathway (Oh et al., 2010). However, recent studies have reported Gpr120 can also signal through a G-protein-independent pathway, notably a β- arrestin-dependent pathway in macrophages (Oh et al., 2010), suggesting that Gpr120 signalling may be different in distinct cell types. In 3T3-L1 adipocytes, β-arrestin-1 was implicated in the stimulation of glucose transport (Imamura et al., 2001). In macrophages, the activated Gpr120-β-arrestin2 complex mediated downstream signalling events, such as ERK phosphorylation, independent of Gαq/11, indicating that Gpr120 mechanism of activation differs with cell type (Talukdar et al., 2011).

1.18 Development of selective ligands for Gpr120 GPCRs represent the most successful drug target with 30-50 % of pharmacological agents targeting these receptors (Salon et al., 2011). Use of agonists and antagonists to modulate

GPCRs action is not without it demerits. While some antagonists can still activate GPCRs, some of the agonists engage regulatory mechanisms leading to off target effects. This underscores the need to develop pathway selective (bias) ligands that will specifically target the signalling pathway.

Medium to long chain fatty acids were identified as endogenous ligands for Gpr120

(Fukunaga et al., 2006). Gpr120 was activated by both saturated and unsaturated fatty acids.

Since fatty acids can bind to other receptors, development of specific ligands is of importance in achieving a targeted effect of receptor activation. Several compounds have been, and are still being developed as Gpr120 agonists. The first was GW9508, which was originally

developed as agonist for Gpr40 but also binds Gpr120 (Briscoe et al., 2006a). Other agonist,

NCG21, which is also non-selective, was developed but not yet readily available (Sun et al.,

2010). However, the drive to develop specific ligands for human Gpr120 led to the discovery of TUG891 (Hudson et al., 2013). Another small-molecule Gpr120 agonist (cpdA) was used to improve glucose tolerance, decrease hyperinsulinaemia, increase insulin sensitivity and decrease hepatic steatosis, and exert anti-inflammatory effect on macrophages in vitro and in obese mice in vivo, suggesting that Gpr120 agonists could become new insulin-sensitizing drugs for the treatment of type 2 diabetes and other human insulin-resistant states in the future (Oh da et al., 2014). Another agonist, TUG1096, thought to be highly selective for mouse Gpr120 was developed by our collaborator (Trond Ulven-University of Southern

Denmark) but there is yet no published data. The pharmacological properties are therefore not immediately available. However, preliminary data (personal communication) has shown that at low concentration this agonist was able to activate the functions of Gpr120.

GW9508

Molecular formula: C22H21NO3

GW9508, also known as 4-[[(3-phenoxyphenyl) methyl] amino]-benzenepropanoic acid, is a small-molecule agonist of Gpr40 and Gpr120 with a molecular weight of 347.41. It was originally identified from a high-throughput screen of the GlaxoSmithKline chemical collection (Briscoe et al., 2006a). Stimulation of intracellular Ca2+ mobilization by GW9508 in human embryonic kidney (HEK) 293 cells expressing Gpr40 and Gpr120 was observed with EC50values of 47 nM and 2.2 µM, respectively (Briscoe et al., 2006a). However, it was found to have distinct pEC50 potency values at human Gpr120 in various functional assays, with values of 6.07 ± 0.08 for intracellular Ca2+ release, 6.04 ± 0.04 in β-arrestin-2 and 5.64 ±

0.04 β-arrestin-1 recruitment assays (Hudson et al., 2013).

The pharmacological mechanism of this agonist in the improvement of glycemic control remains unclear. Nevertheless it was found to dose-dependently potentiate glucose-dependent insulin secretion and the KCL-mediated increase in insulin secretion in MIN6 cells (Briscoe et al., 2006a), and to activate the Akt/GSK-3β pathway to increase glycogen levels in HepG2

cells (Ou et al., 2013), defining a function for this ligand in the regulation of glucose homeostasis.

TUG891

Molecular formula: C23H21FO3

TUG891, also known as 4-[(4-Fluoro-4'-methyl [1, 1’-biphenyl]-2-yl) methoxy]- benzenepropanoic acid is a recently developed compound (Hudson et al., 2013). It has a molecular weight of 364.41. At human Gpr120, its pEC50 values were found to be 6.93 ± 0.07 for intracellular Ca2+ release, 7.19 ± 0.07 in β-arrestin-2 and 6.83 ± 0.06 β-arrestin-1 recruitment assays (Hudson et al., 2013). This ligand has been found to be more selective for human Gpr120 than mouse, where it also binds Gpr40. However, higher doses of TUG891 induced anti-inflammatory and anti- metabolic effects in 3T3-L1 cells (Hudson et al., 2013).

1.19 Hypothesis and Aims of the study The worldwide increase in obesity and its associated metabolic disorders represents a growing challenge for health care systems. The activation of human BAT is an opportunity to increase energy expenditure and weight loss, alongside improved lipid and glucose homeostasis. With the recent demonstration of significant deposits of adult BAT and the potential of tissue remodelling in response to temperature changes, new approaches targeting this tissue could provide effective treatments for obesity and its associated diseases, including insulin resistance, and diabetes. There is therefore a potential for a manipulative control of energy homeostasis via the induction of specific genes to enhance BAT levels.

A preliminary microarray-based gene expression analysis of mice maintained for 10 days in either 60C or 280C, identified a number of genes whose expression changed with temperature changes. Two of the genes, Nrg4 and Gpr120, apart from being regulated in a temperature- dependent manner, were highly expressed in BAT. Their expressions were significantly upregulated by cold acclimation. Based on these effects demonstrated and the high thermogenic capacity of BAT, Nrg4 and Gpr120 were chosen for further studies.

The broad aim of the study is to determine the cellular processes and signalling factors and pathways of Nrg4 and Gpr120 in brown adipocytes. To address this hypothesis, the specific aims are:

1. To investigate the expression of Nrg4 in adipocytes and its role in the activation of

BAT function

2. To investigate the expression of Gpr120 and determine factors that regulate the

expression of Gpr120 in BAT

3. To assess the role of Gpr120 via Gpr120 knockout models

4. To investigate impact of novel and specific Gpr120 ligands

5. To investigate the Gpr120 signalling pathways and determine their downstream role

in brown adipocytes

Chapter 2

Materials and Methods

2.1 Materials

2.1.1 Antibodies Primary antibodies

ERK (Cell signalling 9102)

Beta actin (Santa cruz 47778)

GAPDH (Millipore MAB374)

Tuj 1 (abcam14545)

ERK1/2 (Cell Signalling D11A8) phospho-ERK1/2 (Cell Signalling 9101) phospho-p38 (Cell Signalling 9215) p38 (Cell Signalling 9212) phospho-AMPKα (Cell Signalling 2531)

AMPKα (Cell Signalling 2532)

Anti NRG4 (ab60090)

Secondary antibodies

HRP conjugated Goat Anti-rabbit IgG (Invitrogen 656120)

HRP conjugated Rabbit Anti-goat IgG (Dako P0449)

HRP conjugated Rabbit Anti-mouse IgG (Invitrogen 626520)

2.1.2 Plasmids pcDNA3.1 (+) (Invitrogen) pGL3 basic (Promega) pGL3 basic- Nrg4 promoter and enhancer (generated during PhD)

pGL4 basic- Nrg4 promoter and enhancer (generated during PhD) pSuperior shNrg4 (generated during PhD)

β-arrestin1-YFP

β-arrestin2-YFP

2.1.3 Chemicals and Reagents 10mM dNTPs (Invitrogen)

3-Methyadenine (3-MA) (Sigma)

4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma)

10x MMLV buffer (Sigma)

100x ROX reference dye (Sigma)

5X Reporter lysis buffer (Promega)

Agarose, molecular biology grade (Sigma)

Ammonium persulphate (APS) (Sigma)

Ampicillin (Sigma)

Beta-mercaptoethanol (Sigma)

Bovine serum albumin (BSA (Sigma)

Bromophenol blue (Sigma)

Chloramphenicol (Sigma)

Chloroform (Sigma)

Complete EDTA-free protease inhibitors tablets (Roche)

Dexamethasone (Sigma)

Dharmafect 3 (Dharmacon)

Diethylpyrocarbonate (DEPC) - treated water (Sigma)

Dimethyl sulfoxide (DMSO) (Sigma)

Dithiothreitol (DTT) (Sigma)

DNase I, amplification grade (Invitrogen)

Ethanol (BDH)

Ethylenediaminetetraacetic acid (EDTA)

Formaldehyde 16% (w/v) (Thermo Scientific)

Forskolin (Enzo Life Sciences)

Glycine (Sigma)

IBMX (Sigma)

Imidazole (Sigma)

Indomethacin (Sigma)

Insulin (Sigma)

Jumpstart SYBR Green I Mix (Sigma)

Lipofectamine 2000 (Invitrogen)

Kanamycin (Sigma)

Luciferase Assay Reagent (Promega)

Methanol (Sigma)

MMLV Reverse Transcriptase (Sigma)

Non-fat milk powder (Sigma)

Nonidet P-40 (NP-40) (BDH)

Paraformaldehyde (PFA) (Sigma)

PBS

Phenylmethylsulfonyl fluoride (PMSF) (Sigma)

Phosphatase inhibitors cocktail 2 and 3 (Sigma)

Potassium Chloride (Sigma)

PPARα agonist (GW-7647) (Sigma)

PPARα antagonist (GW-6471) (Sigma)

PPARγ antagonist (GW-9662) (Sigma)

PPARδ agonist (GW-501516) (Sigma)

Propan-2-ol (BDH)

Protogel 30% acrylamide (37.5:1 acrylamide to bisacrylamide) (National Diagnostics)

Puromycin (Sigma)

Random hexamers (Invitrogen)

Restriction endnucleases and buffers (New England Biolabs)

RNAse A (Sigma)

RNAse OUT Ribonuclease inhibitor (Invitrogen)

Rosiglitazone (Enzo Life Sciences)

Sodium azide (Sigma)

Sodium chloride (Sigma)

Sodium dodecyl sulphate (SDS) (BDH)

SYBR safe DNA gel stain (Invitrogen)

Tetramethylethylenediamine (TEMED) (Sigma)

TRIzol reagent (Sigma) tris(hydroxymethyl)aminomethane (Tris) (Sigma)

Triton X-100 (Sigma)

Tween-20 (Sigma)

WY-14643 (Sigma)

2.1.4 Kits Amplification grade DNase I kit (Sigma)

BCA kit (Thermo Scientific)

cAMP EIA kit (Enzo Life Sciences)

Fluo-4 Direct™ Calcium Assay Kit (Invitrogen)

GenElute DNA Gel extraction kit (Sigma)

HiSpeed Maxiprep kit (Qiagen)

KOD DNA polymerase (Novagen)

PCR array (SaBiosciences)

Profection Mammalian cell Transfection kit (Promega)

QIAprep Spin Miniprep kit (Qiagen)

QIAquick PCR Purification Kit. (Qiagen)

T4 DNA ligase (Invitrogen)

2.1.5 Cell culture Materials Dulbeco‘s Modified Eagle Medium containing L-glutamine (DMEM) (Invitrogen)

Dulbeco‘s Modified Eagle Medium containing L-glutamine (DMEM-F12) (Invitrogen)

Heat Inactivated Fetal Bovine Serum (FBS) (Invitrogen)

Heat Inactivated Newborn Calf Serum (NCS) (Invitrogen)

100x Penicillin (100 U/mL)/ Streptomycin (50 μg/ml) (Invitrogen)

RPMI (Invitrogen)

Tissue Culture Plasticware and cell culture plates/dishes (Corning)

0.05% Trypsin-EDTA (Invitrogen)

Optimem reduced serum medium (Invitrogen)

2.1.6 Cell lines Immortalized brown adipose tissue cell line (Wild type IMBAT cells, generated in the lab)

Immortalized-Gpr120 Knockout (KO) and Gpr120 Heterozygous (Het) (from Karsen Kristiansen’ lab, University of Copenhagen).

PC12/HER4 cells (provided by Prof William Gullick, University of Kent)

HEK293 human embryonic kidney cells

2.1.7 Mouse tissues FVBN female

CB53-Gpr120 WT and KO BAT

2.1.8 Buffers and solutions High Salt Buffer

20 mM Tris-HCl pH 8.1

500 mM NaCl

2 mM EDTA

0.1% SDS

1% Triton-X100

Lithium Chloride Buffer

10 mM Tris-HCl pH 8.1

250mM LiCl

1 mM EDTA

1% Nonidet p40

1% Deoxycholate

Low Salt Buffer

20 mM Tris-HCl pH 8.1

150 mM NaCl

2 mM EDTA

0.1% SDS

1% Triton-X100

SDS Lysis Buffer

0.5 M Tris-HCl pH 8.1

10 mM EDTA

1% SDS

1% Triton-X100

0.5% Deoxycholate

RIPA Buffer

20nM Tris-HCl pH 7.5

1 mM Na2 EDTA

1 mM EGTA

150 mM NaCl

1% NP-40

1% sodium deoxycholate

2.5 mM sodium pyrophosphate

1 mM Na3 VO4

Swelling Buffer

25 mM HEPES pH 7.9

1.5 mM MgCl2

10 mM KCl

0.1% Nonidet

Tris-EDTA (TE) buffer

10 mM Tris, pH 8.0

1 mM EDTA, pH 8.0

New England Biolabs Restriction Endonuclease Buffers (10x)

NEBuffer 1

10mM Tris Propane-HCl pH 7.0, 10mM MgCl2, 1mM DTT

NEBuffer 2

10mM Tris-HCl pH 7.9, 10mM MgCl2, 50mM NaCl, 1mM DTT

NEBuffer 3

50mM Tris-HCl pH 7.9, 10mM MgCl2, 100mM NaCl, 1mM DTT

NEBuffer 4

20mM Tris-Acetate pH 7.9, 10mM MgCl2, 50mM potassium acetate, 1mM

DTT

Qiagen Buffers

Plasmid prep suspension buffer P1

50 mM Tris-HCl, pH 8.0

10 mM EDTA

100 mg/ml RNase A

Plasmid prep lysis buffer P2

200 mM NaOH

1 % w/v SDS

Plasmid prep neutralization buffer P3

3 M KAc pH 5.5

Plasmid prep equilibration buffer QBT

750 mM NaCl

50 mM MOPS, pH 7.0

15 % v/v isopropanol

Plasmid prep wash buffer QC

1 M NaCl

50 mM MOPS, pH 7.0

15 % v/v isopropanol

Plasmid prep elution buffer QF

1.25 M NaCl

50 mM Tris-HCl, pH 8.5

15 % v/v isopropanol

Plasmid prep elution buffer EB

10 mM Tris-HCl, pH 8.5

Tris-EDTA (TE) buffer

10 mM Tris, pH 8.0

1 mM EDTA, pH 8.0

Western Blotting Buffers

Blocking Solution

5% (w/v) non-fat milk powder in TBS-T or 5% (w/v) BSA in TBS-T

NuPAGE® Tris-Acetate SDS Running Buffer

Tris base 50 mM pH 8.24

Tricine 50 mM

SDS 0.1%

SDS Running buffer

25mM Tris pH 8.3

190mM glycine

0.1% (w/v) SDS

Transfer Buffer

48 mM Tris-base pH 8.0

39 mM Glycine

0.037% (w/v) SDS

20 % (v/v) methanol

Tris Buffered Saline-Tween (TBS-T)

130mM NaCl,

20mM Tris, pH 7.6

Tris Buffered Saline- Tween 20 (TBS-T)

130mM NaCl,

20mM Tris, pH 7.6,

0.1% Tween

Miscellaneous Buffers

10x DNA loading buffer:

0.2% (w/v) Bromophenol blue

40% (v/v) Glycerol

100mM EDTA pH 8.0

10x DNAase I Reaction Buffer (Sigma)

200 mM Tris-HCl, pH 8.3

20 mM MgCl2

10x M-MLV Reverse Transcriptase Buffer (Sigma)

500 mM Tris-HCl, pH 8.3

500 mM KCl,

30 mM MgCl2

50 mM DTT

2x Laemmli loading buffer:

50 mM Tris-HCl, pH 6.8

50 mM Imidazole, pH 6.8

1% (w/v) SDS

10% (v/v) Glycerol

2% (v/v) 2-Mercaptoethanol

0.002% (w/v) Bromophenol blue

5x T4 Ligase Buffer (Invitrogen)

250mM Tris HCl pH7.6

50mM MgCl2

5mM ATP

5mM DTT

25% (w/v) polyethylene glycol-8000

Antibody Dilution buffers

5% non-fat milk in TBS-T with 0.1% (v/v) NaN3

5% BSA in TBS-T with 0.1% (v/v) NaN3

DNase Stop solution

50 mM EDTA

Oil Red O Stock solution

0.7g Oil Red O

200ml isopropanol

Oil Red O Working solution

6 Parts of Oil Red O Stock and 4 of dH20

Phosphate Buffered Saline (PBS)

140mM NaCl

2.5mM KCl

1.5mM KH2PO4 pH7.2

10mM Na2HPO4 pH7.2

Protein lysis buffer

1% Triton-X

Tris pH 7.0

150mM NaCl

1mM PMSF

1x protease inhibitor cocktail

1x phosphatase inhibitor cocktail 2 and 3

Renilla Buffer

0.5M HEPES pH 7.8

40mM EDTA

Stripping Buffer (Protein)

100mM β-Mercaptoethanol

2% (w/v) SDS,

62.5mM Tris-HCl pH 6.7

Tris Borate EDTA (TBE)

90mM Tris Borate

2mM EDTA pH 8.0

2.1.9 Bacterial strains and Media LB-agar

1% (w/v) Bactotryptone,

0.5% (w/v) Yeast Extract,

0.5% (w/v) NaCl,

0.1% (w/v) Glucose,

1.5% Bactoagar

LB-broth

1% (w/v) Bactotryptone,

0.5% (w/v) Yeast Extract,

0.5% (w/v) NaCl,

0.1% (w/v) Glucose

S.O.C Medium (Invitrogen)

2% Bactotryptone

0.5% Yeast Extract

10 mM NaCl

2.5 mM KCl

10 mM MgCl2

10 mM MgSO4

20 mM glucose

2.1.10 Competent Cells DH5α chemically competent cells

DH5α electrocompetent cells

Electrocompetent Top10

2.1.11 SDS gels Resolving gels

375 mM Tris-HCl, pH 8.9

0.1 % w/v SDS

10 %, 12% or 14% v/v acrylamide/bis-acrylamide (37.5:1)

0.03 % w/v APS

0.06% v/v TEMED

Stacking gels

80 mM Tris-HCl, pH 6.8

80 mM Imidazole pH 6.8

0.1 % w/v SDS

4.1 % v/v acrylamide/bis-acrylamide (37.5:1)

0.09 % v/v APS

0.09 % v/v TEMED

Miscellaneous

Amicon 10,000 NMWL centrifugal filter units (Millipore)

ECL Plus Western Blotting Detection System (Thermo Scientific)

Electroporation Cuvettes (Cell projects)

Hyperladder I and IV DNA ladders (Bioline)

Immobilon Polyvinylidene difluoride (PVDF) membrane (Millipore)

Oil Red O (Sigma)

Oligonucleotides (Invitrogen)

Optically clear adhesive seal sheets (Appleton Woods)

PageRuler pre-stained protein ladder (Fermentas)

RNase ZAP (Ambion)

Super RX autoradiography film (Fujifilm)

384-well plates for qRT-PCR (Applied Biosystems)

NuPAGE® Novex 7% Tris-Acetate Gel 1.5 mm, 10 Well

2.2 Methods

2.2.1 Cell culture PC12/HER4 cells: Cells were grown in RPMI-1640 supplemented with 10% horse serum and 5% FBS , 1% L-glutamine and 1%penicillin/streptomycin in 75cm2 tissue culture flasks,

0 and incubated at 37 C in a humid atmosphere maintained at 5% (v/v) CO2 (BOC Ltd,

Guildford, UK). The medium was replenished every 2-3 days and culture was passaged depending on the growth rate. When the cells were approaching confluence, the medium was removed and the cells washed with PBS, incubated for 1 minute at 370C with 1ml of pre- warmed trypsin-EDTA, replenished with medium and transferred to a 15ml centrifuge tube.

The tube was centrifuged at 1,000 rpm for 10 minutes and the pellet was gently re-suspended in 10ml of pre-warmed fresh medium. A proportion of the cells was diluted and used to re- seed a new flask; another proportion was used to seed in culture plates. For study of neurite outgrowth, cells were plated on poly-L-lysine-coated glass coverslips and exposed to unconditioned DMEM-F-12, 10% FBS medium, or conditioned medium from differentiated adipocytes.

Cells were also prepared for storage in liquid nitrogen. Cells were trypsinized and pelleted as described above. The pellets were re-suspended in media containing 10%v/v DMSO. 1 ml aliquots of cells were placed in cryogenic vials and then placed in an isopropanol-filled freezing container, to ensure a constant cooling rate of 1 °C/min at -80 °C. The vials were then transferred into liquid nitrogen for long term storage. Cells recovered from liquid nitrogen were thawed in a 37 °C water bath and added to 20 ml of pre-warmed 10% (v/v)

FBS in DMEM in a 75cm2 flask.

2.2.2 Generation of immortalized cell lines. Primary cultures of brown adipose and subcutaneous, mesenteric, and gonadal white adipose tissues were generated by first digesting the tissue with collagenase and pelleting the stromal vascular fraction. Preadipocytes were purified by collecting the cells that passed through 100 m of mesh. Next, cells were passed through strainers of 70- or 25µm mesh size for brown and white preadipocytes, respectively, and were plated and cultured in DMEMF-12, 10% FBS, and 1% antibiotic-antimycotic. After culture for 2 days, preadipocytes were immortalized by retroviral-mediated expression of temperature-sensitive SV40 large T-antigen H-2kb-tsA58

(a gift from Prof P. Jat, UCL). Cells were cultured at 330C and selected with G418 (100 mg/ml) for 2 week and then maintained in 50 mg/ml G418. Experiments were performed between passages 12 and 22. Cells were differentiated as described below.

2.2.3 Culture and differentiation of IMBAT cells Immortalized brown adipocytes were cultured and maintained in 75cm2 flasks at 330C, 10%

CO2 with DMEM/F12, 1:1 (Life Technologies, Paisley, Scotland), supplemented with 4.5 g/l glucose, 10% FBS (Sigma–Aldrich Co.; St. Louis, MO, USA), 1% penicillin/streptomycin

(BioWhittaker, Vervier, Belgium), and 1% L-glutamine . Cells were plated in 6-well plates

0 and incubated at 37 C and 5% CO2 for treatment with ligands. Two days after attaining confluence, induction of differentiation was started. At the end of the differentiation, conditioned medium from differentiated cells was obtained and used to treat PC12/HER4 cells.

IMBAT: For standard differentiation protocol: An induction medium was used for the first 2-3 days, and then a maintenance medium until full differentiation; the maintenance medium changed every 2-3 days.

Induction medium Maintenance medium

Standard culture medium Standard culture medium

1nM Triiodothyronine (T3) 1nM Triiodothyronine (T3)

170nM Insulin 170nM Insulin

500µM IBMX

250nM Dexamethasone

125nM Indomethacin

2.2.4 Oil Red O staining IMBAT cells were fixed with 4% parafomaldehyde in PBS for 20 minutes at room temperature and washed twice with PBS buffer. An ORO stock was diluted 60:40 in water and filtered. 200µl ORO was added to each well for 30 minutes at room temperature. This was washed off twice with 60% isopropanol and rinsed with PBS. ORO-stained cells in PBS were viewed with a light microscope.

2.2.5 Immunostaining of PC12/HER4 cell: PC12/HER4 cells were treated with conditioned medium from differentiated IMBAT cells.

Following the development of neurite outgrowths cells were fixed in 4% paraformaldehyde

(PFA) for 30 minutes. Fixed cells were washed three times in PBS and were replaced with a blocking solution comprising 0.5% BSA, 0.05% Saponin and 50mM ammonium chloride in

PBS. This was incubated for 20 minutes at room temperature, and washed with PBS. Then

1µl Tuj1 (primary antibody, raised in mouse) in 250µl blocking solution preserved in 2.5µl sodium azide, was added. After an overnight incubation in the primary antibody at 40C, the cover slip was removed and washed 3 times in PBS, and a secondary antibody diluted in blocking solution was incubation at room temperature for 45 minutes. The secondary antibody used was conjugated to alexer 555nm wavelength, and raised in mouse. The cells were washed 3 times with PBS and mounted in DAPI-antifade reagent (Invitrogen). The immunostained cells were then visualised with the confocal microscope.

2.2.6 Western Blotting: The Cells were lysed with RIPA buffer, mixed with EDTA, Protease Inhibitor (cocktail roche), 1mM PMSF, 5mM Sodium fluoride, and 500mM sodium orthovanadate. Lysates were transferred into 1.5ml tubes, incubated on ice for 5 minutes, and centrifuged at 12,000g for 5 minutes at 40C. The supernatant was then transferred into pre-cooled 1.5ml tubes, and snap frozen. 2µl of lysates was used for the determination of protein concentration.

2.2.7 Determination of protein concentration (BCA assay) Three replicates of each sample and standards were used in a 96- well plate. The BCA kit

(Thermo Scientific, USA) was used for the preparation of the standard, and 50 part reagent A

were mixed with 1 part reagent B. 100µl BCA preparation was added to all samples and standards and the plate incubated for 30 minutes at 370C, then allowed to cool at room temperature. The protein concentrations were read with a spectrophotometric plate reader at

562nm.

2.2.8 SDS-polyacrylamide gel electrophoresis: 10-20µg of the protein was diluted to 20µl, an equal volume of laemmli 2X buffer was added and the sample heated for 5 minutes at 950C before loaded into a 12% polyacrylamide gel.

The gel was run for 1 hour at 150 volts, and the separated proteins transferred onto a PVDF membrane at 100 volts and 230mA for 2 hours. Membranes were blocked for 1 hour in 5%

BSA in TBS-T and incubated in primary antibody overnight at 40C. After washing three times with TBS-T, the membranes were then incubated in secondary antibody for 1 hour at room temperature. The membranes were then washed three times with TBS-T and ECL+ added to the membranes and placed on saran wrap. The proteins of interest were detected with a chemiluminescent imager following manufacturer’s instructions. Densitometry was carried out by analysing Western blot images for p-ERK and total-ERK, and for the phosphokinase array with ImageJ software.

2.2.9 RNA preparation:

Total RNA was isolated from cells and tissues using TRIzol Reagent. To avoid ribonuclease

(RNAase) contamination RNAase-free tips, tubes and DEPC-treated water were used.

Moreover, disposable gloves were worn at all times and the surfaces and pipettes were cleaned with RNAase Away. Each sample was homogenised in 1ml TRIzol per 50-100mg

tissue using a power homogenizer. 1ml TRIzol was added per well of a 6-well plate to lyse the cells and the lysate was transferred to a 1.5ml microcentrifuge tube. The homogenised samples were incubated for 5 minutes at room temperature to permit the complete dissociation of nucleoprotein complexes. 0.2ml of chloroform was then added per 1ml of

TRIzol. The sample was mixed vigorously, incubated for 2-3 minutes at room temperature and centrifuged at 12,000g for 15 minutes at 40C. Following centrifugation, the mixture separated into a lower organic red, phenol-chloroform phase, an interphase, and a colourless upper aqueous phase. RNA remained exclusively in the aqueous phase while DNA and proteins remained in the interphase and in the organic phase respectively. Total RNA was precipitated from the aqueous phase by mixing with 0.5ml isopropanol per 1ml TRIzol, incubated for 10 minutes at room temperature and pelleted by centrifuging at 12,000g for 15 minutes. The pellet was then washed with 1ml of 75% ethanol and air-dried. The RNA pellet was dissolved in RNase-free water and the concentration determined from the absorbance at

260 nm with a NanoDrop ND1000 spectrophotometer and samples were stored at -80ºC.

2.2.10 cDNA preparation: One microgram of total RNA was reverse-transcribed to cDNA in a 20µl reaction volume.

Then 1µg RNA was diluted to 4µl and DNAse treated with 0.5µl DNAse I Amplification grade (Sigma-Aldrich) for 15 minutes, to remove any genomic DNA which would be amplified along with the target cDNA, and 0.5µl Reaction Buffer (Invitrogen) for 15 minutes at RT. 0.5 µl EDTA (25mM, Invitrogen) pH 8.0 was added to stop the reaction, and sample incubated at 650C for 10 minutes, then on ice. A mastermix containing 1µl Random hexamers

(50ng/µl, Invitrogen) and 1µl dNTP (10mM, Invitrogen) and 4.5µl water was added to the sample, heated at 650C for 5 minute and cooled on ice. Another mastermix containing 4µl 5X

reverse transcriptase buffer (invitrogen), 2µl 0.1M DTT (Invitrogen) and 1µl RNase OUTTM

(Invitrogen) was added to each sample and incubated at 370C for 2 minutes. Finally, 1µl M-

MLV (Invitrogen) was added to each sample and a cycle of incubation was done at 250C for

10 minutes, 370C for 50 minutes and 700C for 15 minutes, and thereafter the 20µl reaction volume was diluted to 200 with water. The synthesized cDNA was then used for quantitative real-time PCR (qRT-PCR) or stored at -20oC.

2.2.11 Primer design Primers were designed to give a product of approximately 100 bp crossing intron exon boundaries to eliminate the amplification of genomic DNA. Sequences were obtained from

Ensembl mouse genome database and applied to the software Primer Design or Primer 3.

Primers were dissolved in DEPC-treated water to a final concentration of 100 pmol/μl, this was then diluted again to a working concentration of 20 pmol/μl. The primers used for q-RT-

PCR are listed in the Appendix.

2.2.12 q-RT-PCR: For each gene tested, a master mix of the samples was prepared. The master mix of 16µl consisted of the following: 10µl SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich),

0.15µl each of the forward and reverse primers (at 20µM), 0.2µl ROX (Sigma-Aldrich) and

5.5µl DEPC-treated water. This was added into each well followed by 4µl cDNA, giving a reaction volume of 20µl. 4µl DEPC-treated water was added to the non-template control

(NTC) in place of cDNA. Two replicates were loaded for each sample and two wells of the plate were used as the NTC. The plate was then sealed with optically clear adhesive seal

(4titude), centrifuged for 2 minutes at 1,000 rpm and loaded into the PCR machine. qRT-PCR

was carried out using either 7900HT Fast Real-Time PCR System (Applied Biosystems) or

StepOnePlus Real-Time PCR Systems (Applied Biosystems/(Life Technologies Corporation,

Carlsbad, CA, USA). The samples were programmed to run at an initial denaturation temperature of 950C for two minutes, and then melting, annealing and elongation temperatures of 950C for 15 seconds, 600C for 30 seconds and 720C for 30 seconds respectively for a total of 40 cycles. Gene expression was normalised with the expression of the housekeeping gene β-actin, and the relative gene expression was calculated using the 2-

ΔΔCT method (Livak and Schmitgen, 2001).

2.2.13 Bacterial propagation of plasmids

2.2.13.1 Transformation of chemically competent DH5α E.coli by heat shock

For the preparation of large plasmid DNA quantities, chemically competent DH5α cells were thawed on ice (typically 50μl). In a microcentrifuge tube, bacteria were mixed with the relevant plasmid (50 ng DNA). After 30 minutes on ice, cells were heat shocked in a 42oC water bath for 30 seconds and then placed on ice for a further two minutes. Then 200 μl of

SOC medium was added to the reaction and the cells incubated at 37oC for 1 hour. The cells were then spread on L-agar plates containing 100μg/ml ampicillin to select for transformants.

The plates were inverted and incubated at 37oC overnight and the next day colonies were picked.

2.2.13.2 Transformation of electrocompetent Top10 or DH5α E.coli by electroporation

Electrocompetent DH5α cells were thawed on ice. 50μl of bacteria was mixed with the ligation in a pre-chilled 1mm electroporation cuvette and electroporated using a Bio-Rad

gene pulser, at 1.65kV, giving a time constant of approximately 4 milliseconds. Following electroporation, 200μl SOC medium was added and the cells were incubated at 37oC for 1h, and then spread on L-agar plates containing 100μg/ml ampicillin, inverted and incubated at

37oC overnight and the next day colonies were picked.

2.2.14 Small-scale preparation of plasmid DNA (Miniprep) Individual bacterial colonies were used to inoculate 5 ml of LB containing 50μg/ml ampicillin and incubated in a shaking incubator at 37oC overnight. Bacteria were then pelleted by centrifugation for 15 min, at 3900 rpm at 4oC. Plasmid DNA was purified by using QIAprep Spin MiniPrep Kit. Cells were resuspended in 250 μl buffer P1 and lysed under alkaline conditions by the addition of 250μl buffer P2. The lysates were subsequently neutralised and adjusted to high-salt binding conditions by the addition of 350μl of buffer N3.

Samples were centrifuged and the supernatants were passed through a silica membrane. The membrane allowed selective adsorption of plasmid DNA under the high-salt conditions, while RNA, cellular proteins, and metabolites flow through. Endonucleases were removed by a wash step with buffer PB to ensure plasmid DNA was not degraded. The membrane was then desalted by the addition of 750μl of buffer PE. Plasmid DNA was eluted with 50μl elution buffer. Eluted DNA was suitable for diagnostic digestion or sequencing.

2.2.15 Large-scale plasmid DNA preparation (Maxiprep) Higher amounts of recombinant plasmids were prepared by using the Qiagen HiSpeed Maxi

Kit and were suitable for mammalian cell transfection. As described above, a single colony was picked and 5 ml of LB broth containing 50μg/ml ampicillin was inoculated and grown at

37oC for approximately 8 h with continuous shaking. This was then diluted into 200 ml of LB

broth with 50μg/ml ampicillin, which was incubated overnight at 37oC with constant shaking.

Bacteria were recovered by centrifugation at 3900 rpm for 15 min at 4oC. Supernatants were removed and pellets were processed according to the manufacturer’s protocol. The protocol is based on a modified alkaline lysis procedure in which bacterial cells (suspended in buffer P1) were lysed in sodium hydroxide/SDS in the presence of RNase A (buffer P2). SDS solubilised the phospholipid and protein components of the cell membrane, leading to cell lysis. Sodium hydroxide denatured chromosomal DNA, plasmid DNA and proteins, while

RNase A digested the liberated RNA. The lysate was neutralized by the addition of acidic potassium acetate (buffer P3). The high salt condition caused SDS to precipitate with the denatured proteins, chromosomal DNA and cellular debris, trapped in salt-detergent complexes. The smaller, covalently closed plasmid DNA re-natured and remained in solution.

The lysates were passed through a pre-equilibrated (buffer QBT) anion-exchange resin operating by gravity flow under low salt and low pH conditions to trap the plasmid DNA,

RNA, protein, dyes and low-molecular weight impurities were removed by a medium salt wash (buffer QC). Plasmid DNA was eluted in a high salt buffer (buffer QF) and then concentrated and desalted by isopropanol precipitation. The purified DNA was washed with

70 % v/v ethanol, air-dried and redissolved in TE buffer. DNA concentration was measured with a Nanodrop ND1000 spectrophotometer.

2.2.16 Cloning

2.2.16.1 ShNrg4 constructs:

The primers were designed using the Oligoengine software. The pSUPERIOR vector was used in concert with the custom oligonucleotides that were designed to target the Nrg4 mRNA. The pSUPERIOR vector was cut with BglII and NotI enzymes and

dephosphorylated. The sense and antisense oligos were annealed, phosphorylated and ligated into the vector between the BglII and HindIII enzyme sites and the product transformed into electro competent E.coli for miniprep and sequencing. The plasmid DNA was then used to transfect IMBAT cells. IMBAT cells were plated on a 6-well plate and, at 80% confluence, transfected with shNrg4 plasmid according to standard protocol with lipofectamin2000

(invitrogen, USA). A Puromycin kill-curve was used to arrive at the dose that effectively selected the stable cell line expressing the antibiotic resistant gene. Transfected cells were selected with 5μg/ml puromycin and knockdown of Nrg4 assessed.

2.2.16.2 5’RACE:

The transcription start site was determined using FirstChoice® RLM-RACE Kit (Part

Number AM1700). Primers were designed according to the manufacturer’s instructions. A taq polymerase was used to amplify the PCR reaction. A 50μl reaction volume was cycled at an initial denaturation temperature of 980C for 30 seconds, and then 35 cycles comprising 10 seconds denaturation at 980C, 30 seconds annealing at 600C and 30 seconds elongation at

720C, and a final extension step at 720C for 10 minutes. The PCR product was then purified, ligated into topo TA cloning vector (Invitrogen, USA) according to the manufacturer’s instructions and transformed into electro competent E-coli for miniprep and sequencing. The plasmid DNA was digested with EcoRI. Analysis of restriction enzyme digestions was performed via agarose gel electrophoresis. The presence of the inserted gene was identified via sequencing.

2.2.17 Restriction digests Restriction enzyme digests were performed using enzymes from New England Biolabs at

37oC in the buffers recommended by the manufacturer supplemented with 100x BSA where required. DNA was digested with excess of enzyme. For analysis of digestion products, reactions were terminated by the addition of 10x DNA loading buffer and analysed by gel electrophoresis.

2.2.18 PCR for cloning The KOD Hot Start DNA polymerase was used to amplify DNA. KOD polymerase is a high- fidelity, proofreading and has 3‘to 5‘exonuclease activity, so PCR products are of high fidelity. In 0.2ml PCR tubes 1ng plasmid DNA or 200ng genomic DNA or 2μl of a 20μl reverse transcriptase reaction mix was mixed with 5μl of 10X PCR Buffer for KOD Hot Start

DNA Polymerase, 3μl of each forward and reverse primers (at final concentration of 0.3μM),

5 μl dNTPs (final concentration 0.2 mM), 2 μl MgSO4 (final concentration 1 mM), 1μl KOD

Hot Start DNA Polymerase (1 U/μl) and PCR grade water to a final volume of 50μl. At the same time non-template control reactions were set up. PCR run conditions were set based on the size of the amplified fragment.

2.2.19 DNA agarose gel electrophoresis Molecular biology agarose was dissolved in 1x TBE in a canonical flask to give the appropriate percentage gels around 1-2 % (w/v). The suspension was heated in a microwave oven until boiling. The solution was allowed to cool, 0.5μg/ml ethidium bromide or sybr safe was added, and poured into appropriate trays with combs. Once set, the gel was submerged in

1x TBE buffer in a gel tank. DNA samples were mixed with 10x DNA loading buffer and

loaded into the wells along with the appropriate DNA ladder. Electrophoresis was carried out at 100V. DNA was visualised and photographed by illumination on a long wave UV light box.

2.2.20 PCR purification

2.2.20.1 Gel extraction of DNA

Restriction fragments were purified from TBE agarose gels using GenElute DNA Gel

Extraction kit according to manufacturer‘s protocol. DNA bands of the desired molecular weight were cut from the gel with a clean scalpel under UV light. The gel slice was weighed and 3 volumes of gel solubilisation solution were added. The gel mixture was incubated at

50oC for 10 min with occasional mixing until the gel slice was completely dissolved. At the same time, the binding column was prepared by adding 500μl of column preparation solution and centrifuging at 13,000 rpm for 1min and discarding the flowthrough. 1 gel volume of

100% isopropanol was added and mixed. The solubilized gel solution was loaded to the prepared binding column and centrifuged at 13,000rpm for 1min. DNA binds to silica membrane and was washed with 700μl of wash solution. Residual ethanol was removed by centrifugation for 1min. DNA was eluted by adding 30-50μl of elution buffer to the membrane, and the concentration of the eluted DNA was measured with the Nanodrop spectrophotometer (ND-1000, Ladtech International).

2.2.21 DNA sequencing Plasmid DNA was mixed with 3.2 pmol of sequencing primer to a total volume of 10μl. DNA sequencing carried out by Beckman Coulter Genomics, and the chromatographs were analysed with the 4Peaks software.

2.2.22 siRNA transfection of IMBAT cells Undifferentiated or differentiated IMBAT cells were transiently transfected in 24 or 12-well plates using Lipofectamine RNAiMax reagent. Undifferentiated IMBAT cells were seeded into wells and grown in 10 % FBS and 1% L-glutamine in DMEM/F-12 without antibiotics until they were 80% confluent. The following day, the transfection mixes were prepared as follows: in an appropriate size tube siRNA was diluted in 50μl/100μl Opti-MEM® I reduced serum medium and mixed gently, whereas in a separate tube the appropriate volume of lipofectamine RNAiMax reagent was diluted in Opti-MEM® I reduced serum medium, mixed and incubated at room temperature for 5 minutes. The diluted siRNA and diluted lipofectamine were combined, gently mixed and incubated for 25 minutes to allow siRNA- lipofectamine complexes to form. The transfection mix was then added to each well. After

24h, transfection media was replaced with normal growth media and allowed a further 24 hours before the cells were treated and harvested.

For transfection of differentiated cells, following 7 days of differentiation cells in 6-well plates were washed with PBS and trypsinized (Trypsin added to cover cells then immediately removed; trypsin coated wells were kept in 37°C for one minute). Cells were resuspended in

2ml medium (10% serum, 1% L-glutamine) without antibiotics. Cell were reverse transfected

(while settling) with siRNA using Lipofectamine RNAiMAX diluted in OptiMEM reduced serum medium following manufacturers protocol, and the siRNA and lipofectamine complex

was incubated for 25 minutess. Cells were left in transfection reagents overnight. Next day, each well was washed with DMEM/F-12 medium containing 10% FBS, 1% L-glutamine and

1% Pen/strep. 2 mls of this media was then added to each well and left at 37°C for 24 hours.

Cells were treated and harvested the following day (48h after transfection).

2.2.23 Reporter Gene assays IMBAT cells were plated on 96-well plates washed with PBS and lysed in 25 μl 1x Reporter lysis buffer. The plates were then placed on a shaker for 5min and then placed at -80oC for storage or for a freeze-thaw step which is required for the appropriate lysis of the cells. Plates were then thawed and 10 μl of each lysate was transferred to a white 96-well plate. 50 μl of the luciferase assay reagent was then added to each well and immediately the luciferase activity was measured by reading luminescence on Victor2 plate reader (Perkin Elmer). The remaining lysates were used to measure luciferase activity to normalise firefly activity measurements. Thus, 10 μl of each lysate was transferred to a white 96-well plate together with 50 μl of Coelenterazine in Renilla buffer. Plates were incubated in dark at room temperature for 20 minutes and then read as described above. Each firefly luciferase activity was divided by Renilla activity to correct for variations in the transfection efficiency.

2.2.24 Calcium mobilisation assay IMBAT cells were seeded into 35mm tissue culture treated dishes maintained in medium containing 10% FBS and 1% Penicillin/Streptomycin in DMEM/F-12 in an incubator (5%

CO2 at 37°C) and grown to confluence. On the day of assay the Fluo4-AM dye was prepared according to the manufacturer‘s instructions. 2x calcium sensitive Fluo-4-AM was mixed with the same volume of culture medium, and cells were incubated for 30min in an incubator,

and a further 30min at room temperature. Plates were then placed for live cell imaging on the

SP5 confocal microscope (Leica) using the LAS‐AF program. Cells were imaged with 20x objective at room temperature, capturing images every 1.2 sec for ~ 5min. DMSO was used to initially stimulate the cells to obtain a baseline control. Thereafter, the cells were stimulated with different ligands. The data exported from the program as values based on the fluorescence emitted by the experiment. These values were exported to Excel and the basal average intensity from the first 1min was subtracted. Ca2+ transient responses were reported as fold-change in Ca2+ dye fluorescence relative to the baseline signal.

2.2.25 cAMP Accumulation Assays Undifferentiated IMBAT cells were seeded into 24 well plates. On reaching confluence the cells were serum starved overnight and pre-treated with 500μM IBMX, a phosphodiesterase inhibitor, for 5 min. Cells were then treated with 100μM GW9508, 10μM TUG891 or 10µM

TUG1096 for 30min in the presence or absence of 3uM forskolin, an activator of adenyly cyclase. The experiment was terminated with the addition of 0.1 % HCl- Triton X-100. cAMP was measured using a competitive enzyme immunoassay (Enzo Life Sciences) according to the manufacturer‘s instructions, and normalised to protein concentration estimated using the BCA assay.

2.2.26 β-arrestin recruitment assays IMBAT cells were plated on polyD-lysine coated cover slips in 24-well plates in 10% FBS and 1% Penicillin/Streptomycin in DMEM/F-12 media. On reaching 80 to 90% confluence cells were transfected with YFP-tagged β-arrestin-1 or β-arrestin-2 plasmid for 72 hours, using Lipofectamine 2000 as follows: In an appropriate size tube DNA was diluted in

50μl/100μl Opti-MEM® I reduced serum medium and mixed gently, whereas in a separate tube the appropriate volume of lipofectamine 2000 reagent was diluted in Opti-MEM® I reduced serum medium, mixed and incubated at room temperature for 5 minutes. The diluted

DNA and diluted lipofectamine were combined, gently mixed and incubated for 20 minutes to allow DNA-lipofectamine complexes to form. The transfection mix was then added to each well and after 24h, transfection media was replaced with normal growth media and allowed a further 48 hours before the cells were treated ligands. The cells were treated with 100µM

GW9508, 10µM TUG891 or 10µM TUG1096 for 1, 5 and 20 minutes. Another set was treated with DMSO and served as untreated control. Following treatment, the cells were immediately fixed in 4% paraformaldehyde (PFA) for 30 minutes. Fixed cells were washed three times in PBS and mounted on to coverslips with Fluoromount G. Images were taken via confocal microscopy (SP5 Leica microsystem) with 63x oil immersion objective.

2.2.27 Phospho-kinase array Phospho-kinase array experiments were carried out using the Proteome Profiler, Human

Phospho-Kinase Array Kit (R & D systems). Undifferentiated IMBAT cells were grown to confluence in DMEM/F-12, supplemented with 10 % FBS, 1% Pen/Strep and 1% L- glutamine. Cells were then treated with various ligands for 5 minutes and harvested with buffer 6 according to manufacturer’s instructions. Protein estimation was carried out using the BCA assay, and membranes incubated with 20µg of protein. The proteins of interest were detected with the chemiluminescent imager and the light emission was captured and visualized by exposing the blot to film. The positive signals seen on developed film were identified by placing the Transparency overlay, provided in the kit, on the developed membranes. Densitometry was carried out with ImageJ software.

2.2.28 Microarray experiments Global mRNA expression was measured in BAT depot using Illumina bead chip. Whole- genome expression of wild-type and knockout samples were profiled using MouseWG-6 v2.0

Expression BeadChips (Kuhn et al., 2004). The summary-level data was processed using the

R packages lumi 2.10.0, lumiMouseAll.db 1.18.0 and lumiMouseIDMapping 1.10.0 using nuID annotations (Du et al., 2007, 2008). No background correction was used for a more sensitive analysis and the data was normalised using quantile normalisation. Differentially expressed genes (DEGs) between the wild-type and knockout samples were detected based on a moderated t-test using limma on the normalised data, removing unexpressed genes. The normalised expression data was filtered using logFC < 0.5 and q < 0.05, converted into z- scores and heatmap 2 was used to visualise the data. DEGs with p < 0.05 were submitted to

DAVID (Database for Annotation, Visualization and Integrated Discovery) for functional classification by submitting RefSeq mRNA accession numbers to DAVID. Probe sets are coloured according to average expression levels across all samples, with green denoting a lower expression level and red denoting a higher expression level. Functional clusters were considered significant for FDR < 0.01 (Huang et al., 2009a, b).

2.2.29 Statistical Analysis Data were analysed with GraphPad Prism5 software. ANOVA tests and T-tests were performed and only P values <0.05 were considered statistically significant. Results were given as mean ± standard error of mean.

Chapter 3 Results

Adipose Tissue: Cold-induced changes in gene expression

3.1 Introduction Adipose tissue is found in two forms: White Adipose Tissue (WAT) and Brown Adipose

Tissue (BAT) (Cannon and Nedergaard, 2004). WAT stores energy and possesses endocrine properties whereas BAT, which is highly vascularized and possesses a high concentration of

UCP1-containing mitochondria, provides heat to the body in response to cold stimulation.

The primary molecule involved in this cold-induced thermogenesis in BAT is UCP1, a mitochondrial inner-membrane protein that uncouples proton entry from ATP synthesis. Both

WAT and BAT are innervated by the sympathetic nervous system. Although all three known

β-adrenoceptor subtypes (β 1-, β 2- and β3-adrenoceptor) are expressed in brown adipocytes

β3-adrenoreceptor (β3-AR) seems to be most relevant for the acute activation of thermogenesis (Lafontan and Berlan, 1993). β1-AR and β2-AR do not mediate thermogenesis in rat brown fat cells even after cold acclimation (Zhao et al., 1998).

How is the reduction in the environmental temperature sensed and translated into a thermogenic response in BAT? The activation of sympathetic nerves induces noradrenaline release from the nerve terminals. Upon cold exposure, efferent signals from the hypothalamus and brain stem control regions activating BAT thermogenesis and are relayed to the tissue by sympathetic innervation such that the release of norepinephrine activates β3-ARs in the membrane of brown adipocytes. This leads to increased lipolysis and β-oxidation of fatty acids and subsequently the activation of Ucp1 (Cannon and Nedergaard, 2004; Wu et al.,

2013).

3.2 Cold stimulation causes changes in gene expression

Different fat depots vary in their response to cold. To understand the function of BAT, we have investigated the differences in gene expression profiles between BAT and WAT, induced by cold acclimation. We utilized microarray technology to investigate the differences in gene expression of mice kept at different temperatures. In doing this, we used female

129Sv mice, a strain that has been reported to be resistant to both diabetes and obesity

(Almind et al., 2007), and has a greater amount of adipocytes expressing Ucp1 in the different adipose tissues (Murano et al., 2009). Gene expression from the interscapular BAT, subcutaneous WAT and mesenteric WAT was analysed by microarray from mice maintained for 10 days at either 280C or 60C. This analysis identified a number of genes that were regulated in a temperature-dependent manner and differentially expressed in one adipose depot than another.

The origin of brown adipocytes arising in white adipose tissue (WAT) after cold acclimatization is unclear. It is well established that β-adrenergic stimulation, such as cold acclimatization, not only activates the brown adipocytes in interscapular BAT but also induces the appearance of brown adipocytes in WAT, termed ‘’brown in white (BRITE) or beige adipocytes (Nedergaard and Cannon, 2010; Zheng et al., 2014) . In showing these tissue remodelling properties, we compared the cold-induced genes in WAT to those enriched in BAT following cold exposure. Changes in gene expression identified by microarray were further investigated by q-RT-PCR in interscapular BAT, subcutaneous WAT, mesenteric

WAT, and gonadal WAT at 280C, 220C or 60C (Figures 3.1 and 3.2). Nrg4, Gpr120, Cidea and Rgs7 were highly expressed in BAT with moderate expression in the gonadal WAT. The expression of Nrg4 and Gpr120 was induced in BAT, subcutaneous and gonadal WAT following cold exposure (Figure 3.1). Nnat was preferentially expressed in gonadal WAT, followed by subcutaneous and mesenteric WAT and BAT, but was downregulated in all

depots following cold exposure (Figure 3.2). These results indicate that cold stimulation induces a series of changes in gene expression of BAT and WAT-associated genes.

100

Ucp1 Nrg4 28°C 20 0.25 22°C ** 0.20 *** 6°C 15 0.15

0.10 Relative mRNA fold Relative mRNA fold 10 0.05 change * change ** * 5 0.008 * 0.004 **

0 0.000 sWAT gWAT mWAT BAT sWAT gWAT mWAT BAT

Gpr120 Rgs7

Relative mRNA fold Relative mRNA fold change change

BAT sWAT gWAT mWAT BAT sWAT gWAT mWAT Bmp8b Cidea

2.0 ***

1.5

Relative mRNA fold Relative mRNA1.0 fold change change 0.5 0.2 * 0.1 0.0 BAT BAT sWAT gWAT mWAT sWAT gWAT mWAT

Figure 3.1: mRNA expression levels of selected genes upregulated by cold exposure using q-RT- PCR. A microarray analysis of BAT, subcutaneous WAT (sWAT), gonadal WAT (gWAT) and mesenteric WAT (mWAT) of mice exposed to 28, 22, or 60C. Gene expression was normalized to beta-actin and depicted with reference to BAT at 280C. All mRNAs are expressed as fold change. Error bars represent the mean ± SEM of at least 3 mice/groups in duplicates. Significant differences are shown. *P< 0.05, **P <0.005, ***P< 0.001.

101

Nnat

Relative mRNA fold change 28°C 22°C

6°C

BAT sWAT gWAT mWAT

Figure 3.2: mRNA expression levels of Nnat downregulated by cold exposure using q-RT-PCR. A microarray analysis of BAT, subcutaneous WAT (sWAT), gonadal WAT (gWAT) and mesenteric WAT (mWAT) of mice exposed to 28, 22, or 60C. Gene expression was normalized to beta-actin and depicted with reference to BAT at 280C. All mRNAs are expressed as fold change. Error bars represent the means ± SEM of at least 3 mice/groups in duplicates. Significant differences are shown. *P< 0.05, **P <0.005.

102

3.3 Validation of the gene expression on a mouse tissue panel Based on the results of the micro array-based gene expression analysis, we carried out q-RT-

PCR to validate the expression of the genes that were regulated in this temperature-dependent manner. A panel of mouse tissues from three sets of female FVBM mice was analysed for

Ucp1, Nrg4, Gpr120, Rgs7, Nnat, Bmp8b, and Cidea, to determine their relative expressions.

The expression of Cidea, a known brown fat gene (Seale et al., 2007), was used as a positive control. Following the analysis, it was observed that Ucp1, Nrg4, Gpr120, Rgs7, Bmp8b and

Cidea were most highly expressed in BAT.

Nnat, a member of the proteolipid family of amphipathic polypeptides, was downregulated by cold stimulus in BAT, mesenteric and subcutaneous WAT (Figure 3.2B). The expression of

Rgs7 (Regulator of G-protein signalling 7), a negative regulator of GPCR signalling, was upregulated in BAT, subcutaneous WAT, gonadal WAT and mesenteric WAT following cold exposure (Figure 3.2A). Rgs7 was found to be highly expressed in the brain, BAT and pituitary, with its highest expression in BAT (Figure 3.3). Bone morphogenetic protein 8b

(Bmp8b), is a member of the transforming growth factor-β (TGF-β) superfamily with a role to play in BAT’s sympathetic stimulation (Whittle et al., 2012). Bmp8b was found to be highly expressed in BAT (Figure 3.2A), and induced in BAT and subcutaneous WAT following cold stimulus, with little change in the mesenteric WAT (Figure 3.2A).

The free fatty acid receptor, Gpr120 was most highly expressed in BAT (Figure 3.2A), and upregulated in BAT and gonadal WAT upon cold exposure (Figure 3.2A). Cidea, a known brown fat gene, was upregulated in all adipose depots following cold exposure (Figure 3.2A) and serves here as a positive control, thereby validating the result of other gene expression profiles seen (Figure 3.3). Nrg4 was highly expressed in BAT, with relatively low expression in the white adipose tissues, liver and mammary gland (Figure 3.2B). This expression was significantly induced in BAT, subcutaneous WAT and gonadal WAT upon cold exposure

103

(Figure 3.2A). Based on its high expression in BAT and its upregulation in BAT and WAT following cold acclimation, Nrg4 was selected for further studies.

104

105

Figure 3.3: mRNA levels of Nrg4, Bmp8b, Gpr120, Rgs7, Nnat, and Cidea across a panel of mouse tissues using q-RT-PCR. Tissue samples were obtained from FVB/N female mice kept under normal housing conditions. Total RNA was extracted with Trizol and cDNA was performed by using Moloney Murine Leukemia Virus Reverse transcriptase (M-MLV RT) following the manufacturer’s instructions. Gene expression was normalized to β-actin with kidney as the reference value. All data are expressed as the mean ± SEM of three samples in duplicate (n=3).

106

Table 3.1: Summary of gene expression profile of Nrg4, CIDEA, Bmp8b, Rgs7, Gpr129 and Nnat across a panel of mouse tissues using q-RT-PCR.

Approximate fold change in mRNA expression with reference to the kidney Mouse tissues Nrg4 CIDEA Bmp8b Rgs7 Gpr120 Nnat Intestine 1 NE 13 NE 12 NE Spleen NE NE NE NE 7 NE Stomach NE 1 NE 1 76 NE

Adrenal 2 4 NE 3 18 5 Ovary 3 1 NE 2 3 9 Mammary 39 221 NE 6 212 25 Brain NE 3 NE 53 NE 54 Lung 1 2 NE NE 435 1

Brown 307 2409 21 73 1797 2 Uterus 2 2 1 NE 2 1 Pituitary 5 19 NE 40 245 829 Kidney 1 1 1 1 1 1 Pancreas 3 12 NE 1 138 19 White Sub 6 14 1 4 180 44 White Gon 52 104 NE 4 256 170 Heart 2 19 NE 3 2 1 Liver 25 1 1 NE 12 1 Skeletal NE NE NE NE 2 1

Sub = Subcutaneous; Gon = Gonadal; NE = Not expressed

107

3.4 Discussion The discovery of the existence of significant deposits of BAT in adult humans and its physiological response to cold and genetic activation (Cao et al., 2011) has opened new frontiers for therapeutic strategy for the treatment of obesity and related metabolic disorders.

It has an enormous thermogenic function that will lead to increased energy expenditure. In fact, it has been estimated that 50g of brown adipose tissue would be sufficient to burn 20% of the daily energy intake (Cannon and Nedergaard, 2004). Since the major function of BAT is to dissipate energy, the potential to recruit and activate even a small amount of endogenous

BAT via the induction of specific genes will be useful in the maintenance of energy homeostasis.

To understand the function of BAT we have investigated the differences in gene expression between BAT and WAT with respect to temperature changes using microarray technology

(Sun, 2007). From our microarray analysis we have identified a set of genes that are induced or downregulated following cold exposure in BAT and WAT. Previous studies have established preferential expression of genes involved in fatty acid metabolism in BAT compared to WAT following cold exposure (Shore et al., 2013). We were able to confirm the cold induced increase in Ucp1 and Gpr120, expression. Our result identified Nrg4, Gpr120 and Rgs7 to be cold induced, and Nnat was downregulated. We confirmed that Nrg4 has its highest expression in BAT, with moderate expression levels in gonadal WAT, mammary gland and liver and low levels in the pituitary. Other studies have reported that Nrg4 had its highest expression in the pancreas (Harari et al., 1999). However, a recent report supports our finding that Nrg4 is mainly a brown fat gene (Wang et al., 2014). Based on the findings that Nrg4 and Gpr120 were mostly expressed in BAT, and significantly upregulated following cold exposure, both Nrg4 and Gpr120 were selected for further studies in mice.

108

Chapter 4 Results

Neuregulin 4 (Nrg4) and its Functional Characterization in Brown Adipose Tissue

109

4.1 Introduction From the microarray-based gene expression data, Nrg4 was one of the genes that was identified to be regulated in a temperature-dependent manner. Furthermore, it was most highly expressed in BAT and this expression was increased upon cold exposure. It was also one of the very few genes that was cold regulated in the mesenteric WAT. Based on these findings, Nrg4 was selected for further study.

Nrg4 is a member of a distinct subgroup of growth factors called the neuregulins (Nrg1–

Nrg4). They contain epidermal growth factor-like (EGF-like) domains and primarily signal through HER4, encoded by the gene ErbB4. The EGF protein family are involved in diverse biological processes involving normal development, and in the pathology of many diseases

(Yarden and Sliwkowski, 2001). Neuregulins (NRGs) are signalling proteins that mediate cell-cell interactions in the nervous system, heart, breast, and other organ systems (Falls,

2003). The neuregulin family of genes has four members: Nrg1, Nrg2, Nrg3, and Nrg4. Until recently, the role of Nrg4 in adipose tissue had not been studied. The primary structure and the pattern of expression of Nrg4, together with the strict specificity of this growth factor for

ErbB4, suggest a physiological role distinct from that of the other known ErbB ligands

(Harari et al., 1999). Nrg4 is highly expressed in BAT, with lower levels of expression in

WAT, and its expression is induced by cold exposure. In order to understand the role of Nrg4 in brown fat function we looked at its expression following brown adipocyte differentiation and Ucp1 induction, and the regulatory elements that are important for its role. An immortalized brown fat cell line was first created to test these function. Since the neuregulins interact with the nervous system, and Nrg4 was found to be expressed in brain, albeit a low level, it could have a role in BAT through interaction with the neurons innervating it.

110

4.2 Nrg4 is a brown fat–enriched adipokine

Given the high mRNA level of Nrg4 in BAT (Figure 3.2A) , we decided to analyse its protein expression in vivo by a comprehensive immunohistochemistry staining with an anti-NRG4 antibody. This confirmed the presence of NRG4 in the adipocytes of BAT and gonadal WAT, with BAT being much more immunoreactive than the Gonadal WAT (Figure 4.1)

BAT

WAT

Anti-Nrg4 No antibody (control)

Figure 4.1: Immunohistochemical staining of BAT and gonadal WAT with of anti-127 NRG4 antibody showing presence of Nrg4 in BAT and gonadal WAT. Fixed and paraffin-embedded BAT and gonadal WAT mouse samples were incubated with anti-127 NRG4 antibody (left panel/ brown colour) or blocking buffer alone as a negative control (right panel/ bluish colour). The samples were then incubated with Streptavidin Poly-HRP Conjugate and immunoreactivity was visualized by light microscopy (20X Magnification). Red arrows show brown adipocytes (with centrally placed nucleus) and the black arrows demonstrate show white adipocytes (with peripherally placed nucleus).

111

4.3 Immortalized brown adipocytes (IMBAT cells) system and Nrg4 expression Adipocyte differentiation is a complex process characterized by coordinated changes in cell morphology, hormone sensitivity, gene expression and secretory capacity (Perera et al.,

2006). This involves communication of extracellular signals to the nucleus, and is associated with the accumulation of triglycerides in lipid droplets, secretion of several hormones and changes in gene expression of certain genes (Spiegelman and Flier, 2001). This results in the mature adipocyte that is highly specialized for energy storage and homeostasis. A variety of agents influence adipocyte differentiation. At least two families of transcription factors,

C/EBP and PPAR, are induced early during adipocyte differentiation.

Until recently, studies using adipocyte cell lines have mostly relied on the 3T3-L1 line since these cells can be chemically induced to differentiate into adipocytes. However, these cells are fibroblastic and easily lose their adipogenic potential in culture (Wolins et al., 2006) especially with increasing passage (Poulos et al., 2010) and therefore not true preadipocytes.

An immortalized brown adipose tissue (IMBAT) cell system was developed, which provides a model for adipocytes that are derived from bona fide preadipocytes rather than fibroblasts and provides an alternative system to primary preadipocytes for investigation of brown adipocyte functions.

The immortalized protocol involved infection of brown adipocytes with SV40 large T antigen that has been genetically modified to express a mutated, temperature-sensitive SV40 large T- antigen under the control of a major histocompatability complex class II promoter (Jat et al.,

1991). This was done prior to initial differentiation in order to prevent the sequestration of retinoblastoma protein thereby avoiding the risk of generating brown-like adipocytes from white preadipocytes (Rosell et al., 2014a; Scime et al., 2005). These IMBAT cells are able to proliferate at permissive temperatures of 31-330C in the presence of Geneticin (G418) but can also be induced to differentiate normally at 370C in the absence of G418.

112

4.3.1 Immortalized brown adipocytes (IMBAT cells) system differentiate efficiently under standard differentiation protocol In testing the differentiation properties of our cell system, IMBAT cells were incubated with a standard differentiation cocktail comprising insulin, dexamethasone, triiodothyronine (T3), indomethacin, and IBMX. Lipid droplets became detectable within two days and following seven to eight days the cells were fully differentiated and could be visualized under the microscope (Figure 4.2.1B). To further demonstrate lipid droplets formation, the cells were stained with Oil Red O (ORO) a dye that stains lipids (Figure 4.2.1C).

113

Figure 4.2.1: IMBAT cells showing differentiation capacity (A) Undifferentiated cells stained with ORO (B) IMBAT Cells following 8 days of differentiation with standard differentiation cocktail showing lipid droplets-not stained with ORO. (C) IMBAT Cells following 8 days of differentiation with standard differentiation cocktail, and stained with ORO. To differentiate the cells, undifferentiated IMBAT cells cultured in 10% FBS and 1% L-glutamine and 1 % Pen/Strep were treated with 500µM IBMX, 250nM Dexamethasone, 170nM insulin, 125nM Indomethacin, and 1nM Triiodothyronine (T3) for the first 48hours. Thereafter the cells were maintained in 170nM insulin and 1nM T3 for next 6 days. For ORO staining, the culture medium from differentiated IMBAT cells was removed and cells were washed and fixed in 4% PFA at room temperature for 15 minutes, and washed again. Thereafter Oil Red O working solution (made up with isopropanol) was applied for 1h at room temperature. The cells were then rinsed with 60% isopropanol and PBS stained cells were visualized by light microscopy (20X Magnification).

114

4.3.2 Nrg4 expression increases during brown adipocyte differentiation It has previously demonstrated that Nrg4 was highly expressed in brown adipose tissue, and its expression enriched during cold acclimation (Chapter 3). It was hypothesised here that

Nrg4 is associated with brown adipocyte differentiation. Adipocyte differentiation involves major changes in gene expression critical to its regulation such as PPARγ (Schoonjans et al.,

1996). In this present study, we carried out gene expression analysis to assess the changes in the expression of genes known to be upregulated during adipocyte differentiation. IMBAT cells were treated with insulin, triiodothyronine, IBMX, indomethacin, and dexamethasone for the first 2 days, and thereafter, cells were maintained on insulin and triiodothyronine for the next 6 days. Samples were taken at various time points for gene expressions (Figure

4.2.2).

The mRNA levels of the adipocyte marker aP2 became detectable within 12 hours of induction of differentiation and increased steeply and progressively over an 8 day period of differentiation validating an efficient differentiation of the IMBAT cells. The mRNA levels of PPARγ, a known regulator of adipogenesis, were detectable within hours of differentiation and rose rapidly to its peak during the induction period of differentiation. Glut4 expression followed a similar pattern to aP2, although the expression of aP2 was detectable within the first 12 hours following differentiation. PPARγ and PPARα mRNA were observed early, although while mRNA levels of PPARα remained low until 4 days following differentiation,

PPARγ mRNA levels rose steeply from the second day peaking 4 days following differentiation. The expression pattern of C/EBPα and HSL appeared to follow a similar pattern, however the mRNA levels of C/EBPα was relatively higher. The metabolic genes,

HSL and SREBP1c showed rapid induction after 24 hours of differentiation achieving their highest induction on day 4. Cidea showed a rapid induction after 2 days of differentiation.

115

Although Ucp1 expression was observed early during IMBAT cells differentiation, its mRNA levels fluctuated throughout differentiation, peaking at 12 hours of differentiation.

116

Figure 4.2.2: mRNA levels of BAT associated genes following a differentiation time-course using q-RT-PCR. Undifferentiated IMBAT cells cultured in 10% FBS and 1% L-glutamine and 1 % Pen/Strep were treated with 500µM IBMX, 250nM Dexamethasone, 170nM insulin, 125nM Indomethacin, and 1nM Triiodothyronine (T3) for the first 48hours. Thereafter the cells were maintained on 170nM insulin and 1nM T3 for next 6 days. Samples were taken at 12 hours, 24 hours, 2 days, 4 days and at the 8 day time-points. Total RNA was extracted and cDNA were prepared as already described in materials and method. Gene expression was normalized to β- actin with the untreated (0h) cells as the reference value. All data are expressed as the mean ± SEM of three independent samples in duplicate.

117

4.3.3 Nrg4 is expressed early during brown adipocyte differentiation. Based on the dynamics of gene expression observed following IMBAT cell differentiation, another experiment was carried out to compare changes in the Nrg4 expression with the changes in aP2 expression following brown adipocyte differentiation. To do this IMBAT cells were differentiated using the standard differentiation protocol as previously described.

Here it was observed that both aP2 and Nrg4 mRNAs became detectable within 2 days of differentiation and rose steadily afterwards. However, the induction level of aP2 was higher

(Figure 4.2.3).

118

aP2 Nrg4

10000 2000

8000

) )

1500 e e A A g g N n N n R

6000 a

a R h h m

c m 1000 c

4 d 2 d l g l 4000 r P o o a F N F ( ( 500 2000

0 0 0h 4h 24h 2d 4d 6d 8d 0h 4h 24h 2d 4d 6d 8d

Figure 4.2.3: mRNA levels of aP2 and Nrg4 in IMBAT cells throughout differentiation using q- RT-PCR. IMBAT cells were differentiated for 8 days using the standard differentiation protocol, and total RNA and cDNA were carried out as already described. Gene expression was normalized to β-actin with the untreated (0h) cells as the reference value. All data are expressed as fold induction compared with time 0h. Error bar represent the mean ± SEM of three independent samples in duplicate.

119

4.3.4 Nrg4 expression in IMBAT cells is activated by β3-AR. In rodents, prolonged cold exposure or adrenergic signalling can provoke the appearance of clusters of Ucp1 positive cells with a multilocular brown adipocyte-like morphology in WAT

(Rosen and Spiegelman, 2014). The Ucp1 mRNA and protein are found in “brown” and to a lesser extent in “white” adipose tissue; however, its expression is confined to brown adipocytes (Ricquier and Bouillaud, 2000) The β3-AR exerts a central role in the transduction of catecholamine effects in WAT and BAT. In the absence of β-AR signalling, mice are unable to maintain their core temperature (Bachman et al 2002). Therefore, exposure to temperatures below thermoneutrality activates BAT through the activation of adrenergic fibres since nor-adrenaline acts via β3-AR which have similar pharmacological effect as cold exposure (Cinti et al., 2002). The factors that mediate β3 signalling in WAT have yet to be fully determined.

To address whether Nrg4 expression is regulated by β3-AR activation, differentiated IMBAT were treated with a selective β3-AR agonist (CL-316,243) for 5 hours. Nrg4 levels in undifferentiated IMBAT cells and its induction following IMBAT cell differentiation for 8 days was first assessed. Given that Ucp1 expression is under the control of NE released from the sympathetic nerve terminals innervating the BAT cells and activated by β3-AR stimulation (Bartness et al., 2010b; Vaughan et al., 2014), it was also of interest to compare

Nrg4 induction with that of Ucp1 (Figure 4.2.3B). A significant increase in the expression of

Ucp1, aP2 and Nrg4 occurred following IMBAT differentiation. Both Ucp1 and Nrg4 mRNAs levels, but not aP2, were significantly increased upon β3-AR stimulation. The induction of Ucp1 was however much greater than that for Nrg4 (Figure 4.2.4B). The induction of Ucp1 was approximately 100-fold as compared to that of Nrg4 which was approximately 2.5-fold. Put together, Nrg4 expression increases with IMBAT cells

120

differentiation, and in brown adipocytes is sensitive to regulation downstream of β3-AR activation.

121

Figure 4.2.4: (B) mRNA levels of Ucp1, aP2 and Nrg4 in undifferentiated (U), differentiated (D), and β3-AR agonist-treated (D + CL) IMBAT cells. Cells were differentiation using standard a protocol that was already described. Thereafter the cells were maintained in 170nM insulin and 1nM T3 for next 6 days. A set of the differentiated cells was then treated with a selective, β3-AR agonist (10μM CL 316,243) for 5 hours. All data are expressed as the mean ± SEM of three samples in duplicate. *p<0.05, **p˂0.005.

122

4.4 Functional role Nrg4 in BAT

4.4.1 Nrg4 is secreted by brown adipocytes. Nrg4 was identified to be a brown fat gene. To test if Nrg4 was secreted into the culture media by mature brown adipocytes, conditioned medium from undifferentiated and differentiated IMBAT cells was subjected to ELISA. Nrg4 was detected in the conditioned medium from the differentiated adipocytes but not in the unconditioned medium or medium from undifferentiated IMBAT cells. This, confirms Nrg4 to be present in BAT and secreted by mature brown adipocytes (Figure 4.3.1)

Figure 4.3.1: Nrg4 levels in unconditioned medium (control), conditioned medium from undifferentiated IMBAT cells (Undifferentiated Conditioned), and 4-wk-differentiated IMBAT cells (Differentiated Conditioned), determined by ELISA. DNA content was 28.65 ± 1.3896μg/well and 26.04 ± 1.96μg/well, for differentiated and undifferentiated cells respectively. ND=not detectable.

123

4.4.2 Nrg4 promotes neurite outgrowth Since Nrg4 was found to be highly expressed in brown adipose tissue, enriched in brown fat and markedly increased during brown adipocyte differentiation, what then are its functions in

BAT? To provide insight into the potential role of Nrg4 in BAT we decided to investigate the possible communication of brown adipocytes with sympathetic nervous system via Nrg4 induction. It has been shown that a synthesized form of NRG4 stimulated neurite outgrowth in PC12/HER4 cells (Hayes et al., 2008). PC12 cells are a cell line derived from a pheochromocytoma of the rat adrenal medulla (Greene and Tischler, 1976). It is an established cell line for the study of neurons (Das et al., 2004). Conditioned medium from differentiated IMBAT cells was used to treat PC12 cells that had been transfected with

HER4. Differentiation of PC12 cells is most often assessed by semiquantitative or quantitative morphological methods. These methods can include determination of cell size, the number of cells exhibiting processes (neurites), and the extent of neurite growth or neurite length (Das et al., 2004). Since all the cells treated with the conditioned medium from differentiated IMBAT cells had neurite outgrowths (Figure 4.5), the neurite lengths with different concentrations of conditioned medium was measured. Conditioned media was used at 100%, 50%, or 25%, diluted in normal medium, to treat PC12/HER4 cells for 24 hours and the average neurite length determined. In comparison to unconditioned medium, significant increase in the neurite lengths of the PC12/HER4 cells in a dose dependent manner was observed. The cells treated with 100% differentiation medium had the most numerous and longest outgrowths. The unconditioned medium showed no outgrowth (Figure 4.3.2A and B).

In order to determine if NRG4 was the secreted factor in the conditioned medium that stimulated neurite formation, we knocked down Nrg4 in IMBAT cells with shRNA and used conditioned medium from differentiated IMBAT cells to treat PC12/HER4 cells. The conditioned medium following approximately 75% Nrg4 knockdown (Figure 4.3.2E) was

124

unable to stimulate neurite formation in the PC12/HER4 cells compared to the control (figure

4.3.2C and D), suggesting that brown adipocyte-derived NRG4 is involved in the control of sympathetic neurons activating BAT. Thus, NRG4 appears to be involved in a crosstalk between brown adipose tissue and their innervation, and may also enhance the sympathetic innervation of WAT during browning.

125

A B 100% medium 50% medium

25% medium Control

C D E

100% BAT sh control 100% BAT shNrg4 conditioned media conditioned media

Figure 4.3.2: (A) PC12/HER4 cells showing neurite outgrowth (white arrows) following treatment with different concentrations of conditioned medium from differentiated IMBAT cells (20X Magnification). IMBAT cells were differentiated using standard differentiation cocktail, and on the 8th day of differentiation conditioned medium was collected. A part of this was serially diluted with normal media to give 50% and 25% concentration; the control was the unconditioned media. The collected media were used to treat PC12/HER4 cells. The treated PC12/HER4 cells were then fixed and immunostained with Tuj1 antibody (a neuron-specific class II beta-tubulin). (B) Neurite outgrowth measured in µm and expressed as fold induction over control cells. (C) Effect of the knockdown of Nrg4 in the cell system (20X Magnification). The IMBAT cells stably expressing shNrg4 cells were differentiated for 8 days using standard differentiation cocktail, and the conditioned medium was used to treat PC12/HER4 cell. The cells were fixed and immunostained with Tuj1 antibody (D) Graph of average neurite length of PC12/HER4 cells following knockdown of Nrg4 in IMBAT cells. (E) mRNA expression of Nrg4 in the IMBAT cells following Nrg4 knockdown. For all of the data, error bars represent means ± SEM, and significant differences are shown as *P < 0.05.

126

4.4.3 HER4 receptor is expressed in BAT and upregulated in differentiated IMBAT cells The Nrg4 receptor, HER4 has been associated with cellular processes including the regulation of cell division, survival, chemotaxis and differentiation (Maatta et al., 2006;

Sundvall et al., 2008). Driven by our result that NRG4 promotes neurite outgrowth in PC12 cells stably expressing the HER4 (Figure 4.5A), we investigated the potential for a specific autocrine action of NRG4 in BAT. We carried out a q-RT-PCR on a mouse tissue panel that we had earlier used to validate our micro array data to determine the expression of HER4. We observed a relatively low expression of HER4 in BAT, with undetectable levels in WAT

(Figure 4.3.3A). Its expression was high in the brain, pituitary, kidney and heart. However, in the IMBAT cell system, its expression which was low in pre-adipocytes was induced approximately 20-fold following differentiation for 8 days (Figure 4.3.3B).

127

Figure 4.3.3: (A) mRNA levels of HER4 across a panel of mouse tissues using q-RT-PCR. Tissue samples were obtained from FVB/N female mice kept under normal housing conditions. Total RNA was extracted with TRIzol and cDNA was performed by using Moloney Murine Leukemia Virus Reverse transcriptase (M-MLV RT) following the manufacturer’s instructions. Gene expression was normalized to β-actin with kidney as the reference value. All data are expressed as the mean ± SEM of three samples in duplicate (n=3). (B) mRNA levels of HER4 measured via q-RT-PCR in undifferentiated and differentiated IMBAT cells. Cell differentiation was done using standard differentiation cocktail for 8 days. Gene expression was normalized to β-actin with undifferentiated cells as the reference value. All data are expressed as the mean ± SEM of three samples in duplicate. *p<0.05

128

4.4 Regulation of Nrg4 expression

4.4.1 Nrg4 expression in IMBAT cells is regulated by PPARγ. The transcriptional regulation of Nrg4 in brown adipocytes remains unknown. The PPAR and

CEBP families of transcription factors are known to be the major regulators of adipocyte function, and PPARγ is the key regulator of adipocyte differentiation in both white and brown adipocytes (Rosen et al., 2000; Tontonoz et al., 1994). The activation of PPARγ by synthetic ligands has been shown to promote the differentiation of brown fat precursor cells

(Tai et al., 1996). To investigate the role of PPARγ in Nrg4 regulation of BAT function, we treated undifferentiated IMBAT cells for 5 days with PPARγ agonists (rosiglitazone or

GW1929), PPARγ antagonist (GW9662), PPARα agonist (GW7647) or PPARδ agonist

(GW1516). mRNA levels of Nrg4 and aP2 were then determined by q-RT-PCR.

In the undifferentiated IMBAT cells, both Nrg4 and aP2 expression was induced following treatment with rosiglitazone, although the induction of aP2 was higher (Figure 4.2.1A).

Treatment with GW9662 (PPARγ antagonist) alone had no effect on the expression of Nrg4 and aP2. However, when undifferentiated IMBAT cells were incubated with Rosiglitazone for 5 days, followed by the GW9662 for 24 hours, there was an attenuation of rosiglitazone- induced expression of Nrg4 and aP2 (Figure 4.4.1A). Whereas treatment with another selective PPARγ agonist, GW1929 induced over 100-fold induction in the expression of Nrg4 and aP2, there was no effect with either PPARα (GW7647) or PPARδ agonists (GW1516).

The similar pattern of Nrg4 and aP2 induction following treatment with PPARγ agonists

(rosiglitazone and GW1929), indicates that these factors may share common modes of transcriptional regulation during brown adipocyte differentiation (Figure 4.4.1A).

Based on the above results that Nrg4 and aP2 exhibit similar responses to various PPAR ligands stimuli in undifferentiated IMBAT cells, the responses of Nrg4 and aP2 were also analysed in fully differentiated IMBAT cells stimulated with the same PPAR ligands.

129

IMBAT cells were differentiated for 7 days, followed by stimulation with PPAR ligands for

24 hours. There was an induction in the expression of Nrg4 and aP2 following PPARγ agonist stimulation but this was not significant (Figure 4.4.1B). However, Nrg4 and aP2levels were undetectable following addition of GW9662 (Figure 4.4.1B). Overall, these results indicated that Nrg4 is regulated by PPARγ in a manner similar to aP2.

130

Rosiglitasone (Rosi): PPARγ agonist GW9662: PPARγ antagonist GW1929 PPARγ agonist GW7647: PPARα agonist

GW1516: PPARδ agonist

Figure 4.4.1: mRNA levels of aP2 and Nrg4, measured via q-RT-PCR in undifferentiated and differentiated IMBAT cells treated with PPARƴ agonist and antagonist. (A) Undifferentiated IMBAT Cells were treated for 5 days with 100nM rosiglitazone (in the presence or absence of 10µM GW9662), 2.5µM GW1929, 100nM GW7647, and 1µM GW1561. Gene expression was normalized to β-actin with DMSO as the reference value. (B) IMBAT cells were differentiated using standard differentiation protocol for 7 days. Thereafter they were treated 12 hourly for 24 hours with PPARγ agonists, 100nM rosiglitazone, 10µM GW9662, 2.5µM GW1929, 100nM GW7647, and 1µM GW1561. Gene expression was normalized to β-actin with DMSO as the reference value. All data are expressed as the mean ± SEM of two independent samples in triplicate.

131

4.4.2 Nrg4 expression in IMBAT cells is regulated by PPARγ. To further characterize the regulation of Nrg4 the accurate identification of transcription start sites (TSSs) and promoter regions is an important step that enables targeted searching for regulatory-protein binding motifs in the promoter regions of genes with similar expression patterns (McGrath et al., 2007). Therefore, to localize the important control regions that activate Nrg4 gene expression, we decided to clone its promoter region and identify its regulatory elements. We first determined the transcription start site of the Nrg4 transcripts.

The full length cDNA sequence of Nrg4 was acquired by performing 5’ RACE reaction.

(B) -2000….GTTCCCCTGGCTGCTTGCGACCTCTGCTCACACCTTGGTCTGCCTTGACCTCG +1 CCCACACTGAAGTGACATAAATCCGATTTTTGACACGTTGTAAAGTTCGAGTCACAGTT GCTGAAGTCCTCAGTGTTCAAACACTTGTGAAACGCTGCATGTCTAGC…..+60

Figure 4.4.2 (A): Electrophoretic image showing 200bp purified PCR product from 5’ RACE experiment with Nrg4 gene. Specific inner and outer reverse primers were designed using the Primer Blast software. A taq polymerase was used to amplify the PCR reaction. The PCR product was separated using a 2% agarose gel electrophoresis and the purified PCR product was cloned into PCR 4.0 vector. (B) Genomic sequence showing regions around the transcription start site (TSS). Red arrow (+1) indicates the transcription start site detected by genomic analysis.

132

Having identified a single Nrg4 transcription start site the promoter regions within 2000 base pairs upstream and 60 base pairs downstream of the primers was assessed. This region was subcloned into pGL3-Basic vector and the obtained plasmid transfected into HEK293 cells.

Unfortunately the result was inconclusive indicating that the 2kb Nrg4 promoter is not the full promoter that is necessary for Nrg4 transcription activation. However, comparing the expression of Nrg4 expression with that of the PPARγ–regulated aP2 in brown adipocytes exposed to PPAR ligands (Figure 4.4.1) strongly support a regulatory role for PPARγ.

An analysis of open access chromatin immunoprecipitation (ChIP) sequencing data in 3T3-

L1 cells shows PPARγ, C/EBPβ and Stat5a binding sites within introns of the Nrg4 gene.

These data raise the possibility that the key regulatory region for Nrg4 expression in brown adipocytes is intronic rather than within the promoter 5’ of the transcription start site (Figure

4.4.3A and 4.4.3B).

Figure 4.4.3A: Binding sites for Nrg4 regulatory regions in the early and late stages of differentiation of 3T3-L1 cells. Data from (Siersbaek et al., 2011). (Track were displayed on the UCSC genome browser: genomes.ucsc.edu)

133

Figure 4.4.3B: Binding sites for PPARγ, C/EBPβ and Stat5a in the Nrg4 regulatory regions in the early stages of 3T3-L1 differentiation and PPARγ binding sites in the late stages of differentiation of 3T3-L1 cells. Data from (Siersbaek et al., 2011). (Track were displayed on the UCSC genome browser: genomes.ucsc.edu)

134

4.5 Discussion Nrg4 is a member of the neuregulin family comprising of 4 ligands that activate ErbB tyrosine kinase receptors. We have reported that Nrg4 was highly expressed in brown adipose tissue, with low expression in WAT, and this expression was increased by temperature reduction, indicating that Nrg4 may have a role to play in brown adipose tissue thermogenesis or the transition from white to beige fat. Next, we looked to see if NRG4 protein was expressed in the adipose tissue. Based on an immunohistochemical staining with a specific antibody, NRG4 was detected in BAT and gonadal WAT. A subsequent report has confirmed that Nrg4 is expressed in adipose tissue (Wang et al., 2014). The significance of the presence of Nrg4 in the WAT may be relevant to WAT remodelling given the paucity of

BAT compared to WAT.

How does Nrg4 affect the function of brown adipocytes? The differentiation of adipocyte is associated with its maturity and the expression of certain specific genes, notably aP2. A number of genes whose expression levels changed throughout brown adipocyte differentiation process were identified. aP2, a known differentiation marker became detectable in the early period of differentiation, and its expression levels increased steadily throughout. This finding was in line with other reports showing aP2 to be expressed early following differentiation (Matsubara et al., 2005). Nrg4 was observed to have a similar mRNA profile with aP2 throughout differentiation. This observation suggests that Nrg4 is more likely subject to similar regulatory mechanisms as aP2. Given that Ucp1 expression, which is central to brown fat heat production in response to cold exposure, is under the control of BAT sympathetic innervations, it was therefore of interest to compare its expression with that of Nrg4 in adipocytes. Increased mitochondrial uncoupling is associated with increased BAT thermogenic activity. Both Nrg4 and Ucp1 were induced upon IMBAT cells differentiation. When the differentiated brown adipocytes were challenged with a β3-AR

135

agonist, there was a significant induction in the Nrg4 and Ucp1 mRNA levels. This induction was however not observed in aP2 mRNA

The presence of Nrg4 in BAT and the differential expression pattern observed in BAT versus

WAT was confirmed by an immunohistochemical staining using anti-NRG4 antibody. BAT showed a much higher immunoreactivity to the presence of NRG4 protein than the Gonadal

WAT. The most recently described member of the ErbB receptor tyrosine kinase family is

ErbB4 (HER4). Although related in sequence to other ErbB family members and organized in a similar fashion, ErbB4 has a larger spectrum of ligands that activate it. A recent report has indicated that NRG4 binds both ErbB-3 and ErbB-4 (Wang et al., 2014). However, the experiments were concluded before this and based on several other reports on the specificity of NRG4 to HER4 (Harari et al., 1999; Hayes et al., 2007; Hayes et al., 2008). Not much is known about the role of ErbB4 in adipose tissue. ErbB4 was been determined to be present in

BAT and neuronal tissues, and its expression was induced upon IMBAT cell differentiation.

In deciphering the function of Nrg4 in BAT, the ability of NRG4 to activate HER4 in a paracrine fashion was determined, by exposing PC12 cells stably expressing HER4

(PC12/HER4 cells) to conditioned medium from differentiated brown adipocytes. The conditioned medium from differentiated brown adipocytes was found to contain detectable levels of NRG4 protein. Following the treatment, there was an extensive neurite formation in the PC12/HER4 cells. Although other researchers have reported that recombinant NRG4 activates PC12 cells transfected with HER4 following a direct biochemical assay (Hayes et al., 2007), this is the first time it was demonstrated that endogenously derived secreted NRG4 from brown adipocytes leads to extensive neurite formation. It was confirmed via shRNA knockdown in IMBAT cells that the neurite outgrowths observed in PC12/HER4 cells were caused directly by Nrg4. This suggests a novel role of Nrg4 in the function of brown fat. The ability of conditioned medium from differentiated IMBAT cells to stimulate extensive neurite

136

outgrowth in PC12/HER4 cells and the significant induction of Nrg4 in differentiated

IMBAT cells have important implications for neuronal signalling in BAT. Since enhanced sympathetic innervation will increase the potential to upregulate Ucp1 and promote uncoupling, the NRG4-ErbB-4 axis could therefore represent an important signalling mechanism in BAT for increasing the sensitivity of BAT to sympathetic stimuli.

Peroxisome proliferator-activated receptors (PPARγ, PPARα, and PPARδ) are important regulators of lipid metabolism. Although they share significant structural similarity, the biological effects associated with each PPAR isotype are distinct (Hummasti and Tontonoz,

2006). To determine the possible factors that may be involved in the regulation of Nrg4 in

BAT, we used a number of PPAR ligands to stimulate both undifferentiated and differentiated brown adipocytes. Both Nrg4 and aP2 were induced by PPARγ activation and inhibited by a potent and selective PPARγ antagonist (GW9662), while excluding the role of both PPARδ and PPARα in the regulation of Nrg4 function in BAT.

A detailed understanding of the process regulating brown adipose tissue function is essential for the control of obesity and its associated conditions. PPARγ has been identified as a possible transcriptional regulator of Nrg4 in adipocytes. The Nrg4 promoter was cloned into a reporter gene plasmid as a first step to define its regulatory motifs and determine the role of

PPARγ. Although brown fat-selective transcription factors have not been identified, the binding of PPARγ is essential for the function of the Ucp1 enhancer (Sears et al., 1996) indicating that PPARγ could represent key components of the selectivity and thermogenic response of brown adipose tissue. There was an induction in the expression of Nrg4 and aP2 following PPARγ agonist stimulation but this was not significant (Figure 4.4.1B). The inability to detect PPARγ-dependent induction of a reporter construct containing the Nrg4 5’- untranslated region is likely due to key regulatory regions being further upstream, downstream or within the gene. In support of this, analysis of available ChIP seq data reveals

137

significant binding of PPARγ to Nrg4 intronic regions. Although we do not exclude other regulatory motifs that may be interacting with Nrg4 to induce BAT function, the overall data indicates that Nrg4 is a PPARγ-regulated brown fat adipokine that can signal to neuronal cells. PPARγ has been reported to interact with β3-AR in obese people (Yoshihara et al.,

2015), and its agonist have been used for the treatment of diabetes in humans (Hsu and Pan,

2014). Since HER4 is present in BAT and upregulated in mature brown adipocytes, NRG4 appears to be involved in a crosstalk between brown adipose tissue and their innervation, and may also enhance the sympathetic innervation of WAT during browning.

138

Chapter 5 Results

Gpr120: Regulation of Expression in BAT

139

5.1 Introduction Gpr120 is a member of the family of G protein-coupled receptors (GPCRs). It binds both saturated and unsaturated fatty acids (Hirasawa et al., 2005), where it has a critical role in various physiological homeostatic mechanisms such as adipogenesis, regulation of appetite and food preference (Gotoh et al., 2007a). Stimulation of Gpr120 with ω-3 fatty acids also causes broad anti-inflammatory effects in monocyte 264.7 cells and in primary intraperitoneal macrophages (Oh et al., 2010). Gpr120 is the only lipid sensing GPCR which is highly expressed in adipose tissue, proinflammatory CD11c+ macrophages (BMDCs), mature adipocytes, and monocytic RAW 264.7 cells (Oh et al., 2010). Gpr120-deficient mice fed a high-fat diet developed obesity, glucose intolerance, and fatty liver with decreased adipocyte differentiation and lipogenesis and enhanced hepatic lipogenesis (Ichimura et al., 2012b). It has also been reported that the R270H variant of human Gpr120 enhances inflammation in adipose and hepatic tissue, and carriers of this gene, irrespective of geographical origin, developed obesity (Ichimura et al., 2012b; Marzuillo et al., 2014).

Adipose tissue metabolism exerts an impact on whole-body metabolism, playing a critical role in glucose homeostasis by releasing adipocytokines that regulate insulin sensitivity in other organs (Coelho et al., 2013). The energy burning property of BAT is a promising target for the treatment of obesity and its associated complications. This property is conferred to

BAT by its expression of Ucp1 whose uncoupling is achieved by its ability to transport protons across the inner mitochondria membrane (Brondani et al., 2012). Based on the potential role of Gpr120 in inflammation, obesity and insulin resistance, and the thermogenic property of BAT, the roles of Gpr120 in BAT function was assessed. Its expression in BAT was therefore determined.

140

5.2 Gpr120 is regulated in a temperature-dependent manner To decipher the factors that could be responsible for the switch from one form of adipose tissue to the other in response to temperature changes, our group had earlier performed a microarray-based gene expression analysis of mice placed at different temperatures (Figure

5.1). Gpr120 was identified to be highly expressed in BAT and upregulated in BAT and selective WAT depots following cold exposure (Figure 5.1). Although there was no significant change in its expression in the mesenteric WAT in response to cold, Gpr120 expression was significantly upregulated in the subcutaneous and gonadal WAT (Figure 5.1).

141

Gpr120

Relative mRNA fold change

28°C 22°C 6°C

BAT sWAT gWAT mWAT

Figure 5.1: q-RT-PCR showing gene expression of Gpr120 induced by cold exposure following a microarray analysis of BAT, subcutaneous WAT (sWAT), gonadal WAT (gWAT) and mesenteric WAT (mWAT) of mice exposed to 28, 22, or 60C. All mRNAs are expressed as fold induction relative to BAT at 280C. Bars represent the means ± SEM of at least 3 mice/groups, and significant differences are shown. *P< 0.05, **P <0.005, ***P< 0.001.

142

5.3 Gpr120 is more highly expressed in Brown Adipose Tissue Based on its high expression in BAT and upregulation with respect to cold acclimation in adipose tissue, we decided to validate the expression of Gpr120 on a panel of mouse tissues while comparing its expression profile with that of Gpr40, Gpr41, and Gpr43 which are fatty acid receptors (Figure 5.2). Gpr120 had its highest expression in BAT, with lower levels in white adipose tissues as well as in pancreas, lung, stomach and mammary gland (Figure 5.2).

Levels were very low in the liver, skeletal muscle, heart, intestine, spleen and brain. Gpr40 was undetectable in brown adipose tissues, with low expression in subcutaneous WAT.

Gpr43, which is known to be abundantly expressed in WAT (Kimura et al., 2013), was the most highly expressed in the white subcutaneous and gonadal adipose tissues depots with low levels in BAT. Gpr41 mRNA expression was highest in the adrenal and undetectable in BAT.

Overall, this data indicates that Gpr120 is the most highly expressed and predominant free fatty acid receptor in BAT.

143

144

Figure 5.2: mRNA levels of Gpr120, Gpr40, Gpr41, and Gpr43 across a panel of mouse tissues using q-RT-PCR. Tissue samples were obtained from FVB/N female mice kept under standard housing conditions. Total RNA was extracted with TRIzol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin with kidney as the reference value. All data are expressed as the mean ± SEM of three samples in duplicate (n=3).

145

Table 5.1: Summary of gene expression profile of Gpr120, Gpr40, Gpr41 and Gpr43 across a panel of mouse tissues using q-RT-PCR.

Approximate fold change in mRNA expression with reference to the kidney

Mouse tissues Gpr120 Gpr40 Gpr41 Gpr43 Intestine 12 7 NE 3 Spleen 7 159 1 73 Stomach 76 4 NE 7

Adrenal 18 1 3 6 Ovary 3 1 NE 5 Mammary 212 95 NE 56 Brain NE NE 1 NE Lung 435 3 NE 3

Brown 1797 1 NE 15 Uterus 2 NE NE 1 Pituitary 245 5 1 1 Kidney 1 1 1 1 Pancreas 138 212 1 12

White Sub 180 18 NE 161 White Gon 256 1 NE 212 Heart 2 1 NE 2 Liver 12 1 1 1 Skeletal 2 NE NE 2

Sub = Subcutaneous; Gon = Gonadal; NE = Not expressed

146

5.3 Regulation of Gpr120 expression in brown adipocytes

5.3.1 Gpr120 expression is detectable in early phase of brown adipocyte differentiation Gpr120 has been implicated as playing an important role in the control of lipid and glucose metabolism (Miyauchi et al., 2009a). Based on its significant expression level in BAT, and its property of being cold-regulated, a q-RT-PCR was carried out to determine its expression levels during adipocyte differentiation, and potential mechanism of regulation. IMBAT cells were differentiated over a time course of 8 days (Figure 5.3.1). Gpr120 levels were compared to that of aP2 (an adipocyte differentiation marker) following treatment of differentiated

IMBAT cells with a β3-AR agonist (CL-316,243) for 5 hours (Figure 5.3.2). Gpr120 mRNA became detectable on the second day of differentiation and increased steeply till full differentiation. Although aP2 expression was detected earlier than Gpr120, they both showed similar pattern of increase in their mRNA expression with differentiation.

147

Figure 5.3.1: q-RT-PCR showing gene expression of Gpr120 and aP2 following a differentiation time-course. IMBAT Cells were treated with standard differentiation cocktail on reaching full confluence. The cells were harvested following differentiation over a time course for 8 days as indicated. Total RNA was extracted with Trizol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin with the untreated (0h) cells as the reference value. All data are expressed as the mean ± SEM of three independent samples in duplicate.

148

5.3.2 Gpr120 expression in brown adipocyte is regulated by β3-AR activation When fully differentiated, IMBAT cells were treated with β3-AR agonist (CL-316,243).

There was a significant induction in the levels of Gpr120 (Figure 5.3.2There was approximately a thousand fold increase in Gpr120 expression following differentiation.

Expression was induced a further 2-fold upon treatment with β3-AR agonist. There was Ucp1 induction which was over 100-fold upon β3-AR agonist treatment. However, there was no change in aP2 mRNA upon β3-AR agonist stimulation. This result reveals that both differentiation and β3-AR signalling pathway are involved in the regulation of Gpr120 in brown adipocytes.

149

Figure 5.3.2: mRNA levels of Ucp1, aP2 and Gpr120 in undifferentiated (U), differentiated (D), and β3-AR agonist-treated differentiated (D+CL) IMBAT cells, using q-RT-PCR. Undifferentiated IMBAT cells were harvested 2 days after confluence. A second set of IMBAT cells was differentiated using the standard differentiation protocol as already described, and another set of cells was fully differentiated and treated with a selective β3-AR agonist (10μM CL 316,243) for 5 hours. Total RNA was extracted with TRIzol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin with undifferentiated (U) as the reference value. All data are expressed as the mean ± SEM of three samples in duplicate (n=3). *p<0.05 and **p<0.005.

150

5.4 Gpr120 agonist, GW9508, induced lipid droplet formation in IMBAT cells As Gpr120 is highly expressed in BAT and induced upon adipocyte differentiation, the role of Gpr120 on adipocyte differentiation was assessed via ability of a Gpr120 ligand to induce lipid droplet formation. Lipid accumulation is a characteristic of adipocyte maturation to a functional state (Seale and Lazar, 2009). Undifferentiated IMBAT cells were treated with

DMSO or a Gpr120 agonist, GW9508. Although this agonist is known to bind and activate both Gpr120 and Gpr40 (Briscoe et al., 2006b), the ligand was used as Gpr120 agonist since

Gpr40 was not expressed in BAT (Figure 5.2). Interestingly, compared to the undifferentiated cells (Figure 5.4A), the agonist-treated cells developed lipid droplet (Figure 5.4B), with morphological features indicative of cell differentiation (figure 5.4C).

151

Figure 5.4: GW9508 induces lipid droplet formation. Oil Red O (O Red O) staining of IMBAT cells following treatment with GPR120 ligand, GW9508. (A) Undifferentiated cells stained with ORO (B) Undifferentiated IMBAT cells treated with 100μM GW9508 12 hourly for 8 days, and stained with O Red O (C) IMBAT Cells following 8 days of differentiation with standard differentiation cocktail, and stained with O Red O. To differentiate the cells, undifferentiated IMBAT cells cultured in 10% FBS and 1% L-glutamine and 1 % Pen/Strep were treated with 500µM IBMX, 250nM Dexamethasone, 170nM insulin, 125nM Indomethacin, and 1nM Triiodothyronine (T3) for the first 48hours. Thereafter the cells were maintained on 170nM insulin and 1nM T3 for next 6 days. Lipid droplets were visualized with the aid of a light microscope (20X Magnification).

152

5.5 Discussion Gpr120 was one of the genes regulated in a temperature-dependent manner. Following a gene expression profile experiment on a panel of mouse tissue (figure 5.2), our validated result showed that Gpr120 was more highly expressed in BAT than other tissues assessed. Another group had demonstrated that its expression was high in mature adipocytes, with negligible expression in muscle, pancreatic cell and hepatocytes (Gotoh et al., 2007a), they did not however discriminate between BAT and WAT. Gpr120 is upregulated in BAT and some

WAT depots following cold exposure, implying that this gene may be involved in recruitment of more BAT on appropriate stimulation and WAT remodelling. Gpr40 was found to be predominantly expressed in the pancreas, corroborating the works of Briscoe et al., 2003; and Itoh et al., 2003. The finding that Gpr43, a known white fat gene, was more highly expressed in WAT than other tissues validated our results.

When undifferentiated IMBAT cells were treated with a Gpr120 agonist (GW9508), there was lipid droplet formation and development of a mature phenotype. This induction of differentiation suggests a major function of Gpr120 in adipocyte function especially in terms of differentiation and maturity. Gotoh et al., 2007 had demonstrated that loss of function of

Gpr120 by RNA interference led to the inhibition of adipocyte differentiation of 3T3-L1 cells.

The anti-obesity effect of β3-AR stimulation is largely attributable to Ucp1 (de Souza and

Burkey, 2001) and treatment of obese animals with β3-AR agonists is known to increase lipid mobilization, induce Ucp1, improve insulin action, and reduce body fat content (de Souza and Burkey, 2001; Inokuma et al., 2006). Gpr120 has been demonstrated to be highly expressed in brown fat, induced upon cold exposure and involved in the differentiation property of BAT by its ligand-induced lipid droplet formation, and induced by β3-AR agonists. Gpr120 is a lipid sensor whose dysfunction has been reported to cause obesity in

153

both mice and human (Ichimura et al., 2014; Ichimura et al., 2012b). Based on our findings

Gpr120 may be involved in β3-AR regulation of BAT function. This suggests a putative mechanism for Gpr120 involvement in BAT thermogenic, anti-obesity and anti-diabetic activities through its effect on β3-AR pathway.

154

Chapter 6 Results

The role of Gpr120 in BAT via Gpr120 knockout models

155

6.1 Introduction Gpr120 is known to be a nutrient-sensing receptor, which may have an important role in the activation of metabolic pathways that control energy utilisation of adipocytes, including β- oxidation and glucose uptake (Gotoh et al., 2007). It has been found to promote secretion of cholecytokinin and glucagon-like peptide from intestinal luminal cells in response to stimulation by unsaturated long chain fatty acids (Tananka et al 2008a/b). Gpr120 activation in primary white adipose tissue and 3T3-L1 adipocytes led to an increase in glucose transport and translocation of GLUT4 to the plasma membrane, and this effect was abolished upon

Gpr120- and Gαq/11 knock-out (Talukdar et al., 2011). Gpr120 KO mice developed obesity, increased inflammation, and insulin resistance, consistent with a role for Gpr120 signalling in the metabolic syndrome and diabetes mellitus (Oh et al., 2010). However, the role of Gpr120 in brown adipose tissue is unknown, and whether it has a role to play in directly modulating the metabolic and inflammatory conditions is yet to be determined.

BAT has been shown to be activated by cold, and brown adipocyte maturity can be induced by ligands that activate Gpr120 (Chapter 5). To evaluate the role of Gpr120 in glucose metabolism and inflammation, BAT from Gpr120 knockout (KO) and wild type (WT)

(provided by Dr Sami Damak, Nestle, Switzerland) were obtained. The effect of Gpr120 knockout on genes central to these functions and the potential to identify novel functional roles within brown fat was determined. This would aid in determining the impact of pharmacological interventions that target Gpr120 to activate and/or expand BAT.

156

6.2 Gene expression analysis of BAT in Gpr120 KO mice Tissues from Gpr120 KO mice and WT littermates with similar body weights and on normal chow diet were evaluated. We carried out a microarray to monitor global changes in expression of genes that were either upregulated or downregulated in the Gpr120 knockout mice tissues. 101 gene sets were differentially expressed (Figure 6.1). We identified 27 upregulated genes and 74 downregulated genes (Table 6.1). The majority of downregulated genes (Table 6.3) were involved in energy expenditure (example, O3far1), lipid metabolism

(for example, Apoc1 and Acsl1) and glucose metabolism (for example, Gys2), while the upregulated genes (Table 6.2) were those implicated in inflammation (for example the chemokine ligands) and certain forms of cancer (for example, melanoma antigen).

Based on the analysis of differentially expressed genes identified in BAT from Gpr120 knockout mouse, q-RT-PCR was carried out to validate certain key genes identified and to determine role of BAT Gpr120 in additional genes known to be involved in adipogenesis, inflammation , lipolysis, lipogenesis, and in glucose metabolism.

Table 6.1: Summary of up and downregulated genes in Gpr120 knockout BAT.

FC: Fold change DE: Differentially expressed nuID: Nucleotide universal IDentifier

157

Heatmaps, normalised

q = 0.05

Figure 6.1 Global expression analysis of brown adipose tissue (BAT) in Gpr120 knockout mice. Global mRNA expression was measured in BAT depot using Illumina bead chip. Whole-genome expression of wild-type and knockout samples were profiled using MouseWG-6 v2.0 Expression BeadChips (Kuhn et al., 2004). The summary-level data was processed using the R packages lumi 2.10.0, lumiMouseAll.db 1.18.0 and lumiMouseIDMapping 1.10.0 using nuID annotations (Du et al., 2007, 2008). No background correction was used for a more sensitive analysis and the data was normalised using quantile normalisation. Differentially expressed genes (DEGs) between the wild-type and knockout samples were detected based on a moderated t-test using limma on the normalised data, removing unexpressed genes. The normalised expression data was filtered using logFC < 0.5 and q < 0.05, converted into z-scores and heatmap.2 was used to visualise the data. DEGs with p < 0.05 were submitted to DAVID (Database for Annotation, Visualization and Integrated Discovery) for functional classification by submitting RefSeq mRNA accession numbers to DAVID. Probe sets are coloured according to average expression levels across all samples, with green denoting a lower expression level and red denoting a higher expression level. Functional clusters were considered significant for FDR < 0.01 (Huang et al., 2009a, b).

158

6.2.1 Differentially expressed genes

Table 6.2: Genes Upregulated in Gpr120 KO BAT

Gene Symbol Gene Name Fold Adjusted Change P Value Sncg synuclein, gamma 1.99 0.037 Xlr4a X-linked lymphocyte-regulated 4A 1.86 0.047 Npm3-ps1 nucleoplasmin 3, pseudogene 1 1.75 0.039 Cd52 CD52 antigen 1.71 0.014 Rarres2 retinoic acid receptor responder (tazarotene induced) 2 1.71 0.021 Hist1h2ap histone cluster 1, H2ap 1.68 0.011 Wdfy1 WD repeat and FYVE domain containing 1 1.67 0.021 Cxcl9 chemokine (C-X-C motif) ligand 9 1.65 0.011 Hist1h2ad histone cluster 1, H2ad 1.62 0.011 Ccl11 chemokine (C-C motif) ligand 11 1.62 0.023 Npm3 nucleoplasmin 3 1.52 0.040 Hebp1 heme binding protein 1 1.52 0.013 Coro1a coronin, actin binding protein 1A 1.52 0.008 Hn1 hematological and neurological expressed sequence 1 1.50 0.023 Gm10063 predicted gene 10063 1.49 0.028 CD74 antigen (invariant polypeptide of major 1.48 0.045 Cd74 histocompatibility complex, class II antigen-associated) Hist1h2ai histone cluster 1, H2ai 1.48 0.022 Sae1 SUMO1 activating enzyme subunit 1 1.48 0.009 Gm11425 predicted gene 11425 1.46 0.034 proteasome (prosome, macropain) subunit, beta type 9 (large 1.45 0.005 Psmb9 multifunctional peptidase 2) Slamf9 SLAM family member 9 1.45 0.031 Pigp phosphatidylinositol glycan anchor biosynthesis, class P 1.45 0.034 Maged2 melanoma antigen, family D, 2 1.45 0.011 H2-Eb1 histocompatibility 2, class II antigen E beta 1.44 0.034 Hist1h2af histone cluster 1, H2af 1.44 0.027 Dus4l dihydrouridine synthase 4-like (S. cerevisiae) 1.43 0.029 Wbp5 WW domain binding protein 5 1.42 0.037 Rpl12 ribosomal protein L12 1.41 0.031 Rps5 ribosomal protein S5 1.41 0.046 1110059E24Ri RIKEN cDNA 1110059E24 gene 1.41 0.003 k 4833442J19Ri RIKEN cDNA 4833442J19 gene 1.41 0.025 k Anxa2 annexin A2 1.40 0.004 Mgst3 microsomal glutathione S-transferase 3 1.39 0.026 Nsmce1 non-SMC element 1 homolog (S. cerevisiae) 1.39 0.021 Hist1h2an histone cluster 1, H2an 1.39 0.027 LSM5 homolog, U6 small nuclear RNA associated (S. 1.38 0.034 Lsm5 cerevisiae) Mpeg1 macrophage expressed gene 1 1.38 0.025 Ubxn6 UBX domain protein 6 1.38 0.023 Rps12 ribosomal protein S12 1.38 0.026 Evi2a ecotropic viral integration site 2a 1.38 0.034 Arhgdib Rho, GDP dissociation inhibitor (GDI) beta 1.38 0.036 Fbn1 fibrillin 1 1.37 0.049 Rps26 ribosomal protein S26 1.37 0.034 Rhoj ras homolog gene family, member J 1.37 0.015 Ugt1a10 UDP glycosyltransferase 1 family, polypeptide A10 1.37 0.034 Mgst3 microsomal glutathione S-transferase 3 1.36 0.009 Tyrobp TYRO protein tyrosine kinase binding protein 1.36 0.031

159

Ebpl emopamil binding protein-like 1.36 0.016 Arpc3 actin related protein 2/3 complex, subunit 3 1.36 0.033 Siva1 SIVA1, apoptosis-inducing factor 1.35 0.040

160

Table 6.3: Genes Downregulated in Gpr120 KO BAT

Gene Symbol Gene Name Fold Adjusted Change P Value O3far1 omega-3 fatty acid receptor 1 0.35 0.002 Pnpla3 patatin-like phospholipase domain containing 3 0.38 0.016 Hspa8 heat shock protein 8 0.41 0.001 Cyp2b10 cytochrome P450, family 2, subfamily b, polypeptide 10 0.43 0.038 Adrbk2 adrenergic receptor kinase, beta 2 0.55 0.004 Vegfa vascular endothelial growth factor A 0.55 0.003 Apoc1 apolipoprotein C-I 0.55 0.004 Mlxipl MLX interacting protein-like 0.56 0.007 Hspd1 heat shock protein 1 (chaperonin) 0.56 0.017 Luc7l3 LUC7-like 3 (S. cerevisiae) 0.58 0.015 Per2 period homolog 2 (Drosophila) 0.60 0.011 Atl2 atlastin GTPase 2 0.60 0.034 Neat1 nuclear paraspeckle assembly transcript 1 (non-protein coding) 0.61 0.050 Acsl1 acyl-CoA synthetase long-chain family member 1 0.61 0.041 Ggnbp1 gametogenetin binding protein 1 0.61 0.011 Slc4a4 solute carrier family 4 (anion exchanger), member 4 0.61 0.014 Per2 period homolog 2 (Drosophila) 0.61 0.021 Rnf44 ring finger protein 44 0.62 0.023 Flcn Folliculin 0.62 0.028 Slc25a20 solute carrier family 25 (mitochondrial carnitine/acylcarnitine 0.62 0.025 translocase), member 20 Atl2 atlastin GTPase 2 0.62 0.047 Hnrpdl heterogeneous nuclear ribonucleoprotein D-like 0.62 0.011 Srsf2 serine/arginine-rich splicing factor 2 0.63 0.016 Slc38a2 solute carrier family 38, member 2 0.63 0.016 Gys2 glycogen synthase 2 0.63 0.023 Ddx17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 0.63 0.014 Gm3308 predicted gene 3308 0.64 0.021 Gm10621 predicted gene 10621 0.64 0.004 Ccrn4l CCR4 carbon catabolite repression 4-like (S. cerevisiae) 0.64 0.024 Actb actin, beta 0.64 0.021 Aspg asparaginase homolog (S. cerevisiae) 0.64 0.021 Clasrp CLK4-associating serine/arginine rich protein 0.64 0.013 Ppargc1b peroxisome proliferative activated receptor, gamma, coactivator 0.64 0.029 1 beta Apoc1 apolipoprotein C-I 0.65 0.034 Hnrnpa2b1 heterogeneous nuclear ribonucleoprotein A2/B1 0.65 0.017 Adhfe1 alcohol dehydrogenase, iron containing, 1 0.65 0.028 Klf9 Kruppel-like factor 9 0.65 0.029 Aacs acetoacetyl-CoA synthetase 0.66 0.039 Vegfa vascular endothelial growth factor A 0.66 0.003 Srrm2 serine/arginine repetitive matrix 2 0.66 0.013 2810403A07R RIKEN cDNA 2810403A07 gene 0.67 0.011 ik Hsp90ab1 heat shock protein 90 alpha (cytosolic), class B member 1 0.67 0.046 Gtf3c2 general transcription factor IIIC, polypeptide 2, beta 0.67 0.011 Lgals4 lectin, galactose binding, soluble 4 0.67 0.011 Paqr9 progestin and adipoQ receptor family member IX 0.67 0.030 Arap3 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 0.68 0.030 3 Slc1a5 solute carrier family 1 (neutral amino acid transporter), member 0.68 0.001 5 Fam126b family with sequence similarity 126, member B 0.68 0.022

161

Slc1a5 solute carrier family 1 (neutral amino acid transporter), member 0.68 0.003 5 Gm2589 predicted gene 2589 0.68 0.012

162

6.2.2 Effect of Gpr120 KO on brown fat associated genes We carried out preliminary gene expression studies to determine the effects of Gpr120 KO on the expression of specific brown fat genes aP2, Ucp1, and CIDEA. Also the expression of

Adrbk2 and Sncg, genes that were highly downregulated or upregulated respectively within the microarray, were determined. As expected, there was no detectable Gpr120 mRNA in the

KO BAT. However, in these samples, Gpr40 was detected at low level in BAT, but not significantly affected by Gpr120 KO. There was no significant change in the expression of aP2, Ucp1 or CIDEA in the KO compared to the WT (Figure 6.2.1). However, there was a significant reduction in the mRNA levels of Adrbk2 in Gpr120 KO BAT compared to WT, confirming the observation. The most upregulated gene in Gpr120 KO BAT, Sncg, a member of the synuclein family of genes, exhibited a significant increase in Gpr120 KO BAT compared to the WT (Figure 6.2.1).

163

Figure 6.2.1: mRNA expression levels of Gpr120, aP2, Ucp1, Gpr40, CIDEA, Sncg, and Adrbk2 in brown adipose tissue (BAT) from either GPR120 knockout (KO) or wild type (WT) mice using q-RT-PCR. BAT samples were obtained from five pairs of Gpr120 KO and WT littermates kept in the same housing condition. Total RNA was extracted with TRIzol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin with GPR120 WT as the reference value. All data are expressed as the mean ± SEM of five samples in duplicates (n=5). *p<0.05

164

6.2.2 The role of Gpr120 in inflammation in BAT It is now recognized that chronic tissue inflammation is a major component of obesity- induced insulin resistance, and this is due to the accumulation of proinflammatory immune cells (Oh and Olefsky, 2012), and adipocytes are capable of contributing to this inflammation by their production of inflammatory mediators (Vielma et al., 2013) such as TNF-α, IL-1β,

IL-6, and/or BDNF, and by playing a significant role in initiating the inflammatory cascade

(Deshmane et al., 2009). The effect of Gpr120 knockout on BAT inflammatory genes was therefore assessed. The mRNA expression levels of IL-6, TNFα, RANTES, CD36, and MCP-

1 in Gpr120 KO BAT was compared to WT BAT. There was a trend towards upregulation of

IL-6, and RANTES in the Gpr120 knockout BAT compared to WT (Figure 6.2.2) although this was not significant.

165

Figure 6.2.2: mRNA expression levels of IL-6, TNFα, CD36, RANTES, and MCP-1 in brown adipose tissue from either GPR120 knockout (KO) or wild type (WT) mice using q-RT-PCR. BAT samples were obtained from five pairs of Gpr120 KO and WT littermates kept in the same housing condition. Total RNA was extracted with TRIzol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin with GPR120 WT as the reference value. All data are expressed as the mean ± SEM of five samples in duplicates (n=5).

166

6.2.3 Gpr120 is essential for lipogenesis Fatty acid synthesis is an important component of the metabolic regulation of adipose tissue.

Thermogenesis in BAT has been attributed predominantly to activation of mitochondrial uncoupling via Ucp1, resulting in heat production. Increased adipose tissue lipogenesis is associated with enhanced insulin sensitivity (Yore et al., 2014) and improved thermogenesis

(Diaz et al., 2014). To determine the effect of Gpr120 KO on lipogenesis, mRNA levels of known genes involved in lipogenesis were examined. Specifically Acc1, Acc2, Fasn, Scd1,

Scd2, Aacs, and Srebp1c were analysed in Gpr120 KO BAT compared to WT BAT. A significant reduction in the expression of Acc1, Acc2, Fasn, and Scd2, in the Gpr120 knockout BAT as compared to the WT was observed (Figure 6.2.3). This suggests that downregulation of Gpr120 may cause an impairment in BAT lipogenic activity, through the inhibition of key genes that control this process.

167

Figure 6.2.3: mRNA expression levels of Acc1, Acc2, Scd1, Scd2, Aacs, and Srebp1c in brown adipose tissue from either GPR120 knockout (KO) or wild type (WT) mice using q-RT-PCR. BAT samples were obtained from five pairs of Gpr120 KO and WT littermates kept in the same housing condition. Total RNA was extracted with TRIzol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin with GPR120 WT as the reference value. All data are expressed as the mean ± SEM of five samples in duplicates (n=5). *p<0.05

168

6.2.4 Gpr120 KO impairs lipolysis in BAT The hydrolysis of stored triacylglycerol (TAG) in adipocytes results in the release of free fatty acids and glycerol into the bloodstream. Complete TAG hydrolysis depends on the activity of certain key enzymes such as adipose triglyceride lipase (ATGL) and hormone- sensitive lipase (HSL). Therefore in order to assess the effects of Gpr120 knockout on genes involved in the lipolytic pathway, we analysed mRNA levels of ATGL, HSL, Acsl1, Pnpla3,

Adhfe1, and Apoc1 in the Gpr120 KO BAT compared to the WT. A reduction in mRNA levels of all the genes was observed. However, ATGL, HSL, and Apoc1 were the only genes with significantly reduced mRNA levels (Figure 6.2.4). This suggests that Gpr120 KO is associated with reduction of lipolytic genes and impairment of fatty acid metabolism.

169

Figure 6.2.4: mRNA expression levels of HSL, ATGL, Acsl1, Pnpla3, Adhfe1, and Apoc1 in brown adipose tissue from either GPR120 knockout (KO) or wild type (WT) mice using q-RT- PCR. BAT samples were obtained from five pairs of Gpr120 KO and WT littermates kept in the same housing condition. Total RNA was extracted with TRIzol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin with GPR120 WT as the reference value. All data are expressed as the mean ± SEM of five samples in duplicates (n=5). *p<0.05

170

6.2.5 Gpr120 is involved in the regulation of glucose metabolism Brown adipose tissue activation is reported to play a physiologically significant role in whole-body energy expenditure, glucose homeostasis and insulin resistance (Chondronikola et al., 2014). Therefore the requirement of Gpr120 in regulation of key genes in glucose metabolism was next evaluated. The mRNA levels of genes known to be constitutively involved in the metabolism of glucose, some of which were identified by the microarray experiments (Gys2, Paqr9) were analysed. We compared the expression of Glut4, Insulin receptor, Adcy4, Mlxip1, Glut1, Gys2, Vldlr, Paqr9, and Aldh2 in Gpr120 KO BAT to WT

BAT. A significant reduction in the mRNA expression levels of Glut4, Insulin receptor,

Adcy4 and Mlxip1in the Gpr120 KO BAT as compared to the WT BAT (Figure 6.2.5). This result suggests that BAT Gpr120 has a role to play in adipose tissue glucose homeostasis.

171

Figure 6.2.5A: mRNA expression levels of Glut1, Glut2, Insulin receptor, Gys2, and Adcy4 in brown adipose tissue from either GPR120 knockout (KO) or wild type (WT) mice using q-RT- PCR. BAT samples were obtained from five pairs of Gpr120 KO and WT littermates kept in the same housing condition. Total RNA was extracted with TRIzol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin with GPR120 WT as the reference value. All data are expressed as the mean ± SEM of five samples in duplicates (n=5). *p<0.05

172

Figure 6.2.5B: mRNA expression levels of Vldlr, Mlxip1, Adrbk2, Paqr9, and Aldh2 in brown adipose tissue from either GPR120 knockout (KO) or wild type (WT) mice using q-RT-PCR. BAT samples were obtained from five pairs of Gpr120 KO and WT littermates kept in the same housing condition. Total RNA was extracted with TRIzol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin with GPR120 WT as the reference value. All data are expressed as the mean ± SEM of five samples in duplicates (n=5). *p<0.05

173

Table 6.4: Summary of genes found to be downregulated in Gpr120 knockout BAT using q-RT-PCR.

Downregulated genes Gene name p-value Adrbk2 adrenergic receptor kinase, beta 2 <0.05 Gpr40 omega-3 fatty acid receptor 1 >0.05 Acc1 Acetyl-CoA carboxylase 1 <0.05 Acc2 Acetyl-CoA carboxylase 2 <0.05 Fasn Fatty acid synthase <0.05 Scd1 Stearoyl-CoA desaturase 1 >0.05 Scd2 Stearoyl-CoA desaturase 2 <0.05 Aacs acetoacetyl-CoA synthetase >0.05 Srebp1c sterol regulatory element-binding protein 1c >0.05 HSL Hormone sensitive lipase <0.05 ATGL Adipose triglyceride lipase <0.05 acyl-CoA synthetase long-chain family Acsl1 member 1 >0.05 Pnpla3 patatin-like phospholipase domain containing 3 <0.05 Adhfe1 Alcohol dehydrogenase, iron containing,1 >0.05 Apoc1 apolipoprotein C-I <0.05 Glut1 Glucose transporter 1 >0.05 Glut4 Glucose transporter 4 <0.05 Insulin receptor Insuline receptor <0.05 Gys2 Glycogen Synthase 2 >0.05 Adcy4 Adenylate cyclase 4 <0.05 Vldlr Very low density lipoprotein lipase receptor >0.05 Mlxip1 MLX interacting protein-like <0.05 progestin and adipoQ receptor family member Paqr9 IX >0.05 Aldh2 Aldehyde dehydrogenase 2 >0.05

Note: only those with p-value <0.05 were found to be significantly downregulated

174

Table 6.5: Summary of genes found to be upregulated in Gpr120 knockout BAT using q-RT-PCR.

Upregulated genes Gene name p-value Sncg synuclein, gamma <0.05 IL6 Interleukin-6 >0.05 TNFα Tumour necrosis factor-α >0.05 CD36 Thrombospondin Receptor >0.05 RANTES Chemokine ligand 5 (CCL5) >0.05 MCP-1 Monocyte chemoattractant protein-1 (CCL2) >0.05

Note: only those with p-value <0.05 were found to be significantly upregulated

175

6.3 siRNA-mediated Gpr120 Knockdown in IMBAT cells is associated with increase in inflammatory gene expression and reduction in metabolic gene expression In order to further confirm a direct impact of the loss or the absence of Gpr120 in BAT,

Gpr120 levels were reduced by siRNA in the IMBAT cell system. Noting that Gpr120 is only expressed at the basal level in brown preadipocytes but upregulated in mature adipocytes,

IMBAT cells were differentiated for 6 days to allow expression of Gpr120. Thereafter the cells were transfected for 48 hours with Gpr120 siRNA and the mRNA expression levels of

Gpr120, aP2, Ucp1, IL-6, Glut4, Sncg, Mlxipl, and Scd2 were determined using q-RT-PCR.

The validity of the knockdown was provided by over 70% downregulation of Gpr120 expression (Figure 6.3). Similar to the effects observed with the KO BAT, there was a significant increase in expression of Sncg. Ucp1 levels were lower in IMBAT cells treated with Gpr120 siRNA as compared to the control, although this did not reach significance. IL-

6, aP2, Glut4, and Mlxipl levels, however, were not significantly altered.

176

Figure 6.3: Regulation of expression of aP2, Ucp1, Mlxip1, Sncg, IL-6, and Glut4 in IMBAT cells by Gpr120 using q-RT-PCR. IMBAT cells were differentiated for 48 hours with 500µM IBMX, 250nM Dexamethasone, 170nM insulin, 125nM Indomethacin, and 1nM Triiodothyronine (T3). Thereafter, they were transfected with either Gpr120 siRNA or siControl for 48hours. Total RNA was extracted with TRIzol and cDNA was prepared as described in materials and methods. Gene expression was normalized to β-actin and depicted with reference to siControl. All data are expressed as the mean ± SEM of three samples in duplicates (n=3). *p<0.05

177

6.4 Discussion In the search for genes that may be potentially involved in the regulation of brown adipose tissue function with respect to Gpr120, a microarray study, in addition to study of known candidate genes, in BAT from WT and Gpr120 KO mice, was carried out. These two approaches were used to investigate the importance of Gpr120 as a fatty acid receptor in BAT function.

Obesity is a chronic inflammatory state associated with elevated levels of pro-inflammatory cytokines and chemokines in tissues and in the circulation. Adipocytes are capable of contributing to this inflammation by production of inflammatory mediators. Certain genes are traditionally associated with inflammation, such as Interleukin-6 (IL-6), Tumour necrosis factor-α (TNFα) and some chemokines. Together with TNFα, the expression of IL-6 in adipose tissue is known to be associated with obesity-linked insulin resistance (Kern et al.,

2001). Gpr120 has been reported to have anti-inflammatory and anti-diabetic effects (Oh et al., 2010). Following knockout of Gpr120 in BAT, there was an upregulation of IL-6, and

MCP-1, albeit not significant. IL-6 is an interleukin that acts as both a pro-inflammatory

(Bastard et al., 1999) and anti-inflammatory cytokine (Pedersen, 2013) to modulate immune response. Despite the high variability in levels of IL-6 in KO tissue, which may indicate a larger sample size is required, Gpr120 may have an anti-inflammatory function but the current study suggests that there may be more key functions of this receptor in BAT, and possibly Gpr120 in other cell types/tissues may be more anti-inflammatory.

Immune response and metabolic regulation are highly integrated and this interface maintains a central homeostatic system, dysfunction of which can cause obesity-associated metabolic disorder such as type 2 diabetes, fatty liver disease, and cardiovascular disease (Hotamisligil,

2006). Certain molecular pathways have linked obesity to insulin resistance (Shoelson et al.,

2006). Furthermore, there may be regulatory links between BAT thermal plasticity and

178

glucose metabolism in humans (Lee et al., 2014a). Since Gpr120 was highly expressed in

BAT and upregulated by cold exposure, it was hypothesized that Gpr120 had a role in the maintenance of glucose homeostasis. Expression of genes that are constitutively involved in the metabolism of glucose was assessed in the Gpr120 KO compared to WT BAT. Glucose transporter type 4, (Glut4) is involved in insulin-regulated trafficking of glucose, and whole body energy homeostasis. It is expressed in tissues that exhibit insulin-stimulated glucose uptake (heart and skeletal muscle and adipose tissue). One of the main acute effects of insulin is to regulate the disposal and storage of dietary glucose by stimulating the uptake of glucose into muscle and fat. Mice overexpressing Glut4 in adipocytes have elevated lipogenesis and increased glucose tolerance despite being obese with elevated circulating fatty acids (Yore et al., 2014). In Gpr120 KO BAT, a significant reduction in the mRNA levels of Glut4, Insulin receptor and Mlxipl was observed. Although other studies have reported similar findings in adipose tissue as a whole (Oh et al., 2010), this is the first study to identify a potential role of

Gpr120 in glucose and lipid metabolism in BAT. Although downregulation of Gpr120 in

IMBAT cells did not corroborate these findings, this may reflect that a more complete knockdown is required, as in the tissue from the KO mice. Mlxipl, also known as MLX- interacting protein-like is a carbohydrate-responsive element-binding protein (ChREBP).

ChREBP and peroxisome proliferator-activated receptor alpha (PPARα) plays an important role in the regulation of lipid metabolism in the liver (Iizuka et al., 2013).

BAT is a thermogenic organ involved in energy balance and maintenance of healthy body weight. There was a significant reduction in the levels of enzymes involved in lipolysis, HSL and ATGL in Gpr120 KO compared to WT BAT. The primary action attributed to HSL is hydrolysis of stored triacylglycerols in adipose tissue. Since activation of HSL leads to the release of free fatty acids which are taken up by mitochondria, the interaction with Ucp1 results in increased energy expenditure (Djouder et al., 2010). ATGL, Adipose triglyceride

179

lipase (ATGL), an enzyme that catalyzes the rate limiting hydrolytic step of triglycerides in the triacylglycerol lipolysis cascade, is expressed predominantly in adipose tissue. There was also significant downregulation of Pnpla3 and Apoc1 in the Gpr120 KO BAT compared to

WT BAT. Human patatin-like phospholipase (Pnpla) is an enzyme involved in the regulation of adipocyte differentiation. Members of this new enzymatic family displaying lipase and transacylase properties appear to have major roles in the regulation of lipid metabolism and that it participates in the restoration of lipid homeostasis upon aberrant intracellular lipid accumulation (Chamoun et al., 2013). Apoc1 is secreted in plasma where it is a component of very low density lipoproteins (VLDL) and chylomicrons. This protein activates the enzyme lipoprotein lipase which hydrolyzes triglycerides and thus provides FFAs to cells.

Apolipoprotein C-I binds FFAs and reduces their intracellular esterification. Interestingly, expression of Apoc1 in mice has been linked to protection against obesity (Westerterp et al.,

2007), thus its reduction in the absence of Gpr120, which results in obese animals when fed a high fat diet (Jong et al., 2001), is consistent with these observations.

Acsl1 is a member of the ligase family of enzymes. It plays a key role in lipid biosynthesis and fatty acid degradation. By directing fatty acids toward beta-oxidation Acsl1 is required for cold thermogenesis (Ellis et al., 2010). Alcohol dehydrogenase, iron containing,1

(Adhfe1) is responsible for the oxidation of 4-hydroxybutyrate in mammalian tissues (Kardon et al., 2006) and has been shown to be upregulated during brown adipocytes differentiation

(Kim et al., 2007). Although there was a mild reduction in the mRNA levels of Adhfe1 and

Acsl1 in the Gpr120 KO compared to WT, Gpr120 does not seem to have a role in the regulation of these genes.

In addition to lipolysis, genes associated with lipogenesis also seem to require Gpr120. Two stearoyl-CoA desaturase (Scd1 and Scd2) isoforms can be expressed during the differentiation of 3T3-L1 preadipocytes into adipocytes. Stearoyl-CoA desaturase (SCD) is a

180

key rate-limiting enzyme in the synthesis of unsaturated fatty acids. Scd1 and Scd2 are enzymes involved in fatty acid metabolism required for diet-induced insulin resistance

(Gutierrez-Juarez et al., 2006). The significant downregulation of Scd2 following Gpr120 knockout in BAT also suggests a role for Gpr120 in brown fat lipogenesis. Acetyl-CoA carboxylase (Acc1 and Acc2) are enzymes whose functions involve the generation of malonyl-CoA which is a precursor in fatty acid synthesis. Both Acc1 and Acc2 mRNA levels were significantly reduced in Gpr120 KO BAT compared to WT BAT. Adipocyte lipogenic pathway encompasses fatty acid synthesis and subsequent triacyl glyceride synthesis catalysed by FAS. Inhibiting lipogenic enzymes could therefore potentially reduce obesity.

Our result showed a significant reduction in the Level of Fasn in the Gpr120 KO BAT compared to WT. (Lodhi et al., 2012) had reported that Fasn deficiency resulted in reduced

PPARγ activation and reduced adipogenesis.

Loss of Gpr120 also affected the levels of GPCR-associated signalling molecules. Adcy4 encodes a member of the family of adenyly cyclases, which are membrane-associated enzymes that catalyse the formation of the second messenger cyclic adenosine monophosphate (cAMP). The significant reduction in the mRNA levels of Adcy4 observed in

Gpr120 KO suggests that Gpr120 may regulate the ability of distinct GPCRs to activate

(Gαs-coupled) or inhibit (Gαi-coupled) the cAMP pathway such as the β-ARs, in BAT.

Adrbk2 (adrenergic, beta, receptor kinase 2), also known as G-protein-coupled receptor kinase 3(GRK3) is a serine/threonine kinase specifically involved in the phosphorylation of activated GPCRs, contributing to receptor desensitization and recruitment of β-arrestins.

Although GRK6 is implicated in phosphorylation of human Gpr120 in heterologous cell lines

(Burns et al., 2014), its downregulation in Gpr120 KO BAT may suggest a role for this kinase in Gpr120 signal regulation and/or a role for Gpr120 in regulating activity of distinct receptors in this tissue.

181

Synuclein (Sncg) was the most upregulated gene identified in the microarray in the Gpr120

KO BAT compared to WT. This gene is known to be expressed in WAT, with mild expression in BAT and neuronal cells. Sncg has been reported to be one of obesity associated genes linked with aP2 (Bag et al., 2015). Recent findings implicate an important role for synuclein-γ (Sncg) in energy homeostasis and adipocyte function (Dunn et al., 2015).

In summary, Gpr120 may have a role in regulating the expression levels of both lipogenic and lipolytic genes in BAT, and the absence of Gpr120 may cause metabolic impairment.

Regulation of glucose and lipid homeostasis is a key function of adipocytes, one that critically depends on insulin-mediated glucose uptake by Glut4. Downregulation of Glut4 in adipose tissue is one of the earliest events in the pathogenesis of insulin resistance and type 2 diabetes (Ussar and Tschop, 2014). Furthermore, obesity and diabetes appear to share an interconnectivity characterised by inflammation, insulin resistance and metabolic changes, and which may be ameliorated by regulation of long chain fatty acid receptor, Gpr120 in brown adipose tissue. Understanding the integration of these biological systems is important as it relates to energy balance and maintenance of a healthy body weight. Lack of Gpr120 may result in disorders of lipid metabolism. In fact, there seems to be interdependency between glucose and lipids metabolism, and thermogenesis, where Gpr120 may play a pivotal role in their regulation.

182

Chapter 7 Results

Assessment of novel Gpr120- specific ligand-induced cellular events in the differentiation and function of BAT

183

7.1 Introduction Metabolic diseases such as obesity and type 2 diabetes mellitus are increasing by the day.

Gpr120 which plays an important role in the control of energy homeostasis and inducing anti- inflammatory effects is of vital importance in this respect. Synthetic agonists, that will selectively bind Gpr120, could be highly invaluable in the search for pharmacological treatments of obesity, diabetes and its associated complications. Therefore Gpr120 agonism correlates with prevention of the occurrence and development of metabolic disorders such as obesity and diabetes (Zhang and Leung, 2014). In this regard, we have used distinct compounds that activate Gpr120 to assess their responsiveness in brown adipocytes.

Three different Gpr120 compounds which are agonists to Gpr120 were assessed, namely

GW9508, TUG891 and TUG1096. GW9508 is a synthetic non-selective agonist that binds both Gpr120 and Gpr40 (Briscoe et al., 2006a), although its agonist activities have been studied mainly with respect to Gpr40 (Ou et al., 2013). However, Gpr40 was not detectable in

IMBAT cells (Figure 5.2) hence its effect in our cell system can be attributable to Gpr120

binding. GW9508 has been reported to have EC50values of 47 nM and 2.2 µM, respectively, in

HEK293 cells expressing GPR40 and GPR120 (Briscoe et al., 2006a). A second ligand, TUG891, was developed as a potent and selective agonist of human Gpr120 (Hudson et al., 2013).

Stimulation with TUG891 has been reported to enhance glucose uptake in 3T3-L1 cells, inhibit release of proinflammatory mediators from RAW264.7 macrophages and induce

Ca2+ mobilization, β-arrestin-1 and β-arrestin-2 recruitment, and extracellular signal- regulated kinase phosphorylation in HEK293 cells transfected to express species orthologs of

Gpr120 (Hudson et al., 2013; Hudson et al., 2014). TUG891 was found to be approximately

10 times more potent than GW9508, with pEC50 potency values of 7.36 and 7.77 for human and mouse Gpr120 respectively (Shimpukade et al., 2012). Therefore, based on the various

184

reported data, standard concentrations of 100µM and 10µM for GW9508 and TUG1096 respectively (Hudson et al., 2013; Hudson et al., 2014) have been used through in this project.

The third agonist, TUG1096 was recently developed and provided by our collaborator, Trond

Ulven, University of Southern Denmark. It is thought to be a more specific agonist, but there are currently no published studies that utilised this compound. However, at a dose 10µM, they observed physiological response to Gpr120 stimulation (personal communication).

Therefore experiments were carried out to test and compare these more specific Gpr120 ligands (TUG891 and TUG1096) to GW9508 in brown adipocytes. We tested the potential of these ligands to induce cellular differentiation of brown adipocytes, and regulate metabolic and inflammatory processes in brown adipocytes.

185

7.1.1 Effect of Gpr120 agonists on Gpr120 and aP2 gene expression Undifferentiated IMBAT cells were treated with the three different ligands every 12 hours over a 6-day period, and the expression profile of Gpr120, aP2 (a differentiation marker) and some key genes involved in adipose tissue metabolism was determined. Untreated undifferentiated IMBAT cells and differentiated cells treated on a standard differentiation protocols served as negative and positive controls respectively.

The expression of the differentiation marker aP2, following the standard differentiation treatment, increased steadily with time (Figure 7.1.1). Treatment with GW9508 resulted in an early expression of aP2, which gradually reduced over time. While treatment with TUG891 did not induce any significant changes in aP2 expression, treatment with TUG1096 caused a gradual but small increase in the expression levels of aP2 which peaked following 4 days of treatment (Figure 7.1.1). GW9508 also stimulated Gpr120 expression that increased steadily from the first day of treatment with an approximately 50-fold increase following 6 days of treatment which was similar to the levels induced by standard differentiation protocol.

TUG1096 and TUG891 however, induced only a small increase in Gpr120 mRNA levels following 2 days or 6 days treatment respectively (Figure 7.1.1).

186

Figure 7.1.1: mRNA levels of aP2 and Gpr120 in ligand-treated undifferentiated IMBAT cells, using q-RT-PCR. The cells were treated 12 hourly for 6 days with GW9508 (100µM), TUG891 (10µM), and TUG1096 (10µM); a set IMBAT cells was treated with a standard differentiation cocktail for 6 days. Gene expression was normalized to beta-actin and depicted with reference to the undifferentiated IMBAT cells. All data represent mean ± SEM of three samples in duplicate. *P<0.05**p<0.005, ***p<0.001

187

7.1.2 Effect of Gpr120 agonists on expression of metabolic genes Gpr120 is known to play roles in the regulation of metabolism, and its agonist has been reported to have insulin-sensitizing and anti-inflammatory effects (Hudson et al., 2013; Oh et al., 2010). To determine the effect of stimulation of IMBAT cells with Gpr120 ligands on expression of genes involved in lipid and glucose metabolism that were decreased in Gpr120

KO BAT (Chapter 6), a treatment-time course was carried out as in section 7.1.1. There was an increase in mRNA levels of all genes with standard differentiation protocol. Treatment with GW9508 caused an approximately 40-fold increase in the mRNA levels of Acc2, Glut1 and Glut4 after 6 days, but did not cause any appreciable change in the mRNA levels of

Scd2. Whereas just 2 days of treatment, GW9508 induced expression of insulin receptor

(Figure 7.1.2).

Treatment with TUG891 or TUG1096 caused a mild, but non-significant increase in the mRNA levels of Acc2 and Scd2 after 4 days. No appreciable changes in the levels of Glut4 were observed following treatment with either TUG891 or TUG1096, however, TUG1096 significantly increased insulin receptor mRNA levels after 2 days and Glut1 following 6 days of treatment. Overall, this data suggests that treatment of brown adipocytes with Gpr120 agonists can induce differential effects on activation of metabolic gene expression.

188

189

Figure 7.1.2: mRNA levels of Glut1, Glut4 and Insulin receptor in ligand-treated undifferentiated IMBAT cells using q-RT-PCR. Undifferentiated IMBAT cells treated for 6 days with Gpr120 ligand. The cells were treated 12 hourly for 6 days with GW9508 (100µM), TUG891 (10µM), and TUG1096 (10µM); a set IMBAT cells was treated with a standard differentiation cocktail for 6 days. Gene expression was normalized to beta-actin and depicted with reference to the undifferentiated IMBAT cells. All data represent mean ± SEM of three samples in duplicate. *P<0.05**p<0.005, ***p<0.001

190

7.2 Effects of Gpr120 ligands on Gpr120 KO IMBAT cells

7.2.1 Gpr120 ligands induce lipid droplet formation in IMBAT cells via Gpr120 Based on the differential effects that the Gpr120 ligands had on gene expression, further experiments were carried out to determine the receptor specificity of the above ligand- induced effect on differentiation and metabolic gene expression. IMBAT cell lines were generated from Heterozygous (Het) and knockout (KO) brown adipocytes (kindly provided by Karsten Kristiansen, University of Copenhagen).

Lipid droplet formation is classically used as a phenotypic manifestation of adipocyte maturation. GW9508 was earlier demonstrated to stimulate lipid droplet formation in IMBAT cells, suggesting the ability of this ligand to induce the mature brown phenotype in our cell system (Figure 5.4). The capacity of GW9508, TUG891 and TUG1096 to stimulate lipid droplet formation in IMBAT cells from Gpr120 heterozygous (Het) or Gpr120 knockout

(KO) lines was compared. This would also determine the specificity of Gpr120 ligands in the mouse IMBAT cell system. Undifferentiated Het and KO IMBAT cells were treated with

GW9508, TUG891 or TUG1096 12 hourly for 8 days and cells stained with Oil red O and imaged. As a positive control cells were also treated with the standard differentiation protocol.

Following 8 days of treatment with standard differentiation protocol both the Het and KO cells exhibited lipid droplet formation (Figure 7.2.1 A-B). When cells were treated with

GW9508, there was a reduction in the lipid droplet formation in the Gpr120 KO cells compared to the Het (Figure 7.2.1). Whereas TUG891 induced minimal lipid droplet formation in Gpr120 Het IMBAT cells, there was almost no visible Oil red O staining in the

KO cells. Although TUG1096 induced lipid droplet formation, there was no appreciable difference in the lipid droplet induced by TUG1096 between Gpr120 Het and KO IMBAT cells. Taken together, this suggests that downregulation of Gpr120 in IMBAT cells reduces

191

the ability of the cells to certain different Gpr120 agonists and that such ligands may possess different capacity to induce brown adipocyte lipid droplet formation.

192

Gpr120 -/+ Gpr120 -/-

Standard Standard

100µM GW9508 100µM GW9508

10µM TUG891 10µM TUG891

10µM TUG1096 10µM TUG1096

Figure 7.2.1: Oil Red O (O Red O) staining of Gpr120-/+ and Gpr120-/- IMBAT cells treated with Gpr120 agonists. Undifferentiated Gpr120 Het and KO IMBAT cells were treated with 100µM GW9508, 10µM TUG891, 10µM TUG1096 or standard differentiation cocktail for 6 days and stained with ORO. Standard differentiation was performed as in materials and methods. Images were taken with light microscope (20X magnification).

193

7.2.2 Gpr120 KO attenuates the Gpr120 ligand-induced induction of metabolic genes. It has been demonstrated that downregulation of Gpr120 in BAT reduced the expression of certain key metabolic genes (Chapter 6). To assess the ability of Gpr120 ligands to stimulate expression of these metabolic genes and to further determine the function of Gpr120 in BAT metabolism, the expression levels of Acc2 and Srebp1c, representative metabolic genes, were determined. Undifferentiated Het and KO IMBAT cells were treated with GW9508, TUG891 or TUG1096. Cells were also differentiated using the standard differentiation cocktail. The expression levels of Acc2 and Srebp1c in Het cells were robustly increased following treatment with GW9508, or standard differentiation cocktail (Figure 7.2.3). In contrast this

GW9508 or differentiation cocktail-induced expression was dramatically reduced in Gpr120

KO cells compared to Gpr120 Het IMBAT cells. Both TUG891 and TUG1096 induced a small but significant increase in Srebp1c mRNA levels (approximately five-fold) in the

Gpr120 Het cells but not in in the Gpr120 KO cells. These findings suggest that the ligand- induced increases in genes induced by these distinct ligands are via Gpr120.

194

Figure 7.2.2: mRNA levels of Acc2 and Srebp1c in Gpr120 heterozygous (Het) and knockout (KO) IMBAT cells using q-RT-PCR. Both Het and KO cells were treated with 100µM GW9508, 10µM TUG891 or 10µM TUG 1096 12 hourly for 6 days. Another set was either treated with standard differentiation cocktail or left undifferentiated. Gene expression was normalized to β- actin and depicted with respect to the untreated. All data are expressed as the mean ± SEM of three samples in duplicate (n=3). *p<0.05, **p<0.005, ***p<0.001

195

7.2.3 Gpr120 ligand activation reduces inflammatory gene expression in IMBAT cells Gpr120 has been reported to be an ω-3 fatty acid receptor or sensor with anti-inflammatory effects (Oh et al., 2010; Wellhauser and Belsham, 2014). Chapter 6 indicated that knockout of Gpr120 in BAT caused an induction in mRNA levels of certain inflammatory genes, indicating an anti-inflammatory role in BAT. Therefore the effect of Gpr120 ligand treatment of Het and KO cells on inflammatory gene expression was measured. Undifferentiated Het and KO IMBAT cells were treated with GW9508, TUG891 or TUG1096 as above. Another set of Gpr120 Het and KO IMBAT cells were either left untreated, or differentiated using the standard differentiation cocktail for 6 days and the gene expression of IL-6 was determined.

Interestingly there was more than 20-fold increase in the levels of IL-6 expression in the untreated KO cells compared to the Gpr120 Het cells, whereas following treatment with standard differentiation protocol IL-6 expression was induced in Gpr120 Het cells, but not in

Gpr120 KO cells (Figure 7.2.3). Treatment with TUG891 or TUG1096 induced an approximately 18-fold increase in the expression of IL-6 in Het cells compared to untreated

Het cells. However, the increase induced by TUG891, was lost in the KO cells, and only partly reduced in KO cells treated with TUG1096. Although IL-6 mRNA levels were higher in the Gpr120 KO compared to Het, treatment with GW9508 caused a reduction in mRNA levels of IL-6 in both Het and KO cells compared to the untreated (Figure 7.2.3). These findings suggest that the distinct ligands may have contrasting pro- and anti-inflammatory responses that act via Gpr120 and possibly other receptor targets.

196

Figure 7.2.3: mRNA levels of IL-6 in Gpr120 heterozygous (Het) and knockout (KO) IMBAT cells using q-RT-PCR. Both Het and KO cells were treated with 100µM GW9508, 10µM TUG891 or 10µM TUG 1096 12 hourly for 6 days. Another set was either treated with standard differentiation cocktail or left undifferentiated. Gene expression was normalized to β-actin and depicted with respect to the untreated. All data are expressed as the mean ± SEM of three samples in duplicate (n=3). *p<0.05, **p<0.005

197

7.3 Regulation of Gpr120 expression in brown adipocytes by Gpr120

7.3.1 GW9508-induced activation of Gpr120 and aP2 in brown adipocytes is dependent on PPARγ and PPARα It has been demonstrated that Gpr120 agonist induced the expression of Gpr120 and aP2 in undifferentiated brown pre-adipocytes (Chapter 5). PPARs are known master regulators of adipocyte differentiation (Nedergaard et al., 2005). To determine if PPARs are involved in these regulatory activities, the potential of PPAR ligands to alter the Gpr120 agonist-induced expression of aP2 and Gpr120 was investigated. For these experiments undifferentiated and differentiated IMBAT cells were treated for 5 days with GW9508 in the presence and absence of a PPARγ antagonist (GW9662) or PPARα antagonist (GW6471). The effect of stimulation of brown adipocytes with Rosiglitazone (PPARγ agonist), GW7647 (PPARα agonist) and GW1516 (PPARδ agonist) were also assessed.

A robust induction in the expression levels of Gpr120 and aP2 was observed following treatment with rosiglitazone, and this induction was significantly reduced in the presence of the PPARγ antagonist GW9662. However, treatment with a PPARα or PPARδ agonist did not induce expression of either Gpr120 or aP2 (Figure 7.3.1 A and B). These findings suggest

PPARγ activation can increase the levels of Gpr120 in brown adipocytes.

When IMBAT cells were fully differentiated (Figure 7.3.1 d and D) and stimulated in a similar manner, there was a reduction in Gpr120 mRNA levels upon GW9508 activation which was only partly reversed in the presence of PPARγ antagonist but not PPARα antagonist However, there was an approximately two-fold increase in aP2 expression following treatment with GW9508, which was only partially reduced by PPARα antagonist, but not by PPARγ antagonist (Figure 7.3.1). Overall, GW9508-induced Gpr120 expression is attenuated by PPARγ and PPARα antagonists, and while GW9508 induced Gpr120 mRNA in

198

undifferentiated IMBAT cells, it mildly inhibited Gpr120 expression in differentiated

IMBAT cells.

199

Rosiglitasone (Rosi): PPARγ agonist GW9662: PPARγ antagonist GW7647: PPARα agonist GW6471: PPARα antagonist GW1516: PPARδ agonist

200

Rosiglitasone (Rosi): PPARγ agonist GW9662: PPARγ antagonist GW7647: PPARα agonist

GW6471: PPARα antagonist GW1516: PPARδ agonist

Figure7.3.1: Role of PPARs in the regulation of Gpr120 expression. IMBAT Cells were differentiated using standard differentiation protocol described in materials and methods, and differentiated cells were treated for 24 hours with 100µM GW9508 in the presence or absence of PPARγ ligands (100nM Rosi and 10µM GW9662), PPARα (100nMGW7647 and 100nM GW6471), and PPARδ ligand (1µM GW1561). Gene expression was normalized to β-actin with DMSO as the reference value. All data are expressed as the mean ± SEM of two independent samples in triplicate.

201

7.3.2 Gpr120 activation by TUG891 and TUG1096 occurs via a PPARγ-dependent mechanism GW9508-induced activation of Gpr120 and aP2 in brown adipocytes appears to be via a

PPAR-dependent mechanism. To determine if TUG891 or TUG1096-induced expression of these genes was via a similar mechanism undifferentiated brown adipocytes were stimulated for 5 days with rosiglitazone, TUG891 or TUG1096 in the presence or absence of PPARγ inhibitor (GW9662) and the relative gene expression levels of Gpr120 and aP2 determined.

It was observed that GW9662 attenuated the rosiglitazone-induced expression of Gpr120, aP2 and Ucp1 suggesting that these genes are regulated by PPARγ (Figure 7.3.2). Following agonist stimulation, TUG1096 induced approximately a 15-fold induction in the levels of

Gpr120 mRNA, whereas TUG891 treatment caused about 3-fold increase. However, the

TUG891 and TUG1096-induced expression of Gpr120 was completely inhibited by the presence of PPARγ antagonist. For aP2, PPARγ antagonist completely inhibited the

TUG1096-induced expression of aP2. However there was no appreciable change in aP2 expression with TUG891 alone. These observations further suggest that Gpr120 function in brown adipocytes is regulated via a PPARγ-dependent mechanism.

202

Rosi: PPARγ agonist GW9662: PPARγ antagonist

Figure 7.3.2: mRNA levels of Gpr120, aP2, Ucp1 Undifferentiated IMBAT Cells were treated for 5 days with 100nM Rosi, 100µM GW9508, 10µM TUG891 or 10µM TUG1096 in the presence or absence of PPARγ inhibitor (10µM GW9662). Gene expression was normalized to β-actin with DMSO as the reference value. All data are expressed as the mean ± SEM of two independent samples in triplicate.

203

7.4 Discussion The global prevalence of obesity and its associated complications has increased in recent times. Research attempting to contribute to the management of this condition is tailored towards development of pharmaceutical treatments that can improve energy expenditure. In this regards manipulation of BAT to increase its metabolic and energy homeostasis is very important. It has been found that Gpr120 is present in the brown adipose tissues at high levels and may induce BAT thermogenic and metabolic homeostasis. The objectives of this chapter were to begin to investigate the potential actions of novel Gpr120-specific ligands in brown adipocytes, and determine which ligand may be specific for Gpr120 activation.

Although all three ligands tested induced an increase in Gpr120 expression, GW9508 gave the highest level of expression of Gpr120 followed by TUG1096, and they may exhibit different specificities to Gpr120 with respect to species. TUG891, for example, is reported to be potent for both human and mouse Gpr120, yet it is more selective in human between

Gpr120 and Gpr40 than mouse , hence the potential utility of TUG891 in animal studies may be restricted (Zhang and Leung, 2014). TUG891 was also able to induce only a minimal increase in the expression of Gpr120, Acc2, Scd2 Glut1, and insulin receptor, although a recent study reported an increase in glucose uptake following stimulation of 3T3-L1 cells with TUG891 (Milligan et al., 2014) which may reflect the distinct cell types used or that

TUG891 directly increases glucose uptake but not dependent on changes at the transcriptional level. GW9508 is known to bind both Gpr120 and Gpr40, but it is more specific to Gpr40.

Although GW9508 is not expressed in IMBAT cells and BAT, the lack of specificity of

GW9508 (Briscoe et al., 2006a) reduces it potential as a likely candidate for use as Gpr120 agonist in BAT. Stimulation with TUG1096 showed a more sustained response on Insulin receptor expression than TUG891 and GW9508. Although the ability of TUG1096 to induce expression of Gpr120, Glut1 Scd2 and Insulin receptor marks it as a potential new ligand for

204

regulation of cellular metabolism in BAT, the only partial loss of ligand-induced expression in the Gpr120 KO lines may suggest that this compound may not be specific to Gpr120 alone.

The role of PPARs in the regulation of adipose tissue function is well established. In undifferentiated adipocytes PPARγ antagonist completely blocked the Gpr120 expression induced by all three ligands. PPARγ agonists also have been reported to show more selectivity towards Gpr120 than Gpr40 in adipose tissue and its antagonist blocked Gpr120 gene expression (Zhang and Leung, 2014). In the differentiated brown adipocytes, GW9508 reduced the expression of Gpr120 which was increased by PPARγ antagonist. Although this effect was not tested for TUG891 and TUG1096, it suggests that GW9508 directly regulates

Gpr120 expression through PPARγ. Overall, Gpr120 is a PPARγ target gene, and the

Gpr120-ligand-induced effects are thus regulated in a PPARγ-dependent manner.

205

Chapter 8 Results

Profiling Gpr120 signalling pathways and their downstream roles in IMBAT cells

206

8.1 Introduction The potential to promote the number of brown fat cells and to enhance their differentiation to improve their thermogenic capacity would be considered attractive, as this could potentially represent a new avenue for preventing or at least slowing the development of obesity. An understanding of the signalling pathways governing these processes in brown adipocytes is therefore of considerable significance. GPCRs have proved to be very successful drug targets for the pharmaceutical industry. It has been estimated, that about 50% of all modern drugs act on GPCRs (Tautermann, 2014; Thompson et al., 2014).

GPCRs can signal through both G-protein and non G-protein pathways (Belcheva and

Coscia, 2002). Gpr120 couples to Gαq/11 family of G-proteins leading to activation of PLC which then cleaves PIP2 into DAG and IP3. IP3 causes an increase in the cytosolic calcium concentration. Calcium and DAG together activate PKC and MAP kinase pathways (Sun et al., 2010). Gpr120 can also recruit the adaptor protein β-arrestins. β-arrestins 1 and 2 bind the activated and phosphorylated GPCR. β-arrestins uncouple receptors from their G-proteins

(desensitization) and target the receptor to the internalization machinery (clathrin and clathrin adaptor, AP2) via clathrin-coated pits and subsequent transport to internal compartments called endosomes. β-arrestins also activate G-protein-independent signalling via its ability to scaffold MAP kinase pathways (Luttrell and Lefkowitz, 2002), a property that is being exploited pharmacologically via the identification of ‘biased’ ligands (Rajagopal et al.,

2011).

Different ligands have been used to investigate Gpr120 signalling primarily in heterologous cell lines. Activation of Gpr120 by GW9508, results in rapid elevation of intracellular Ca2+ indicating that Gαq/11 pathway is involved (Briscoe et al., 2006a). Selective knock-down of

β-arrestin 2, but not β-arrestin 1 in RAW 264.7 cells blocked effects of GW9508 to inhibit

LPS-mediated inflammatory signals (Oh et al., 2010). Although GW9508 binds both Gpr120

207

and Gpr40, its binding affinity is higher to Gpr40 (Oh et al., 2010). Another agonist, TUG891 which was reported to be more selective, activates calcium and β-arrestin recruitment in

HEK293 cells (Hudson et al., 2013). It also stimulated increase in glucose uptake in 3T3-L1 adipocytes, and inhibited release of proinflammatory mediators from RAW264.7 macrophages. Based on the reported signalling pathways of Gpr120 ligands in distinct cell types, and the observed differences in downstream responses in brown adipocytes between these ligands (Chapter 7), the next question was to decipher which signalling pathways these distinct ligands activate in BAT and their potential roles in mediating specific downstream actions of Gpr120.

8.2 Agonist-induced calcium mobilization

8.2.1 Agonist activation of Gpr120 increases intracellular Ca2+ mobilization in a ligand specific manner As Gpr120 is a Gαq/11 coupled receptor in other cellular systems, calcium mobilization was used as readout to assess ligand activation of Gpr120 in IMBAT cells. To measure intracellular calcium levels upon ligand activation, Fluo-4 a calcium indicator dye and confocal microscopy imaging was used. Fluo-4 has a greater absorption and fluorescent properties than most Ca2+ detectors and exhibits a calcium-dependent increase in fluorescence emission upon binding Ca2+(Gee et al., 2000). Calcium mobilization assays were carried out on Gpr120 WT IMBAT cells. Undifferentiated IMBAT cells were loaded with Fluo-4 and challenged with GW9508, TUG891 or TUG106. The calcium response to

GW9508 is demonstrated in Figure 8.1A. There was no calcium response on addition of

DMSO (Figure 8.1A-i). However, within seconds of agonist treatment, calcium mobilization was observed (Figure 8.1A-ii), which gradually reduced with time (Figure 8.1A-iii). This rapid and transient calcium wave is illustrated in Figure 8.1B.

208

A i ii iii

Fluorescence Intensity/AU

Time (sec)

Figure 8.1: GW9508 increases intracellular calcium levels in WT undifferentiated IMBAT cells. IMBAT cells were loaded with calcium sensitive Fluo-4 before stimulation with DMSO as vehicle control and 100μM GW9508. Calcium mobilisation was determined by live confocal microscopy. (A) Representative confocal microscopy images showing effects of ligand treatment on IMBAT cells. (i) DMSO Control, (ii) ligand treated and (iii) Declining calcium response (B) Florescent intensity plot showing calcium response following addition of GW9508 to IMBAT cells. Plot represents 20 cells from four different experiments. (n=3)

209

8.2.2 Differential activation of calcium signalling by TUG891 and TUG1096 in IMBAT cells When undifferentiated IMBAT cells were stimulated with TUG891, there was a more robust and significantly higher increase in intracellular (Figure 8.2A), Furthermore, TUG891- induced calcium signals appeared to be more sustained (approximately 200 seconds) than calcium waves induced by GW9508 (approximately 80 seconds). However, when cells were stimulated with TUG1096, there was no calcium response. In order to confirm that TUG1096 did not activate calcium signalling, TUG1096-stimulated cells that produced no observable calcium response were then challenged with GW9508. There was a robust increase in the intracellular calcium mobilization within seconds of addition of GW9508 (Figure 8.2B).

Overall, the three Gpr120 ligands produced distinct calcium signal responses in IMBAT cells.

210

Fluorescence Intensity/AU

Time (sec)

Fluorescence Intensity/AU

Time (sec)

Figure 8.2: Fluorescent intensity plot showing calcium response following addition of TUG891 (A) or TUG1096 followed by GW9508 (B). IMBAT cells were loaded with calcium sensitive Fluo-4 before stimulation with 10μM TUG891 or 10μM TUG1096. Calcium mobilisation was determined by live confocal microscopy imaging. (C) Mean maximal calcium responses induced by GW9508 and TUG891. Error bars represent Mean ± SEM of at least 10 cells per 3 experiments. **p<0.005 (n=3)

211

8.3 GW9508, but not TUG891, mediated Gpr120 Ca2+signalling is via a Gαq/11 pathway Since GW9508 and TUG891, but not TUG1096, increased intracellular calcium levels in

IMBAT cells, the next step was to determine if these two ligands were signalling via a

Gαq/11 pathway. A number of pharmacological agents are known to inhibit Gαq/11 pathway, such as YM-254890, UBO-QIC and GP-2A (Kamato et al., 2014). In this set of experiments

UBO-QIC, a novel compound reported to effectively inhibit Gαq/11 signalling in many laboratory cell lines, by directly binding to this G-protein and inhibiting the release of GDP, was used.

Undifferentiated IMBAT cells were pre-treated for 2 hours with UBO-QIC followed by ligand treatment and measurement of calcium mobilization as above. Following pre-treatment with UBO-QIC, there was a significant reduction in GW9508-induced intracellular calcium levels (Figure 8.3A). Surprisingly, when the cells were stimulated with TUG891, there was no difference in the calcium mobilization in the UBO-QIC treated cells as compared to control (Figure 8.4A). This suggests that activation of Gpr120 by GW9508, but not TUG891, to induce calcium mobilization is Gαq/11 mediated.

Since the Gαq/11 inhibitor did not have any effect on TUG891-induced calcium signalling,

Gpr120 was downregulated via siRNA, to confirm if the TUG891-induced calcium response is via Gpr120 activation. There was a significant reduction in TUG891-induced calcium response in the IMBAT cells transfected with Gpr120 siRNA compared to the control (Figure

8.3B). This finding suggests that TUG891 is activating calcium signalling via Gpr120, but in a Gαq/11-independent manner.

212

Figure 8.3: (A) Average maximal ligand-induced calcium responses following pre-treatment with the Gαq inhibitor (UBO QIC). Undifferentiated IMBAT cells were pre-treated with 2.5µM UBO QIC for 2 hours, Thereafter, IMBAT cells were loaded with calcium sensitive Fluo-4 before stimulation with ligands. Calcium mobilisation was determined by live confocal microscopy (B) Average maximal TUG891-induced calcium responses following Gpr120 knockdown. siRNA transfected IMBAT cells were loaded with Fluo-4 and stimulated with TUG891 (10µM). Calcium mobilisation was determined by live confocal microscopy. Error bars represent Mean ± SEM of at least 10 cells from three different experiments. **p<0.005, ***p<0.001

213

8.4 Gpr120 ligands stimulate β-arrestin recruitment in IMBAT cells β-arrestin-1 and β-arrestin-2 are well-known negative regulators of heterotrimeric G-protein signalling, but can also function as scaffold proteins to activate GPCR-mediated signal transduction (Ma and Pei, 2007). Gpr120 is known to recruit β-arrestins in heterologous cells and macrophages (Oh et al., 2010), but its ability to recruit these key GPCR regulatory proteins in IMBAT cells is unknown. To determine whether Gpr120 activation induces β- arrestin recruitment, IMBAT cells were transfected with YFP-tagged β-arrestin-1 or β- arrestin-2. Fluorescently tagged β-arrestin is classically employed to measure β-arrestin dependence of a GPCR. Cells were stimulated with Gpr120 ligands (GW9508, TUG891 or

TUG1096) for 1, 5 or 20 minutes to determine any transient or stable recruitment of the

Gpr120-β-arrestin complex. The cells were then fixed and imaged via confocal microscopy.

Prior to ligand treatment IMBAT cells expressing β-arrestin-1-YFP exhibited a diffuse cytoplasmic and nuclear distribution consistent with its localization in other cell types.

Treatment with GW9508, TUG891 or TUG1096 stimulated a robust β-arrestin-1 recruitment from the cytoplasm to the plasma membrane and cytosolic vesicles, likely representing endosomes. This was evident following 1 minute of agonist treatment and persisted even after

20 minute stimulation for all ligands (Figure 8.4.1).

Cells expressing β-arrestin-2-YFP also exhibited a diffuse cytoplasmic localization prior to stimulation. The absence of protein in the nucleus is due to the known nuclear export signal in β-arrestin-2 (Wang et al., 2003). Treatment of IMBAT cells with GW9508, TUG891 or

TUG1096 yielded a small but visible recruitment, as evidenced by the vesicular localization of β -arrestin-2, that was also sustained following 20 minute of ligand stimulation. Overall these results may suggest that Gpr120 preferentially recruits β-arrestin-1 over β-arrestin-2

(Figure 8.4.2). Furthermore these results demonstrate that, although TUG1096 did not induce

214

any calcium response, IMBAT cells are responding to TUG1096 via recruitment of β- arrestins.

215

β-arrestin 1-YFP

1 min 5 min 20 min

GW9508

TUG891

TUG1096

Untreated

Figure 8.4.1: Gpr120 ligand-mediated recruitment of β-arrestin-1 in IMBAT cells. IMBAT cells were grown to confluence and transfected with YFP-tagged β-arrestin-1 plasmid for 72 hours. They were then treated with 100µM GW9508, 10µM TUG891 or 10µM TUG1096 for 1, 5 and 20 minutes. Another set was treated with DMSO and served as untreated control. The cells were then fixed in 4% paraformaldehyde (PFA). Images were taken with confocal microscopy. Each confocal image shown is a representative of 20 cells imaged per experiment (n=3). The multiple white dots represent recruited β-arrestin.

216

β-arrestin 2-YFP

1 min 5 min 20 min

GW9508

TUG891

TUG1096

Untreated

Figure 8.4.2: Gpr120 ligand-mediated recruitment of β-arrestin-2 in IMBAT cells. IMBAT cells were grown to confluence and transfected with YFP-tagged β-arrestin-2 plasmid for 72 hours. They were then treated with 100µM GW9508, 10µM TUG891 or 10µM TUG1096 for 1, 5 and 20 minutes. Another set was treated with DMSO and served as untreated control. The cells were then fixed in 4% paraformaldehyde (PFA). Images were taken with confocal microscopy. Each confocal image shown is a representative of 20 cells imaged per experiment (n=3). The multiple white dots represent recruited β-arrestin.

217

8.5 TUG1096 does not activate Gαs or Gαi signalling It was observed that GW9508 and TUG891, but not TUG1096 activated calcium signalling

(Figure 8.1 and 8.2), yet all ligands effectively recruited β-arrestins (Figure 8.4.1). To determine if TUG1096 may be activating distinct G-protein pathways, the potential of

Gpr120 ligands to activate (Gαs) or inhibit (Gαi) the cAMP pathway was assessed. IMBAT cells were serum-starved overnight and pre-treated with a phosphodiesterase inhibitor

(IBMX) for 5 min. The cells were then stimulated for 5 minutes with Gpr120 ligands

(GW9508, TUG891 and TUG1096) in the presence or absence of forskolin (a cAMP activator).

Following ligand treatment there was no change in the accumulation of cAMP caused by any of the ligands compared to the untreated control (Figure 8.6). Treatment of cells with forskolin increased cAMP levels, which combined with TUG891, caused a small but significant reduction in the forskolin-induced increase in cAMP levels (Figure 8.5). Neither

GW9508 nor TUG1096 induced any significant changes in the forskolin-induced cAMP accumulation. Therefore, TUG891 may exhibit some Gαi signalling activity. Importantly,

TUG1096 stimulation did not have any appreciable effect on increasing cAMP levels or decreasing forskolin-induced cAMP accumulation. These findings suggest that TUG1096 does not activate Gαs or Gαi signalling in brown adipocytes.

218

Figure 8.5 Ability of Gpr120 ligands to increase cAMP and /or inhibit forskolin-induced cAMP accumulation in undifferentiated IMBAT cells. Undifferentiated IMBAT cells were serum- starved overnight, pre-treated, with 500µM IBMX for 5min and then incubated with 100µM GW9508, 10µM TUG891 or 10µM TUG1096 for 5 minutes. Reactions were terminated by addition of 0.1 % HCl /Triton X- 100. cAMP levels were measured via ELISA (see methods). Protein concentrations were measured with BCA assay to normalize the cAMP concentrations. All relative cAMP levels are presented as mean ±SEM.

219

8.6 Effects of Gpr120 ligands on ERK activation

8.6.1 GW9508 stimulation causes ERK Phosphorylation in IMBAT cells Because GPCRs are known to stimulate ERK phosphorylation through a number of different pathways, and the Gpr120 ligands employed in this study exhibit potentially unique G- protein-dependent and independent (β-arrestin) signal responses, the ability of each ligand to activate ERK signalling response was assessed. Cultured undifferentiated and differentiated

IMBAT cells were serum-starved overnight and then treated with GW9508 over a 30-minute period. Western blot analysis was carried out to assess the phospho-ERK and total ERK levels in IMBAT cells treated with GW9508. The unstimulated cells served as the control.

In undifferentiated cells, GW9508 treatment induced an early (5 minute) and significant phosphorylation of ERK. This phosphorylation was however diminished after 10 minutes

(Figure 8.6.1A). When the IMBAT cells were fully differentiated, GW9508 stimulation also resulted in an early phosphorylation of ERK similar to the undifferentiated although much less robust than undifferentiated cells (Figure 8.6.1B).

220

A B

P-ERK1/2

ERK1/2

GAPDH

0 5 10 20 30 (min)

C D

P-ERK1/2

ERK1/2

GAPDH 0 5 10 20 30 (min)

Figure 8.6.1: GW9508 activates ERK1/2 signalling. Serum starved undifferentiated (A) and differentiated (B) IMBAT cells were treated for the time points indicated with 100μM GW9508 and cells lysed. MAPK activity was detected by Western blot using phospho-specific anti- ERK1/2 antibody (p-ERK 1/2). Expression levels of ERK were controlled using antibody directed against the total kinase population (ERK 1/2). Immunoblot images were taken with the Chemillumiscent imager and the densitometry was analysed with the ImageQuant TL software. (B) Fold increase in p-ERK/ERK of the levels observed following stimulation in the undifferentiated and (D) Fold increase in p-ERK/ERK of the levels observed following stimulation in the differentiated IMBAT). Relative intensity for each sample was calculated by normalizing its p-ERK to the corresponding control total-ERK. *P< 0.05, **P< 0.005. Error bars represent Mean ± SEM.

221

8.6.2 Treatment of IMBAT cells with TUG891 and TUG1096 activates ERK with distinct temporal profiles

Given the potential differences in upstream signals and downstream gene expression induced by the more selective Gpr120 ligands (TUG891 and TUG1096), these ligands were used to determine their potential to induce ERK phosphorylation. Undifferentiated IMBAT cells were serum-starved overnight and then stimulated with TUG891 or TUG1096 over a 30- minute period and samples were taken at various time points. Western blot analysis was carried out to assess the phospho-ERK and total ERK in the treated and untreated (control)

IMBAT cells.

Both compounds stimulated an early Gpr120-induced ERK activation of about 2 fold higher than the basal following 5 minutes of ligand treatment. However, TUG891 mediated ERK activation was reduced following 20 minutes treatment (Figure 8.6.2A and 8.6.2B), while stimulation with TUG1096 gave a significantly more sustained activation even after 30 minutes of ligand stimulation (Figure 8.6.4C and 8.6.4D). These results suggest that TUG891 and TUG1096, as compared to GW9508, induce distinct temporal profiles in ERK activation in IMBAT cells.

222

A B P-ERK1/2 ERK1/2

GAPDH

0 5 10 20 30 min

C D

P-ERK1/2

ERK1/2

GAPDH

0 5 10 20 30 min

Figure 8.6.2: TUG891 and TUG1096-mediated ERK1/2 activation. Serum starved undifferentiated IMBAT cells were treated for 30 minutes on a time course with 10μM TUG891 (A) or 10μM TUG1096 (C). Lysates were taken at 5, 10, 20, and 30 minutes. MAPK activity was detected by Western blot using phospho-specific anti-ERK1/2 antibody (p-ERK 1/2). Expression levels of ERK were controlled using antibody directed against the total kinase population (ERK 1/2). Immunoblot images were taken with the Chemillumiscent imager and the densitometry was analysed with the ImageQuant TL software. (B) Fold increase in p-ERK/ERK of the levels observed following stimulation with TUG891 and (D) Fold increase in p-ERK/ERK of the levels observed following stimulation with TUG1096 in the treated relative to the untreated (veh). Relative intensity for each sample was calculated by normalizing its p-ERK to the corresponding control total-ERK. *P< 0.05, **P< 0.005. Error bars represent Mean ± SEM.

223

8.7 Gpr120 agonists may activate multiple downstream signalling pathways in IMBAT cells GPCR-induced mitogenic signalling involves activation of a number of "mitogen activated protein kinases" (MAPK) (Gutkind, 1998) via, transactivatio of receptor tyrosine kinases

(Liebmann and Bohmer, 2000) or β-arrestin-dependent MAPK signalling. As distinct Gpr120 ligands stimulate differential signalling responses in IMBAT cells, a more comprehensive profiling of Gpr120 signalling was carried out, via a phospho-kinase array that can simultaneously detect the relative phosphorylation of 43 kinases. Cultured undifferentiated

IMBAT cells were serum-starved overnight and then stimulated with GW9508, TUG891 or

TUG1096. Cell lysates were collected after 5 minutes of treatment, noting that all three compounds had previously stimulated ERK activation at this time point (Figures 8.6.1 and

8.6.2). Levels of phosphorylated protein were then assessed using membranes spotted with the distinct phospho-specific antibodies (Figure 8.7A).

Kinases that exhibited responses following agonist activation are shown in Figure 8.8. All three agonists stimulated the activation of ERK1/2, although the TUG1096-induced effect was the lowest and possibly reflects that peak activation of ERK by this ligand is following

20 minutes stimulation (Figure 8.7.2). Only TUG891 stimulated a low level of activation of p38α. All three ligands stimulated activation of cyclic-AMP response element-binding protein (CREB), although the response induced by TUG1096 was weak. CREB is a cellular transcription factor that binds certain gene promoter element, cAMP response element’ thereby regulating the transcription of certain downstream genes. Stimulation with GW9508 or TUG891, but not TUG1096 increased levels of pAMPK. Epidermal growth factor receptor, EGFR, a member of the receptor tyrosine kinases, exhibited a small activation following TUG891 and TUG1096 stimulation. GW9508 and TUG891 stimulated a minor activation of Akt1/2/3. The Akt pathway is important in regulating cell cycle, and leads to cell survival by blocking apoptosis.

224

Untreated

TUG891

Relative intensity

Figure 8.7: Phospho-kinase array ‘hits’ following ligand-stimulated Gpr120 activation. (A) Representative blot showing ERK 1/2, AMPKα1 and CREB activation by TUG891 compared to untreated. (B) Relative intensity plot. Undifferentiated IMBAT cells were Serum- starved overnight and stimulated with 100µM GW9508, 10µM TUG891 or 10µM TUG1096 for 5 minutes and cell lysates were extracted and analysed using R & D systems Phospho Kinase array kit. Levels of phosphorylated proteins were then assessed using phospho-specific antibodies and images were taken with the aid of the chemiluminescent imager. Densitometry was calculated with Image J software.

225

8.8 Agonist stimulation of Gpr120 activates AMPK in the IMBAT cells The identification of AMPK as a signalling pathway activated by Gpr120 ligands in the phosphokinase-array was confirmed. AMPK was of interest as it is a sensor of cellular energy status, and a regulator of energy balance, and thus highly pertinent to brown adipocytes. It modulates multiple metabolic pathways including the cellular uptake of glucose, β-oxidation of fatty acids and the biogenesis of glucose transporter 4 in the mitochondria. It is also regulated by the adipokines, adiponectin and leptin, hormones that are secreted from adipocytes (Carling et al., 2008). Once activated, it switches on catabolic pathways that generate adenosine triphosphate (ATP), while switching off ATP-consuming anabolic processes. It is considered a key therapeutic target for the treatment of obesity, insulin resistance and cancer (Hardie, 2008; Sanz, 2008). Recent studies indicate that AMPK may not only influence metabolism in adipocytes, but also act to suppress this pro-inflammatory environment, such that targeting AMPK in adipose tissue may be desirable to normalize adipose dysfunction and inflammation.

Therefore, to investigate the ability of Gpr120 ligands to activate AMPK, cultured undifferentiated IMBAT cells were serum-starved overnight, and stimulated with GW9508 for 5, 10, 20 or 30 minutes, thereafter cells were lysed for Western blot analysis. Although there were technical issues with the AMPK antibodies used relating to sensitivity, preliminary results indicate an increase in GW9508-induced AMPK phosphorylation in the undifferentiated IMBAT cells, peaking at 20-30 minutes (Figure 8.8A). For cells treated with

TUG1096, AMPK activation occurred after 10 minutes of treatment and was decreased after

20 minutes of treatment (Figure 8.8B). However, stimulation with TUG891 did not cause any detectable activation (data not shown).

226

A P-AMPK

AMPK

Beta-Actin

0 5 10 20 30 min

P-AMPK

AMPK

Beta-Actin 0 5 10 20 30 min

Figure 8.8: Agonist-mediated AMPK activation. Serum starved undifferentiated IMBAT cells were treated for 30 minutes on a time course with 100μM GW9508 (A) or 10μM TUG1096 (B). Lysates were taken at 0, 5, 10, 20, and 30 minutes. AMPK activity was detected by Western blot using phospho-specific anti-AMPKα1 antibody (P-AMPK). Expression levels of AMPK were controlled using antibody directed against the total AMPK (AMPK). Immunoblot images were taken with the Chemillumiscent imager.

227

8.9 Role of Gαq/11 signalling in Gpr120 function

8.9.1 GW9508-induced ERK signalling is via Gαq/11 activation in IMBAT cells. Gpr120 is a known Gαq/11 coupled receptor, yet all three ligands stimulated calcium and

ERK activation in IMBAT cells with distinct profiles. Therefore the requirements for activation of Gαq/11 on ligand-induced ERK phosphorylation were determined.

Undifferentiated IMBAT cells were pre-treated with the Gαq/11 inhibitor UBO-QIC before being stimulated with GW9508. The result indicate that inhibition of Gαq/11 attenuated the

GW9508-induced ERK phosphorylation (Figure 8.9.1A), confirming that Gpr120 activation of ERK by GW9508 is via Gαq/11 –Ca2+ pathway.

In a similar experiment, IMBAT cells were stimulated with TUG891 or TUG1096 in the presence and absence of Gαq/11 inhibitor (UBO-QIC). The Gαq/11 inhibitor did not have any effect on the TUG891 or TUG1096-induced ERK phosphorylation (Figure 8.9.1B and

C), suggesting that the ERK signalling induced by these ligands is via a distinct mechanism from Gαq/11 signalling.

228

A P-ERK

ERK

GAPDH

100μM GW9508 - + + - 1μM UBO-QIC - - + +

B P-ERK C P-ERK

ERK ERK 10μM TUG891 - + + - 10μM TUG1096 - + + - 1μM UBO-QIC - - + + 1μM UBO-QIC - - + +

Figure 8.9.1: Gαq/11 inhibitor attenuates the GW9508-induced, but not TUG891 or TUG1096- induced Gpr120 ERK phosphorylation in IMBAT cells. Undifferentiated IMBAT cells were Serum- starved overnight and pre-treated with Gαq inhibitor (1µM UBO-QIC) for 2 hours prior to stimulation. The cells were then stimulated with 100µM GW9508 (A), 10µM TUG891 (B) or 10µM TUG1096 (C) for 5 minutes and cell lysates were extracted and analysed by Western blotting with antibodies against p-ERK, total- ERK.

229

8.9.2 Role of Gαq/11 inhibition on Gpr120-agonist induced gene signalling in IMBAT Considering the direct effect of UBO-QIC inhibition of GW9508 action on Gpr120-induced calcium and ERK signalling, the effects of Gαq/11 inhibition on ligand-induced gene expression of some key adipogenic genes was assessed. Undifferentiated WT IMBAT cells were pre-treated for 2 hours with UBO-QIC and stimulated for 5 days with GW9508, and the mRNA levels of Gpr120, aP2, Ucp1 and PPARγ were determined. UBO-QIC reduced the

GW9508 -induced expression of all four of the genes, although only the reduction by UBO-

QIC in aP2 and Gpr120 mRNA levels reached significance (Figure 8.9.2). This result suggests that GW9508-induced activation of Gpr120 induces Gαq signalling pathway that is required for modulation of adipogenic genes in brown adipocytes.

230

Figure 8.9.2: mRNA level of Gpr120, aP2, Ucp1, and PPARγ measured via q-RT-PCR in IMBAT cells. Undifferentiated IMBAT cells were treated for with 100µM GW9508 12 hourly for 5 days in the presence and absence of 1µM UBO QIC. Gene expression was normalized to β- actin and depicted with respect to the untreated. Result was from three independent experiments in duplicate. Error bar represent ± SEM (n=3) *p<0.05, **p<0.005.

231

8.9.3 Inhibition of Gαq/11 attenuates TUG1096-induced activation of Gpr120 and aP2 expression Although Gαq/11 activation is required for GW9508-induced gene expression in IMBAT cells, the effect of Gαq/11 inhibition was also assessed for TUG891- and TUG1096-induced gene expression in undifferentiated IMBAT cells. As neither compound induced an increase in Ucp1 or PPARγ following 5 days treatment (not shown), only Gpr120 and aP2 were assessed.

Unexpectedly, UBO-QIC significantly attenuated TUG1096-induced expression of Gpr120 and aP2 in undifferentiated WT IMBAT cells. However, pre-treatment with UBO-QIC did not seem to inhibit TUG891-induced Gpr120 expression (Figure 8.9.3). These results suggest that there may be a requirement for this G-protein signalling pathway in downstream gene expression of Gpr120.

232

Figure 8.9.3: mRNA expression levels of Gpr120 and aP2 in IMBAT cells. Undifferentiated IMBAT cells were treated for with 100µM GW9508, 10µM TUG891 and 10µM TUG1096 12 hourly for 5 days in the presence and absence of 1µM UBO QIC. Gene expression was normalized to β-actin and depicted with respect to the untreated. Result was from three independent experiments in duplicate (n=3). Error bar represent ± SEM. *p<0.05, **p<0.005.

233

8.10 Discussion It is now recognized that GPCRs interact with a myriad of proteins, and activate complex and diverse signalling pathways via both heterotrimeric G-protein-dependent and -independent mechanisms (Stallaert et al., 2011). Given that this project has identified that distinct Gpr120 ligands produce very distinct downstream cellular responses, the aim of this chapter was to identify the upstream pathways activated by these ligands.

Many GPCRs can trigger an increase in intracellular calcium levels via Gαq/11 activation of

PLC-β to produce the intracellular messengers, inositol trisphosphate (IP3) and diacylglycerol

(DAG). IP3 triggers the release of calcium from intracellular stores, and DAG recruits protein kinase C (PKC) to the membrane and activates it. Agonist-stimulated Gpr120 is known to couple to Gαq/11 leading to elevation in intracellular Ca2+concentration. Both GW9508 and

TUG891 induced calcium responses, consistent with reports in other cell systems.

Surprisingly, TUG1096, which is related structurally to TUG891, produced no evident rise in intracellular calcium. However, in HEK293 cells expressing human Gpr120 TUG1096 induces a calcium response (personal communication with Trond Ulven and independently acquired data not shown). These differences may thus reflect species-dependent responses to

TUG1096 by Gpr120. Furthermore, the Gαq/11-independent calcium signalling induced by

TUG891 indicates that additional G proteins may be activated by Gpr120. One possibility is that TUG891 activates a Gαi signalling pathway, the associated βγ subunits of which are able to stimulate PLC-β to increase intracellular calcium, and/or activate cell surface calcium channels and influx of extracellular calcium. The latter pathway may underlie the more robust and prolonged calcium responses observed with this compound.

234

It has become increasingly clear that GPCR signalling is not limited to G-protein coupling alone, but other mechanisms mediate its functional responses. GPCRs can engage multiple pathways to activate ERK1/2 via both G proteins and/or β-arrestin (Ahn et al., 2004). The potential for GPCRs to form complexes with signalling proteins other than G proteins also raises the possibility that different ligands can discriminate between these pathways. Gpr120 has been reported to signal also via the β-arrestin pathway in macrophages (Oh et al., 2010;

Talukdar et al., 2011). Thus, each downstream signalling pathway measured in a particular cell might have its own unique pharmacology depending on the pathway stimulated by each unique ligand–receptor conformation or complex involved (Baker and Hill, 2007).

All three ligands gave a robust β-arrestin-1 recruitment. Interestingly, β-arrestin-1 recruitment was seen within the first minute of activation. Other researchers have reported similar early recruitment of β-arrestin-1 to GPCR in other cell types (N'Diaye et al., 2008;

Puthenveedu and von Zastrow, 2006). However, recruitment of β-arrestin-2 was not as strong as that of β-arrestin-1, indicating preference of activated Gpr120 for β-arrestin-1 over β- arrestin-2. This is at variance with a prior classification of GPCRs to arrestin binding where

Class A receptors preferentially bind β-arrestin-2, whereas Class B receptors bind to both β- arrestin-1 and β-arrestin-2 with equal affinity and a sustained effect (Moden et al., 2013) that consequently impacts the temporal and spatial ERK activation induced by GPCR/β-arrestins.

The temporal profiles of ligand-induced ERK responses observed in this study also varied with the different ligands. ERK response to TUG1096 activation occurred later and was more sustained compared to GW9508. It has been reported that β-arrestin-mediated ERK activation is slower in onset and more sustained in duration, and it is sensitive to depletion of

β-arrestins but not inhibition or loss of G-protein signalling (Ebisuya et al., 2005). This is indicated from the rapid and transient GW9509-induced ERK response and inhibition by the

Gαq/11 inhibitor suggesting primary mechanism of ERK activation is G protein-mediated,

235

despite the efficient recruitment of β-arrestin1 by this ligand. In contrast the slow onset and more sustained ERK activation induced by TUG1096 in IMBAT cells, and that TUG1096 did not stimulate calcium response or exhibit Gαs or Gai signalling, suggests a primary arrestin- mediated ERK signalling pathway. Attempts to knockdown β-arrestin-1 and 2 in IMBAT cells, in order to measure arrestin-dependent signalling were however, unsuccessful. Thus the requirement of this adaptor protein on TUG1096 signalling in IMBAT cells remains to be determined. It is known that distinct ligands acting at a GPCR may show varying degrees of bias with respect to the potency and efficacy with which they may activate distinct heterotrimeric G-protein and β-arrestin signalling, including a complete or “perfect” bias toward the activation of the β-arrestin pathway (Southern et al., 2013). Likewise, this study suggests that TUG1096 may be acting as a biased agonist of Gpr120 to the β-arrestin pathway in IMBAT cells.

In terms of signalling, there is paucity of information on Gpr120 in brown adipocytes. To further elucidate the possible signalling pathways mediating Gpr120 function in brown adipocytes, a phosphokinase array was carried out and identified that Gpr120 activates

AMPK. All three ligands exhibited differential abilities to activate AMPK. AMPK plays a major role in energy balance by integrating signals in the periphery and central nervous system to regulate glucose and lipid metabolism, food intake and body weight. AMPK is thought to be expressed in all cell types but its expression is highest in tissues that regulate energy homeostasis (Hutchinson et al., 2008), such as brown adipose tissue, but its role in regulating the acute metabolic state and chronic thermogenic potential of BAT is unknown

(Towler and Hardie, 2007). Both LKB1 and Ca2+/calmodulin-dependent protein kinases have been identified to regulate AMPK, suggesting that they may be activated by stimuli that signal through second messengers which may occur even in the absence of increase in AMP

236

(regulation of AMPK by upstream kinases). From the standpoint of treating obesity and insulin resistance, Gpr120-ligand activation of AMPK appears to be an attractive target.

When considering both the upstream signalling pathways activated by the distinct ligands and their downstream effects on gene expression, GW9508 seems to primarily activate Gαq/11, as the Ca2+ response, ERK activation and gene expression are all sensitive to Gαq/11 inhibition. Although TUG891 activates similar pathways, the ability to induce expression of the same genes as GW9508 are considerably weaker. As suggested above one possibility for the differences in gene expression between GW9508 and TUG891 is that TUG891 signals via

Gαi, which may explain its lack of Gαq/11 inhibitor sensitivity for calcium and ERK signalling. Surprisingly, the increase in gene expression of Gpr120 and aP2 induced by

TUG1096 was sensitive to Gαq/11, even though this ligand did not induce a calcium signal response. It is therefore possible that TUG1096 induces a weak activation of Gαq/11, that is is not sufficient to result in a detectable calcium signal, but that this small activity is amplified downstream resulting in increases in these target genes. This may also underlie the less robust responses obtained with TUG1096, in terms of gene expression compared to

GW9508. Therefore it seems that the key pathway for switching on these genes is Gαq/11, and these distinct ligands have also been tools to potentially ‘unveil’ distinct and novel pathways of Gpr120 activation in brown adipocytes. Indeed, crystallographic and pharmacological studies indicate that an individual GPCR can exist in different active conformations that differ in their capacity to activate specific signalling pathways (Gonzalez-

Maeso and Sealfon, 2012). This complexity of GPCR signalling led to the concept of bias agonism, such that some agonists produce activation of some but not all available pathways

(Kenakin, 2009; Shukla et al., 2008). From this study it appears that all three Gpr120 ligands could be biased compounds, depending on the downstream readout. Such ligands are not only tools in understanding the multiple conformations that can be induced in Gpr120 and

237

consequent distinct signalling profiles that can be activated, but also may form the basis of identifying appropriate screening platforms for this receptor for future novel drugs targeted to this receptor in BAT.

238

Chapter 9

General Discussion

239

Discussion The prevalence of obesity and other metabolic diseases are increasing worldwide (Ng et al.,

2014), leading to serious health consequences for individuals and increased burden for the health care system as a whole. Since the recent identification of active BAT in adult human, and the discovery that adipose tissue can interconvert from one form to another depending on temperature changes, the anti-obesity and anti-diabetic role of BAT is of significant interest to researchers. While BAT has long been appreciated as an important player in cold defence in human infants, BAT thermogenesis was thought to be completely blunted during adulthood. Importantly, active BAT in humans appears to be negatively correlated with body mass index, body fat mass (Yoneshiro et al., 2013). Therefore, the potential to induce even a small amount of BAT to enhance energy homeostasis will be of significance in addressing obesity, and its associated complication.

Earlier, a microarray-based gene expression analysis of mice that had been exposed to cold for 10 days was carried out and a number of genes were identified to be regulated in a temperature-dependent manner. Nrg4 and Gpr120 were identified as two of the genes regulated following cold acclimation are highly expressed in BAT. Although adipocytes are the main cellular component of adipose tissue, there are other cell types present in the adipose tissue that constitute the stromal vascular fraction (SVF), which include precursor cells

(including pre-adipocytes), fibroblasts, vascular cells and immune cells, and these cells constitute the stromal vascular fraction of adipose tissue. Vascular cells include both endothelial cells and vascular smooth muscle cells, which are associated with the major blood vessels (Ouchi et al., 2011). It was therefore important to determine whether tissue expression of Nrg4 is due to expression in adipocytes rather than other cells. Nrg4 and

Gpr120 were expressed at low levels in brown adipocytes but these expressions were

240

significantly upregulated in mature adipocytes. Based on these expression patterns, Nrg4 and

Gpr120 were therefore selected for further study.

We found NRG4 protein to be secreted by brown adipocytes but not preadipocytes. Using

PC12 pheochromocytoma cells stably expressing the receptor for Nrg4 (HER4), we have been able to show for the first time that NRG4 is a BAT secreted adipokine (Rosell et al.,

2014b). Our finding that that brown adipocyte-secreted NRG4 promoted neurite formation supports a potential role in enhancing sympathetic nerve stimulation of BAT through β3-AR stimulation, which is essential for thermogenesis (Bartness et al., 2010a). The neurite- stimulating effect was specific to Nrg4 as neurite outgrowth was prevented in conditioned media from brown adipocytes in which Nrg4 was knocked down by shRNA interference.

This neurotropic role for Nrg4 is further supported by studies that reported Nrg1, a related member of the neuregulins family, affected the development of neuronal cells (Liu et al.,

2005; Wen et al., 2010).

Apart from Nrg4 that has been found to be secreted by BAT, there are other paracrine factors synthesized by BAT. These include nerve growth factor (NGF), vascular endothelia growth factor (VEGF), angiotensin and nitric oxide. NGF is also produced by cultured brown adipocytes with a potential role in adipocyte-neuronal communication and obesity (Nisoli et al., 1996). VEGF causes an increase in BAT thermogenesis, and promotes the browning of

WAT (Xue et al., 2009). Angiotensin has a regulatory role in obesity-induced hypertension

(Cassis et al., 2008). However, the action of Ngr4 is not restricted to adipocyte-neuronal signalling. A recent study has reported that Nrg4 is involved in endocrine and other paracrine functions affecting lipid metabolism in the liver, by autonomously attenuating de novo lipogenesis in hepatocytes, and its deficiency exacerbated diet-induced obesity (Wang et al.,

2014). Future studies will be directed towards the use of Nrg4 as a potential therapeutic new

241

player for treating obesity, and its associated metabolic disorders through it interaction with other tissues.

Gpr120 had been identified as a lipid sensor expressed in macrophages and mature adipocytes, and having anti-inflammatory anti diabetic effects (Oh et al., 2010). Our results suggest that Gpr120 regulates adipogenic processes such as adipocyte development and differentiation. Investigating the downstream signalling effects of Gpr120 activation showed that Gpr120 activation generated diverse signalling effects induced by the same agonist. ERK has been shown to have a diverse range of substrates as it can translocate to the nucleus and phosphorylate transcription factors or it can regulate the activity of other cytoplasmic protein kinases (Roux and Blenis, 2004).

It has become increasingly clear that Gpr120 signalling is not limited to G-protein coupling, and agonist-induced activation of Gpr120 is a complex process, which may involve integration of different signalling pathways (Zhang and Leung, 2014). In search for specific pharmacological activators of Gpr120, three different ligands, GW9508, TUG891 and

TUG1096, were tested. Although all three ligands activated Gpr120, they all showed various levels of bias towards the receptor. Other studies have reported this type of molecular bias with TUG891-induced Gpr120 activation (Hudson et al., 2014). In this study, the use of

TUG1096 to activate the receptor has further defined the diverse signalling function of

Gpr120.

Alterations in cellular calcium homeostasis are widely employed as a potent regulatory mechanism that modulates many functionally distinct physiologic processes (Wolf et al.,

1997). While TUG1096 did not induce any calcium signalling response, it activated downstream ERK signalling, and a robust β-arrestin recruitment. This effect by TUG1096 might have occurred through pathway interaction (Puckerin et al., 2006). This is the first

242

study in which agonist activities have been assessed on Calcium, cAMP and β-arrestin signalling events within the IMBAT cell system. The same agonist can activate different signalling cascades upon binding to Gpr120. In addition to coupling to Gαq/11, Gpr120 couples to β-arrestin and both pathways mediate Gpr120-dependent ERK activation. Profiling

Gpr120 signalling pathways and their downstream roles in IMBAT cells showed that

TUG891 and TUG1096 activate ERK with distinct temporal profiles.

One GPCR can signal through multiple different downstream pathways, by either signalling through G-proteins, signalling through β-arrestin or direct signalling through receptor associated kinases (Ritter and Hall, 2009). The signalling and trafficking properties of

GPCRs are often highly malleable depending on the cellular context (Ritter and Hall, 2009).

Distinct GPCR conformations induced or stabilized by ligands can differentially recruit and interact with different cellular effectors to elicit specific signalling cascades (Eishingdrelo and Kongsamut, 2013). Thus, ligand binding to GPCRs might initiate a second wave of signalling and represent a novel mechanism of GPCR signal transduction. There is also a cross-talk between GPCRs. One such mechanism is the heterologous desensitisation, which involves the activation of one GPCR to generate a signal that causes inhibition of signalling by a second, heterologous GPCR mediated via phosphorylation by G protein coupled receptor kinases or PKA and PKC (Bunemann and Hosey, 1999).

Gpr120 agonists may activate multiple downstream signalling pathways in IMBAT cells.

Based on our data, GW9508, TUG891 and TUG1096, all demonstrated various levels of bias agonism to Gpr120. Although GW9508 appeared to have activated more pathways, it is however not a specific ligand for Gpr120. TUG891 demonstrated the least effect on gene expression following Gpr120 activated, although had robust calcium effects, and it is reported to activate both mouse and human Gpr120 (Hudson et al., 2013). Activation of Gpr120 by

TUG1096 resulted in significant gene expression changes and showed more β-arrestin

243

response as well as response to PPARγ regulation. Considering all these effects, TUG1096 appears to be a candidate that should be exploited further. Exploiting biased ligands for therapeutic benefit represents a promising opportunity to develop safer and more efficacious drugs, as there is often a cross talk between signalling pathways (Siso-Nadal et al., 2009).

Since many of the functionally beneficial physiological effects of Gpr120 are noted to be β- arrestin-mediated (Burns et al., 2014), these findings could provide insight into the structural requirements for agonist-induced Gpr120 function.

In assessing the impact of loss of Gpr120 in BAT on gene expression changes, a microarray analysis was carried out to determine the genes regulated by Gpr120 knockout in BAT. We demonstrated that Gpr120 KO BAT showed increase in the expression of inflammatory gene markers, reduced lipolytic and lipogenic gene markers and reduced expression of genes involved in glucose metabolism. Since FFAs can promote adipogenesis in adipose tissue by activating Gpr120 (Zhang and Leung, 2014), dysfunction of Gpr120 may lead to a failure of adipocyte differentiation in adipose, resulting in lipid accumulation in the liver and tissues

This finding is supported by a study that reported that dysfunction of Gpr120 has been shown to result in obesity in both mice and humans (Ichimura et al., 2012b). The pharmacological properties of Gpr120 ligands were further characterized by assessing their agonist-induced effects on Gpr120 heterozygous and knockout cells. Treatment of brown adipocytes with

Gpr120 agonists induced differential effects on activation of metabolic gene expression, and on the expression of differentiation markers, with expression of metabolic marker reduced in the Gpr120 KO cells. Therefore both at the tissue and at the cellular levels, dysfunction of

Gpr120 lead to increased inflammation and metabolic disorders.

Although all Gpr120 agonist induced differential amount of lipid droplets in IMBAT cells only GW9508-induced lipid droplet formation showed a higher amount in Het cells as compared to the KO cells. These findings suggest that brown adipocyte differentiation can be

244

regulated by stimulation with GW9508 and TUG1096, and while GW9508 can stimulate early induction of brown adipocyte differentiation, TUG1096 is involved in the late stage of differentiation. As Gpr120 was induced during differentiation, we also reasoned that PPARγ could be central to its transcriptional region. PPARγ ligands induced it expression which was blocked by antagonists. This action was specific for PPARγ as other PPAR ligands had little or no effect.

Gpr120 may have a role in the regulation of metabolism through it effect on the expression both lipogenic and lipolytic genes in BAT. Adipose tissue inflammation impairs insulin sensitivity and metabolic homeostasis in part through augmented proinflammatory cytokine signalling (Osborn and Olefsky, 2012). Although our data showed that Gpr120 is highly expressed in mature brown adipocytes, Gpr120 is also expressed in other cell type within

BAT. Gpr120 activation has been shown to produce anti-inflammatory effects in macrophages by repressing the activation of toll-like receptor 4-induced NF-κB signalling, which can inhibit downstream pro-inflammatory cascades like IL-6 (Zhang and Leung,

2014). Apart from its effects in adipose tissue, Gpr120 activation also affects other tissue.

Gpr120 activation may promote pancreatic β-cells survival and proliferation, and stimulation of insulin (Whalley et al., 2011). It is expressed in the stomach where it is involved in the inhibition of gastric hormone ghrelin, in the taste buds where it is involved in lipid sensing. In the skeletal muscle, Gpr120 is expressed at moderate levels where it functions to enhance insulin sensitivity by exerting anti-inflammatory effects (Zhang and Leung, 2014). Having determined the effects of Gpr120 ligands in cultured adipocyte, the next stage is to explore the ability of these ligands to stimulate similar effects in vivo. It has been reported that

GW9508 and TUG891 stimulated Gpr120-induced anti-inflammatory and anti-diabetic effects in mice (Hudson et al., 2014; Oh da et al., 2014). Future work will therefore include testing this effect using TUG1096. This can be used to investigate BAT-specific role for

245

Gpr120 by treating Gpr120 KO mice and WT littermates with this specific ligand, and determine the gene expression changes that follow. Also in vivo metabolic studies will be evaluated with this ligand.

GPCRs are among the most heavily investigated drug targets in the pharmaceutical industry, and in my views, it will remain at the hub of drug discovery activities for the foreseeable future. There are still a lot of questions about how GPCRs work and how they can be selectively activated. Because of the complexity and diversification in the function of these receptors, there may not be an easy path to the development of novel GPCR-targeted drugs.

However, since the discovery of the phenomenon of biased agonism, there is a need for a paradigm shift towards agents that will preferentially activate a particular pathway. Certainly there are many researches looking at the role of GPCRs in obesity (Bjenning et al., 2004).

But clearly, based on our findings, BAT is a definitive tissue-type important to target for some therapeutic benefits and the Gpr120 expressed in it is a unique heterodimer within BAT

(Holliday et al., 2011). Future researches will therefore be directed towards probing more deeply into the functional activity of compounds that will selectively activate Gpr120 function in BAT.

GPCRs also transactivate cell surface transmembrane kinase receptors of protein tyrosine kinase and protein serine/threonine kinase families, such as the epidermal growth factor receptor (EGFR) and transforming growth factor-β (TGF-β) (Cattaneo et al., 2014), expanding the role of GPCRs in physiology and pathology. Since Nrg4 and Gpr120, are both highly expressed in BAT and regulated in a temperature-dependent manner, and regulated by

PPARγ network, they appear to share some common cellular effects. The possibility of

Gpr120-HER4 transactivation could therefore be explored for future work.

246

References

Ahn, S., Shenoy, S.K., Wei, H., and Lefkowitz, R.J. (2004). Differential kinetic and spatial patterns of beta-arrestin and G protein-mediated ERK activation by the angiotensin II receptor. J Biol Chem 279, 35518-35525.

Almind, K., Manieri, M., Sivitz, W.I., Cinti, S., and Kahn, C.R. (2007). Ectopic brown adipose tissue in muscle provides a mechanism for differences in risk of metabolic syndrome in mice. Proc Natl Acad Sci U S A 104, 2366-2371.

Bachman, E.S., Dhillon, H., Zhang, C.Y., Cinti, S., Bianco, A.C., Kobilka, B.K., and Lowell, B.B. (2002). betaAR signaling required for diet-induced thermogenesis and obesity resistance. Science 297, 843-845.

Bag, S., Ramaiah, S., and Anbarasu, A. (2015). fabp4 is central to eight obesity associated genes: A functional gene network-based polymorphic study. J Theor Biol 364, 344-354.

Baker, J.G., and Hill, S.J. (2007). Multiple GPCR conformations and signalling pathways: implications for antagonist affinity estimates. Trends Pharmacol Sci 28, 374-381.

Barbatelli, G., Murano, I., Madsen, L., Hao, Q., Jimenez, M., Kristiansen, K., Giacobino, J.P., De Matteis, R., and Cinti, S. (2010). The emergence of cold-induced brown adipocytes in mouse white fat depots is determined predominantly by white to brown adipocyte transdifferentiation. Am J Physiol Endocrinol Metab 298, E1244-1253.

Bartness, T.J., Shrestha, Y.B., Vaughan, C.H., Schwartz, G.J., and Song, C.K. (2010a). Sensory and sympathetic nervous system control of white adipose tissue lipolysis. Mol Cell Endocrinol 318, 34-43.

Bartness, T.J., and Song, C.K. (2007). Thematic review series: adipocyte biology. Sympathetic and sensory innervation of white adipose tissue. J Lipid Res 48, 1655-1672.

Bartness, T.J., Vaughan, C.H., and Song, C.K. (2010b). Sympathetic and sensory innervation of brown adipose tissue. Int J Obes (Lond) 34 Suppl 1, S36-42.

Bastard, J.P., Jardel, C., Delattre, J., Hainque, B., Bruckert, E., and Oberlin, F. (1999). Evidence for a link between adipose tissue interleukin-6 content and serum C-reactive protein concentrations in obese subjects. Circulation 99, 2221-2222.

Belcheva, M.M., and Coscia, C.J. (2002). Diversity of G protein-coupled receptor signaling pathways to ERK/MAP kinase. Neurosignals 11, 34-44.

Bengtsson, T., Cannon, B., and Nedergaard, J. (2000). Differential adrenergic regulation of the gene expression of the beta-adrenoceptor subtypes beta(1), beta(2) and beta(3) in brown adipocytes. Biochemical Journal 347, 643-651.

Berg, A.H., and Scherer, P.E. (2005). Adipose tissue, inflammation, and cardiovascular disease. Circ Res 96, 939-949.

247

Billon, N., Monteiro, M.C., and Dani, C. (2008). Developmental origin of adipocytes: new insights into a pending question. Biol Cell 100, 563-575.

Bjarnadottir, T.K., Gloriam, D.E., Hellstrand, S.H., Kristiansson, H., Fredriksson, R., and Schioth, H.B. (2006). Comprehensive repertoire and phylogenetic analysis of the G protein- coupled receptors in human and mouse. Genomics 88, 263-273.

Bjenning, C., Al-Shamma, H., Thomsen, W., Leonard, J., and Behan, D. (2004). G protein- coupled receptors as therapeutic targets for obesity and type 2 diabetes. Curr Opin Investig Drugs 5, 1051-1062.

Bostrom, P., Wu, J., Jedrychowski, M.P., Korde, A., Ye, L., Lo, J.C., Rasbach, K.A., Bostrom, E.A., Choi, J.H., Long, J.Z., et al. (2012). A PGC1-alpha-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature 481, 463-468.

Briscoe, C.P., Peat, A.J., McKeown, S.C., Corbett, D.F., Goetz, A.S., Littleton, T.R., McCoy, D.C., Kenakin, T.P., Andrews, J.L., Ammala, C., et al. (2006a). Pharmacological regulation of insulin secretion in MIN6 cells through the fatty acid receptor GPR40: identification of agonist and antagonist small molecules. Br J Pharmacol 148, 619-628.

Briscoe, C.P., Peat, A.J., McKeown, S.C., Corbett, D.F., Goetz, A.S., Littleton, T.R., McCoy, D.C., Kenakin, T.P., Andrews, J.L., Ammala, C., et al. (2006b). Pharmacological regulation of insulin secretion in MIN6 cells through the fatty acid receptor GPR40: identification of agonist and antagonist small molecules. British journal of pharmacology 148, 619-628.

Brondani, L.A., Assmann, T.S., Duarte, G.C., Gross, J.L., Canani, L.H., and Crispim, D. (2012). The role of the uncoupling protein 1 (UCP1) on the development of obesity and type 2 diabetes mellitus. Arquivos brasileiros de endocrinologia e metabologia 56, 215-225.

Bunemann, M., and Hosey, M.M. (1999). G-protein coupled receptor kinases as modulators of G-protein signalling. J Physiol-London 517, 5-23.

Burns, R.N., Singh, M., Senatorov, I.S., and Moniri, N.H. (2014). Mechanisms of homologous and heterologous phosphorylation of FFA receptor 4 (GPR120): GRK6 and PKC mediate phosphorylation of Thr(3)(4)(7), Ser(3)(5)(0), and Ser(3)(5)(7) in the C- terminal tail. Biochem Pharmacol 87, 650-659.

Cannon, B., Houstek, J., and Nedergaard, J. (1998). Brown adipose tissue. More than an effector of thermogenesis? Ann N Y Acad Sci 856, 171-187.

Cannon, B., and Nedergaard, J. (2004). Brown adipose tissue: function and physiological significance. Physiol Rev 84, 277-359.

Cao, L., Choi, E.Y., Liu, X., Martin, A., Wang, C., Xu, X., and During, M.J. (2011). White to brown fat phenotypic switch induced by genetic and environmental activation of a hypothalamic-adipocyte axis. Cell Metab 14, 324-338.

Carling, D., Sanders, M.J., and Woods, A. (2008). The regulation of AMP-activated protein kinase by upstream kinases. Int J Obes (Lond) 32 Suppl 4, S55-59.

248

Cassis, L.A., Police, S.B., Yiannikouris, F., and Thatcher, S.E. (2008). Local adipose tissue renin-angiotensin system. Curr Hypertens Rep 10, 93-98.

Cattaneo, F., Guerra, G., Parisi, M., De Marinis, M., Tafuri, D., Cinelli, M., and Ammendola, R. (2014). Cell-surface receptors transactivation mediated by g protein-coupled receptors. International journal of molecular sciences 15, 19700-19728.

Chainani-Wu, N., Weidner, G., Purnell, D.M., Frenda, S., Merritt-Worden, T., Kemp, C., Kersh, E., and Ornish, D. (2010). Relation of B-type natriuretic peptide levels to body mass index after comprehensive lifestyle changes. Am J Cardiol 105, 1570-1576.

Chamoun, Z., Vacca, F., Parton, R.G., and Gruenberg, J. (2013). PNPLA3/adiponutrin functions in lipid droplet formation. Biol Cell 105, 219-233.

Chartoumpekis, D.V., Habeos, I.G., Ziros, P.G., Psyrogiannis, A.I., Kyriazopoulou, V.E., and Papavassiliou, A.G. (2011). Brown adipose tissue responds to cold and adrenergic stimulation by induction of FGF21. Mol Med 17, 736-740.

Chaudhry, A., and Granneman, J.G. (1999). Differential regulation of functional responses by beta-adrenergic receptor subtypes in brown adipocytes. Am J Physiol-Reg I 277, R147-R153. Chaves, V.E., Frasson, D., and Kawashita, N.H. (2011). Several agents and pathways regulate lipolysis in adipocytes. Biochimie 93, 1631-1640.

Chondronikola, M., Volpi, E., Borsheim, E., Porter, C., Annamalai, P., Enerback, S., Lidell, M.E., Saraf, M.K., Labbe, S.M., Hurren, N.M., et al. (2014). Brown adipose tissue improves whole-body glucose homeostasis and insulin sensitivity in humans. Diabetes 63, 4089-4099.

Chung, S., Funakoshi, T., and Civelli, O. (2008). Orphan GPCR research. Br J Pharmacol 153 Suppl 1, S339-346.

Cinti, S. (2005). The adipose organ. Prostag Leukotr Ess 73, 9-15.

Cinti, S., Barbatelli, G., Murano, I., Madsen, L., Hao, Q., Jimenez, M., Kristiansen, K., Giacobino, J.P., and De Matteis, R. (2010). The emergence of cold-induced brown adipocytes in mouse white fat depots is determined predominantly by white to brown adipocyte transdifferentiation. Am J Physiol-Endoc M 298, E1244-E1253.

Cinti, S., Cancello, R., Zingaretti, M.C., Ceresi, E., De Matteis, R., Giordano, A., Himms- Hagen, J., and Ricquier, D. (2002). CL316,243 and cold stress induce heterogeneous expression of UCP1 mRNA and protein in rodent brown adipocytes. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society 50, 21-31.

Coelho, M., Oliveira, T., and Fernandes, R. (2013). Biochemistry of adipose tissue: an endocrine organ. Archives of medical science : AMS 9, 191-200.

Collins, S., Yehuda-Shnaidman, E., and Wang, H. (2010). Positive and negative control of Ucp1 gene transcription and the role of beta-adrenergic signaling networks. Int J Obesity 34, S28-S33.

249

Cousin, B., Cinti, S., Morroni, M., Raimbault, S., Ricquier, D., Penicaud, L., and Casteilla, L. (1992). Occurrence of brown adipocytes in rat white adipose tissue: molecular and morphological characterization. J Cell Sci 103 ( Pt 4), 931-942.

Cypess, A.M., Lehman, S., Williams, G., Tal, I., Rodman, D., Goldfine, A.B., Kuo, F.C., Palmer, E.L., Tseng, Y., Doria, A., et al. (2009). Identification and Importance of Brown Adipose Tissue in Adult Humans. New Engl J Med 360, 1509-1517.

Dalgaard, L.T., and Pedersen, O. (2001). Uncoupling proteins: functional characteristics and role in the pathogenesis of obesity and Type II diabetes. Diabetologia 44, 946-965.

Das, K.P., Freudenrich, T.M., and Mundy, W.R. (2004). Assessment of PC12 cell differentiation and neurite growth: a comparison of morphological and neurochemical measures. Neurotoxicology and teratology 26, 397-406. de Souza, C.J., and Burkey, B.F. (2001). Beta(3)-adrenoceptor agonists as anti-diabetic and anti-obesity drugs in humans. Curr Pharm Design 7, 1433-1449.

Degerman, E., Resjo, S., Landstrom, T.R., and Manganiello, V. (2001). Methods to study phosphorylation and activation of the hormone-sensitive adipocyte phosphodiesterase type 3B in rat adipocytes. Methods Mol Biol 155, 167-180.

Deiuliis, J.A., Liu, L.-F., Belury, M.A., Rim, J.S., Shin, S., and Lee, K. (2010). Beta(3)- adrenergic signaling acutely down regulates adipose triglyceride lipase in brown adipocytes. Lipids 45, 479-489.

Derosa, G., and Maffioli, P. (2012). Anti-obesity drugs: a review about their effects and their safety. Expert Opin Drug Saf 11, 459-471.

Deshmane, S.L., Kremlev, S., Amini, S., and Sawaya, B.E. (2009). Monocyte chemoattractant protein-1 (MCP-1): an overview. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 29, 313- 326.

Diaz, M.B., Herzig, S., and Vegiopoulos, A. (2014). Thermogenic adipocytes: from cells to physiology and medicine. Metabolism: clinical and experimental 63, 1238-1249.

Djouder, N., Tuerk, R.D., Suter, M., Salvioni, P., Thali, R.F., Scholz, R., Vaahtomeri, K., Auchli, Y., Rechsteiner, H., Brunisholz, R.A., et al. (2010). PKA phosphorylates and inactivates AMPKalpha to promote efficient lipolysis. Embo J 29, 469-481.

Dorsam, R.T., and Gutkind, J.S. (2007). G-protein-coupled receptors and cancer. Nature reviews Cancer 7, 79-94.

Drake, M.T., Shenoy, S.K., and Lefkowitz, R.J. (2006). Trafficking of G protein-coupled receptors. Circ Res 99, 570-582.

Du, P., Kibbe, W.A., and Lin, S.M. (2007). nuID: a universal naming scheme of oligonucleotides for illumina, affymetrix, and other microarrays. Biology direct 2, 16.

250

Du, P., Kibbe, W.A., and Lin, S.M. (2008). lumi: a pipeline for processing Illumina microarray. Bioinformatics 24, 1547-1548.

Duncan, R.E., Ahmadian, M., Jaworski, K., Sarkadi-Nagy, E., and Sul, H.S. (2007). Regulation of lipolysis in adipocytes. Annual review of nutrition 27, 79-101.

Dunn, T.N., Akiyama, T., Lee, H.W., Kim, J.B., Knotts, T.A., Smith, S.R., Sears, D.D., Carstens, E., and Adams, S.H. (2015). Evaluation of the Synuclein-gamma (SNCG) Gene as a PPARgamma Target in Murine Adipocytes, Dorsal Root Ganglia Somatosensory Neurons, and Human Adipose Tissue. PLoS One 10, e0115830.

Ebisuya, M., Kondoh, K., and Nishida, E. (2005). The duration, magnitude and compartmentalization of ERK MAP kinase activity: mechanisms for providing signaling specificity. J Cell Sci 118, 2997-3002.

Eishingdrelo, H., and Kongsamut, S. (2013). Minireview: Targeting GPCR Activated ERK Pathways for Drug Discovery. Current chemical genomics and translational medicine 7, 9-15.

Ellis, J.M., Li, L.O., Wu, P.-C., Koves, T.R., Ilkayeva, O., Stevens, R.D., Watkins, S.M., Muoio, D.M., and Coleman, R.A. (2010). Adipose acyl-CoA synthetase-1 directs fatty acids toward beta-oxidation and is required for cold thermogenesis. Cell Metab 12, 53-64.

Falls, D.L. (2003). Neuregulins: functions, forms, and signaling strategies. Exp Cell Res 284, 14-30.

Farmer, S.R. (2006). Transcriptional control of adipocyte formation. Cell Metab 4, 263-273.

Farmer, S.R. (2008). Molecular determinants of brown adipocyte formation and function. Genes & development 22, 1269-1275.

Feldmann, H.M., Golozoubova, V., Cannon, B., and Nedergaard, J. (2009). UCP1 Ablation Induces Obesity and Abolishes Diet-induced Thermogenesis in Mice Exempt from Thermal Stress by Living at Thermoneutrality. Cell Metab 9, 203-209.

Fenzl, A., and Kiefer, F.W. (2014). Brown adipose tissue and thermogenesis. Hormone molecular biology and clinical investigation 19, 25-37.

Finck, B.N., and Kelly, D.P. (2007). Peroxisome proliferator-activated receptor gamma coactivator-1 (PGC-1) regulatory cascade in cardiac physiology and disease. Circulation 115, 2540-2548.

Floyd, Z.E., and Stephens, J.M. (2012). Controlling a master switch of adipocyte development and insulin sensitivity: Covalent modifications of PPAR gamma. Bba-Mol Basis Dis 1822, 1090-1095.

Fredriksson, R., Hoglund, P.J., Gloriam, D.E.I., Lagerstrom, M.C., and Schioth, H.B. (2003). Seven evolutionarily conserved human rhodopsin G protein-coupled receptors lacking close relatives. FEBS Lett 554, 381-388.

251

Frontini, A., Vitali, A., Perugini, J., Murano, I., Romiti, C., Ricquier, D., Guerrieri, M., and Cinti, S. (2013). White-to-brown transdifferentiation of omental adipocytes in patients affected by pheochromocytoma. Biochim Biophys Acta 1831, 950-959.

Fukunaga, S.i., Setoguchi, S., Hirasawa, A., and Tsujimoto, G. (2006). Monitoring ligand- mediated internalization of G protein-coupled receptor as a novel pharmacological approach. Life Sci 80, 17-23.

Galindo, M.M., Voigt, N., Stein, J., van Lengerich, J., Raguse, J.D., Hofmann, T., Meyerhof, W., and Behrens, M. (2012). G protein-coupled receptors in human fat taste perception. Chemical senses 37, 123-139.

Gee, K.R., Brown, K.A., Chen, W.N., Bishop-Stewart, J., Gray, D., and Johnson, I. (2000). Chemical and physiological characterization of fluo-4 Ca(2+)-indicator dyes. Cell calcium 27, 97-106.

Germack, R., Starzec, A., and Perret, G.Y. (2000). Regulation of beta(1)- and beta(3)- adrenergic agonist-stimulated lipolytic response in hyperthyroid and hypothyroid rat white adipocytes. Br J Pharmacol 129, 448-456.

Gesta, S., Tseng, Y.H., and Kahn, C.R. (2007). Developmental origin of fat: Tracking obesity to its source. Cell 131, 242-256.

Gonzalez-Maeso, J., and Sealfon, S.C. (2012). Functional selectivity in GPCR heterocomplexes. Mini reviews in medicinal chemistry 12, 851-855.

Gotoh, C., Hong, Y.-H., Iga, T., Hishikawa, D., Suzuki, Y., Song, S.-H., Choi, K.-C., Adachi, T., Hirasawa, A., Tsujimoto, G., et al. (2007a). The regulation of adipogenesis through GPR120. Biochem Biophys Res Commun 354, 591-597.

Gotoh, C., Hong, Y.H., Iga, T., Hishikawa, D., Suzuki, Y., Song, S.H., Choi, K.C., Adachi, T., Hirasawa, A., Tsujimoto, G., et al. (2007b). The regulation of adipogenesis through GPR120. Biochem Biophys Res Commun 354, 591-597.

Gray, S.L., Dalla Nora, E., Backlund, E.C., Manieri, M., Virtue, S., Noland, R.C., O'Rahilly, S., Cortright, R.N., Cinti, S., Cannon, B., et al. (2006). Decreased brown adipocyte recruitment and thermogenic capacity in mice with impaired peroxisome proliferator- activated receptor (P465L PPARgamma) function. Endocrinology 147, 5708-5714.

Greene, L.A., and Tischler, A.S. (1976). Establishment of a Noradrenergic Clonal Line of Rat Adrenal Pheochromocytoma Cells Which Respond to Nerve Growth-Factor. P Natl Acad Sci USA 73, 2424-2428.

Gutierrez-Juarez, R., Pocai, A., Mulas, C., Ono, H., Bhanot, S., Monia, B.P., and Rossetti, L. (2006). Critical role of stearoyl-CoA desaturase-1 (SCD1) in the onset of diet-induced hepatic insulin resistance. J Clin Invest 116, 1686-1695.

Gutkind, J.S. (1998). The pathways connecting G protein-coupled receptors to the nucleus through divergent mitogen-activated protein kinase cascades. Journal of Biological Chemistry 273, 1839-1842.

252

Haemmerle, G., Lass, A., Zimmermann, R., Gorkiewicz, G., Meyer, C., Rozman, J., Heldmaier, G., Maier, R., Theussl, C., Eder, S., et al. (2006). Defective lipolysis and altered energy metabolism in mice lacking adipose triglyceride lipase. Science 312, 734-737.

Hallberg, M., Morganstein, D.L., Kiskinis, E., Shah, K., Kralli, A., Dilworth, S.M., White, R., Parker, M.G., and Christian, M. (2008). A functional interaction between RIP140 and PGC-1alpha regulates the expression of the lipid droplet protein CIDEA. Mol Cell Biol 28, 6785-6795.

Hansen, J.B., and Kristiansen, K. (2006). Regulatory circuits controlling white versus brown adipocyte differentiation. Biochem J 398, 153-168.

Hanyaloglu, A.C., and von Zastrow, M. (2008). Regulation of GPCRs by Endocytic membrane trafficking and its potential implications. Annu Rev Pharmacol 48, 537-568.

Harari, D., Tzahar, E., Romano, J., Shelly, M., Pierce, J.H., Andrews, G.C., and Yarden, Y. (1999). Neuregulin-4: a novel growth factor that acts through the ErbB-4 receptor tyrosine kinase. Oncogene 18, 2681-2689.

Hardie, D.G. (2008). AMPK: a key regulator of energy balance in the single cell and the whole organism. Int J Obes (Lond) 32 Suppl 4, S7-12.

Harms, M., and Seale, P. (2013). Brown and beige fat: development, function and therapeutic potential. Nat Med 19, 1252-1263.

Hayes, N.V., Blackburn, E., Smart, L.V., Boyle, M.M., Russell, G.A., Frost, T.M., Morgan, B.J., Baines, A.J., and Gullick, W.J. (2007). Identification and characterization of novel spliced variants of neuregulin 4 in prostate cancer. Clinical cancer research : an official journal of the American Association for Cancer Research 13, 3147-3155.

Hayes, N.V., Newsam, R.J., Baines, A.J., and Gullick, W.J. (2008). Characterization of the cell membrane-associated products of the Neuregulin 4 gene. Oncogene 27, 715-720.

Herrera, B.M., Keildson, S., and Lindgren, C.M. (2011). Genetics and epigenetics of obesity. Maturitas 69, 41-49.

Herzig, S., Long, F.X., Jhala, U.S., Hedrick, S., Quinn, R., Bauer, A., Rudolph, D., Schutz, G., Yoon, C., Puigserver, P., et al. (2001). CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413, 179-183.

Himms-Hagen, J. (2001). Does brown adipose tissue (BAT) have a role in the physiology or treatment of human obesity? Rev Endocr Metab Disord 2, 395-401.

Himms-Hagen, J., Melnyk, A., Zingaretti, M.C., Ceresi, E., Barbatelli, G., and Cinti, S. (2000). Multilocular fat cells in WAT of CL-316243-treated rats derive directly from white adipocytes. American journal of physiology Cell physiology 279, C670-681.

Hirasawa, A., Tsumaya, K., Awaji, T., Katsuma, S., Adachi, T., Yamada, M., Sugimoto, Y., Miyazaki, S., and Tsujimoto, G. (2005). Free fatty acids regulate gut incretin glucagon-like peptide-1 secretion through GPR120. Nat Med 11, 90-94.

253

Holliday, N.D., Watson, S.-J., and Brown, A.J.H. (2011). Drug discovery opportunities and challenges at g protein coupled receptors for long chain free Fatty acids. Frontiers in endocrinology 2, 112.

Holstila, M., Virtanen, K.A., Gronroos, T.J., Laine, J., Lepomaki, V., Saunavaara, J., Lisinen, I., Komu, M., Hannukainen, L.C., Nuutila, P., et al. (2013). Measurement of brown adipose tissue mass using a novel dual-echo magnetic resonance imaging approach: A validation study. Metabolism-Clinical and Experimental 62, 1189-1198.

Hotamisligil, G.S. (2006). Inflammation and metabolic disorders. Nature 444, 860-867.

Hsu, W.H., and Pan, T.M. (2014). A novel PPARgamma agonist monascin's potential application in diabetes prevention. Food & function 5, 1334-1340.

Huang, D.W., Sherman, B.T., and Lempicki, R.A. (2009a). Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37, 1-13.

Huang, D.W., Sherman, B.T., and Lempicki, R.A. (2009b). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44-57.

Hudson, B.D., Shimpukade, B., Mackenzie, A.E., Butcher, A.J., Pediani, J.D., Christiansen, E., Heathcote, H., Tobin, A.B., Ulven, T., and Milligan, G. (2013). The pharmacology of TUG-891, a potent and selective agonist of the free fatty acid receptor 4 (FFA4/GPR120), demonstrates both potential opportunity and possible challenges to therapeutic agonism. Mol Pharmacol 84, 710-725.

Hudson, B.D., Shimpukade, B., Milligan, G., and Ulven, T. (2014). The molecular basis of ligand interaction at free fatty acid receptor 4 (FFA4/GPR120). J Biol Chem 289, 20345- 20358.

Hummasti, S., and Tontonoz, P. (2006). The peroxisome proliferator-activated receptor N- terminal domain controls isotype-selective gene expression and adipogenesis. Mol Endocrinol 20, 1261-1275.

Hutchinson, D.S., Summers, R.J., and Bengtsson, T. (2008). Regulation of AMP-activated protein kinase activity by G-protein coupled receptors: Potential utility in treatment of diabetes and heart disease. Pharmacol Therapeut 119, 291-310.

Ichimura, A., Hara, T., and Hirasawa, A. (2014). Regulation of Energy Homeostasis via GPR120. Frontiers in endocrinology 5, 111.

Ichimura, A., Hirasawa, A., Poulain-Godefroy, O., Bonnefond, A., Hara, T., Yengo, L., Kimura, I., Leloire, A., Liu, N., Iida, K., et al. (2012a). Dysfunction of lipid sensor GPR120 leads to obesity in both mouse and human. Nature 483, 350-U149.

Ichimura, A., Hirasawa, A., Poulain-Godefroy, O., Bonnefond, A., Hara, T., Yengo, L., Kimura, I., Leloire, A., Liu, N., Iida, K., et al. (2012b). Dysfunction of lipid sensor GPR120 leads to obesity in both mouse and human. Nature 483, 350-354.

254

Iizuka, K., Wu, W., Horikawa, Y., Saito, M., and Takeda, J. (2013). Feedback looping between ChREBP and PPARalpha in the regulation of lipid metabolism in brown adipose tissues. Endocrine journal 60, 1145-1153.

Imamura, T., Huang, J., Dalle, S., Ugi, S., Usui, I., Luttrell, L.M., Miller, W.E., Lefkowitz, R.J., and Olefsky, J.M. (2001). beta -Arrestin-mediated recruitment of the Src family kinase Yes mediates endothelin-1-stimulated glucose transport. J Biol Chem 276, 43663-43667.

Inokuma, K., Okamatsu-Ogura, Y., Omachi, A., Matsushita, Y., Kimura, K., Yamashita, H., and Saito, M. (2006). Indispensable role of mitochondrial UCP1 for antiobesity effect of beta3-adrenergic stimulation. Am J Physiol Endocrinol Metab 290, E1014-1021.

Itoh, Y., Kawamata, Y., Harada, M., Kobayashi, M., Fujii, R., Fukusumi, S., Ogi, K., Hosoya, M., Tanaka, Y., Uejima, H., et al. (2003). Free fatty acids regulate insulin secretion from pancreatic beta cells through GPR40. Nature 422, 173-176.

Jat, P.S., Noble, M.D., Ataliotis, P., Tanaka, Y., Yannoutsos, N., Larsen, L., and Kioussis, D. (1991). Direct derivation of conditionally immortal cell lines from an H-2Kb-tsA58 transgenic mouse. Proc Natl Acad Sci U S A 88, 5096-5100.

Johnson, A.R., and Makowski, L. (2015). Nutrition and Metabolic Correlates of Obesity and Inflammation: Clinical Considerations. J Nutr.

Jong, M.C., Voshol, P.J., Muurling, M., Dahlmans, V.E., Romijn, J.A., Pijl, H., and Havekes, L.M. (2001). Protection from obesity and insulin resistance in mice overexpressing human apolipoprotein C1. Diabetes 50, 2779-2785.

Kajimura, S., Seale, P., Kubota, K., Lunsford, E., Frangioni, J.V., Gygi, S.P., and Spiegelman, B.M. (2009). Initiation of myoblast to brown fat switch by a PRDM16-C/EBP- beta transcriptional complex. Nature 460, 1154-1158.

Kamato, D., Rostam, M.A., Piva, T.J., Babaahmadi Rezaei, H., Getachew, R., Thach, L., Bernard, R., Zheng, W., Little, P.J., and Osman, N. (2014). Transforming growth factor beta- mediated site-specific Smad linker region phosphorylation in vascular endothelial cells. The Journal of pharmacy and pharmacology 66, 1722-1733.

Kardon, T., Noel, G., Vertommen, D., and Van Schaftingen, E. (2006). Identification of the gene encoding hydroxyacid-oxoacid transhydrogenase, an enzyme that metabolizes 4- hydroxybutyrate. FEBS Lett 580, 2347-2350.

Kenakin, T. (2009). Biased agonism. F1000 biology reports 1, 87.

Kern, P.A., Ranganathan, S., Li, C., Wood, L., and Ranganathan, G. (2001). Adipose tissue tumor necrosis factor and interleukin-6 expression in human obesity and insulin resistance. Am J Physiol Endocrinol Metab 280, E745-751.

Kim, J.Y., Tillison, K.S., Zhou, S., Lee, J.H., and Smas, C.M. (2007). Differentiation- dependent expression of Adhfe1 in adipogenesis. Arch Biochem Biophys 464, 100-111.

255

Kimura, I., Ozawa, K., Inoue, D., Imamura, T., Kimura, K., Maeda, T., Terasawa, K., Kashihara, D., Hirano, K., Tani, T., et al. (2013). The gut microbiota suppresses insulin- mediated fat accumulation via the short-chain fatty acid receptor GPR43. Nat Commun 4.

Kirk, S.F., Penney, T.L., and McHugh, T.L. (2010). Characterizing the obesogenic environment: the state of the evidence with directions for future research. Obesity reviews : an official journal of the International Association for the Study of Obesity 11, 109-117.

Kirk, S.F., Penney, T.L., McHugh, T.L., and Sharma, A.M. (2012). Effective weight management practice: a review of the lifestyle intervention evidence. Int J Obes (Lond) 36, 178-185.

Klaus, S., Choy, L., Champigny, O., Cassard-Doulcier, A.M., Ross, S., Spiegelman, B., and Ricquier, D. (1994). Characterization of the novel brown adipocyte cell line HIB 1B. Adrenergic pathways involved in regulation of uncoupling protein gene expression. J Cell Sci 107 ( Pt 1), 313-319.

Klingenspor, M. (2003). Cold-induced recruitment of brown adipose tissue thermogenesis. Experimental physiology 88, 141-148.

Kobilka, B.K. (2007). G protein coupled receptor structure and activation. Biochim Biophys Acta 1768, 794-807.

Kuhn, K., Baker, S.C., Chudin, E., Lieu, M.H., Oeser, S., Bennett, H., Rigault, P., Barker, D., McDaniel, T.K., and Chee, M.S. (2004). A novel, high-performance random array platform for quantitative gene expression profiling. Genome research 14, 2347-2356.

Kuji, I., Imabayashi, E., Minagawa, A., Matsuda, H., and Miyauchi, T. (2008). Brown adipose tissue demonstrating intense FDG uptake in a patient with mediastinal pheochromocytoma. Ann Nucl Med 22, 231-235.

Lafontan, M., and Berlan, M. (1993). Fat cell adrenergic receptors and the control of white and brown fat cell function. J Lipid Res 34, 1057-1091.

Lass, A., Zimmermann, R., Oberer, M., and Zechner, R. (2011). Lipolysis - a highly regulated multi-enzyme complex mediates the catabolism of cellular fat stores. Progress in lipid research 50, 14-27.

Lee, P., Greenfield, J.R., Ho, K.K., and Fulham, M.J. (2010). A critical appraisal of the prevalence and metabolic significance of brown adipose tissue in adult humans. Am J Physiol Endocrinol Metab 299, E601-606.

Lee, P., Smith, S., Linderman, J., Courville, A.B., Brychta, R.J., Dieckmann, W., Werner, C.D., Chen, K.Y., and Celi, F.S. (2014a). Temperature-acclimated brown adipose tissue modulates insulin sensitivity in humans. Diabetes 63, 3686-3698.

Lee, Y.H., Jung, Y.S., and Choi, D. (2014b). Recent advance in brown adipose physiology and its therapeutic potential. Exp Mol Med 46.

256

Leonardsson, G., Steel, J.H., Christian, M., Pocock, V., Milligan, S., Bell, J., So, P.W., Medina-Gomez, G., Vidal-Puig, A., White, R., et al. (2004). Nuclear receptor corepressor RIP140 regulates fat accumulation. Proc Natl Acad Sci U S A 101, 8437-8442.

Leurs, R., Bakker, R.A., Timmerman, H., and de Esch, I.J. (2005). The histamine H3 receptor: from gene cloning to H3 receptor drugs. Nature reviews Drug discovery 4, 107-120.

Li, M.-F., and Cheung, B.M. (2011). Rise and fall of anti-obesity drugs. World J Diabetes 2, 19-23.

Liebmann, C., and Bohmer, F.D. (2000). Signal transduction pathways of G protein-coupled receptors and their cross-talk with receptor tyrosine kinases: Lessons from bradykinin signaling. Curr Med Chem 7, 911-943.

Lin, J.D., Handschin, C., and Spiegelman, B.M. (2005). Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab 1, 361-370.

Liu, X., Wang, S., You, Y., Meng, M., Zheng, Z., Dong, M., Lin, J., Zhao, Q., Zhang, C., Yuan, X., et al. (2015). Brown adipose tissue transplantation reverses obesity in Ob/Ob mice. Endocrinology, en20141598.

Liu, Y., Ford, B.D., Mann, M.A., and Fischbach, G.D. (2005). Neuregulin-1 increases the proliferation of neuronal progenitors from embryonic neural stem cells. Dev Biol 283, 437- 445.

Lodhi, I.J., Yin, L., Jensen-Urstad, A.P., Funai, K., Coleman, T., Baird, J.H., El Ramahi, M.K., Razani, B., Song, H., Fu-Hsu, F., et al. (2012). Inhibiting adipose tissue lipogenesis reprograms thermogenesis and PPARgamma activation to decrease diet-induced obesity. Cell Metab 16, 189-201.

Lowe, C.E., O'Rahilly, S., and Rochford, J.J. (2011). Adipogenesis at a glance. Journal of Cell Science 124, 2681-2686.

Lukaszewski, M.A., Eberle, D., Vieau, D., and Breton, C. (2013). Nutritional manipulations in the perinatal period program adipose tissue in offspring. Am J Physiol-Endoc M 305, E1195-E1207.

Luttrell, L.M., and Lefkowitz, R.J. (2002). The role of beta-arrestins in the termination and transduction of G-protein-coupled receptor signals. J Cell Sci 115, 455-465.

Lyon, H.N., and Hirschhorn, J.N. (2005). Genetics of common forms of obesity: a brief overview. Am J Clin Nutr 82, 215S-217S.

Ma, L., and Pei, G. (2007). beta-arrestin signaling and regulation of transcription. Journal of Cell Science 120, 213-218.

Maatta, J.A., Sundvall, M., Junttila, T.T., Peri, L., Laine, V.J., Isola, J., Egeblad, M., and Elenius, K. (2006). Proteolytic cleavage and phosphorylation of a tumor-associated ErbB4 isoform promote ligand-independent survival and cancer cell growth. Mol Biol Cell 17, 67- 79.

257

Malnick, S.D., and Knobler, H. (2006). The medical complications of obesity. QJM : monthly journal of the Association of Physicians 99, 565-579.

Marzuillo, P., Grandone, A., Conte, M., Capuano, F., Cirillo, G., Di Sessa, A., Umano, G.R., Romano, R., Perrone, L., and del Giudice, E.M. (2014). Novel Association Between a Nonsynonymous Variant (R270H) of the G-Protein-Coupled Receptor 120 and Liver Injury in Children and Adolescents With Obesity. J Pediatr Gastr Nutr 59, 472-475.

Matsubara, Y., Sato, K., Ishii, H., and Akiba, Y. (2005). Changes in mRNA expression of regulatory factors involved in adipocyte differentiation during fatty acid induced adipogenesis in chicken. Comp Biochem Physiol A Mol Integr Physiol 141, 108-115.

McGrath, P.T., Lee, H., Zhang, L., Iniesta, A.A., Hottes, A.K., Tan, M.H., Hillson, N.J., Hu, P., Shapiro, L., and McAdams, H.H. (2007). High-throughput identification of transcription start sites, conserved promoter motifs and predicted regulons. Nat Biotechnol 25, 584-592.

McKinlay, J., and Marceau, L. (2000). US public health and the 21st century: diabetes mellitus. Lancet 356, 757-761.

Medeiros, L.J., Katsas, G.G., and Balogh, K. (1985). Brown fat and adrenal pheochromocytoma: association or coincidence? Human pathology 16, 970-972.

Milligan, G., Alvarez-Curto, E., Watterson, K.R., Ulven, T., and Hudson, B.D. (2014). Characterising pharmacological ligands to study the long chain fatty acid receptors GPR40/FFA1 and GPR120/FFA4. Br J Pharmacol.

Miyauchi, S., Hirasawa, A., Iga, T., Liu, N., Itsubo, C., Sadakane, K., Hara, T., and Tsujimoto, G. (2009a). Distribution and regulation of protein expression of the free fatty acid receptor GPR120. Naunyn-Schmiedeberg's archives of pharmacology 379, 427-434.

Miyauchi, S., Hirasawa, A., Iga, T., Liu, N., Itsubo, C., Sadakane, K., Hara, T., and Tsujimoto, G. (2009b). Distribution and regulation of protein expression of the free fatty acid receptor GPR120. N-S Arch Pharmacol 379, 427-434.

Moden, J.I., Haude, K., Carroll, R., Goodspeed, A., and Cook, L.B. (2013). Analyzing the role of receptor internalization in the regulation of melanin-concentrating hormone signaling. International journal of endocrinology 2013, 143052.

Murano, I., Barbatelli, G., Giordano, A., and Cinti, S. (2009). Noradrenergic parenchymal nerve fiber branching after cold acclimatisation correlates with brown adipocyte density in mouse adipose organ. J Anat 214, 171-178.

N'Diaye, E.N., Hanyaloglu, A.C., Kajihara, K.K., Puthenveedu, M.A., Wu, P., von Zastrow, M., and Brown, E.J. (2008). The ubiquitin-like protein PLIC-2 is a negative regulator of G protein-coupled receptor endocytosis. Molecular Biology of the Cell 19, 1252-1260.

Nedergaard, J., Bengtsson, T., and Cannon, B. (2007). Unexpected evidence for active brown adipose tissue in adult humans. Am J Physiol Endocrinol Metab 293, E444-452.

258

Nedergaard, J., and Cannon, B. (2010). The changed metabolic world with human brown adipose tissue: therapeutic visions. Cell Metab 11, 268-272.

Nedergaard, J., Petrovic, N., Lindgren, E.M., Jacobsson, A., and Cannon, B. (2005). PPARgamma in the control of brown adipocyte differentiation. Biochim Biophys Acta 1740, 293-304.

Ng, M., Fleming, T., and Robinson, M. (2014). Global, regional, and national prevalence of overweight and obesity in children and adults during 1980-2013: a systematic analysis for the Global Burden of Disease Study 2013 (vol 384, pg 766, 2014). Lancet 384, 746-746.

Niemela, S.M., Miettinen, S., Konttinen, Y., Waris, T., Kellomaki, M., Ashammakhi, N.A., and Ylikomi, T. (2007). Fat tissue: Views on reconstruction and exploitation. J Craniofac Surg 18, 325-335.

Nisoli, E., Tonello, C., Benarese, M., Liberini, P., and Carruba, M.O. (1996). Expression of nerve growth factor in brown adipose tissue: Implications for thermogenesis and obesity. Endocrinology 137, 495-503.

Nubel, T., and Ricquier, D. (2006). Respiration under control of uncoupling proteins: Clinical perspective. Hormone research 65, 300-310.

Oh da, Y., Walenta, E., Akiyama, T.E., Lagakos, W.S., Lackey, D., Pessentheiner, A.R., Sasik, R., Hah, N., Chi, T.J., Cox, J.M., et al. (2014). A Gpr120-selective agonist improves insulin resistance and chronic inflammation in obese mice. Nat Med 20, 942-947.

Oh, D.Y., and Olefsky, J.M. (2012). Omega 3 fatty acids and GPR120. Cell metabolism 15, 564-565.

Oh, D.Y., Talukdar, S., Bae, E.J., Imamura, T., Morinaga, H., Fan, W., Li, P., Lu, W.J., Watkins, S.M., and Olefsky, J.M. (2010). GPR120 is an omega-3 fatty acid receptor mediating potent anti-inflammatory and insulin-sensitizing effects. Cell 142, 687-698.

Olefsky, J.M., Oh, D.Y., Talukdar, S., Bae, E.J., Imamura, T., Morinaga, H., Fan, W.Q., Li, P.P., Lu, W.J., and Watkins, S.M. (2010). GPR120 Is an Omega-3 Fatty Acid Receptor Mediating Potent Anti-inflammatory and Insulin-Sensitizing Effects. Cell 142, 687-698.

Osborn, O., and Olefsky, J.M. (2012). The cellular and signaling networks linking the immune system and metabolism in disease. Nat Med 18, 363-374.

Osuga, J., Ishibashi, S., Oka, T., Yagyu, H., Tozawa, R., Fujimoto, A., Shionoiri, F., Yahagi, N., Kraemer, F.B., Tsutsumi, O., et al. (2000). Targeted disruption of hormone-sensitive lipase results in male sterility and adipocyte hypertrophy, but not in obesity. P Natl Acad Sci USA 97, 787-792.

Ou, H.Y., Wu, H.T., Hung, H.C., Yang, Y.C., Wu, J.S., and Chang, C.J. (2013). Multiple mechanisms of GW-9508, a selective G protein-coupled receptor 40 agonist, in the regulation of glucose homeostasis and insulin sensitivity. Am J Physiol Endocrinol Metab 304, E668- 676.

259

Ouchi, N., Parker, J.L., Lugus, J.J., and Walsh, K. (2011). Adipokines in inflammation and metabolic disease. Nature reviews Immunology 11, 85-97.

Pedersen, B.K. (2013). Muscle as a Secretory Organ. Compr Physiol 3, 1337-1362.

Perera, R.J., Marcusson, E.G., Koo, S., Kang, X., Kim, Y., White, N., and Dean, N.M. (2006). Identification of novel PPARgamma target genes in primary human adipocytes. Gene 369, 90-99.

Pond, C.M. (2005). Adipose tissue and the immune system. Prostaglandins Leukot Essent Fatty Acids 73, 17-30.

Poulos, S.P., Dodson, M.V., and Hausman, G.J. (2010). Cell line models for differentiation: preadipocytes and adipocytes. Experimental biology and medicine 235, 1185-1193.

Puckerin, A., Liu, L.Y., Permaul, N., Carman, P., Lee, J., and Diverse-Pierluissi, M.A. (2006). Arrestin is required for agonist-induced trafficking of voltage-dependent calcium channels. Journal of Biological Chemistry 281, 31131-31141.

Puthenveedu, M.A., and von Zastrow, M. (2006). Cargo regulates clathrin-coated pit dynamics. Cell 127, 113-124.

Rajagopal, S., Ahn, S., Rominger, D.H., Gowen-MacDonald, W., Lam, C.M., DeWire, S.M., Violin, J.D., and Lefkowitz, R.J. (2011). Quantifying Ligand Bias at Seven-Transmembrane Receptors. Mol Pharmacol 80, 367-377.

Ricquier, D., and Bouillaud, F. (2000). Mitochondrial uncoupling proteins: from mitochondria to the regulation of energy balance. The Journal of physiology 529 Pt 1, 3-10.

Ricquier, D., Mory, G., Nechad, M., Combes-George, M., and Thibault, J. (1983). Development and activation of brown fat in rats with pheochromocytoma PC 12 tumors. Am J Physiol 245, C172-177.

Ritter, S.L., and Hall, R.A. (2009). Fine-tuning of GPCR activity by receptor-interacting proteins. Nat Rev Mol Cell Biol 10, 819-830.

Robidoux, J., Martin, T.L., and Collins, S. (2004). beta-adrenergic receptors and regulation of energy expenditure: A family affair. Annu Rev Pharmacol 44, 297-323.

Rosell, M., Kaforou, M., Frontini, A., Okolo, A., Chan, Y.-W., Nikolopoulou, E., Millership, S., Fenech, M.E., MacIntyre, D., Turner, J.O., et al. (2014a). Brown and white adipose tissues: intrinsic differences in gene expression and response to cold exposure in mice. Am J Physiol Endocrinol Metab 306, E945-964.

Rosell, M., Kaforou, M., Frontini, A., Okolo, A., Chan, Y.W., Nikolopoulou, E., Millership, S., Fenech, M.E., MacIntyre, D., Turner, J.O., et al. (2014b). Brown and white adipose tissues: intrinsic differences in gene expression and response to cold exposure in mice. Am J Physiol Endocrinol Metab 306, E945-964.

260

Rosen, E.D., Hsu, C.H., Wang, X., Sakai, S., Freeman, M.W., Gonzalez, F.J., and Spiegelman, B.M. (2002). C/EBPalpha induces adipogenesis through PPARgamma: a unified pathway. Genes Dev 16, 22-26.

Rosen, E.D., and Spiegelman, B.M. (2014). What We Talk About When We Talk About Fat. Cell 156, 20-44.

Rosen, E.D., Walkey, C.J., Puigserver, P., and Spiegelman, B.M. (2000). Transcriptional regulation of adipogenesis. Genes Dev 14, 1293-1307.

Roux, P.P., and Blenis, J. (2004). ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev 68, 320-344.

Sacks, H., and Symonds, M.E. (2013). Anatomical locations of human brown adipose tissue: functional relevance and implications in obesity and type 2 diabetes. Diabetes 62, 1783-1790.

Salon, J.A., Lodowski, D.T., and Palczewski, K. (2011). The significance of G protein- coupled receptor crystallography for drug discovery. Pharmacological reviews 63, 901-937.

Sanz, P. (2008). AMP-Activated Protein Kinase: Structure and Regulation. Curr Protein Pept Sc 9, 478-492.

Sarjeant, K., and Stephens, J.M. (2012). Adipogenesis. Cold Spring Harbor perspectives in biology 4, a008417.

Schoonjans, K., Staels, B., and Auwerx, J. (1996). The peroxisome proliferator activated receptors (PPARs) and their effects on lipid metabolism and adipocyte differentiation. Bba- Lipid Lipid Met 1302, 93-109.

Scime, A., Grenier, G., Huh, M.S., Gillespie, M.A., Bevilacqua, L., Harper, M.E., and Rudnicki, M.A. (2005). Rb and p107 regulate preadipocyte differentiation into white versus brown fat through repression of PGC-1alpha. Cell Metab 2, 283-295.

Seale, P., Bjork, B., Yang, W., Kajimura, S., Chin, S., Kuang, S., Scime, A., Devarakonda, S., Conroe, H.M., Erdjument-Bromage, H., et al. (2008). PRDM16 controls a brown fat/skeletal muscle switch. Nature 454, 961-967.

Seale, P., Kajimura, S., and Spiegelman, B.M. (2009). Transcriptional control of brown adipocyte development and physiological function--of mice and men. Genes & development 23, 788-797.

Seale, P., Kajimura, S., Yang, W., Chin, S., Rohas, L.M., Uldry, M., Tavernier, G., Langin, D., and Spiegelman, B.M. (2007). Transcriptional control of brown fat determination by PRDM16. Cell Metab 6, 38-54.

Seale, P., and Lazar, M.A. (2009). Brown fat in humans: turning up the heat on obesity. Diabetes 58, 1482-1484.

261

Sears, I.B., MacGinnitie, M.A., Kovacs, L.G., and Graves, R.A. (1996). Differentiation- dependent expression of the brown adipocyte uncoupling protein gene: regulation by peroxisome proliferator-activated receptor gamma. Mol Cell Biol 16, 3410-3419.

Shan, T., Liang, X., Bi, P., Zhang, P., Liu, W., and Kuang, S. (2013). Distinct populations of adipogenic and myogenic Myf5-lineage progenitors in white adipose tissues. J Lipid Res 54, 2214-2224.

Shimpukade, B., Hudson, B.D., Hovgaard, C.K., Milligan, G., and Ulven, T. (2012). Discovery of a potent and selective GPR120 agonist. J Med Chem 55, 4511-4515.

Shoelson, S.E., Lee, J., and Goldfine, A.B. (2006). Inflammation and insulin resistance. J Clin Invest 116, 1793-1801.

Shore, A.M., Karamitri, A., Kemp, P., Speakman, J.R., Graham, N.S., and Lomax, M.A. (2013). Cold-induced changes in gene expression in brown adipose tissue, white adipose tissue and liver. PLoS One 8, e68933.

Shukla, A.K., Violin, J.D., Whalen, E.J., Gesty-Palmer, D., Shenoy, S.K., and Lefkowitz, R.J. (2008). Distinct conformational changes in beta-arrestin report biased agonism at seven- transmembrane receptors. Proc Natl Acad Sci U S A 105, 9988-9993.

Siersbaek, R., Nielsen, R., John, S., Sung, M.H., Baek, S., Loft, A., Hager, G.L., and Mandrup, S. (2011). Extensive chromatin remodelling and establishment of transcription factor 'hotspots' during early adipogenesis. Embo Journal 30, 1459-1472.

Silva, J.E. (2006). Thermogenic mechanisms and their hormonal regulation. Physiol Rev 86, 435-464.

Siso-Nadal, F., Fox, J.J., Laporte, S.A., Hebert, T.E., and Swain, P.S. (2009). Cross-talk between signaling pathways can generate robust oscillations in calcium and cAMP. PLoS One 4, e7189.

Skurk, T., Alberti-Huber, C., Herder, C., and Hauner, H. (2007). Relationship between adipocyte size and adipokine expression and secretion. J Clin Endocr Metab 92, 1023-1033.

Song, C.K., Schwartz, G.J., and Bartness, T.J. (2009). Anterograde transneuronal viral tract tracing reveals central sensory circuits from white adipose tissue. Am J Physiol-Reg I 296, R501-R511.

Southern, C., Cook, J.M., Neetoo-Isseljee, Z., Taylor, D.L., Kettleborough, C.A., Merritt, A., Bassoni, D.L., Raab, W.J., Quinn, E., Wehrman, T.S., et al. (2013). Screening beta-arrestin recruitment for the identification of natural ligands for orphan G-protein-coupled receptors. Journal of biomolecular screening 18, 599-609.

Spiegelman, B.M., and Flier, J.S. (2001). Obesity and the regulation of energy balance. Cell 104, 531-543.

Stallaert, W., Christopoulos, A., and Bouvier, M. (2011). Ligand functional selectivity and quantitative pharmacology at G protein-coupled receptors. Expert Opin Drug Dis 6, 811-825.

262

Sun, G. (2007). Application of DNA microarrays in the study of human obesity and type 2 diabetes. Omics : a journal of integrative biology 11, 25-40.

Sun, Q., Hirasawa, A., Hara, T., Kimura, I., Adachi, T., Awaji, T., Ishiguro, M., Suzuki, T., Miyata, N., and Tsujimoto, G. (2010). Structure-activity relationships of GPR120 agonists based on a docking simulation. Mol Pharmacol 78, 804-810.

Sundvall, M., Iljin, K., Kilpinen, S., Sara, H., Kallioniemi, O.P., and Elenius, K. (2008). Role of ErbB4 in breast cancer. Journal of mammary gland biology and neoplasia 13, 259-268.

Tai, T.A., Jennermann, C., Brown, K.K., Oliver, B.B., MacGinnitie, M.A., Wilkison, W.O., Brown, H.R., Lehmann, J.M., Kliewer, S.A., Morris, D.C., et al. (1996). Activation of the nuclear receptor peroxisome proliferator-activated receptor gamma promotes brown adipocyte differentiation. J Biol Chem 271, 29909-29914.

Talukdar, S., Olefsky, J.M., and Osborn, O. (2011). Targeting GPR120 and other fatty acid- sensing GPCRs ameliorates insulin resistance and inflammatory diseases. Trends in Pharmacological Sciences 32, 543-550.

Tam, C.S., and Ravussin, E. (2012). Energy balance: an overview with emphasis on children. Pediatric blood & cancer 58, 154-158.

Tautermann, C.S. (2014). GPCR structures in drug design, emerging opportunities with new structures. Bioorg Med Chem Lett 24, 4073-4079.

Thompson, M.D., Cole, D.E., Capra, V., Siminovitch, K.A., Rovati, G.E., Burnham, W.M., and Rana, B.K. (2014). Pharmacogenetics of the G protein-coupled receptors. Methods Mol Biol 1175, 189-242.

Tontonoz, P., Hu, E., and Spiegelman, B.M. (1994). Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 79, 1147-1156.

Towler, M.C., and Hardie, D.G. (2007). AMP-activated protein kinase in metabolic control and insulin signaling. Circ Res 100, 328-341.

Trayhurn, P. (2007). Adipocyte biology. Obes Rev 8, 41-44.

Ussar, S., and Tschop, M.H. (2014). [Br]eaking FAt. Cell 159, 238-240. van Marken Lichtenbelt, W.D., Vanhommerig, J.W., Smulders, N.M., Drossaerts, J.M., Kemerink, G.J., Bouvy, N.D., Schrauwen, P., and Teule, G.J. (2009). Cold-activated brown adipose tissue in healthy men. N Engl J Med 360, 1500-1508.

Vaughan, C.H., Zarebidaki, E., Ehlen, J.C., and Bartness, T.J. (2014). Analysis and measurement of the sympathetic and sensory innervation of white and brown adipose tissue. Methods Enzymol 537, 199-225.

Vielma, S.A., Klein, R.L., Levingston, C.A., and Young, M.R.I. (2013). Adipocytes as immune regulatory cells. Int Immunopharmacol 16, 224-231.

263

Virtanen, K.A., Lidell, M.E., Orava, J., Heglind, M., Westergren, R., Niemi, T., Taittonen, M., Laine, J., Savisto, N.J., Enerback, S., et al. (2009). Functional Brown Adipose Tissue in Healthy Adults (vol 360, pg 1518, 2009). New Engl J Med 361, 1123-1123.

Waguri, T., Goda, T., Kasezawa, N., and Yamakawa-Kobayashi, K. (2013). The combined effects of genetic variations in the GPR120 gene and dietary fat intake on obesity risk. Biomed Res 34, 69-74.

Wang, G.X., Zhao, X.Y., Meng, Z.X., Kern, M., Dietrich, A., Chen, Z., Cozacov, Z., Zhou, D., Okunade, A.L., Su, X., et al. (2014). The brown fat-enriched secreted factor Nrg4 preserves metabolic homeostasis through attenuation of hepatic lipogenesis. Nat Med 20, 1436-1443.

Wang, J., Wu, X., Simonavicius, N., Tian, H., and Ling, L. (2006). Medium-chain fatty acids as ligands for orphan G protein-coupled receptor GPR84. J Biol Chem 281, 34457-34464.

Wang, P., Wu, Y., Ge, X., Ma, L., and Pei, G. (2003). Subcellular localization of beta- arrestins is determined by their intact N domain and the nuclear export signal at the C terminus. J Biol Chem 278, 11648-11653.

Wellhauser, L., and Belsham, D.D. (2014). Activation of the omega-3 fatty acid receptor GPR120 mediates anti-inflammatory actions in immortalized hypothalamic neurons. Journal of neuroinflammation 11, 60.

Wells, J.C. (2006). The evolution of human fatness and susceptibility to obesity: an ethological approach. Biol Rev Camb Philos Soc 81, 183-205.

Wen, L., Lu, Y.S., Zhu, X.H., Li, X.M., Woo, R.S., Chen, Y.J., Yin, D.M., Lai, C., Terry, A.V., Jr., Vazdarjanova, A., et al. (2010). Neuregulin 1 regulates pyramidal neuron activity via ErbB4 in parvalbumin-positive interneurons. Proc Natl Acad Sci U S A 107, 1211-1216.

Westerterp, M., Berbee, J.F.P., Delsing, D.J.M., Jong, M.C., Gijbels, M.J.J., Dahlmans, V.E.H., Offerman, E.H., Romijn, J.A., Havekes, L.M., and Rensen, P.C.N. (2007). Apolipoprotein C-I binds free fatty acids and reduces their intracellular esterification. J Lipid Res 48, 1353-1361.

Whalley, N.M., Pritchard, L.E., Smith, D.M., and White, A. (2011). Processing of proglucagon to GLP-1 in pancreatic alpha-cells: is this a paracrine mechanism enabling GLP- 1 to act on beta-cells? The Journal of endocrinology 211, 99-106.

Whittle, A.J., Carobbio, S., Martins, L., Slawik, M., Hondares, E., Vazquez, M.J., Morgan, D., Csikasz, R.I., Gallego, R., Rodriguez-Cuenca, S., et al. (2012). BMP8B Increases Brown Adipose Tissue Thermogenesis through Both Central and Peripheral Actions. Cell 149, 871- 885.

Wise, A., Jupe, S.C., and Rees, S. (2004). The identification of ligands at orphan G-protein coupled receptors. Annu Rev Pharmacol 44, 43-66.

264

Wolf, M.J., Wang, J., Turk, J., and Gross, R.W. (1997). Depletion of intracellular calcium stores activates smooth muscle cell calcium-independent phospholipase A2. A novel mechanism underlying arachidonic acid mobilization. J Biol Chem 272, 1522-1526.

Wolins, N.E., Quaynor, B.K., Skinner, J.R., Tzekov, A., Park, C., Choi, K., and Bickel, P.E. (2006). OP9 mouse stromal cells rapidly differentiate into adipocytes: characterization of a useful new model of adipogenesis. J Lipid Res 47, 450-460.

Wu, J., Bostrom, P., Sparks, L.M., Ye, L., Choi, J.H., Giang, A.H., Khandekar, M., Virtanen, K.A., Nuutila, P., Schaart, G., et al. (2012). Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 150, 366-376.

Wu, J., Cohen, P., and Spiegelman, B.M. (2013). Adaptive thermogenesis in adipocytes: is beige the new brown? Genes Dev 27, 234-250.

Xia, Q., and Grant, S.F. (2013). The genetics of human obesity. Ann N Y Acad Sci 1281, 178-190.

Xue, Y., Petrovic, N., Cao, R., Larsson, O., Lim, S., Chen, S., Feldmann, H.M., Liang, Z., Zhu, Z., Nedergaard, J., et al. (2009). Hypoxia-independent angiogenesis in adipose tissues during cold acclimation. Cell Metab 9, 99-109.

Yarden, Y., and Sliwkowski, M.X. (2001). Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2, 127-137.

Yoneshiro, T., Aita, S., Matsushita, M., Kayahara, T., Kameya, T., Kawai, Y., Iwanaga, T., and Saito, M. (2013). Recruited brown adipose tissue as an antiobesity agent in humans. Journal of Clinical Investigation 123, 3404-3408.

Yore, M.M., Syed, I., Moraes-Vieira, P.M., Zhang, T., Herman, M.A., Homan, E.A., Patel, R.T., Lee, J., Chen, S., Peroni, O.D., et al. (2014). Discovery of a class of endogenous mammalian lipids with anti-diabetic and anti-inflammatory effects. Cell 159, 318-332.

Yoshihara, A., Sugita, N., Iwasaki, M., Wang, Y., Miyazaki, H., Yoshie, H., and Nakamura, K. (2015). The Interaction Between Beta-3 Adrenergic Receptor and PPAR Gamma Gene Polymorphism to Periodontal Disease in Community-Dwelling Elderly Japanese. Journal of periodontology, 1-16.

Zechner, R., Kienesberger, P.C., Haemmerle, G., Zimmermann, R., and Lass, A. (2009). Adipose triglyceride lipase and the lipolytic catabolism of cellular fat stores. J Lipid Res 50, 3-21.

Zechner, R., Zimmermann, R., Eichmann, T.O., Kohlwein, S.D., Haemmerle, G., Lass, A., and Madeo, F. (2012). FAT SIGNALS - Lipases and Lipolysis in Lipid Metabolism and Signaling. Cell Metab 15, 279-291.

Zhang, D., and Leung, P.S. (2014). Potential roles of GPR120 and its agonists in the management of diabetes. Drug design, development and therapy 8, 1013-1027.

265

Zhao, J., Cannon, B., and Nedergaard, J. (1998). Thermogenesis is beta3- but not beta1- adrenergically mediated in rat brown fat cells, even after cold acclimation. Am J Physiol 275, R2002-2011.

Zhao, J., Unelius, L., Bengtsson, T., Cannon, B., and Nedergaard, J. (1994). Coexisting beta- adrenoceptor subtypes: significance for thermogenic process in brown fat cells. Am J Physiol 267, C969-979.

Zheng, Z., Liu, X., Zhao, Q., Zhang, L., Li, C., and Xue, Y. (2014). Regulation of UCP1 in the Browning of Epididymal Adipose Tissue by beta3-Adrenergic Agonist: A Role for MicroRNAs. International journal of endocrinology 2014, 530636.

Zhou, Z., Yon Toh, S., Chen, Z., Guo, K., Ng, C.P., Ponniah, S., Lin, S.C., Hong, W., and Li, P. (2003). Cidea-deficient mice have lean phenotype and are resistant to obesity. Nat Genet 35, 49-56.

266

Appendix I

Publication

Publication during the course of PhD

267

Appendix II

Murine primers used for gene expression experiments, written in a 5’ to 3’ direction

Aacs CTGTCAGTGCTGGAGGAGAA TGGCCCATGAAACAGGAGAT Acaa2 AGAAGGCCCTGGATCTTGAC CTCCAATGCAAGCTGATCCC Acsl1 CAGAACCCGAAGATCTTGCG CGGTCTCAAACATATGGGCG Adcy4 CCTCATTGCCCGCCTTTATC GTCTCAGTCTCCTCTCGCTC Adhfe1 CCAGCTCCCTCCTGTACAAA CCCACAGCAACATAGGCATC Adrbk2 GGCAGCATGTGTACTTACGG TTCCTCCTGGCCTCGATTTT Aldh2 GAGCAGAGCCATGTCATGTG TGTCACACATCCAGGCATCT aP2 ACACCGAGATTTCCTTCAAACTG CCATCTAGGGTTATGATGCTCTTCA Apoc1 GAGGGCGGTGGTGAATACTA ATGCTCTCCAATGTTCCGGA C/EBPα TGGAGTTGACCAGTGACAATGAC CAGTTCACGGCTCAGCTGTTC Egfl7 CTTGGAGGAACATCTGGGGT ATGCCCAAGTCCTAGGAACC FAS TGCGGAAACTTCAGGAAATGT AGAGACGTGTCACTCCTGGACTT Glut-4 CTATTCAACCAGCATCTTCGAG CTACTAAGAGCACCGAGACC Gpr108 ACCACGTCATTCACCCATCT CAGTCCCAACACCTGATCCT GPR120: ACATTGGATTGGCCCAACCGCA TCCGCGATGCTTTCGTGATCTGT Gpr34 TTGCCTGGATCCTGTCATGT CACGGACAGATCATGCAAGG Gys2 ATCCTTTCTCGTGCCAGGAA GCGGTGGTATATCTGCCTCT Mlxipl CCCTCAGACACCCACATCTT TCAGAAAGGGGTTGGGATCC Nrg4: TGTGGACCATACGACGAGAG GTGCAAGGTCAACACAGGAA Paqr9 GGTTTGCGTGGAGTTTCTGT TGTTTCACCTCCCATCTCCC Pnpla3 ACCTGAGAGCCTGCAATCTT AACAGAACCCTTCCCAGAGG PPARγ CGAGTCTGTGGGGATAAAGC GGATCCGGCAGTTAAGATCA Sncg CAAGGAAGGTGTTGTGGGTG CTTGTTGGCCACTGTGTTGA Ucp1: ACTGCCACACCTCCAGTCATT CTT TGC CTC ACT CAG GAT TGG Vldlr GCCCTGAACAGTGCCATATG CATCACTGCCATCGTCACAG β-actin: TTGCTGACAGGATGCAGAAG CCACCGATCCACACAGAGTA

268

Primers used for molecular cloning experiments, written in a 5’ to 3’ direction shNrg4-a F GATCCCCCCTTAATTCTTCCATCAAGTTCAAGAGACTTGATGGAAGAATTAAG GTTTTTA R AGCTTAAAAACCTTAATTCTTCCATCAAGTCTCTTGAACTTGATGGAAGAATT AAGGGGG shNrg4-b F GATCCCCATTAAGATGCCAACAGATCTTCAAGAGAGATCTGTTGGCATCTTAA TTTTTTA R AGCTTAAAAAATTAAGATGCCAACAGATCTCTCTTGAAGATCTGTTGGCATCT TAATGGG shNrg4-c F GATCCCCGATGCCAACAGATCACGAGTTCAAGAGACTCGTGATCTGTTGGCA TCTTTTTA R AGCTTAAAAAGATGCCAACAGATCACGAGTCTCTTGAACTCGTGATCTGTTGG CATCGGG shNrg4-d F GATCCCCTGGGGGGATTTGTTATGTGTTCAAGAGACACATAACAAATCCCCCC ATTTTTA R AGCTTAAAAATGGGGGGATTTGTTATGTGTCTCTTGAACACATAACAAATCCC CCCAGGG

Directional Topo cloning into pcDNA-v5/His: Nrg4 F C ACC ATG CCA ACA GAT CAC GAG CAG R GTG TTC TCT GTG GCT GTG ACG G

5’RACE: Nrg4 Inner reverse AATGGGCTGGGGATAGTAGG

Outer reverse CCATTGAGGCAAAATGACCT

269

Am J Physiol Endocrinol Metab 306: E945–E964, 2014. First published February 18, 2014; doi:10.1152/ajpendo.00473.2013.

Brown and white adipose tissues: intrinsic differences in gene expression and response to cold exposure in mice

Meritxell Rosell,1 Myrsini Kaforou,2 Andrea Frontini,3 Anthony Okolo,1 Yi-Wah Chan,4 Evanthia Nikolopoulou,1 Steven Millership,5 Matthew E. Fenech,6 David MacIntyre,1 Jeremy O. Turner,6 Jonathan D. Moore,4 Edith Blackburn,7 William J. Gullick,7 Saverio Cinti,3 Giovanni Montana,8 Malcolm G. Parker,1 and Mark Christian9 1Institute of Reproductive and Developmental Biology, Department of Surgery and Cancer, Imperial College London, London, United Kingdom; 2Section of Paediatrics, Division of Infectious Diseases, Department of Medicine, Imperial College London, London, United Kingdom; 3Department of Experimental and Clinical Medicine, Obesity Center, United Hospitals-University of Ancona (Politecnica delle Marche), Ancona, Italy; 4Warwick Systems Biology Centre, University of Warwick, Coventry, United Kingdom; 5Metabolic Signalling Group, Medical Research Council Clinical Sciences Centre, Imperial College London, London, United Kingdom; 6Norwich Medical School, University of East Anglia, Norwich, United Kingdom; 7School of Biosciences at the University of Kent, Canterbury, Kent, United Kingdom; 8Department of Mathematics, Statistics Section, Imperial College London, London, United Kingdom; and 9Division of Metabolic and Vascular Health, Warwick Medical School, University of Warwick, Coventry, United Kingdom Submitted 29 August 2013; accepted in ﬁnal form 14 February 2014

Rosell M, Kaforou M, Frontini A, Okolo A, Chan Y, Nikolo- different types of adipose tissue: white adipose tissue (WAT) poulou E, Millership S, MacIntyre ME, Turner JO, Moore JD, that stores energy in the form of triacylglycerol (TAG) and Blackburn E, Gullick WJ, Cinti S, Montana G, Parker MG, brown adipose tissue (BAT) that dissipates energy as heat, Christian M. Brown and white adipose tissues: intrinsic differences “burning” fatty acids to maintain body temperature. WAT and in gene expression and response to cold exposure in mice. Am J BAT have significant transcriptional, secretory, morphological, Physiol Endocrinol Metab 306: E945–E964, 2014. First published February 18, 2014; doi:10.1152/ajpendo.00473.2013.—Brown adi- and metabolic differences. The main murine BAT depot is pocytes dissipate energy, whereas white adipocytes are an energy located subcutaneously in the interscapular region, but it can storage site. We explored the plasticity of different white adipose also be found in the cervical, axillar, and paravertebral regions. tissue depots in acquiring a brown phenotype by cold exposure. By BAT is a highly vascularized and innervated tissue, and brown comparing cold-induced genes in white fat to those enriched in brown adipocytes possess multilocular lipid droplets and a high num- compared with white fat, at thermoneutrality we defined a “brite” ber of mitochondria and demonstrate a high rate of fatty acid transcription signature. We identified the genes, pathways, and pro- and glucose uptake and oxidation (9). WAT is found primarily moter regulatory motifs associated with “browning,” as these repre- under the skin (subcutaneous) or inside the abdomen (gonadal, sent novel targets for understanding this process. For example, neu- mesenteric, omental, and perirenal), and it is much less inner- regulin 4 was more highly expressed in brown adipose tissue and vated and vascularized than BAT. White adipocytes have a upregulated in white fat upon cold exposure, and cell studies showed unilocular lipid droplet, few mitochondria, and a low oxidative that it is a neurite outgrowth-promoting adipokine, indicative of a role in increasing adipose tissue innervation in response to cold. A cell rate. Important differences exist between subcutaneous and culture system that allows us to reproduce the differential properties visceral depots, which support their different involvement in of the discrete adipose depots was developed to study depot-specific insulin sensitivity and type 2 diabetes, with visceral WAT differences at an in vitro level. The key transcriptional events under- being more closely associated with an adverse metabolic pro- pinning white adipose tissue to brown transition are important, as they file (28). represent an attractive proposition to overcome the detrimental effects In recent years, considerable interest has risen in the poten- associated with metabolic disorders, including obesity and type 2 tial beneficial effects of acquiring BAT features (browning) in diabetes. nonclassic BAT locations such as WAT. It is known that brown adipose tissue; subcutaneous white adipose tissue; visceral subcutaneous WAT is more sensitive to acquisition of BAT white adipose tissue; cold; brite; adipokine characteristics than visceral depots in mice and humans (47, 53). However, it is still a matter of debate as to whether mature white adipocytes undergo transdifferentiation into brown adi- ADIPOSE TISSUE IS A HIGHLY DYNAMIC ENDOCRINE ORGAN with pocytes (12, 16) or whether precursors committed to the brown central roles in the regulation of energy metabolism. Discrete lineage already present in the tissue differentiate into mature adipose tissue depots have distinct contributions to energy brown adipocytes (42, 63). Brown in white (brite) or “beige” balance, and metabolic disorders are associated with its distur- adipocytes are distinct from the adipocytes in interscapular bance (21, 43, 56, 59). The major fat depots in mammals, BAT in that they arise as multilocular adipocytes in WAT including humans, are the subcutaneous and the intra-abdom- during adrenergic stimulus (30, 42, 46, 61, 63). They have low inal depots. These are composed of varying amounts of the two levels of uncoupling protein 1 (UCP1) compared with classic brown adipocytes but possess the capacity to induce UCP1 Address for reprint requests and other correspondence: M. Christian, Div. of expression to a very high extent and the ability to increase their Metabolic and Vascular Health, Warwick Medical School, Univ. of Warwick, oxygen consumption upon adrenergic activation. It has been Coventry, CV4 7AL, UK (e-mail: [email protected]). reported recently that the adipocytes found in human BAT http://www.ajpendo.org Licensed under Creative Commons CC-BY 3.0: the American Physiological Society. ISSN 0193-1849. E945 E946 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES could be of this brite type, and a defined bona fide interscapular Immunohistochemistry and Immunocytochemistry BAT depot is found in infants (13, 31, 36, 49, 63). Several Immediately after removal, adipose tissues were fixed overnight by classes of factors have been identified to promote a BAT immersion at 4°C in 4% paraformaldehyde. Paraffin-embedded dew- phenotype either in white adipocytes and/or WAT. These axed sections were stained with hematoxylin and eosin or incubated include transcription factors [e.g., peroxisome proliferator- with anti-UCP1 (cat. no. 10983; Abcam) or anti-Nrg4 (anti-127; see activated receptor-␥ (PPAR␥), CCAAT/enhancer-binding pro- Ref. 24) according to the avidin-biotin complex method (27). Staining tein beta (C/EBP␤), and Foxc2], coregulators [e.g., PPAR␥ was never observed when the primary antibody was omitted. ␣ ␣ coactivator-1 (PGC-1 ), Prdm16, and Plac8], growth factors RNA Extraction and qRT-PCR [e.g., bone morphogenetic protein (Bmp)7, Fgf21, Bdnf, and Bmp8b], enzymes (e.g., Ptgs2), lipid droplet-associated pro- Total RNA was extracted with Trizol. RNA for microarray analysis teins (e.g., perilipin), and cell survival factors (e.g., necdin) as was purified using Qiagen RNeasy mini columns. The expression of target genes was determined using SYBR green reagent and gene- well as the miR193b-365 microRNA cluster (reviewed in Ref. specific primers (sequences available on request). Relative expression 51). Although these factors have important roles in promoting levels were normalized to ␤-actin. a brown fat phenotype, to date, only fibroblast growth factor 21 (FGF21) has been reported in a therapeutic study (17). Under- Microarray Analysis standing WAT-BAT plasticity in different depots, it is impor- Gene expression microarray was performed by Almac diagnostics tant for the design of future treatments to target type 2 diabetes UK using GeneChip Mouse Genome 430A 2.0 Array (Affymetrix) on and obesity by BAT-inducing drugs or other therapies, such as RNA extracted from interscapular BAT and subcutaneous and mes- tissue transplantation or gene therapy. enteric WAT from mice exposed to 28 or 6°C. Three biological For this study, we have compared gene expression in four replicates were used. The analysis was conducted using R program- different mouse adipose depots with very specific physiologies ming language and Bioconductor (55). After background adjustment, summarization, and normalization of the raw intensities, the data were upon prolonged cold exposure. We sought to identify differ- analyzed using affy (19) and limma (14). Pairwise comparisons entially regulated genes and thereby novel signaling pathways between conditions were performed. A linear model was fitted to the during cold-induced adipose tissue “remodeling.” Further- expression values of each probe, modified to account for the replicated more, we identified motifs that are enriched in the promoters of samples and assuming no interaction between the genes. The moder- brite genes. We have been able to confirm that subcutaneous ated t-statistic was computed for each probe and for each contrast adipose tissue is the most prone to changing to display a brite providing P values that were corrected for multiple testing using the phenotype identified as a number of temperature-regulated and Benjamini and Hochberg’s method to control the false discovery rate (10). Probes with adjusted P values of Ͻ0.01 were considered statis- differentially expressed genes that represent new targets for tically significant. The microarray data have been deposited in NCBI’s further studies. In addition, we have established cell models Gene Expression Omnibus (15) and are accessible through GEO that will allow the comparison of different adipose tissue Series accession no. GSE51080 (http://www.ncbi.nlm.nih.gov/geo/ depots at an in vitro level. From these investigations, we have query/acc.cgi?accϭGSE51080). Heatmaps were produced based on demonstrated that neuregulin 4 (Nrg4)is a novel cold-induced the Euclidian distance. Pathway analysis was generated by Ingenuity adipokine that promotes neurite outgrowth. IPA software. Protein Expression MATERIALS AND METHODS Tissues and cultured cells were lysed in Laemmli loading buffer, Mice and proteins were electrophoresed on a 10% SDS-PAGE gel and transferred to PVDF membrane. Membranes were probed with spe- Cold exposure experiments. Groups of four 10-wk-old female cific antibodies UCP1 (cat. no. U6382; Sigma), cell death-inducing 129Sv mice (Charles River, Milan, Italy) were housed separately and DNA fragmentation factor ␣-subunit-like effector A (CIDEA; cat. no. kept at 22°C. Subsequently, one group of mice was placed at 28°C and AB16922; Chemicon), p-Akt (Ser473), and t-Akt, all from cell-signal- another one at 6°C for 10 days. Another group was kept at 22°C. ing technologies and ␤-actin (Sigma). Animals were singly caged with a 12:12-h light-dark cycle and free access to standard chow diet and water. At the end of the treatment, Preparation of adipocytes vs. stromal vascular fraction-enriched fractions the body weights of single animals did not change significantly either during cold exposure or in warm acclimatization. Mice were culled as Adipose tissues from four mice were cut into 2-mm pieces and reported previously (7), and adipose tissues (interscapular BAT and digested in serum-free DMEM-F-12 culture medium containing 1 subcutaneous, mesenteric, and gonadal WAT) were collected. Care mg/ml collagenase A (Roche) and 10 mg/ml DNAse (Roche). After and handling were in accordance with institutional guidelines. Proce- digestion, the cells were separated by centrifugation at 170 g for 10 dures were approved by the Ethics Committee for Animal Experi- min, and mature adipocytes (floating fraction) and stromal vascular ments at the University of Ancona (11 Gen. 2007, protocol no. 585). fraction (SVF; in the cell pellet) were collected separately for RNA ␤3-Adrenoceptor agonist administration experiments. Two groups extraction. of four 10-wk-old C57BL/6 female mice kept at 22°C were given an intraperitoneal injection either with saline (200 ␮l) or CL316,243 (1 Cell Culture mg/kg body wt in 200 ␮l of saline) 5 h after injection mice were Generation of immortalized cell lines. Primary cultures of brown culled by cervical dislocation and adipose tissues collected. adipose and subcutaneous, mesenteric, and gonadal white adipose Tissue panel. FVB/N female mice kept under normal housing tissues were generated by first digesting the tissue and pelleting the conditions were culled by cervical dislocation and the different tissues SVF, as described above. Preadipocytes were purified by collecting collected. Experiments were carried out in accordance with UK Home the cells that passed through 100 ␮m of mesh. Next, cells were passed Office regulations. through strainers of 70- or 25-␮m mesh size for brown and white

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES E947 preadipocytes, respectively, and were plated and cultured in DMEM- quently submitted to BioMart (Ensembl Genes 72, Mus musculus F-12, 10% FBS, and 1% antibiotic-antimycotic. After culture for 2 GRCm38.p1 dataset) to retrieve the corresponding 1,000-bp upstream days, preadipocytes were immortalized by retroviral-mediated expres- flanks of the transcripts of the genes of interest from the genome sion of temperature-sensitive SV40 large T-antigen H-2kb-tsA58 (a annotation. To remove sequence repeats arising from overlapping gift from P. Jat). Cells were cultured at 33°C and selected with G418 transcript variants, the FASTA sequences were assembled into con- (100 mg/ml) for 2 wk and then maintained in 50 ␮g/ml G418. tiguous sequences with CAP3. Mixed contiguous sequences com- Experiments were performed between passages 12 and 22. Cells were posed of flanks from more than one gene were verified to identify differentiated as described previously (22, 39). overlaps generated in CAP3 due to sequence similarity alone rather PC12-HER4. The PC12-HER4 cell line (24) was cultured in than contiguity. Such false mixed contiguous sequences were re- RPMI-1640 supplemented with 10% horse serum and 5% fetal bovine moved from the set of contiguous sequences. The original flanking serum. Cells were plated on poly-L-lysine-coated glass coverslips and regions making up the false mixed contiguous sequences were then exposed to unconditioned DMEM-F-12, 10% FBS medium, or con- collected, and a contiguous sequence was rebuilt if there was more ditioned medium from differentiated adipocytes. than one transcript-flanking region for a particular gene, whereas singlets were simply added to the final set. The final set of sequences Metabolic Studies was then collated, which included the initial true contiguous sequences, the singlets, and the singlets or contiguous sequences which 9,10-[3H]palmitate oxidation. Assessment was performed as re- arose from the false mixed contiguous sequences. The resulting ported previously (18). Briefly, differentiated adipocytes were starved FASTA sequence file was submitted as a single cluster to MEME-LaB in glucose-deprived DMEM for 1 h. Cells were then incubated at 37°C to detect 10 motifs between six and 12 base pairs, with the promoter in DMEM containing 0.3 mM palmitate (9,10-[3H]palmitate, 12 maximum length adjusted to accommodate the longer contiguous ␮Ci/ml), 2% BSA, 0.25 mM L-carnitine, and 3 mM glucose for 3 h. 3 sequences. Palmitate oxidation was assessed by measuring H2O produced in the incubation medium. Data were normalized to DNA content/well RESULTS measured with a Fluorescent DNA Quantitation Kit (Bio-Rad). Glucose uptake. Glucose uptake was measured using 2-[N-(7-nitro- Fat Depots Vary in Their Response to Cold benz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-D-glucose (2-NBDG; Mo- lecular Probes). Differentiated adipocytes in 96-well plates were To study the ability of different adipose tissue depots to serum starved for 3 h. Then cells were incubated in HBSS buffer with respond to changes in temperature, 129Sv female mice were or without insulin (100 nM) for 30 min. Glucose uptake was initiated exposed to temperatures of 28 or 6°C. This mouse strain is by the addition of HBSS containing 500 ␮M 2-NBDG and 2.5 mM reported to be diabetes and obesity resistant due to a greater deoxyglucose. After 15 min, plates were washed with cold HBSS amount of active BAT (3). It has a greater amount of adi- buffer containing 25 mM glucose. Cells were lysed, and fluorescence pocytes expressing UCP1 in different adipose depots and has was read at 466 nm. Fluorescence was normalized to protein content. been used for several studies addressing cold-induced transdif- Nrg4 ELISA ferentiation of adipose tissues (7, 40). Global changes in expression were monitored by microarray analysis of BAT and NRG4 levels in culture medium were determined by ELISA inguinal subcutaneous and mesenteric WAT. BAT showed the (SEC147Mu; Caltag Medsystems), following the manufacturer’s pro- most dramatic changes upon prolonged cold exposure, with tocol. 11,180 gene probes sets differentially expressed (P Ͻ 0.01) IL-6 ELISA (Fig. 1A). In subcutaneous WAT, 2,178 probes were altered, but only eight were altered in mesenteric WAT. Antibodies and standards were sourced fromR&DSystems, and By considering the up- and downregulated probes sepa- the ELISA was performed according to the manufacturer’s instruc- rately, we identified the most significantly differentially ex- tions. Data were normalized to DNA content/well measured with a pressed pathways in each tissue. The top 20 pathways for BAT Fluorescent DNA Quantitation Kit (Bio-Rad). and subcutaneous WAT are shown in Fig. 1B. The number of Nrg4 Knockdown genes altered in the mesenteric depot was too low to be used for pathway analysis. In BAT, the top upregulated pathways Conditionally immortalized BAT cells were transfected with shRNA involve protein degradation (protein ubiquitination), metabo- (short-hairpin RNA) targeting Nrg4 (pSuperior-shNrg4). Oligonucleo- lism (fructose, mannose, fatty acid, glucose, and propanoate tides (shNrg4 forward, 5=-GATCCCCUGGGGGGAUUUGUUAU- GUGTTCAAGAGACACUAACAAAUCCCCCCATTTTTA-3=; and metabolism), reduced power generation (pentose phosphate shNrg4 reverse, 5=-AGCTTAAAAAUGGGGGGAUUUGUUAU- pathway), signal transduction [thyroid hormone receptor/reti- GUGTCTCTTGAACACAUAACAAAUCCCCCCAGGG-3=) were an- noid X receptor regulation, Toll-like receptor (TLR) activation, nealed and ligated into pSuperior vector. Cells stably expressing the AMPK, IL-17, PI3K/Akt], and oxidative stress regulation. shRNA were achieved by selection with puromycin. Among the downregulated probes, the most significantly altered pathways are cell cycle- and growth regulation-related Statistical Analysis pathways (purine metabolism, DNA methylation, cell cycle ANOVA tests were performed, and only P values Ͻ0.05 consid- G1/S checkpoint, DNA damage repair) as well as signaling ered statistically significant. In all figures, the data are the average of pathways (mTOR, estrogen, RAR, androgen, and VEGF sig- a minimum of three independent replicates Ϯ SE. naling). On analysis of the subcutaneous data set, it becomes evident that this particular depot shows a shift toward a brown Motif Detection in Upstream Flanking Regions of Differentially or brite phenotype when animals are exposed to 6°C. Most of Expressed Genes the top upregulated pathways are those that are highly ex- Lists of differentially expressed genes from the expression exper- pressed in BAT (oxidative phosphorylation, citrate cycle, fatty iments were ordered using fold change, and Ensembl Gene IDs were acid metabolism, ubiquinone synthesis, pyruvate metabolism). obtained for lists of interest. The Ensembl Gene IDs were subse- Downregulated probes belong mostly to pathways related to

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org E948 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES

Fig. 1. Global expression analysis of brown adipose tissue (BAT) and subcutaneous and mesenteric white adipose tissue (WAT) in mice exposed to cold. A: global mRNA expression was measured in BAT and subcutaneous and mesenteric WAT depots of mice exposed at either 28 or 6°C using Affymetix 2.0 ST microarrays. A row-centred heat map of hierarchical clustering carried out on the differentially expressed gene probes at a 5% false discovery rate is shown. Probe sets are colored according to the average expression level across all samples, with green denoting a lower expression level and red denoting a higher expression level. B: top pathways that were altered by cold exposure in BAT and subcutaneous WAT. The bars represent signiﬁcance, and the ratio of genes altered out of the total genes per pathway is indicated. Pathway analysis was performed using up- and downregulated probes separately. mTOR, mammalian target of rapamycin; EIF, eukaryotic initiation factor; NRF2, nuclear factor-E2-related factor; PI3K, phosphatidylinositol 3-kinase; CNTF, ciliary neurotrophic factor; RAR, retinoic acid receptor.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES E949

Fig. 2. Global expression comparison of BAT and subcutaneous (sWAT) and mesenteric WAT (mWAT) at 28°C. A: global mRNA expression was measured in BAT, sWAT, and mWAT depots of mice housed at 28°C, using Affymetix 2.0 ST microarrays. Shown is a row-centred heat map of hierarchical clustering carried out on the differentially expressed gene probes at a 10% false discovery rate. Probe sets are colored according to the average expression level across all samples, with green denoting a lower expression level and red denoting a higher expression level. B: top pathways that are enriched in each of the different depots compared with each other. The bars represent signiﬁcance, whereas ratio shows the genes altered out of the total genes per pathway. Pathway analysis was performed using up- and downregulated probes separately.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org E950 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES the immune system (lipid antigen presentation, natural killer expressed, whereas only 9,647 probes were differentially ex- cell signaling, antigen presentation), signaling, and endoplas- pressed for subcutaneous vs. mesenteric. As expected, these mic reticulum stress. data show that WAT depots are more similar to each other than to BAT. Intrinsic Differences of WAT and BAT Depots at The most highly expressed pathways in BAT were those Thermoneutrality involved in energy expenditure, metabolism, and signaling Using the microarray data, we analyzed the intrinsic differ- (Fig. 2B), with those enriched in WAT related to the immune ences between each adipose depot at 28°C. In Fig. 2A, the heat system, including T cell activation, antigen presentation, com- maps for each of the comparisons are shown. Comparison of plement system activation, and lymphocyte apoptosis. When BAT to subcutaneous and mesenteric WAT indicated that comparing subcutaneous to mesenteric WAT, the enriched 25,625 and 30,242 probes, respectively, were differentially pathways in subcutaneous WAT are related to neuronal sig-

Table 1. Top gene probes up- and downregulated after cold exposure in BAT and subcutaneous and mesenteric WAT

BAT 6°C vs. 28°C Upregulated BAT 6°C vs. 28°C Downregulated

Adjusted Adjusted Gene Symbol FC P Value Gene Name Gene Symbol FC P Value Gene Name Elovl3 76.76 Ͻ0.001 Elongation of very-long-chain EG666481 68.85 Ͻ0.001 Predicted gene 8126 fatty acid-like 3 Bmp8b 32.25 Ͻ0.001 Bone morphogenetic protein 8b 1110059M19Rik 37.60 Ͻ0.001 RIKEN cDNA 1110059M19 9030619P08Rik 30.40 Ͻ0.001 RIKEN cDNA 9030619P08 Snhg11 11.86 Ͻ0.001 Small nucleolar RNA host gene 11 (nonprotein coding) 4933433H22Rik 15.12 Ͻ0.001 RIKEN cDNA 4933433H22 Myh4 11.67 0.019 Myosin, heavy polypeptide 4 Serpina12 14.88 Ͻ0.001 Serine peptidase inhibitor, Rab17 11.06 Ͻ0.001 RAB17 member RAS oncogene clade A member 12 family Gyk 11.83 Ͻ0.001 Glycerol kinase Myh2 10.73 0.014 Myosin heavy polypeptide 2 Ncan 11.71 Ͻ0.001 Neurocan Asb5 10.06 0.005 Ankyrin repeat and SOCS box-containing 5 Rims2 10.38 Ͻ0.001 Regulating synaptic membrane Ddit4l 9.97 0.016 DNA-damage-inducible transcript exocytosis 2 4-like Slc25a34 9.62 Ͻ0.001 Solute carrier family 25, Casq1 9.89 0.017 Calsequestrin 1 member 34 Sgk2 9.51 Ͻ0.001 Serum/glucocorticoid regulated B3 galt2 8.52 Ͻ0.001 UDP-Gal ␤-GlcNAc ␤-1.3- kinase 2 galactosyltransferase, polypeptide 2

Subcutaneous WAT 6°C vs. 28°C Upregulated Subcutaneous WAT 6°C vs. 28°C Downregulated

Adjusted Gene Adjusted Gene symbol FC P value Gene name symbol FC P value Gene name Elovl3 31.98 Ͻ0.001 Elongation of very-long-chain Csn2 50.46 0.004 Casein-␤ fatty acid like 3 Slc27a2 16.64 Ͻ0.001 Solute carrier family 27 (fatty Nnat 16.72 Ͻ0.001 neuronatin acid trasporter) member 2 9030619P08Rik 13.29 Ͻ0.001 RIKEN cDNA 9030619P08 Kera 5.15 Ͻ0.001 Keratocan Ucp1 12.54 Ͻ0.001 Uncoupling protein 1 Defb1 5.06 0.002 Defensin-␤1 Fabp3 10.21 Ͻ0.001 Fatty acid-binding protein 3 Gm266 4.98 Ͻ0.001 predicted gene 266 Cpt1b 9.88 Ͻ0.001 Carnitine palmitoyltransferase Col9a1 4.17 Ͻ0.001 Collagen type IX, ␣1 1b, muscle Cox7a1 9.21 Ͻ0.001 Cytochrome c oxidase, Htr4 4.17 0.004 5 hydroxytryptamine (serotonin) subunit VIIa 1 receptor 4 Kng1 7.84 Ͻ0.001 Kininogen 1 Slc15a2 3.24 Ͻ0.001 Solute carrier family 15 (Hϩ/peptide transporter), member 2 Otop1 7.49 Ͻ0.001 Otopetrin 1 Bdnf 3.15 3.93E-03 brain derived neurotrophic factor Ppara 7.48 Ͻ0.001 Peroxisome proliferator- Adamts2 3.10 1.70E-04 A disintegrin-like metallopeptidase activated receptor-␣ throm-bospondin type1, motif2

Mesenteric WAT 6°C vs. 28°C Upregulated Mesenteric WAT 6°C vs. 28°C Downregulated

Gene Adjusted Adjusted symbol FC P value Gene name Gene symbol FC P value Gene name Ucp1 7.88 Ͻ0.001 Uncoupling protein 1 LOC100046232 2.66 Ͻ0.001 Nuclear factor interleukin 3, regulated Orm3 2.84 Ͻ0.001 Orosomucoid 3 Tmem182 1.84 Ͻ0.001 Transmembrane protein 182 Nrg4 2.18 Ͻ0.001 Neuregulin member 4 Cabc1 2.17 Ͻ0.001 Chaperone, ABC1 activity of bc1 complex like Acsf2 1.77 Ͻ0.001 Acyl-CoA synthetase family member 2 BAT, brown adipose tissue, WAT, white adipose tissue; FC, fold change.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES E951 naling, whereas the most prominent pathways in mesenteric with potential relevance for the temperature-induced acquisi- WAT seem to be related to interleukin production and signal- tion of brite features. The top 10 up- and downregulated genes, ing as well as carbohydrate and amino acid metabolism. due to cold exposure, are presented for BAT and subcutaneous and mesenteric WAT in Table 1, and the top genes for Identiﬁcation of Differentially Expressed Genes Sensitive to Temperature comparisons of the depots at 28°C are presented in Table 2. We chose a set of genes for further study that were more highly From the microarray analysis, we aimed to identify genes expressed in BAT compared with WAT depots and were also that were signiﬁcantly altered in expression by temperature increased in subcutaneous WAT following cold exposure. This

Table 2. Top gene probes up- and downregulated when comparing BAT, subcutaneous WAT, and mesenteric WAT at thermoneutrality

BAT 28°C vs. Subcutaneous 28°C Upregulated BAT 28°C vs. Subcutaneous 28°C Downregulated

Adjusted Gene Adjusted Gene symbol FC P value Gene name symbol FC P value Gene name Zic1 111.91 Ͻ0.001 Zinc ﬁnger protein of the Csn3 106.07 Ͻ0.001 Casein kappa cerebellum 1 Cpn2 77.41 Ͻ0.001 Carboxypeptidase N, polypeptide 2 Btn1a1 90.95 Ͻ0.001 Butyrophilin, subfamily 1, member A1 Slc27a2 76.77 Ͻ0.001 Solute carrier family 27 (fatty acid Foxa1 88.56 Ͻ0.001 Forkhead box A1 transporter), member 2 2310014F07Rik 61.34 Ͻ0.001 RIKEN cDNA 2310014F07 gene Areg 82.96 Ͻ0.001 amphiregulin Kng1 53.07 Ͻ0.001 Kininogen 1 Ehf 81.38 Ͻ0.001 Ets homologous factor EG666481 44.08 Ͻ0.001 Predicted gene 8126 Serpinb5 78.90 Ͻ0.001 Serpin peptidase inhibitor, clade B, member 5 Olig1 42.44 Ͻ0.001 Oligodendrocyte transcription Cxcl15 78.77 Ͻ0.001 Chemokine (C-X-C motif) factor 1 ligand 15 Ppara 40.04 Ͻ0.001 Peroxisome proliferator-activated Krt8 75.07 Ͻ0.001 keratin 8 receptor-␣ 9130214F15Rik 38.03 Ͻ0.001 RIKEN cDNA 9130214F15 gene Slc5a5 64.96 Ͻ0.001 Solute carrier family 5 (sodium iodide), member 5 Chkb-cpt1b 35.86 Ͻ0.001 Carnitine palmitoyltransferase 1b, Hoxa10 59.03 Ͻ0.001 homeobox A10 muscle

BAT 28°C vs. Mesenteric 28°C Upregulated BAT 28°C vs. Mesenteric 28°C Downregulated

Adjusted Gene Adjusted Gene symbol FC P value Gene name symbol FC P value Gene name Ucp1 210.01 Ͻ0.001 Uncoupling protein 1 Upk3b 108.35 Ͻ0.001 Uroplakin 3b Slc27a2 171.79 Ͻ0.001 Solute carrier family 27 (fatty acid Phox2b 101.69 Ͻ0.001 Paired-like homeobox 2b transporter), member 2 Zic1 138.04 Ͻ0.001 Zinc ﬁnger protein of the Colec10 95.85 Ͻ0.001 Collectin subfamily member 10 cerebellum 1 2310014F07Rik 124.87 Ͻ0.001 RIKEN cDNA 2310014F07 gene Bnc1 91.40 Ͻ0.001 Basonuclin 1 Cpn2 107.34 Ͻ0.001 Carboxypeptidase N, polypeptide 2 Scg2 87.39 Ͻ0.001 Secretogranin II Myo5c 65.24 Ͻ0.001 myosin VC Snap25 85.13 Ͻ0.001 synaptosomal-associated protein 25 Myh4 64.22 Ͻ0.001 Myosin, heavy polypeptide 4, Isl1 81.38 Ͻ0.001 ISL1 transcription factor, skeletal muscle LIM/homeodomain EG666481 58.31 Ͻ0.001 Predicted gene 8126 Rims1 78.79 Ͻ0.001 regulating synaptic membrane exocytosis 1 Six1 50.30 Ͻ0.001 Sine oculis-related homeobox 1 Calcb 77.62 Ͻ0.001 calcitonin-related polypeptide, ␤ homolog (Drosophila) Chkb-cpt1b 47.65 Ͻ0.001 Carnitine palmitoyltransferase 1b, Bcl11a 74.34 Ͻ0.001 ␤-cell CLL/lymphoma 11A muscle (zinc ﬁnger protein)

Subcutaneous 28°C vs. Mesenteric 28°C Upregulated Subcutaneus 28°C vs. Mesenteric 28°C Downregulated

Gene Adjusted Gene Adjusted symbol FC P value Gene name symbol FC P value Gene name Csn3 174.98 Ͻ0.001 Casein kappa Rims1 339.50 Ͻ0.001 Regulating synaptic membrane exocytosis 1 Areg 169.91 Ͻ0.001 Amphiregulin Upk3b 263.18 Ͻ0.001 Uroplakin 3b Foxa1 164.17 Ͻ0.001 Forkhead box A1 Snap25 235.42 Ͻ0.001 Synaptosomal-associated protein 25 Tcfap2c 150.16 Ͻ0.001 Transcription factor AP-2, gamma Scg2 152.72 Ͻ0.001 Secretogranin II Cxcl15 116.61 Ͻ0.001 Chemokine (C-X-C motif) ligand 15 Nmu 142.19 Ͻ0.001 Neuromedin U Muc15 113.45 Ͻ0.001 mucin 15 Phox2b 131.78 Ͻ0.001 Paired-like homeobox 2b Btn1a1 113.12 Ͻ0.001 Butyrophilin, subfamily 1, member A1 Colec10 130.78 Ͻ0.001 Collectin sub-family member 10 Elf5 109.85 Ͻ0.001 E74-like factor 5 Vip 113.28 Ͻ0.001 Vasoactive intestinal polypeptide Esrp1 98.22 Ͻ0.001 Epithelial splicing regulatory protein 1 Gal 99.00 Ͻ0.001 galanin Tmprss2 79.11 Ͻ0.001 Transmembrane protease, serine 2 Resp18 95.51 Ͻ0.001 Regulated endocrine-speciﬁc protein 18

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org E952 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES E953

Fig. 4. Adipocyte-selective expression of temperature-regulated genes. mRNA expression of in cells from the stromal vascular fraction (SVF) or mature adipocytes prepared from interscapular BAT, sWAT, gWAT (Gon), and mWAT. Perilipin protein levels from gWAT are shown as an indicator of the quality of the fractionation (top right). Nrg, neuregulin; Nnat, neuronatin; Cil6l, cold-induced lymphocyte antigen 6-like; Letm1, leucine zipper EF hand-containing transmembrane protein 1. group included genes involved in several different processes. ER stress and adipose biology (20, 32), was selected because it Nrg4 is a regulator of neuronal development (23), and Bmp8b was downregulated in cold conditions in BAT and subcutane- regulates thermogenesis in BAT (62). The G protein-coupled ous WAT. receptor (GPCR) Gpr120 is linked with obesity (29), and Rgs7 Prior to the microarray, we determined the expression of (4) has the potential to affect the signaling through many UCP1, a classic cold-induced target gene in BAT by qRT-PCR GPCRs important for BAT function. Slc27a2 (26) and Letm1 in the different adipose tissues. We included another visceral (60) have key roles in lipid metabolism and mitochondrial fat depot, the gonadal WAT, and tissues from animals housed function, respectively. We also identiﬁed the uncharacterized at 22°C (Fig. 3A). UCP1 was induced in all depots after transcript 9030619P08RIK for further study, as it is highly exposure to 6°C compared with either 28 or 22°C, with the regulated and could be a potential cell surface marker of brown subcutaneous depot showing the largest increase. We also adipocytes. This gene shares a high homology with the Ly-6 measured the expression of Cidea, which was increased in protein family and is found in the vicinity of a genomic region subcutaneous WAT but only modestly in BAT. Hematoyxlin that contains the genes for this family (6). Hence, we term it and eosin staining showed a large increase in multilocular cells cold-induced lymphocyte antigen 6-like (Cil6l). Neuronatin of the subcutaneous depot upon cold exposure (Fig. 3B). (Nnat), a gene that has been involved in calcium signaling and Protein expression of UCP1 was monitored in the different

Fig. 3. Expression of selected genes induced by cold exposure or by a ␤3-adrenergic-specific agonist in different adipose depots. A: mRNA expression of uncoupling protein 1 (UCP1) and cell death-inducing DNA fragmentation factor ␣-subunit-like effector A (Cidea) in BAT, sWAT, gonadal WAT (gWAT), and mWAT of mice exposed to 28, 22, or 6°C. B: hematoxylin and eosin staining (H & E) and UCP1 immunohistochemistry. UCP1-immunoreactive brown adipocytes interspersed among unilocular white adipocytes of subcutaneous adipose tissue of mice exposed at 28 or 6°C. C: mRNA expression of genes identified by microarray in BAT, sWAT, gWAT, and mWAT of mice exposed to 28, 22, or 6°C. D: mRNA expression of selected genes in different adipose depots of mice injected intraperitoneally with the selective ␤3-receptor agonist CL-316,243 (1 mg/kg body wt) after 5 h; n ϭ 4. All mRNA data are expressed as fold induction compared with BAT of mice either at 28°C or injected with saline. Bars represent the means Ϯ SE of at least 3 mice/group, and significant differences are shown. *P Ͻ 0.05; **P Ͻ 0.005; ***P Ͻ 0.001.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org E954 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES E955 depots by immunohistochemistry. Figure 3B shows staining of ability to differentiate into adipocytes was maintained after subcutaneous WAT. UCP1 staining increased with exposure to more than 30 passages. At the expression level, the preadi- low temperatures in all adipose depots studied (data not pocyte marker Pref-1 and mature adipocyte markers aP2 and shown). PPAR␥ were downregulated or highly induced, respectively, We next validated expression of our genes of interest (Fig. upon differentiation in the four cell lines (Fig. 5B). The brown 3C). At both 28 and 22°C, Slc27a2 and Letm1 expression was adipocyte marker UCP1 (Fig. 5A) was highly induced in BAT higher in BAT compared with the other depots, and Bmp8b cells after differentiation and to a much lower extent in white expression was higher in BAT and subcutaneous WAT, adipocyte cells. Expression of UCP1 was almost undetectable whereas Nrg4, GPR120, and Rgs7 were highly expressed in in gonadal and mesenteric WAT cells. We then analyzed BAT and gonadal WAT depots. In the gonadal depot, the expression of the identified set of temperature or differentially relatively high levels of these genes are likely due to consti- expressed genes throughout differentiation (Fig. 5C). Nnat and tutively present brown adipocyte pockets observed in the Slc27a2 mRNA levels were undetectable at different time 129Sv strain even at 28°C (57). Cil6l was expressed largely in points in all cell lines. Expression of the other identified genes subcutaneous WAT, whereas Nnat was preferentially ex- was induced upon differentiation to a higher or lower extent in pressed in gonadal WAT, followed by subcutaneous and mes- all cell lines. Nrg4, Rgs7, and Letm1 were more highly ex- enteric WAT and BAT. Upon cold exposure, we found genes pressed in differentiated BAT cells compared with the white with expression induced in all depots (Rgs7, Letm1), genes adipocyte lines. Cil6l was highly expressed in differentiated with expression induced in BAT and subcutaneous and gonadal subcutaneous cells and to a lower extent in gonadal. We next WAT (Nrg4, Gpr120), genes induced only in BAT and subcu- investigated gene regulation due to ␤3-adrenergic signaling. taneous WAT (Bmp8b, Cil6l, Slc27a2), and a gene that was We exposed differentiated adipocytes to an acute (5 h) treat- reduced in all depots (Nnat). ment with CL-316,243. This compound was able to induce To investigate whether the cold-regulated genes were af- UCP1 and PGC-1␣ mRNA (Fig. 5D), showing that the ␤ - ␤ 3 fected directly by the 3-adrenergic signaling pathway, mice adrenergic signaling pathway is fully functional. Regarding the ␤ were treated with the 3-specific adrenergic agonist CL- genes identified from the array, we obtained results similar to 316,243. Examination of the expression of the cold-responsive the in vivo CL-316,243 treatment; GPR120 was the most genes (Fig. 3D, right) revealed that only Bmp8b (very mod- sensitive to acute adrenergic activation in BAT and subcuta- estly) and GPR120 mRNAs were significantly induced by neous cells. In general, Bmp8b was present at low levels in acute adrenergic treatment and only in BAT. These results adipocyte cell lines, unlike adipose tissues. However, it was indicate that many of the genes that are upregulated in WAT present at higher levels in differentiated brown compared with result from long-term remodeling effects rather than rapid white adipocytes and was induced by CL-316,243 only in the direct transcriptional events and are likely to be important for brown adipocytes (Fig. 5D). Nrg4 and Letm1 showed modest brite cell function rather than driving the “browning” process. induction of mRNA expression in BAT cells and a tendency to Alternatively, the genes may initially be refractory to the increase in subcutaneous cells but not in any of the others. ␤ 3-stimulus. These results highlight that pathways in addition to the ␤3- Because adipose tissues are composed of several cell types, adrenergic signaling pathway are necessary for the induction of we determined whether the identified genes were expressed in certain genes (Cidea, Nrg4, Rgs7) upon cold exposure, mature adipocytes or nonadipocyte cells that constitute the whereas others (UCP1, PGC-1␣, GPR120) are regulated di- SVF. Fractionation of the different depots showed that all the rectly by this pathway. genes were preferentially expressed in either brown or white We also performed a series of functional metabolic assays to mature adipocytes (Fig. 4). investigate whether the differences observed at the transcriptional ␤ Gene Expression in Immortalized Cell Lines Generated level had physiological relevance in our cell lines. Basal -oxi- From Different Adipose Tissue Depots dation was highest in BAT and subcutaneous WAT (Fig. 6A). Because cold activates BAT ␤-oxidation (65), we treated the cells Considering that all of the genes we identified were prefer- with 10 ␮M CL-316,243 for 5 h. We detected an increase in the entially expressed in mature adipocytes, we next investigated ␤-oxidation by BAT and subcutaneous WAT cells, whereas it whether their expression was maintained in cells in vitro. We remained unchanged in gonadal and mesenteric WAT cells. took the approach of immortalizing adipocyte precursors from Basal glucose uptake, assessed with a fluorescent glucose each adipose depot. This allows the comparison of adipocytes analog (2-NBDG) in mature adipocytes, was the highest in from depots where both large and small numbers of precursors gonadal WAT cells, followed by mesenteric and subcutaneous can be obtained, using fewer mice. First, we examined whether WAT and BAT (Fig. 6B). Considering the recent findings by the in vitro-differentiated adipocytes retained the features that PET scans, surprisingly, BAT had the lowest basal glucose define each depot. For all the cell lines, 80–100% of cells were uptake. This cannot be explained by the expression levels of differentiated as judged by Oil Red O stain (Fig. 5A). The the glucose transporters GLUT1 and GLUT4 that were present

Fig. 5. Immortalized cell lines from different adipose tissue depots. A: Oil Red O staining of differentiated cells on days 8–10 of differentiation. B: mRNA expression of UCP1, PPAR␥, and preadipocyte factor (Pref-1; n ϭ 3) and a representative example of Western blot for UCP1, CIDEA, and aP2. C: mRNA expression in cells from different immortalized cell lines on days 0, 2, and 8 of differentiation. Data are expressed as fold induction compared with BAT cells on day 0; n ϭ 3. D: mRNA expression in differentiated cells from the different immortalized cell lines that had been treated for 5 h with ␤3-receptor agonist CL-316,243 (10 ␮M) or vehicle control (Ctrl). Data are expressed as fold induction compared with nonstimulated BAT cells; n ϭ 3. For all of the mRNA data, bars represent means Ϯ SE, and signiﬁcant differences are shown. *P Ͻ 0.05; **P Ͻ 0.005; ***P Ͻ 0.001. PGC-1␣, PPAR␥ coactivator-1␣.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org E956 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES at higher levels in BAT compared with WAT cell lines (Fig. 6B) and is likely due to differences between white and brown adipocytes in the pathways controlling glucose uptake. Upon insulin stimulation, glucose uptake increased in gonadal and subcutaneous WAT cells by 30 and 20%, respectively, whereas CL-316,243 treatment increased BAT adipocyte glucose uptake (Fig. 6B), showing that ␤-adrenergic stimulus is more important than insulin for BAT glucose uptake. Furthermore, Akt phosphorylation was increased by insulin stimulation in all cell lines very potently in WAT and subcutaneous WAT, indicating that insulin signaling was intact in the differentiated adipocytes (Fig. 6B). Adipocytes are an important source of inflammatory cytokines (34), and our microarray analysis revealed that WAT depots preferentially expressed gene pathways associated with inflammatory processes. Because previous investigations showed that differentiated adipocytes from human primary cultures were highly sensitive to LPS-stimulated secretion of IL-6 (11), we investigated the inflammatory response of differentiated adipocytes derived from distinct adipose tissues. Basal IL-6 secretion was detected in all cell lines except for BAT, and stimulation with LPS increased IL-6 production in a dose- dependent manner in subcutaneous and gonadal WAT cells (Fig. 6C). The lack of response of the mesenteric adipocytes was somewhat surprising given the link between visceral depots and inflammatory activity. Similar levels of TLR4 mRNA, the receptor for LPS, were detected in all cell lines following differentiation and induced Ͼ2,000-fold in all of the cell lines in differentiated compared with preadipocytes (data not shown). This is the first time immortalized cell lines from four different adipose depots (interscapular BAT and subcutaneous, gonadal, and mesenteric WAT) have been generated and compared. Results demonstrate that it is possible to maintain depot-specific differences in expression and physiology in in vitro systems. Genes and Motifs Defining Browning of White Fat To characterize the transcription profile of WAT subject to browning in response to cold, we first prepared a list of genes that were enriched in both BAT vs. subcutaneous WAT and BAT vs. mesenteric WAT (comparisons at 28°C), which provides BAT genes. Next, we determined which genes from this list were also increased in subcutaneous WAT by cold exposure. The genes of this brite transcriptome are presented in Table 3. This stringent analysis confirmed the association of UCP1, PGC-1␣, Cidea, Plin5, PPAR␣, and Otop1 with the

Fig. 6. Functional characterization of immortalized cell lines from different adipose tissue depots. A:[3H]palmitate oxidation in differentiated adipocytes generated from interscapular BAT and sWAT, gWAT, and mWAT treated with or without CL-316,243 (CL; 10 ␮M) for 5 h. Results are expressed as a mean of 3 experiments and radioactivity count numbers normalized to DNA content. B: basal, insulin (100 nM), and CL (10 ␮M, 5 h) stimulated glucose uptake measured with the fluorescent glucose analog 2-[N-(7-nitrobenz-2-oxa- 1,3-diazol-4-yl)amino]-2-deoxy-D-glucose. Results are expressed as a mean of 3 experiments and fluorescence normalized to protein content. p-Akt was measured by Western blot with antibody against phosphorylated Ser473.A representative blot is shown. GLUT1 and GLUT4 mRNA relative expression levels are shown in differentiated cells. C: IL-6 production by differentiated adipocytes after 24-h treatment with increasing amounts of LPS. Bars represent means Ϯ SE, and significant differences are shown. *P Ͻ 0.05; **P Ͻ 0.01.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES E957 Table 3. List of genes that define the “browning” of tigs, a total of 471 sequences were submitted to MEME-LaB. cold-activated white adipose tissue The 10 most significant motifs between six and 12 bp were identified and their similarity to known eukaryotic transcription Mitochondria Metabolism Signaling Bckdha Acaa2 2310014F07Rik factor-binding sites determined (Fig. 7). For motif 2, which Cabc1 Acads Adcy3 was present in 100% of promoter sequences, the transcription Chchdh10 Acadvl Adora1 factors Klf4, CAC-binding protein, Pu.1, and Sp1 were the Coq3 Acc Adrb3 nearest fit from their position-specific scoring matrix (PSSM). Coq5 Acot11 Akap7 Coq9 Acot4 Angp13 Other transcription factors that were identified as fitting the Cox7a1 Acsf2 Angpt14 motifs included C/EBP␤, p53, Pax6, Pax2, BCL-6, ATF-5, Cox8b Cacb Arl4a Kid3 (Zfp354c), and the nuclear receptors SF1, LRH-1, and Crat Coasy Gnao1 HNF-4. Examination of the microarray data reveals that Cyc1 Cyp2b10 Gpr120 C/EBP␤, BCL-6, SF1, Pax6, and ATF-5 are more highly Decr1 Fbp2 Gpr135 Etfdh Fn3k Gpr146 expressed in brown vs. white adipose tissues at thermoneutral- Hsha Gyk Gpr4 ity. This highlights the potential of these factors through Idh3a Ldhb Igsec2 binding to their respective motifs to affect brown adipocyte Letm1 Pank1 Map2k5 gene expression. Letmd1 Pck1 Mtor Me3 Pdhb Pde8a Finally, the microarray data was analyzed to determine Plat Pdhx Prkaca which transcripts were temperature regulated but not specifi- Rilp Pdk2 Prkar2b cally associated with higher levels in BAT. We generated a list Sirt3 Pdk4 Rgs7 of genes that were more highly expressed at 6 vs. 28°C in Ucp1 Pfkb3 Adora1 Uqcr10 Sod2 Immune/Inflammatory subcutaneous WAT but not more highly expressed in BAT vs. Uqcrfs1 Transcription C8 g mesenteric WAT or BAT vs. subcutaneous WAT (Table 4). Transporters Esrra Ifnar2 Remarkably, of this list of 53 cold-induced genes in subcuta- AI317395 Esrrg Igsf21 neous WAT, 40 were also cold-induced in BAT. Genes that Aqp7 Klf11 Il15ra Cpt1 Nr1d1 Kng1 were increased in both WAT and BAT in response to cold Cpt2 Nr1d2 Serpina12 include Cil6l, Acaa1b, Dbp, Drd1a, Gys2, Lipf, Pla2g2e, and Fabp3 Ppargc1a Lipid droplet Sphk2. They are likely to be important for changes required Fabp4 Ppargc1b Cidea only in response to cold and may be required for elevation of Slc27a2 Ppara Cideb Slc1a5 Sox6 Plin5 metabolic activity that will occur in both WAT and BAT in Slc25a20 Tef Pnpla2 cold conditions. Although these genes are not more highly Slc25a33 Tfb2m Lipe expressed in BAT vs. WAT at thermoneutrality, they may still Slc25a34 Tfdp2 Cell cycle be important for the brite program. Slc25a42 Zfp703 Ccno Slc4a4 Cytoskeleton Cdkl3 Tmem37 Ka7na12 Inca1 Nrg4 is a Brown Adipocyte Adipokine That Promotes Hormone/vitamin Fam82b Apoptosis Neurite Outgrowth Cyp2b10 Tuba8 Nol3 Dio2 Nucleic acid Otopn Nrg4 was one of the genes for the group that define the brite Retsat Asp Ion binding Rdn16 Carhsp1 Adprhl1 transcription signature and was selected for further study. It Peroxisomes Gchfr S100b showed an expression pattern similar to the BAT marker gene Hacl1 Gna13 Smyd4 Cidea in that expression was greater in BAT vs. WAT and that Pex3 Oplah Calr3 cold stimulated a large increase in WAT, whereas only a small Pex19 Pn1dc1 Unknown Poln 4122401k19Rik increase was detected in BAT. Along with Nrg1, -2, and -3, it Structural Satv2 8430408G22Rik is a member of the epidermal growth factor family of proteins Krt79 Secretion/vesicles 9130214F15Rik that are involved in normal development and in the pathology Chpt1 9530008L14Rik of many diseases. Analysis of a panel of mouse tissues re- Circadian rhythm Cpn2 Fam13a Per3 Fam15a Fam195a vealed that Nrg4 was highly expressed in adipose tissues, being Protein degradation Otop1 Fam69b the highest in BAT, followed by gonadal and subcutaneous Fbxo21 Pm20d1 WAT (Fig. 8A). Analysis of in vivo protein expression by Cell adhesion Growth factor immunohistochemistry revealed the presence of NRG4 in BAT Tspan18 Nrg4 and gonadal WAT (Fig. 8B). For in vitro studies, we deter- Genes listed were upregulated in subcutaneous WAT and more highly mined expression of Nrg4 mRNA in our immortalized BAT expressed in both BAT versus subcutaneous WAT and BAT versus mesenteric cell line. Expression progressively increased upon differentia- WAT. tion treatment, being the highest after 8 days (Fig. 8C), confirming adipocyte-specific expression (Fig. 5C). Efficient dif- browning of adipose tissue and also revealed additional genes ferentiation was confirmed by the induction of the adipose that were part of the brown/brite transcription “fingerprint,” marker aP2 (Fig. 8C). To test whether NRG4 was secreted into including GPR120, Nrg4, Rgs7, and Letm1. To investigate the the culture media and whether this had any effect in promoting regulatory motifs associated with brite genes, we took the neurite outgrowth, conditioned medium of mature brown adi- 1,000-bp upstream flanking region from the top 308 sequences. pocytes was used to treat PC12 cells stably expressing ErbB4 After the removal of duplicates and rebuilding of mixed con- (25). NRG4 was detected by ELISA in conditioned medium

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org E958 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES E959 Table 4. Genes that are induced by cold in subcutaneous WAT and are not more highly expressed in BAT versus subcutaneous WAT or BAT versus mesenteric WAT

Gene Name Gene Induced by Cold in BAT Gene Function 4921536K21Rik RIKEN cDNA 4921536K21 gene Yes 9030619P08Rik RIKEN cDNA 9030619P08 gene Yes 9430098F02Rik RIKEN cDNA 9430098F02 gene Yes Abca6 ATP-binding cassette, sub-family A (ABC1), member 6 Abhd1 Abhydrolase domain containing 1 Yes Acaa1b Acetyl-Coenzyme A acyltransferase 1B Yes Acoxl Acyl-coenzyme A oxidase-like Adrm1 Adhesion regulating molecule 1 Yes Apoc2 Apolipoprotein C-II Yes Extracellular Apoc4 Apolipoprotein C-IV Extracellular Apold1 Apolipoprotein L domain-containing 1 Yes Aqp11 Aquaporin 11 Yes Plasma membrane Atrn Attractin Yes Plasma membrane, C2cd2l C2 calcium-dependent domain containing 2-like Yes Catsper3 Cation channel, sperm associated 3 Plasma membrane Ccny Cyclin Y Yes Chrna2 Cholinergic receptor, nicotinic, alpha polypeptide 2 Yes Plasma membrane Cir1 Corepressor interacting with RBPJ, 1 Cldn22 Claudin 22 Plasma membrane Cmbl Carboxymethylenebutenolidase-like (Pseudomonas) Crtac1 Cartilage acidic protein 1 Extracellular Cyp4a10 Cytochrome P450, family 4, subfamily a, polypeptide 10 Yes Dbp D site albumin promoter binding protein Yes Transcription factor Dcst1 DC-STAMP domain containing 1 Drd1a Dopamine receptor D1A Yes Signaling Molecule Fabp12 Fatty acid-binding protein 12 Yes Fndc8 Fibronectin type III domain containing 8 Yes Gys2 Glycogen synthase 2 Yes Katna1 Katanin p60 (ATPase-containing) subunit A1 Yes Cell Cycle Klhl2 Kelch-like 2, Mayven (Drosophila) Kras v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Yes Signaling Apoptosis Lipf Lipase, gastric Extracellular Lsm1 LSM1 homolog, U6 small nuclear RNA associated Yes Mfsd3 Major facilitator superfamily domain containing 3 Yes Mpv17l Mpv17 transgene, kidney disease mutant-like Yes Nploc4 Nuclear protein localization 4 homolog (S. cerevisiae) Yes Nxnl1 Nucleoredoxin-like 1 Yes Padi3 Peptidyl arginine deiminase, type III Pex16 Peroxisomal biogenesis factor 16 Yes Pla2 g2e Phospholipase A2, group IIE Yes Extracellular Psmd4 Proteasome (prosome, macropain) 26S subunit, nonATPase Yes Rcl1 RNA terminal phosphate cyclase-like 1 Reep6 Receptor accessory protein 6 Yes Rnf146 ring finger protein 146 Yes Rora RAR-related orphan receptor alpha Yes Transcription factor Slc9a6 Solute carrier family 9 member 6 Yes Sphk2 Sphingosine kinase 2 Yes Signaling molecule Tbata Thymus, brain and testes associated Tinag Tubulointerstitial nephritis antigen Yes Tmem120a Transmembrane protein 120A Yes Trfr2 Transferrin receptor 2 Yes Plasma membrane Vmn2r1 Vomeronasal 2, receptor 2 Yes Zwint ZW10 interactor Yes Cell cycle Boldface indicates genes that are within the top 200 most significantly upregulated genes in 6°C versus 28°C subcutaneous WAT. from differentiated brown adipocytes and was undetectable in dose-dependent manner (Fig. 8E). This effect was specific for unconditioned medium and medium from preadipocytes (Fig. Nrg4, as neurite outgrowth was prevented in conditioned 8D). Conditioned medium induced neurite outgrowth (mea- medium from adipocytes in which it was knocked down by sured by staining with anti-Tuj1 antibody) after 24 h in a Ͼ75% by shRNA interference (Fig. 8F). Thus, we can con-

Fig. 7. Motif analysis of brite gene promoters. Motif logos are presented from the MEME-LaB-analyzed gene cluster for transcripts induced by cold in subcutaneous WAT and more highly expressed in BAT vs. WAT depots. The MEME-LaB software determined 10 motifs, and these were analyzed for similarity to know motifs from JASPAR, PLACE, and TRANSFAC using position-speciﬁc scoring matrix (PSSM). Eukaryotic transcription factor binding sites are indicated for each relevant PSSM.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org E960 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES

Fig. 8. Nrg4 is a BAT adipokine promoting neurite outgrowth. A: Nrg4 mRNA expression in mouse tissues (n ϭ 4). Data are expressed as a fold difference compared with kidney. B: inmunohistochemistry of Nrg4 in murine BAT and gonadal WAT. C: Nrg4 and aP2 mRNA expression in immortalized BAT cells throughout differentiation. Data are shown as fold induction compared with time 0. D: NRG4 levels in unconditioned medium (control), conditioned medium from undifferentiated brown adipocytes (Undiff Cond), and 4-wk-differentiated brown adipocytes (Diff Cond) in 6-well plates, determined by ELISA. DNA content was 28.65 Ϯ 1.38 and 26.04 Ϯ 1.96 ␮g/well for differentiated and undifferentiated cells, respectively. E: neurite staining with anti-Tuj1 antibody of PC12-HER4 cells incubated with different concentrations of conditioned medium from differentiated brown adipocytes. Neurite outgrowth measured in ␮m and expressed as fold induction over control cells. F: neurite staining by anti-Tuj1 antibody of PC12-HER4 treated with conditioned medium of differentiated brown adipocytes stably expressing shNrg4 or a nontargeting shRNA. For all of the data, bars represent means Ϯ SE, and signiﬁcant differences are shown. *P Ͻ 0.05. clude that NRG4 produced by brown adipocytes in culture can DISCUSSION affect the neurite development in neural cells. This indicates that NRG4 represents a novel brown adipose tissue adipokine In the present study, we aimed to identify factors, pathways, with important autocrine/paracrine functions in the develop- and regulatory elements that are important for acquiring brown ment of the innervation net in adipose tissues, with implica- fat features in WAT depots. We conducted global expression tions in the acquisition of BAT features in WAT depots. analysis on discrete adipose tissue depots, with well-recog-

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES E961 nized differential physiology and involvement in metabolic available for exactly the same probes allowed us to perform a disease, in mice that had been exposed to cold for 10 days. This direct comparison of the differentially expressed transcripts. stimulus drives the appearance of brown adipocytes or the This was conducted in OrderedList, a package in R, for browning of determined WAT depots. Our results support meta-analysis of ordered gene lists like those acquired from previous findings that the subcutaneous adipose depot is most differential gene expression analysis (37). The P value for a reactive to acquiring BAT characteristics, whereas visceral significant overlap between the two expression studies being depots are much less responsive (28). Female gonadal WAT substantially different from random studies is Ͻ10Ϫ16. Nrg4, shows a certain degree of induced expression of UCP1, PGC- Slc27a2, Rgs7, and Nnat were differentially expressed in the 1␣, Cidea, and other BAT-specific genes upon adrenergic GSE44059 data sets for BAT vs. inguinal WAT and BAT vs. activation triggered by cold exposure. Mesenteric WAT seems epididymal WAT. The same genes were also differentially to be almost completely insensitive at the level of gene expres- regulated in an independent microarray of BAT vs. epididymal sion, although interestingly, adipocytes here become multiloc- WAT [GEO accession no. GSE8044 (48)]. Our experiments ular, albeit UCP1-ve, in response to cold (40). In contrast, BAT were performed at thermoneutrality, which may reduce the shows the highest number of genes that are affected upon cold baseline expression of BAT genes in WAT, thereby allowing exposure. We have also identified a set of genes and pathways the identification of additional cold-regulated genes such as that are either induced or repressed by the tissue remodeling GPR120 and Bmp8b, which were not differentially expressed that occurs after the long-term adrenergic activation induced by in the other data sets. cold exposure. VEGF signaling was identified as downregu- In contrast to BAT-enriched genes, the data sets are remark- lated by cold exposure, with Vegfc specifically reduced and ably divergent for genes that are more highly expressed in also more highly expressed in WAT compared with BAT. This WAT compared with BAT. Upk3b showed the greatest differ- contrasts with Vegfa, which was found to be present at higher ence in expression between BAT and Mes WAT in our study levels in BAT. This agrees with previous reports that associate at 28°C and was found in GSE44059 (BAT vs. epididymal Vegfa (64) with angiogenesis in BAT and Vegfc being nega- WAT) and GSE8044 (BAT vs. subcutaneous WAT). Similarly, tively regulated by adrenergic signaling (5) and indicates Nnat was also found in these analyses. Other genes consis- distinct roles for Vegfc and Vegfa signaling in white and tently elevated in WAT compared with BAT across the differ- brown adipocytes, respectively. ent data sets include Sncg, Ighv14-2, Ildr2, Samsn1, and We have highlighted a set of genes, the expression of which Synpo2. can be induced by these signaling events. These include With regard to other analyses of cold-dependent changes in Bmp8b, a member of the TGF␤ family that has recently been gene expression in inguinal WAT, the genes we have identified found to be involved in brown adipose tissue activation (62); are highly consistent with a comparison of a 5-wk exposure to Nrg4, a member of the neuregulin family involved in neurite 4 vs. 30°C male C57BL/6 mice [GEO accession GSE13432 no. growth (23); GPR120, a GPCR that has been shown to mediate (64)]. Importantly, Nrg4, GPR120, Slc27a2, Rgs7, Letm1, the anti-inflammatory and insulin-sensitizing effects of ␻-3 Bmp8b, and Cil6l (9030619P08Rik) were also cold induced in fatty acids, with its absence making mice prone to obesity (29); this microarray. In contrast, there was little consistency in the Rgs7, a regulator of G protein signaling that can inhibit signal genes more highly expressed at 30 vs. 4°C in the independent transduction by increasing the GTPase activity of G protein-␣ experiments. It is noteworthy that Nnat was one of the few subunits (4); Slc27a2, an isozyme of the long-chain fatty genes that was found in both microarrays (Acin1, Ccr2, Far1, acid-coenzyme A ligase family that has the capacity to convert Pida3, Zfp36l, Tnfrsf21, and Ostc were also more highly free long-chain fatty acids into fatty acyl-CoA esters and also expressed at thermoneutrality in the 2 analyses). function as a fatty acid transporter (26); Letm1 a mitochondrial The consistency across our microarray, GSE44059, GSE8044, protein involved in calcium transport (60); and Nnat, a member GSE13432, and other published studies confirms the expres- of the proteolipid family of amphipathic polypeptides that sion profile of already identified BAT and brite genes impli- exhibits paternally inherited imprinted expression and is con- cated in transcriptional regulation (Zic1, Lhx8, PGC-1␣, and sidered to play an important role in brain development (33) and Prdm16), mitochondrial function (Cox7a1, UCP1), lipid me- glucose-mediated insulin secretion (32). For some, this is the tabolism (Gyk, Fabp3, Plin5, Elovl3, Pank1, and Cidea), cy- first time that expression has been described in adipocytes. tokine signaling (Otop1), enzymatic activity (Dio2, Cpn2), and More importantly, with our strategy, we have been able to coagulation regulation (Kng1). identify genes that have implications in metabolic pathophys- It is transcriptional regulators that will be pivotal to expres- iology in mouse and/or humans, including GPR120 (29), Rgs7 sion of the brown fat phenotype. Our analysis of relevant (2), and Nnat (58), that have been reported to be associated controls showed PGC-1␣ and PRDM16 were more highly with human obesity in linkage and single-nucleotide polymor- expressed in BAT compared with WAT depots, and the sub- phism analysis. Further studies will address the relevance of cutaneous WAT depot showed increased levels of both factors these molecules for adipocyte/adipose tissue functionality. in response to cold exposure. Therefore, these transcriptional We have compared the transcriptional differences in our regulators or their interplay with coregulators such as RIP140, microarray with other available data sets. In the present study, which at 4°C was lower in BAT vs. WAT, may be central to because intact females were used, some genes may be subject the changes in gene expression due to cold or the depot-specific to cyclical hormonal changes. Although there were a number profiles. Further work is necessary to determine the role of of technical differences between studies, including using the other factors such as Zic1 and Lhx8 in brown and brite gene C57BL/6 strain, the use of males, and maintenance at 23°C expression. [GEO accession no. GSE44059 (44)], the fact that the same We sought to identify regulatory motifs that were specifi- microarray platform was used and expression values were cally enriched in the promoters of the cluster of brite genes

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org E962 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES found from the microarray. Analysis using the MEME-LaB needed to activate the thermogenic functions. To fully evaluate software determined the association of Sp1-binding sites with the role of Nrg4 in the regulation of adipose tissue innervation, one of the motifs. This transcription factor may be relevant to further studies will require the generation of mouse models induction of BAT genes due its interaction with PPAR␥ (1, with depot-specific ablation of the gene. 52). Other notable transcription factors that had putative bind- The discovery that adult humans possess functional BAT has ing sites enriched in the promoters of the brite cluster include opened the possibility for future treatments against obesity that p53 and C/EBP␤, which are known regulators of BAT differ- would boost BAT activity or promote the appearance of brown entiation (35, 38). HNF-4 has recently been reported to be adipocytes in nonclassical BAT locations where white fat downregulated in WAT by cold, and therefore, it may serve to predominates by BAT-inducing drugs or other therapies, such repress BAT gene expression in this tissue (50). Other factors as tissue transplantation or gene therapy. The identification of with putative binding sites, such as BCL-6, SF1, Pax6, and the key transcriptional events associated with browning of ATF-5, showed elevated expression in BAT compared with WAT is important for the understanding of how gene expres- WAT, and therefore, they represent novel potential regulators sion governs this tissue remodeling. of the brown or brite gene expression pattern. It is well established that adipose tissues are composed of GRANTS lipid-filled mature adipocytes and other nonadipocyte cells, This work was supported by Biotechnology and Biological Sciences which form the SVF. The SVF consists of various types of Research Council Grant BB/H020233/1, the EU FP7 project DIABAT cells, including immune cells, fibroblasts, pericytes, endothe- (HEALTH-F2-2011-278373), Wellcome Trust Grant WT093082MA, and the lial cells, adipocyte progenitors, and stromal cells as well as Genesis Research Trust. undefined pools of stem cells. Fractionation of the different depots showed that all of the genes that were selected from the DISCLOSURES microarray for validation or further study were enriched in The authors declare that they have no conflicts of interest, financial or adipocytes compared with the SVF. To evaluate isolated adi- otherwise. pocytes from discrete depots, we generated cell lines from AUTHOR CONTRIBUTIONS precursors of four different adipose depots (BAT and subcutaneous, gonadal, and mesenteric WAT). Our immortalization M.R., A.F., J.O.T., S.C., M.G.P., and M.C. conception and design of research; M.R., A.F., A.O., E.N., S.M., M.E.F., D.M., E.B., W.J.G., S.C., and protocol, which involves the inactivation by temperature of the M.C. performed experiments; M.R., M.K., A.F., A.O., Y.-W.C., E.N., S.M., SV40 T antigen prior to differentiation, prevents sequestration M.E.F., D.M., J.D.M., W.J.G., G.M., and M.C. analyzed data; M.R., J.D.M., of retinoblastoma protein, avoiding the risk of driving white G.M., M.G.P., and M.C. interpreted results of experiments; M.R., M.K., A.F., preadipocytes into “brown-like” adipocytes (45). The adi- A.O., Y.-W.C., and M.C. prepared figures; M.R. and M.C. drafted manuscript; pocyte cell lines demonstrate clear characteristics that corre- M.R., S.C., M.G.P., and M.C. edited and revised manuscript; M.R., J.D.M., and M.C. approved final version of manuscript. spond to their depot of origin, with the highest expression of UCP1, Cidea, Rgs7, and Nrg4 detected in the differentiated REFERENCES brown adipocytes. Cil6l was present at the highest levels in differentiated subcutaneous white adipocytes, in agreement 1. Aguilo F, Camarero N, Relat J, Marrero PF, Haro D. Transcriptional with tissue expression pattern. The induction of UCP1 and regulation of the human acetoacetyl-CoA synthetase gene by PPAR- ␣ ␤ gamma. Biochem J 427: 255–264, 2010. PGC-1 , in response to a 3-stimulus, was greatest in the 2. Aissani B, Perusse L, Lapointe G, Chagnon YC, Bouchard L, Walts B, adipocytes generated from BAT, followed by subcutaneous Bouchard C. A quantitative trait locus for body fat on chromosome 1q43 WAT and gonadal WAT, with mesenteric WAT being unre- in French Canadians: linkage and association studies. Obesity (Silver sponsive. The cell lines we generated retain functional ␤-ad- Spring) 14: 1605–1615, 2006. 3. Almind K, Manieri M, Sivitz WI, Cinti S, Kahn CR. Ectopic brown renergic and insulin pathways, oxidative metabolism, and an adipose tissue in muscle provides a mechanism for differences in risk of inflammatory response that very similar to what is found in the metabolic syndrome in mice. Proc Natl Acad Sci USA 104: 2366–2371, different adipose tissue depots. Overall, we can conclude that 2007. these cell lines are a reliable model for in vitro studies of 4. Anderson GR, Posokhova E, Martemyanov KA. The R7 RGS protein different adipose tissue depots and are a powerful tool for family: multi-subunit regulators of neuronal G protein signaling. Cell Biochem Biophys 54: 33–46, 2009. future drug discovery studies. 5. Asano A, Irie Y, Saito M. Isoform-specific regulation of vascular endo- We undertook further study of Nrg4, as it was both highly thelial growth factor (VEGF) family mRNA expression in cultured mouse enriched in BAT vs. WAT and upregulated in WAT following brown adipocytes. Mol Cell Endocrinol 174: 71–76, 2001. cold exposure and seemed likely to be an important novel 6. Bamezai A. Mouse Ly-6 proteins and their extended family: markers of cell differentiation and regulators of cell signaling. Arch Immunol Ther signaling factor in adipose tissue that could have a key role in Exp (Warsz) 52: 255–266, 2004. adipocyte-neuronal cross-talk. We found NRG4 to be secreted 7. Barbatelli G, Murano I, Madsen L, Hao Q, Jimenez M, Kristiansen K, by brown adipocytes but not preadipocytes. Using PC12 pheo- Giacobino JP, De Matteis R, Cinti S. The emergence of cold-induced chromocytoma cells stably expressing the receptor for NRG4 brown adipocytes in mouse white fat depots is determined predominantly and ERBB4, we have been able to show that NRG4 is a by white to brown adipocyte transdifferentiation. Am J Physiol Endocrinol Metab 298: E1244–E1253, 2010. BAT/brite adipokine. One of the key differences between 9. Bartelt A, Bruns OT, Reimer R, Hohenberg H, Ittrich H, Peldschus K, brown and white adipose tissue is the degree of sympathetic Kaul MG, Tromsdorf UI, Weller H, Waurisch C, Eychmuller A, innervation (54). Previous studies have indicated that nerve Gordts PL, Rinninger F, Bruegelmann K, Freund B, Nielsen P, growth factor is produced in BAT (41). Our data indicate that Merkel M, Heeren J. Brown adipose tissue activity controls triglyceride clearance. Nat Med 17: 200–205, 2011. NRG4 could be a key factor for the development of BAT and 10. Benjamini Y, Drai D, Elmer G, Kafkafi N, Golani I. Controlling the acquisition of BAT features of WAT depots by promoting the false discovery rate in behavior genetics research. Behav Brain Res 125: growth of neurites and thus enhancing innervation of the tissue 279–284, 2001.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES E963

11. Brenner C, Simmonds RE, Wood S, Rose V, Feldmann M, Turner J. overlaps with brite in the supraclavicular region of adult humans. Cell TLR signalling and adapter utilization in primary human in vitro differ- Metab 17: 798–805, 2013. entiated adipocytes. Scand J Immunol 76: 359–370, 2012. 32. Joe MK, Lee HJ, Suh YH, Han KL, Lim JH, Song J, Seong JK, Jung 12. Cinti S. Transdifferentiation properties of adipocytes in the adipose organ. MH. Crucial roles of neuronatin in insulin secretion and high glucose- Am J Physiol Endocrinol Metab 297: E977–E986, 2009. induced apoptosis in pancreatic beta-cells. Cell Signal 20: 907–915, 2008. 13. Cypess AM, White AP, Vernochet C, Schulz TJ, Xue R, Sass CA, 33. Joseph R, Dou D, Tsang W. Molecular cloning of a novel mRNA Huang TL, Roberts-Toler C, Weiner LS, Sze C, Chacko AT, Des- (neuronatin) that is highly expressed in neonatal mammalian brain. champs LN, Herder LM, Truchan N, Glasgow AL, Holman AR, Biochem Biophys Res Commun 201: 1227–1234, 1994. Gavrila A, Hasselgren PO, Mori MA, Molla M, Tseng YH. Anatomical 34. Kahn SE, Hull RL, Utzschneider KM. Mechanisms linking obesity to localization, gene expression profiling and functional characterization of insulin resistance and type 2 diabetes. Nature 444: 840–846, 2006. adult human neck brown fat. Nat Med 19: 635–639, 2013. 35. Karamanlidis G, Karamitri A, Docherty K, Hazlerigg DG, Lomax 14. Du P, Kibbe WA, Lin SM. lumi: a pipeline for processing Illumina MA. C/EBPbeta reprograms white 3T3-L1 preadipocytes to a Brown microarray. Bioinformatics 24: 1547–1548, 2008. adipocyte pattern of gene expression. J Biol Chem 282: 24660–24669, 15. Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI 2007. gene expression and hybridization array data repository. Nucleic Acids Res 36. Lidell ME, Betz MJ, Dahlqvist Leinhard O, Heglind M, Elander L, 30: 207–210, 2002. Slawik M, Mussack T, Nilsson D, Romu T, Nuutila P, Virtanen KA, 16. Frontini A, Cinti S. Distribution and development of brown adipocytes in Beuschlein F, Persson A, Borga M, Enerback S. Evidence for two types the murine and human adipose organ. Cell Metab 11: 253–256, 2010. of brown adipose tissue in humans. Nat Med 19: 631–634, 2013. 17. Gaich G, Chien JY, Fu H, Glass LC, Deeg MA, Holland WL, 37. Lottaz C, Yang X, Scheid S, Spang R. OrderedList—a bioconductor Kharitonenkov A, Bumol T, Schilske HK, Moller DE. The effects of package for detecting similarity in ordered gene lists. Bioinformatics 22: LY2405319, an FGF21 analog, in obese human subjects with type 2 2315–2316, 2006. diabetes. Cell Metab 18: 333–340, 2013. 38. Molchadsky A, Ezra O, Amendola PG, Krantz D, Kogan-Sakin I, 18. García-Martinez C, Sibille B, Solanes G, Darimont C, Macé K, Buganim Y, Rivlin N, Goldfinger N, Folgiero V, Falcioni R, Sarig R, Villarroya F, Gómez-Foix AM. Overexpression of UCP3 in cultured Rotter V. p53 is required for brown adipogenic differentiation and has a human muscle lowers mitochondrial membrane potential, raises ATP/ protective role against diet-induced obesity. Cell Death Differ 20: 774– ADP ratio, and favors fatty acid vs. glucose oxidation. FASEB J 15: 783, 2013. 2033–2035, 2001. 39. Morganstein DL, Christian M, Turner JJ, Parker MG, White R. 19. Gautier L, Cope L, Bolstad BM, Irizarry RA. affy–analysis of Af- Conditionally immortalized white preadipocytes: a novel adipocyte model. fymetrix GeneChip data at the probe level. Bioinformatics 20: 307–315, J Lipid Res 49: 679–685, 2008. 2004. 40. Murano I, Barbatelli G, Giordano A, Cinti S. Noradrenergic parenchy- 20. Gburcik V, Cleasby ME, Timmons JA. Loss of neuronatin promotes mal nerve fiber branching after cold acclimatisation correlates with brown “browning” of primary mouse adipocytes while reducing Glut1-mediated adipocyte density in mouse adipose organ. J Anat 214: 171–178, 2009. 41. Néchad M, Ruka E, Thibault J. Production of nerve growth factor by glucose disposal. Am J Physiol Endocrinol Metab 304: E885–E894, 2013. brown fat in culture: relation with the in vivo developmental stage of the 21. Gesta S, Tseng YH, Kahn CR. Developmental origin of fat: tracking tissue. Comp Biochem Physiol Comp Physiol 107: 381–388, 1994. obesity to its source. Cell 131: 242–256, 2007. 42. Petrovic N, Walden TB, Shabalina IG, Timmons JA, Cannon B, 22. Hallberg M, Morganstein DL, Kiskinis E, Shah K, Kralli A, Dilworth Nedergaard J. Chronic peroxisome proliferator-activated receptor gamma SM, White R, Parker MG, Christian M. A functional interaction (PPARgamma) activation of epididymally derived white adipocyte cultures between RIP140 and PGC-1alpha regulates the expression of the lipid reveals a population of thermogenically competent, UCP1-containing adi- droplet protein CIDEA. Mol Cell Biol 28: 6785–6795, 2008. pocytes molecularly distinct from classic brown adipocytes. J Biol Chem 285: 23. Harari D, Tzahar E, Romano J, Shelly M, Pierce JH, Andrews GC, 7153–7164, 2010. Yarden Y. Neuregulin-4: a novel growth factor that acts through the 43. Rodríguez A, Catalán V, Gómez-Ambrosi J, Frühbeck G. Visceral and ErbB-4 receptor tyrosine kinase. Oncogene 18: 2681–2689, 1999. subcutaneous adiposity: are both potential therapeutic targets for tackling 24. Hayes NV, Blackburn E, Smart LV, Boyle MM, Russell GA, Frost the metabolic syndrome? Curr Pharm Des 13: 2169–2175, 2007. TM, Morgan BJ, Baines AJ, Gullick WJ. Identification and character- 44. Rosenwald M, Perdikari A, Rulicke T, Wolfrum C. Bi-directional ization of novel spliced variants of neuregulin 4 in prostate cancer. Clin interconversion of brite and white adipocytes. Nat Cell Biol 15: 659–667, Cancer Res 13: 3147–3155, 2007. 2013. 25. Hayes NV, Newsam RJ, Baines AJ, Gullick WJ. Characterization of the 45. Scime A, Grenier G, Huh MS, Gillespie MA, Bevilacqua L, Harper cell membrane-associated products of the Neuregulin 4 gene. Oncogene ME, Rudnicki MA. Rb and p107 regulate preadipocyte differentiation 27: 715–720, 2008. into white versus brown fat through repression of PGC-1alpha. Cell Metab 26. Hirai T, Fukui Y, Motojima K. PPARalpha agonists positively and 2: 283–295, 2005. negatively regulate the expression of several nutrient/drug transporters in 46. Seale P, Bjork B, Yang W, Kajimura S, Chin S, Kuang S, Scimè A, mouse small intestine. Biol Pharm Bull 30: 2185–2190, 2007. Devarakonda S, Conroe HM, Erdjument-Bromage H, Tempst P, 27. Hsu SM, Raine L, Fanger H. Use of avidin-biotin-peroxidase complex Rudnicki MA, Beier DR, Spiegelman BM. PRDM16 controls a brown (ABC) in immunoperoxidase techniques: a comparison between ABC and fat/skeletal muscle switch. Nature 454: 961–967, 2008. unlabeled antibody (PAP) procedures. J Histochem Cytochem 29: 577– 47. Seale P, Conroe HM, Estall J, Kajimura S, Frontini A, Ishibashi J, 580, 1981. Cohen P, Cinti S, Spiegelman BM. Prdm16 determines the thermogenic 28. Ibrahim MM. Subcutaneous and visceral adipose tissue: structural and program of subcutaneous white adipose tissue in mice. J Clin Invest 121: functional differences. Obes Rev 11: 11–18, 2010. 96–105, 2011. 29. Ichimura A, Hirasawa A, Poulain-Godefroy O, Bonnefond A, Hara T, 48. Seale P, Kajimura S, Yang W, Chin S, Rohas LM, Uldry M, Tavernier Yengo L, Kimura I, Leloire A, Liu N, Iida K, Choquet H, Besnard P, G, Langin D, Spiegelman BM. Transcriptional control of brown fat Lecoeur C, Vivequin S, Ayukawa K, Takeuchi M, Ozawa K, Tauber determination by PRDM16. Cell Metab 6: 38–54, 2007. M, Maffeis C, Morandi A, Buzzetti R, Elliott P, Pouta A, Jarvelin MR, 49. Sharp LZ, Shinoda K, Ohno H, Scheel DW, Tomoda E, Ruiz L, Hu H, Korner A, Kiess W, Pigeyre M, Caiazzo R, Van Hul W, Van Gaal L, Wang L, Pavlova Z, Gilsanz V, Kajimura S. Human BAT possesses Horber F, Balkau B, Levy-Marchal C, Rouskas K, Kouvatsi A, molecular signatures that resemble beige/brite cells. PLoS One 7: e49452, Hebebrand J, Hinney A, Scherag A, Pattou F, Meyre D, Koshimizu 2012. TA, Wolowczuk I, Tsujimoto G, Froguel P. Dysfunction of lipid sensor 50. Shore AM, Karamitri A, Kemp P, Speakman JR, Graham NS, Lomax GPR120 leads to obesity in both mouse and human. Nature 483: 350–354, MA. Cold-induced changes in gene expression in brown adipose tissue, 2012. white adipose tissue and liver. PLoS One 8: e68933, 2013. 30. Ishibashi J, Seale P. Medicine. Beige can be slimming. Science 328: 51. Smorlesi A, Frontini A, Giordano A, Cinti S. The adipose organ: 1113–1114, 2010. white-brown adipocyte plasticity and metabolic inflammation. Obes Rev 31. Jespersen NZ, Larsen TJ, Peijs L, Daugaard S, Homoe P, Loft A, de 13, Suppl 2: 83–96, 2012. Jong J, Mathur N, Cannon B, Nedergaard J, Pedersen BK, Moller K, 52. Sugawara A, Takeuchi K, Uruno A, Ikeda Y, Arima S, Kudo M, Sato Scheele C. A classical brown adipose tissue mRNA signature partly K, Taniyama Y, Ito S. Transcriptional suppression of type 1 angiotensin

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org E964 COLD-INDUCED TRANSCRIPTIONAL CHANGES IN ADIPOSE TISSUES

II receptor gene expression by peroxisome proliferator-activated receptor- EF hand-containing transmembrane protein 1 (Letm1) and uncoupling gamma in vascular smooth muscle cells. Endocrinology 142: 3125–3134, proteins 2 and 3 (UCP2/3) contribute to two distinct mitochondrial Ca2ϩ 2001. uptake pathways. J Biol Chem 286: 28444–28455, 2011. 53. Tiraby C, Tavernier G, Lefort C, Larrouy D, Bouillaud F, Ricquier D, 61. Waldén TB, Hansen IR, Timmons JA, Cannon B, Nedergaard J. Langin D. Acquirement of brown fat cell features by human white Recruited vs. nonrecruited molecular signatures of brown, “brite,” and adipocytes. J Biol Chem 278: 33370–33376, 2003. white adipose tissues. Am J Physiol Endocrinol Metab 302: E19–E31, 54. Trayhurn P, Ashwell M. Control of white and brown adipose tissues by 2012. the autonomic nervous system. Proc Nutr Soc 46: 135–142, 1987. 62. Whittle AJ, Carobbio S, Martins L, Slawik M, Hondares E, Vázquez 55. Tuomisto MT, Parkkinen L. Deﬁning behavior-environment interac- MJ, Morgan D, Csikasz RI, Gallego R, Rodriguez-Cuenca S, Dale M, tions: translating and developing an experimental and applied behavior- Virtue S, Villarroya F, Cannon B, Rahmouni K, López M, Vidal-Puig analytic vocabulary in and to the national language. J Exp Anal Behav 97: A. BMP8B increases brown adipose tissue thermogenesis through both 347–355, 2012. central and peripheral actions. Cell 149: 871–885, 2012. 56. Virtue S, Vidal-Puig A. It’s not how fat you are, it’s what you do with it 63. Wu J, Boström P, Sparks LM, Ye L, Choi JH, Giang AH, Khandekar that counts. PLoS Biol 6: e237, 2008. M, Virtanen KA, Nuutila P, Schaart G, Huang K, Tu H, van Marken 57. Vitali A, Murano I, Zingaretti MC, Frontini A, Ricquier D, Cinti S. The adipose organ of obesity-prone C57BL/6J mice is composed of mixed Lichtenbelt WD, Hoeks J, Enerbäck S, Schrauwen P, Spiegelman BM. white and brown adipocytes. J Lipid Res 53: 619–629, 2012. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and 58. Vrang N, Meyre D, Froguel P, Jelsing J, Tang-Christensen M, Vatin V, human. Cell 150: 366–376, 2012. Mikkelsen JD, Thirstrup K, Larsen LK, Cullberg KB, Fahrenkrug J, 64. Xue Y, Petrovic N, Cao R, Larsson O, Lim S, Chen S, Feldmann HM, Jacobson P, Sjöström L, Carlsson LM, Liu Y, Liu X, Deng HW, Larsen Liang Z, Zhu Z, Nedergaard J, Cannon B, Cao Y. Hypoxia-indepen- PJ. The imprinted gene neuronatin is regulated by metabolic status and dent angiogenesis in adipose tissues during cold acclimation. Cell Metab associated with obesity. Obesity (Silver Spring) 18: 1289–1296, 2010. 9: 99–109, 2009. 59. Wajchenberg BL. Subcutaneous and visceral adipose tissue: their relation 65. Yu XX, Lewin DA, Forrest W, Adams SH. Cold elicits the simultaneous to the metabolic syndrome. Endocr Rev 21: 697–738, 2000. induction of fatty acid synthesis and beta-oxidation in murine brown 60. Waldeck-Weiermair M, Jean-Quartier C, Rost R, Khan MJ, Vishnu adipose tissue: prediction from differential gene expression and conﬁrma- N, Bondarenko AI, Imamura H, Malli R, Graier WF. Leucine zipper tion in vivo. FASEB J 16: 155–168, 2002.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00473.2013 • www.ajpendo.org