Investigation of the Microbial Community Associated with The

Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Sandra Cruz Vicente Mestrado em Genética Forense Departamento de Biologia 2017/2018

Orientador Maria de Fátima Carvalho, PhD, Investigadora no Centro Interdisciplinar de Investigação Marinha e Ambiental (CIIMAR)

Coorientadores Fernando Tavares, Professor Auxiliar, Faculdade de Ciências da Universidade do Porto Filipe Pereira, PhD, Universidade do Porto

Todas as correções determinadas pelo júri, e só essas, foram efetuadas.

O Presidente do Júri,

Porto, ______/______/______FCUP 3 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Dissertação de candidatura ao grau de Mestre em Genética Forense submetida à Faculdade de Ciências da Universidade do Porto.

O presente trabalho foi desenvolvido no Centro Interdisciplinar de Investigação Marinha e Ambiental (CIIMAR) sob a orientação científica dos Doutores Maria de Fátima Carvalho e Filipe Pereira e na Faculdade de Ciências da Universidade do Porto, sob a coorientação do Professor Doutor Fernando Tavares.

Dissertation for applying to a Master’s Degree in Forensic Genetics, submitted to the Faculty of Sciences of the University of Porto.

The present work was developed at Interdisciplinary Centre of Marine and Environmental Research (CIIMAR) under the scientific supervision of Maria de Fátima Carvalho, PhD, and Filipe Pereira, PhD, and at Faculty of Sciences of the University of Porto, under the scientific co-supervision of Fernando Tavares, Associate Professor. FCUP 4 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

“You all carry greatness with you and you have your own idea of what it means.” Jackie Mills FCUP 5 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Acknowledgments

First of all, I would like to thank my supervisor Dr. Maria de Fátima Carvalho for the opportunity to carry on the work started by Zita Couto, for sharing scientific knowledge, for the determination, dedication and, most of all for believing in me. Secondly I would like to thank Professor Fernando Tavares for the guidance and the help. I would like to express my appreciation to Dr. Filipe Pereira for the suggestions, assistance and all the patience. I am very grateful to Inês Ribeiro for being a life saver and for the supportive words. I would be lost without you. I would also like to thank Diogo Alexandrino, Maria Leonor Martins and Joana Fernandes for all the help in the laboratory through my journey. Last but not least, I would like to thank my colleagues at ECOBIOTEC for the support, the chats, the laughs and the good environment. You made it a lot more fun.

FCUP 6 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Resumo

Os compostos fluorados têm atualmente um grande impacto nas nossas vidas, sendo utilizados em várias aplicações. A maioria dos compostos fluorados é sintetizada quimicamente, o que contrasta fortemente com as moléculas fluoradas com origem natural, as quais são extremamente raras. O fluoroacetato (FA) é o composto fluorado natural mais comum e foi descoberto pela primeira vez na planta sul-africana Dichapetalum cymosum, tendo sido mais tarde descoberto em outras plantas que habitam regiões tropicais e subtropicais do planeta. Mais recentemente descobriu-se que este composto é também produzido por um pequeno número de actinobactérias, através da ação de uma enzima especial, a fluorinase, que tem a capacidade de catalisar a formação da ligação C-F. Até ao momento, desconhece-se o mecanismo pelo qual as plantas produzem FA e ainda não é claro se serão as plantas ou a comunidade microbiana associada os verdadeiros responsáveis pela produção deste composto. Neste contexto, este estudo teve como objetivo investigar se a comunidade microbiana associada à planta D. cymosum poderá ter um papel na produção do FA presente na planta. O estudo teve como base uma dissertação de mestrado anterior, durante a qual a comunidade microbiana cultivável das folhas, caules e do solo adjacente à planta sul-africana foi isolada utilizando métodos especialmente focados no isolamento de microrganismos pertencentes ao filo Actinobacteria. Nesse estudo, foram isoladas 206 estirpes microbianas e parte delas foram identificadas taxonomicamente. O presente estudo focou-se (i) na identificação filogenética dos restantes isolados, (ii) no estudo da comunidade microbiana por métodos independentes de cultivo, nomeadamente por análise metagenómica (iii) na investigação da possível presença do gene da fluorinase nas estirpes microbianas isoladas da planta, através de ensaios de dot blot. Os resultados revelaram que a maioria dos isolados microbianos obtidos da planta D. cymsum pertence aos filos Actinobacteria (o principal alvo dos métodos de isolamento) e Proteobacteria. Alguns microrganismos foram ainda identificados como pertencentes ao filo Firmicutes, tendo também sido isoladas várias estirpes de fungos associadas ao filo Ascomycota. A análise metagenómica evidenciou grupos taxonómicos bacterianos distintos dos identificados pelos métodos dependentes de cultivo, indicando que estes métodos produzem resultados complementares e são ambos necessários para uma boa compreensão da comunidade bacteriana presente na planta. De acordo com os resultados desta análise, os filos Proteobacteria e FCUP 7 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Cyanobacteria foram os mais predominantes nas folhas e caules da planta D. cymosum. Os caules também tiveram uma elevada abundância de microrganismos afiliados aos filos Actinobacteria e Acidobacteria, enquanto os filos Actinobacteria, Proteobacteria e Acidobacteria foram os mais representados no solo adjacente à planta. Os ensaios de dot blot demonstraram não ser eficazes para a investigação do gene da fluorinase nas estirpes microbianas isoladas a partir de D. cymosum, uma vez que a maioria das reações revelou ser resultados falso positivos. Embora este estudo não tenha fornecido uma resposta clara se os microrganismos associados à planta D. cymosum podem ter um papel na produção de FA, é certamente uma contribuição importante para o aumento da informação disponível sobre o microbioma das plantas produtoras de FA.

Palavras-chave: Fluoroacetato; Fluorinase; Actinobacteria; Streptomyces; Dichapetalum cymosum; Metagenómica; Hibridização Dot blot. FCUP 8 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Abstract

Fluorinated compounds have nowadays an enormous impact in our lives, being used in several applications. Most fluorinated compounds are chemically synthetized, which highly contrasts with fluorinated molecules with a natural origin that are extremely rare. Fluoroacetate (FA) is the most common natural fluorinated compound, and was firstly discovered in the South African plant Dichapetalum cymosum, and later in many other plants inhabiting tropical and sub-tropical regions of the globe. More recently, this compound was also found to be produced by a small number of Actinobacteria, through the action of a special enzyme, the fluorinase, that catalyses the formation of a C-F bond. To date, it is not known how plants produce FA and it is not yet clear whether the plants or the associated microbial community are the true responsible for this production. In this context, the current study aimed to investigate if the microbial community associated with the plant D. cymosum could have a role in the production of the FA present in the plant. The study was based on a previous MSc work, during which the culturable microbial community of the leaves and stems and of the soil in the vicinity of the South African plant was isolated using methods especially targeting microorganisms belonging to the phylum Actinobacteria. In that study 206 microbial strains were isolated and part was taxonomically identified. The present study focused on (i) the phylogenetic identification of the remaining isolates, (ii) study of the microbial community through culture-independent methods, namely metagenomics analysis, and (iii) the investigation of the possible presence of the fluorinase gene in the microbial strains isolated from the plant, through dot blot assays. Results revealed that the majority of the microbial isolates obtained from D. cymosum belonged to the phyla Actinobacteria (the main target of the isolation methods) and Proteobacteria, with some microorganisms of the phylum Firmicutes being also identified. Several fungal strains affiliated with the phylum Ascomycota were also isolated. Metagenomics analysis revealed bacterial taxonomic groups distinct from the ones identified through culture-dependent methods, indicating that these methods yield complementary results and are both necessary for a deeper knowledge of the bacterial community present in the plant. According to metagenomics results, the phyla Proteobacteria and Cyanobacteria were the most predominant in the leaves and stems of D. cymosum. Stems of the plant were also abundant in microorganisms affiliated with the phyla Actinobacteria and Acidobacteria, while the phyla Actinobacteria, FCUP 9 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Proteobacteria and Acidobacteria were more represented in the soil in the vicinity of the plant. Dot blot assays did not reveal to be effective for the investigation of the fluorinase gene in the microbial strains isolated from D. cymosum, as most of the reactions showed to be false positive results. Though this study did not provide a clear answer if microorganisms associated with D. cymosum may have a role in the production of FA, it is an important contribution for increasing the knowledge on the microbiome of FA producing plants.

Keywords: Fluoroacetate; Fluorinase; Actinobacteria; Streptomyces; Dichapetalum cymosum; Metagenomics; Dot blot hybridization. FCUP 10 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Table of contents

Acknowledgments ...... 5

Resumo ...... 6

Abstract ...... 8

Table of contents ...... 10

List of tables ...... 12

List of figures ...... 13

List of abbreviations ...... 14

I. Introduction ...... 15

1. Fluorinated Compounds...... 15

1.1. Natural Fluorinated Compounds ...... 15

1.2. Natural Fluorinated Compounds in Plants ...... 16

1.2.1. Dichapetalum cymosum and Fluoroacetate ...... 16

1.3. Natural Fluorinated Compounds with a microbial origin ...... 18

1.3.1. Actinobacteria and Fluoroacetate ...... 18

1.3.2. General Characteristics of the Phylum Actinobacteria ...... 19

1.3.3. Actinobacteria and mechanism of FA production ...... 20

2. Potential of FA in forensics ...... 21

II. Aims ...... 22

III. Materials and methods ...... 23

1. DNA extraction for 16S or ITS rRNA gene sequencing ...... 23

2. Taxonomic identification ...... 24

3. Dot blot hybridization ...... 25

3.1. Detection of flu by dot blot hybridization ...... 25

3.2. Screening microbial isolates by PCR ...... 27

4. Metagenomics Analysis of the bacterial community of D. cymosum ...... 27 FCUP 11 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

4.1. Extraction of DNA from samples of stems and leaves of D. cymosum and

from soil in its vicinity ...... 27

4.2. Metagenomics analysis ...... 27

IV. Results and discussion ...... 29

1. Taxonomic identification of microbial isolates obtained from D. cymosum ...... 29

2. Investigation of the presence of fluorinase gene by dot blot hybridization ...... 38

3. Metagenomics analysis of the microbial community associated with D.

cymosum ...... 40

V. Conclusions and future perspectives ...... 45

VI. References ...... 46

FCUP 12 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

List of Tables

Table 1. Primers used for amplification of fluorinase gene…………….…….………25

Table 2. Frame detailing the distribution of DNA from D. cymosum isolates in a 8 x 12 cm nylon membrane…………………………………………………..…………………..26

Table 3. Taxonomic identification of some microbial strains isolated from D. cymosum and from the soil in its vicinity by Couto (2016) and not identified in the timeframe of that work……………………………………………………………………………………30

Table 4. Metagenomics results showing the relative abundance of each taxonomic group in the leaves and stems of D.cymosum and in the soil in its vicinity (relative abundances below 1% were not considered)……………………………….…………44

FCUP 13 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

List of Figures

Figure 1. Structure of some fluorinated natural compounds currently known (Adapted from O’Hagan and Deng, 2015)……………………………………………………………..16

Figure 2. Dichapetalum cymosum………………………………………………………….17

Figure 3. Production of fluoroacetate (FA) by Streptomyces cattleya (Adapted from Dong et al., 2004)……………………………………………………………………………..21

Figure 4. Primers Flu226F, Flu524F, Flu435R and Flu721R and expected size of the amplified products…………………………………………………………………………….26

Figure 5. Distribution by phylum of the microbial isolates from D. cymosum identified in this study……………………………………………………………………………………….32

Figure 6. Number of microbial isolates from D. cymosum identified in this study, distributed by genera…………………………………………………………………………32

Figure 7. Comparison of the genera identified in this study for the strains isolated from the leaves and stems of D. cymosum and from the soil in its vicinity…….……….…….33

Figure 8. Phylogenetic tree of bacterial (A) and fungal (B) isolates obtained from the leaves and stems of D. cymosum and from its surrounding soil. Only bootstrap values higher than 60% are indicated in the trees. Numbers in parenthesis correspond to GenBank accession numbers……………………………………...………..………...... 37

Figure 9. Dot blot signals obtained for some microbial strains isolated from D. cymosum. ……………………………………………………………….…………………….38

Figure 10. PCR results obtained for the isolate FEN2 with primers used to construct Probe 2 (Flu524F and Flu721R)………………………………………………………....….39

Figure 11. Distribution of the main bacterial phyla according to the metagenomics analysis of the leaves (A), stems (B) of D. cymosum and of the soil (C) in the neighborhood of the plant…………………………………………………………….……...41

FCUP 14 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

List of Abbreviations

4-FT 4–fluorothreonine 5’-FDA 5’–fluoro–5’–deoxyadenosine BLAST Basic Local Alignment Search Tool bp Base pair (s) DNA Deoxyribonucleic acid FA Fluoroacetate Fig. Figure HCH hexachlorocyclohexane ITS Internal transcribed spacer region NCBI National Center for Biotechnology Information PCA Plate Count Agar PCR Polymerase Chain Reaction RH Raffinose – Histidine agar RNA Ribonucleic acid rRNA Ribosomal RNA SAM S–(5’–adenosyl)–L-methionine SCN Starch Casein Nitrate agar SYBR (Z)-4-((3-Methylbenzo[d]thiazol-2(3H)-ylidene)methyl)-1- propylquinolin-1-ium 4-methylbenzenesulfonate TE Tris-EDTA TWYE Tap Water Yeast Extract agar

FCUP 15 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

I. Introduction

1. Fluorinated Compounds

Fluorine is a very peculiar element, relatively abundant in the Earth’s crust (Key et al., 1997) that was firstly isolated by Henry Moissan in 1886 (Wisniak, 2002). It is the most electronegative of all elements of the periodic table (3.98 in the Pauling scale) (Shah and Westwell, 2007) and is able to form strong bonds with several elements, forming one of the strongest bonds known in nature with carbon (Okazoe, 2009; Shah and Westwell, 2007; Harper and O'Hagan, 1994). It also has a quite small atomic radius, a characteristic that allows the replacement of one or more hydrogen atoms in an organic structure by fluorine without causing much steric impact. All together these characteristics generally increase the stability, biological availability and activity of fluorinated molecules (Key et al., 1997). Fluorinated compounds have, nowadays, an enormous impact in our lives, being used in several applications such as pesticides, fire retardants, plastics, pharmaceuticals, surfactants, aerosol propellants, among others (Leong et al., 2017; Key et al., 1997). These compounds are, however, all chemically synthetized and many of them are now important environmental pollutants (Carvalho and Oliveira, 2017).

1.1. Natural Fluorinated Compounds

It is very uncommon to find fluorinate compounds with a natural origin (Dong et al., 2004; Eustáquio, 2010), although some terrestrial and marine organisms can store substantial amounts of inorganic fluorine (Harper et al., 2003). So far, these compounds have been found to be produced by a few tropical and subtropical plants and by a low number of bacterial species affiliated with the phylum Actinobacteria (Murphy et al., 2003b; Deng et al. 2014; As far as is known, no organofluorine compound has been isolated from terrestrial or marine animals organisms (Harper and O'Hagan, 1994). There are roughly twenty fluorinated natural compounds known, the most common of them being fluoroacetate (FA) (Fig. 1). FA was firstly identified in the South African plant, Dichapetalum cymosum, and later discovered in other plants distributed mainly in tropical and sub-tropical regions, as in Africa, Australia and Brazil (O’Hagan and Deng, 2015; O’Hagan et al., 1993). FCUP 16 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Figure 1. Structure of some fluorinated natural compounds currently known (Adapted from O’Hagan and Deng, 2015).

1.2. Natural Fluorinated Compounds in Plants

1.2.1. Dichapetalum cymosum and Fluoroacetate

Dichapetalum cymosum or gigblaar (Fig. 2), as is commonly known (Marais, 1943; Marais, 1944), is a plant mostly found in South Africa, Zimbabwe, Namibia, Angola and Zambia that is well-known for being poisonous to animals and humans (Marais, 1943; Phillips et al., 1993; Goncharov et al., 2006). This plant has been considered a risk to the livestock sector in Southern Africa since the effects of its ingestion were discovered (Van der Merwe and Du Plessis, 2006; Meyer and Grobbelaar, 1991). The ingestion of leaves of D. cymosum can cause lethal effects due to heart failure, especially in herbivores, and severe impacts in the central nervous system, more common in carnivores, leading to significant economic losses when material from this plant is ingested by grazing animals (Phillips et al., 1993; Hall and Cain, 1972; Aplin, 1971). For example, half a leaf is enough to kill a bullock (Gribble, 2002). The production of leaves of this perennial plant FCUP 17 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome typically happens only once a year, more specifically during spring (August to November) (Grobbelaar and Meyer, 1990). D. cymosum may be considered an underground tree with its leaves occurring just above the ground, although it has also been called as an underground climber (Phillips et al., 1993). The plant hardly ever produces flowers and it is even more unlikely to find fruits, but a small percentage of the flowers may indeed produce them (Phillips, et al., 1993). The fruits are also, apparently, toxic (Steyn, 1928).

Figure 2. Dichapetalum cymosum

The toxic principle of D. cymosum was first reported in 1943 by Marais as potassium cymonate, but it was only in 1944 that the true toxic component of this plant was identified and isolated in a region of South Africa (Meyer and Grobbelaar, 1990; Murphy et al., 2003a). The compound, identified as FA, is the first and most common fluorinated compound known to be produced by biological means (Eloff and Von Sydow, 1971; Murphy et al., 2003a; Harper et al., 2003). It is assumed that the plant produces FA in order to defend itself from local grazing herbivores (Leong et al., 2017), Young leaves of D. cymosum have reasonaby higher concentrations of FA (231.9 mg/kg) than old leaves (97.0 mg/kg), which is consistent with the fact that FA is accumulated easier by young leaves rather than old ones, reason why old leaves are less toxic (Grobbelaar and Meyer, 1990). It also seems that the FA accumulated in the leaves is very stable, as a study conducted by Aplin (1971) showed that after two years of storage the leaves were still toxic to sheep. Since the discovery of FA in D. cymosum, several other species from the Dichapetalaceae family were also found to produce this compound, including D. stuhlmanii, D. toxicarium, D. heudelotii, D. michelsonii, D. guineense, D. venenatum, D. macrocarpum, D. ruhlandii, D. barteri and D. edule (Gribble, 2002; Harper and O'Hagan, 1994). Apart from this family of plants, FA has been additionally found in some other tropical and sub-tropical plants distributed not only in Africa but also in other continents, FCUP 18 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome such as South America, Asia and Australia, showing a preference for dry soils (Aplin, 1971; Hall and Cain, 1972; Twigg et al., 1996). Levels of FA in plants can vary significantly depending on the plant species, age and the season (Harper et al., 2003). For instance, the Australian FA producing plants Oxylobium parviflorum and Gastrolobium bilobum can accumulate up to 2600 ppm of FA in their leaves and 6500 ppm in their seeds, while young leaves and seeds of Tanzanian Dichapetalum braunii, can accumulate up to 8000 ppm of FA, which is the highest concentration known to be produced (Aplin, 1971; Twigg et al., 1996; O’Hagan et al., 1993). The toxicity of FA can be explained by the blockage of the tricarboxylic acid cycle due to the conversion of FA to (2R,3R)-fluorocitrate, which is the only toxic form of fluorocitrate (Sherley, 2004; Sherley, 2007; Eason et al., 2011). Additionally, this metabolite also competitively inhibits the enzyme aconitase, which hinders the metabolism of citrate, leading to its accumulation in the cells (Eason et al., 2011; Eloff and Von Sydow, 1971; Goncharov et al., 2006). To date, it is not known how plants produce FA or if this compound is really produced by the plant or just accumulated, despite the many theories to explain the presence of FA in the plants, including a theory that defends that the plants absorb FA from the neighbouring soil, and after transport it to their aerial parts (Hall and Cain, 1972; Harper et al., 2003; Walker and Chang, 2014).

1.3. Natural Fluorinated Compounds with a microbial origin

1.3.1. Actinobacteria and Fluoroacetate

More recently, FA was also revealed to be produced by five bacterial species, all of them belonging to the phylum Actinobacteria: Streptomyces cattleya, Streptomyces xinghaiensis, Streptomyces sp MA37, Nocardia brasiliensis and Actinoplanes sp N902- 109, though the last two strains only showed the genetic potential to produce FA. The discovery that some bacteria are also capable of producing FA has raised the question whether the plants, their symbiotic bacteria or soil bacteria are the true responsible for the production of this compound (Ma et al., 2015; Walker and Chang, 2014; Deng et al., 2006). Interestingly, all the five FA producing bacteria belong to the bacterial phylum most prolific in terms of production of compounds with important biological activities. Members of this phylum are responsible for the production of many enzymes with economic value, antifungals, anticancer and immunosuppressive agents, anthelmintic compounds, etc. Above all, they are potent sources of several antibiotics, producing ca. 2/3 of the existing FCUP 19 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome antibiotics used in clinics these days (Elbendary et al., 2018; Lee et al., 2018; Barka, et al. 2016; Gopalakrishnan et al., 2014; Zhao et al., 2011; Qin et al., 2009).

1.3.2. General Characteristics of the Phylum Actinobacteria

The phylum Actinobacteria is one of the biggest taxonomic entities among the lineages in the domain Bacteria (Gopalakrishnan et al., 2014; Ventura et al., 2007). It aggregates bacteria Gram-positive, typically holding a high guanine plus cytosine (G+C) content in their DNA, which can be as high as 70%, though some strains can also have a low G+C content. Bacteria belonging to this phylum are dispersed in both aquatic and terrestrial ecosystems (Gong et al., 2018; Lee et al., 2018; Barka et al., 2016; Gopalakrishnan et al., 2014; Qin et al., 2012) and have an extensive diversity in terms of morphology (Ventura et al., 2007). Members of this phylum are also very resistant to extreme environments, including alkaline saline soils and deep sea sediments and are commonly found in association with plants and animals (Gong et al., 2018). The name Actinobacteria comes from the fact that these microorganisms grow by a mix of tip extension and branching of the hyphae, much like fungi. These microorganisms were for a long time wrongly classified as fungi as, like them, many strains can produce mycelium and reproduce by sporulation. However, these microorganisms are not fungi at all, considering that their cells have an organisation similar to other prokaryotic cells, having only one chromosome, being also sensitive to antibacterial agents (Barka et al., 2016). The highly diverse phylum includes soil and aquatic inhabitants such as Streptomyces, Micromonospora, Rhodococcus and Salinispora species, pathogens such as Corynebacterium, Mycobacterium, Nocardia, Propionibacterium and Tropheryma species, plant pathogens like Leifsonia spp., gastrointestinal commensals (e.g., Bifidobacterium spp.) and nitrogen-fixing plant symbionts (e.g., Frankia spp.). The most relevant feature of microorganisms belonging to this phylum is their notable capacity to produce valuable bioactive compounds, like antibiotics, antifungals, antiparasitic agents, antiviral agents, anticancer agents, immunosuppressive agents, inflammatory agents, enzymes, enzyme inhibitors, pigments, herbicides and plant and animal growth promoting substances, where the genus Streptomyces plays a prominent role. Actinobacteria also have a key role in the recycling of nutrients, being primordial for the mineralization of organic matter and fixation of nutrients, like nitrogen. (Yu et al., 2015; Das et al., 2007). These microorganisms also establish important associations with plants, in many cases as endosymbionts, colonising the interior of plant tissues without causing disease. When associated to plants, Actinobacteria have been shown to highly FCUP 20 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome contribute to the development and health of the host plant, increasing and stimulating plant’s growth through the production of antibiotics and hydrolytic enzymes, and decreasing the disease symptoms triggered by phytopathogens (Gong et al., 2018; Qin et al., 2009; Qin et al., 2015). The genera Streptomycyes, Microbispora, Nocardia, Micromonospora, Streptosporangium and Nocardioides have been frequently isolated from plants (Qin et al., 2009).

1.3.3. Actinobacteria and mechanism of FA production

The biological fluorinating mechanism leading to the synthesis of FA in Actinobacteria has been elucidated, being mediated by the enzyme fluorinase, initially discovered in S. cattleya, in 1986 (O’Hagan et al., 2002; Eason et al., 2011; Huang et al., 2014). The enzyme allows the production of FA during the secondary metabolism of S. cattleya in culture medium containing fluorine (O’Hagan and Deng, 2015). In the presence of F- ions, this bacterium converts S-adenosyl-L-methionine (SAM) into 5’-fluoro-5’- deoxyadenosine (5’-FDA), the organic form of fluorine, and also in L-methionine. The conversion is mediated by the fluorinase enzyme that catalyses the formation of a C-F bond when combining SAM and F-, creating 5’-FDA, leading after to the production of FA and 4-fluorothreonine (4-FT) through the action of other enzymes, as illustrated in Fig. 3 (Thompson et al., 2015; Eustáquio et al., 2010; Lewandowski, 2006; Dong et al., 2004). The discovery of the fluorinase enzyme is an important landmark in the field of fluorinated compounds, and the unique reaction catalysed by this enzyme is currently being biotechnologically explored for the synthetic production of fluorinated compounds, to help feeding the growing market of fluorochemicals. (Carvalho and Oliveira, 2017; Eustáquio et al., 2010; Thayer, 2006).

FCUP 21 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Figure 3. Production of fluoroacetate (FA) by Streptomyces cattleya (Adapted from Dong et al., 2004).

2. Potential of FA in forensics Compound 1080, the sodium salt of fluoroacetate, is similar to the fluoroacetate found in the poisonous plants in terms of toxicity and chemical structure. Due to its high toxicity, the compound is only licensed in a few countries (Goncharov, et al., 2006; Kirms et al., 2002; Allender, 1990). The compound has been used for decades, especially in New Zealand and Australia, as rodenticide since it was developed during World War II by German military chemists. Its use has several purposes, including controlling certain mammalian populations such as dogs, pigs, rats and cats, protect native animals from allochthonous species, like foxes, for example, and also protect native flora. In the USA, it is also utilized to protect livestock, goats and sheep, mostly from coyotes, by putting collars containing 1080 on the cattle. The sodium salt of FA is generally used in baits, like apples, carrots and grains, but for large areas it may be applied through aerial spreading. However, sodium monofluoroacetate is very soluble in water, which can easily lead to contamination of groundwater and eventually kill non-target species (Goncharov, et al., 2006; Eason et al., 2011; Sherley, 2004; Sherley, 2007). There have been reported cases of accidental poisoning and intentional (suicidal) ingestion. Nonetheless, even though FA has a potential for terrorism, to injury or kill, for example by contaminating public water supplies, since it has no taste, odour and easily dissolves in water, there are no official reports that prove the use of the compound in this manner (Sherley, 2007; Holstege, 2010). The investigation on how FA is produced in plants will be important for forensic investigations dealing with potential criminal uses of these plants.

FCUP 22 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

II. Aims

The present work aims to continue the work initiated under the scope of a previous MSc dissertation (Couto, 2016), which had as objective to help elucidating if the microbial community associated with the African plant, Dichapetalum cymosum, could have a role in the production of FA accumulated by this plant. In this context, the work conducted in the present master dissertation was focused in three main objectives: 1. Finish the taxonomic identification of the microbial isolates obtained in the MSc work of Couto (2016). 2. Investigate the presence of the gene coding for the fluorinase enzyme in the genome of the recovered isolates as well as in the metagenome of the leaves and stems of D. cymosum and in the soil in the vicinity of the plant, through the dot blot hybridization technique. 3. Investigate the bacterial diversity of D. cymosum through cultivable independent techniques, namely metagenomics analysis. FCUP 23 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

III. Material and Methods

The present work had as basis a previous MSc dissertation work (Couto, 2016), during which a total of 206 isolates were obtained from samples of stems and leaves of D. cymosum and from the soil in its vicinity. Samples of the plant were collected in December 2015, in Pretoria, South Africa. Investigation of the cultivable bacterial community associated to the plant was especially focused on bacteria belonging to the phylum Actinobacteria and took into account both the epiphytic and endophytic communities of D. cymosum. The isolates were obtained using a non-selective medium - Plate Count Agar (PCA) - supplemented with 50 mg L-1 of cyclohemixide and three media selective for Actinobacteria - Starch Casein Nitrate agar (SCN), Tap Water Yeast Extract agar (TWYE) and Raffinose-Histidine agar (RH) - supplemented with 50 mg L-1 of nalidixic acid and 50 mg L-1 of cyclohemixide. Each obtained isolate was cryopreserved in glycerol (final concentration in the culture, 18%), at -80 ºC. More information on the composition of the culture media used and on the isolation of the bacterial community associated with D. cymosum can be found in Couto (2016). In that work, some isolates were also taxonomically identified through 16S or ITS rRNA gene sequencing, but the identification process was not concluded for all isolates. This Materials and Methods section will focus in the description of the methodology used for the identification of non-identified isolates and for the investigation of the potential presence of the fluorinase gene in the genome of the obtained isolates. It will also describe the methodology used for the investigation of the bacterial diversity of D. cymosum through metagenomics analysis.

1. DNA extraction for 16S or ITS rRNA gene sequencing

DNA from non-identified microbial isolates was obtained by streaking a sample of each isolate preserved at -80 ºC in its respective solid medium (Couto, 2016). Isolates grown on solid media were visually checked for their purity after which pure cultures were transferred to flasks containing 10 mL of liquid medium (with a composition similar to the respective solid medium) in order to obtain enough biomass growth for DNA extraction. Cultures were incubated in an orbital incubator shaker (Optic Ivymen System) at 100 rpm, at the temperature of 28 ºC, for 72-120h. Cultures were then centrifuged at 13,000 g for 3 min and the resulting pellet was used for DNA extraction. Genomic DNA was extracted using the EZNA ®Bacterial DNA kit (Omega Bio-tek, Norcross, GA) following manufacturer’s instructions with some modifications: (i) beforehand the performance of the extraction protocol, samples were incubated at 95 ºC for 10 min, followed by a 10 min incubation on ice; (ii) in the step of addition of FCUP 24 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome lysozyme, the samples were incubated at 37 ºC for 30 min, instead of 10 min as stated in the protocol; (iii) in the optional step used for bacteria problematic to lyse, two Zirconia beads (2.3 mm diameter) were added along with the glad beads and the samples were vortexed for 10 min; (iv) incubation with proteinase K was completed with a concentrated stock (10 mg mL-1) instead of the solution provided in the kit and was extended up to 2h; (v) centrifugation speeds were all altered from 10,000 g to 13,000 g; (vi) 25 μL of elution buffer were added to the HiBind® DNA Mini Column, contrarily to the indicated 50-100 μL in the protocol (step performed twice). All DNA extractions were executed in sterile workspaces to prevent contaminations.

2. Taxonomic identification

Taxonomic identification was performed through the amplification of the 16S rRNA gene, for bacterial isolates, or of the internal transcribed spacer region (ITS), for fungal isolates. 16S rRNA gene was amplified using the primers 27F (5’– AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-CGGTTACCTTGTTACGACTT-3’) (Lane, 1991; Weisburg et al., 1991), and the ITS region was amplified with the primers ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’–TCCTCCGCTTATTGATATGC– 3’) (White et al., 1990; Kumar and Shukla, 2005). PCR mixture included in a final volume of 10 μL: 5 μL of Taq PCR Master Mix (Qiagen, Valencia, CA), 1 μL of a mix of the forward and reverse primer (2 μM each), and 2-4 μL of template DNA. Whenever necessary, DNA-free sterile water was used to complete the volume of the mixture. All PCR mixtures were accomplished in sterile workspaces to avoid contaminations and negative controls were always performed. PCRs were carried out in a Applied Biosystems ThermoCycler (Applied Biosystems Inc., Foster City, CA, USA) in the following conditions: initial denaturation at 95 ºC for 15 min, followed by 30 cycles (for bacterial isolates) or 35 cycles (for fungal isolates) at 94 ºC for 30 s, 48 ºC or 56 ºC (for bacterial or fungal isolates, respectively) for 90 s, 72 ºC for 2 min and a final extension at 72 ºC for 10min. PCR products were run in an electrophoresis gel containing 1.5% agarose and SYBR Safe (ThermoFisher Scientific, USA), at 150 V for 30 min. The amplified DNA was visualized through ultraviolet light (Molecular Imager® ChemiDocTM XRS Imaging System, Bio Rad, USA) with the software Image Lab v4.1 (Bio Rad, USA). Purification and sequencing of the amplified DNA fragments was accomplished by GenCore at I3S, (Institute for Research and Innovation, Porto, Portugal), with the same primers used in PCR amplifications. DNA sequences obtained from I3S were analyzed using the Geneious v11.1.4 software and the resulting consensus sequences were compared to FCUP 25 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome the ones available in the GenBank database using the NCBI BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and confirmed using the EzBioCloud database (https://www.ezbiocloud.net/dashboard). The taxonomic identification of the isolates was complemented with a phylogenetic tree. The sequences of each isolate identified in this study and in the study of Couto, 2016, were aligned with the two closest neighbor sequences in Genbank using the Geneious software. This resulted in 164 bacterial sequences with 1269bp and 72 fungal sequences with 577bp. The phylogenic tree was made using the Maximum Likelihood method with 1000 bootstraps based on the Tamura-Nei model. The tree was constructed using the Molecular Evolutionary Genetics Analysis program version 7 (MEGA7) (http://www.megasoftware.net).

3. Dot blot hybridization 3.1. Detection of flu by dot blot hybridization

The presence of fluorinase gene (flu) in the genome of microbial isolates obtained from FA-producing plant D. cymosum was investigated by dot blot hybridization. Two hybridization probes, named probe 1 and probe 2, were constructed from PCR amplicons obtained with primers previously designed for amplification of fluorinase gene (Table 1) (Couto, 2016). Probe 1 (210 bp) correspond to the PCR fragment obtained with the pair of primers Flu226F and Flu435R, and probe 2 (198 bp) correspond to the amplicon obtained with the pair of primers Flu524F and Flu721R (Table 1 and Fig. 4). It is important to emphasize that these primers were designed taking into account the most conserved regions of fluorinase genes available in GenBank and belonging to six Actinobacteria: Actinoplanes sp. N902-109, Nocardia brasiliensis, Streptomyces sp. MA37, Streptomyces xinghaiensis, Streptomyces cattleya and Streptomyces cattleya NRRL 8057. For more information on the design of these primers please refer to Couto (2016).

Table 1. Primers used for amplification of fluorinase gene. Primer’s name Primer’s Sequence (5’-3’) Melting direction temperature (ºC)

Probe 1 (Flu1) Flu226F Forward AGGGCGCCCGCTACATC 59.8ºC

Probe 1 (Flu1) Flu435R Reverse TGTTGGGCGCGATGTAGATG 60.5ºC

Probe 2 (Flu2) Flu524F Forward ACCGACCTTCTACAGCCG 58.4ºC

Probe 2 (Flu2) Flu721R Reverse TTGGTCCACACGTTGCCGAA 60.5ºC FCUP 26 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Figure 4. Primers Flu226F, Flu524F, Flu435R and Flu721R and expected size of the amplified products. . For dot-blot hybridization, bacterial DNA was extracted from microbial isolates as above indicated and quantified using Qubit 2.0 fluorometer (Invitrogen, Eugene, Oregon, USA). Chromosomal DNA from Streptomyces cattleya (JCM4925) and Streptomyces xinghaiensis (JCM16958) were used as positive controls, since fluorinase gene is known to be present in the genome of these species (O’Hagan et al., 2002; Huang et al., 2014). Dot blot assays were performed using 100 ng of heat-denatured DNA from controls and from microbial strains isolated from D. cymosum, diluted in 200 µL of hybridization buffer Tris-EDTA (TE). The template DNA was spotted on a nylon membrane using a Bio-dot apparatus (Bio-Rad, Hercules, CA), following manufacturer’s instructions. DNA probes 1 and 2 were obtained from purified PCR amplicons as described above, and confirmed by sequencing before proceed with digoxigenin labelling using the DIG-High Prime labelling kit (Roche, Basel, Switzerland) and following the manufacturer’s instructions. Hybridization was carried out overnight at 68ºC, i.e. under high stringency conditions to reduce the chance of unspecific hybridization, with a probes concentration set at 100 ng/ml. Washing and detection steps were executed as detailed by the manufacturer’s. DIG-labeled nucleic acids were detected by chemiluminescence and the dot blot images were acquired with a Molecular Imager ChemiDoc system (Bio-Rad), adjusting the exposure time so that all dots were below pixel saturation. Table 2 shows a representation of a 8x12 membrane utilized for dot blot hybridization. All dots were filled with DNA from isolates or Tris-EDTA.

Table 2. Frame detailing the distribution of DNA from D. cymosum isolates in a 8 x 12 cm nylon membrane. 1 2 3 4 5 6 7 8 9 10 11 12 A C X TE TE TE TE TE TE TE TE C X B TE TE TE TE TE TE TE TE TE TE TE TE C TE TE CEN10 CEN17 CEN25 CEN28 CEN29 CEN35 CEN36 CEN37 TE TE

D CEN39 CCS9 FEN2 FEN5 FEN13 FEN15 FEP6 FEP9 FEP10 FEP20 FEP21 FEP22 E FEP23 S24 S25 S28 S29 S30 S31 S33 S36 S37 TE TE F TE TE TE TE TE TE CEN38 FEN28 FEP3 FEP5 FEP8 TE G TE TE TE TE TE TE TE TE TE TE TE TE H C X TE TE TE TE TE TE TE TE C X C – Positive control Streptomyces cattleya; X – Positive control Streptomyces xinghaiensis. TE – Tris-EDTA.

FCUP 27 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

3.2 Screening microbial isolates by PCR PCR with the same primer pairs used for the probes 1 and 2 was performed to further investigate the presence of fluorinase gene in the isolates which showed to be positive by dot-blot hybridization. The PCR mixture consisted of: 1x DreamTaq Buffer with 2.0

µM MgCl2 (Fermentas, Ontario, Canada) 0.2 µM of deoxynucleotide triphosphate (dNTP) (Fermentas), 0.2 µM of each primer, 1U of DreamTaq DNA Polymerase (Fermentas), and 25 ng of DNA template. PCR cycling conditions were carried out with a 10 min denaturation cycle at 95ºC, followed by 30 cycles of 94ºC for 45 s, 56ºC for 60 s, and 72ºC for 30 s, and a final DNA extension at 72ºC for 10 min. PCR products were separated by electrophoresis at 100 V for 45 min with a 1% agarose gel and SYBR Green I (Sigma-Aldrich). Bands suggesting a positive result were cut from the gel, purified using the GTXTM PCR DNA and gel band purification kit (GE Healthcare, Buckinghamshire, United Kingdom), and quantified through Qubit 2.0 fluorometer (Invitrogen, Eugene, Oregon, USA) and sent for sequencing at STAB VIDA.

4. Metagenomics Analysis of the bacterial community of D. cymosum

4.1. Extraction of DNA from samples of stems and leaves of D. cymosum and from soil in its vicinity

Samples of stems and leaves of D. cymosum were aseptically grinded with a pestle to obtain a fine powder, using liquid nitrogen. DNA was extracted from 50 mg of grinded tissues of stems and leaves using the commercial kit, E.Z.N.A.® Plant DNA DS Mini Kit (Omega Bio-tek, Norcross, GA), according to the manufacturer’s instructions. DNA from soil samples collected in the vicinity of D. cymosum plants was extracted from 0.5 g of soil, using the commercial kit PowerSoil® DNA Isolation Kit from MOBIO Laboratories, Inc., according to the manufacturer’s instructions. DNA pellets were shipped to Institute of Soil Science, Chinese Academy of Sciences, Nanjing, China, for metagenomics analysis.

4.2. Metagenomics analysis

Metagenomics analysis was performed using the Illumina MiSeq sequencing. The primers pair 515F–907R (12 bp sample – specific adaptor sequence was attached to the 5’ – end of the primer 515F) were used for the amplification of the V4–V5 region, for the FCUP 28 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

16S rRNA gene, whereas for the 18S rRNA gene, the primers used were EUK528F- EUK706R. PCR was performed with TaKaRa Premix (TaKaRa, Japan) in a final volume of 50 µL: 25 µL of TaKaRa Premix Taq, 18.5 µL of PCR water, 2 µL of each primer (10 mM) and 2.5 µL of template DNA. The amplification was performed at 94 ºC for 3 min, followed by 30 cycles at 94 ºC for 30 s, 55 ºC for 30 s, 72 ºC for 45 s and a final extension at 72 ºC for 5 min. PCR products were verified on 1.2% agarose gel stained with Goldview and purified using a MiniBEST DNA Fragment Purification Kit Ver. 3.0 (TaKaRa, Japan). Then, PCR products were quantified by a NanoDrop ND – 1000 spectrophotometer and mixed at an equimolar ratio. Subsequently, the library was established using TruSeq Nano DNA LT Sample Prep Kit Set A (24 samples) and sequencing followed the manufacturer’s protocol by MiSeq Reagent Kit v3 (600 cycles). The data was then processed using QIIME (Caporaso et al., 2010) and UPARSE (Edgar, 2013) and by unique barcode the sequences were demultiplexed allowing no mismatch. Each sample was joined by FLASH (Magoč and Salzberg, 2011), using default parameters. The high quality reads were clustered and filtered to avoid chimeras (similarity of 97%) with UPARSE, while reads with lower quality were discarded. Then, one representative sequence of each operational taxonomic unit (OUT) was chosen and taxonomic identified, using SILVA 123 database (Quast et al., 2013), with assign_taxonomy.py in QIIME.

FCUP 29 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

IV. Results and discussion

1. Taxonomic identification of microbial isolates obtained from D. cymosum One of the goals of the present study was to taxonomically identify the microbial strains previously isolated from D. cymosum during the MSc work of Couto (2016) that could not be identified in the timeframe of that dissertation. The main objective of that work was to investigate the cultivable microbial community associated with D. cymosum, especially focusing on the actinobacterial community as, so far, FA is known to be produced only by a few actinobacterial species (Huang et al., 2014; Deng et al., 2014; O’Hagan et al., 2002) From the 106 microbial isolates not identified by Couto (2016), 62 were identified in this study and 44 could not be identified using the experimental approaches employed. Failure in the taxonomic identification of these latter isolates may have been due to various reasons: (i) poor or lack of growth of the microbial isolate after preservation at -80 ºC; (ii) loss of the isolate due to microbial contamination during the preservation process; (iii) ineffectiveness in the extraction of the DNA from the isolate; (iv) ineffectiveness of the primers used; (v) poor quality of the extracted DNA; (vi) low quality of the electropherograms. The fact that only one method was employed to extract the DNA of the isolates and only one set of primers was used for identifying bacterial strains (27F/1492R) and fungal strains (ITS1/ITS4) may have hindered the extraction and amplification of all isolates (Hong et al., 2009). Results of the taxonomic identification of the 62 isolates identified in this study are indicated in Table 3 and Figures 5-7. FCUP 30 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Table 3. Taxonomic identification of some microbial strains isolated from D. cymosum and from the soil in its vicinity by Couto (2016) and not identified in the timeframe of that work.

Sample Origin Isolate Taxonomic identification Similarity* Phylum Epiphytic CEP16 Methylobacterium sp. 100% Proteobacteria CEP21 Methylobacterium sp. 100% Proteobacteria

CEP30 Methylobacterium sp. 100% Proteobacteria

CCC8A Methylobacterium sp. 100% Proteobacteria

CCC8B Methylobacterium sp. 100% Proteobacteria

Endophytic CEN17 Bacillus sp. 100% Firmicutes CEN12 Methylobacterium sp. 100% Proteobacteria

CEN18 Pseudomonas sp. 99% Proteobacteria Stem CEN23 Methylobacterium sp.. 100% Proteobacteria

CEN26 Methylobacterium sp. 100% Proteobacteria

CEN28 Rhizobium sp. 99% Proteobacteria

CEN36 Pseudomonas sp. 100% Proteobacteria

CEN24 Fusarium sp. 100% Ascomycota

CEN25 Fusarium sp. 100% Ascomycota

CEN32 Talaromyces sp. 99% Ascomycota

CEN35 Cladosporium sp. 98% Ascomycota

Epiphytic FEP24 Streptomyces sp. 100% Actinobacteria FEP3 Methylobacterium sp. 100% Proteobacteria

FEP5 Bradyrhizobiaceae 99% Proteobacteria

FEP6 Rhizobium sp. 100% Proteobacteria

FEP7 Methylobacterium sp. 99% Proteobacteria

FEP8 Methylobacterium sp. 100% Proteobacteria

FEP9 Methylobacterium sp. 100% Proteobacteria

FEP10 Methylobacterium sp. 100% Proteobacteria

FEP21 Methylobacterium sp. 100% Proteobacteria

Leaves FEP22 Methylobacterium sp. 100% Proteobacteria

FEP23 Methylobacterium sp. 100% Proteobacteria

Endophytic FEN23 Curtobacterium sp. 99% Actinobacteria FEN2 Pseudomonas sp. 100% Proteobacteria

FEN3 Methylobacterium sp. 100% Proteobacteria

FEN5 Agrobacterium sp. 100% Proteobacteria

FEN15 Rhizobium sp. 100% Proteobacteria

FEN28 Methylobacterium sp. 100% Proteobacteria

CCF7 Brevundimonas sp. 100% Proteobacteria

FEN4 Alternaria sp. 99% Ascomycota

S19 Rhodococcus sp. 99% Actinobacteria

S38 Brevibacterium sp. 99% Actinobacteria

S76 Micrococcus sp. 99% Actinobacteria

CCS10 Streptomyces sp. 99% Actinobacteria Soil CCS3 Methylobacterium sp. 99% Proteobacteria

CCS5 Methylobacterium sp. 99% Proteobacteria S24 Bacillus sp. 100% Firmicutes S15 Bradyrhizobiaceae 96% Proteobacteria

FCUP 31 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

S20 Bradyrhizobiaceae 98% Proteobacteria

S28 Methylobacterium sp. 99% Proteobacteria

S29 Methylobacterium sp. 98% Proteobacteria

S48 Methylobacterium sp. 99% Proteobacteria

S49 Methylobacterium sp. 100% Proteobacteria

S50 Methylobacterium sp. 99% Proteobacteria

S53 Methylobacterium sp. 97% Proteobacteria

S57 Methylobacterium sp. 98% Proteobacteria

S58 Methylobacterium sp. 99% Proteobacteria

S61 Methylobacterium sp. 99% Proteobacteria

S72 Methylobacterium sp. 97% Proteobacteria

S74 Methylobacterium sp. 98% Proteobacteria

S79 Pseudomonas sp. 100% Proteobacteria

S83 Methylobacterium sp. 99% Proteobacteria

S84 Methylobacterium sp. 99% Proteobacteria

S8 Aspergillus sp. 100% Ascomycota

S33 Meyerozyma sp. 100% Ascomycota

S64 Cladosporium sp. 100% Ascomycota

S71 Arthrocladium sp. 98% Ascomycota

*percentage of sequence similarity with the nearest relative

FCUP 32 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Figure 5. Distribution by phylum of the microbial isolates from D. cymosum identified in this study.

Figure 6. Number of microbial isolates from D. cymosum identified in this study, distributed by genera. FCUP 33 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Figure 7. Comparison of the genera identified in this study for the strains isolated from the leaves and stems of D. cymosum and from the soil in its vicinity.

The isolates identified in this study are affiliated with the phyla Proteobacteria, Actinobacteria, Firmicutes and Ascomycota, but the majority was associated with phylum Proteobacteria (Fig. 5). Members of these phyla have been commonly isolated from leaves, stems and roots of other plants and from their surrounding soils (Cui et al., 2014; Xia et al, 2013; Qin et al., 2010). However, it is important to note that some isolates may actually be the same microorganism due to the fact that very similar DNA sequences were obtained for some of these microorganisms. As shown in Table 3 and Fig. 6, the 42 isolates affiliated to the phylum Proteobacteria are distributed by 5 genera, dispersed in the leaves (18 isolates) and stems (8 isolates) of D. cymosum and in its neighboring soil (16 isolates), with the genus Methylobacterium being the most representative one (33 isolates identified). Microorganisms affiliated with this genus are commonly found in soils, water and plants (both as epiphytics or endophytics) (Dourado et al., 2015; Tani et al., 2012; Madhaiyan et al., 2012; Araújo et al., 2002). Apart from Methylobacterium, the genera Pseudomonas and Rhizobium were the following most dominant ones. Both genera are commonly found in plants, where they may play important roles in their FCUP 34 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome protection and growth promotion, though some Pseudomonas strains may also act as plant pathogens (Wasai and Minamisawa, 2018; Preston, 2004). Concerning the phylum Actinobacteria, isolates were distributed by 5 genera, with no clear predominance of any of these genera (Fig. 6). Most of these genera were isolated from the soil in the vicinity of D. cymosum (Rhodococcus, Brevibacterium, Micrococcus and Streptomyces), while two genera were retrieved from the leaves (Streptomyces and Curtobacterium) (Table 3 and Fig. 6). (The genera Brevibacterium, Micrococcus and Rhodococcus have been reported to occur in soils (Jung et al., 2018; Kuo et al., 2017; Gurtler and Seviour, 2010). Rhodococcus strains were also reported to occur in the leaves and rhizosphere of plants. Microorganisms associated with the genus Streptomyces are common inhabitants of the soil and are capable of colonizing plant tissues, from the roots to the aerial parts (Vurukonda et al., 2018; Tarkka et al., 2008). Martins et al. (2013) found several Streptomyces strains in soils surrounding grapevine plants. A study by Quin et al., (2012) on the abundance and diversity of endophytic Actinobacteria associated with a Chinese medicinal plant reported a high percentage (67%) of endophytic Streptomyces, dispersed by the root, stem and leaves. Several endophytic Streptomyces were isolated from the stems of plants from the Amazonian rainforest in Peru (Bascom-Slack et al., 2009). Curtobacterium members have been mostly isolated from plants and their surroundings and seem to be ubiquitous in plant leaves (Saddler et al., 2007; Huang et al, 2006; Ercolani, 1991; Dunleavy, 1989; Chen et al., 2007). Two isolates were found to be affiliated with the Firmicutes phylum and to belong to the genus Bacillus. This genus is usually found in numerous environments and in various plant species, including cotton, grape, beans, grass, peas and rice (Kumar et al., 2012; Wahyudi et al., 2011; Madhaiyan et al., 2010; Saile and Koehler, 2006; Reva et al., 2002). Of the 62 isolates identified, 9 were fungi affiliated with the Ascomycota phylum. DNA of these microorganisms was extracted with a kit designed for bacteria (EZNA Bacterial DNA kit), as this kit revealed to be more efficient than a kit specific for the extraction of fungal DNA (E.Z.N.A.® Fungal DNA Mini Kit, Omega Biotek, Norcross, GA). Though the study of the microbial community associated with the plant D. cymosum was focused on bacteria, more specifically on Actinobacteria, the fact that fungal strains were also retrieved means that these fungi were resistant to cycloheximide, the antifungal compound used in the culture media for microbial isolation. As Table 3 and Figs. 6-7 indicate, the 9 isolates identified belong to the genera Fusarium, Cladosporium, Talaromyces, Alternaria, Aspergillus, Meyerozyma and Arthrocladium, with the first three genera being identified in stems of D. cymosum and the fourth genera being identified in FCUP 35 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome the leaves of the plant. Most of these genera are linked to pathogenic effects on plants, though some of them, like the genera Cladosporium and Talaromyces, may colonize plants as endophytes and stimulate the growth of some plants (Akimitsu et al., 2014; Bensch et al., 2012; Naraghi et al., 2012; Dean et al., 2012). As the leaves and stems of D. cymosum had a healthy appearance, it is difficult to assess whether these fungi were exerting a pathogenic effect on the plant. Figure 8 shows the phylogenetic trees for the bacterial (A) and fungal (B) isolates identified in the study by Couto (2016) and in the present study. Several isolates were not included in the trees due to their small 16S or ITS rRNA gene sequences. Most of the isolates are very well grouped with their closest neighbors, indicating that they have very close phylogenies. For example, the strains CEP26, FEN12, CEP24, CEN20, CEN14, CEN13 and CEP25 seem to be closely related with three different strains of Bacillus thuringiensis, being very probable that all these strains are associated with that species (Fig. 8A). The same happens for strains CEN30, CEN11, CEN31, FEN22 and CEN24 which seem to be highly related with Fusarium oxysporum (Fig. 8B) On the contrary, the rRNA sequences of strains CEP10, CEP 2 and CEP 19 did not directly cluster with those of their closest neighbors, suggesting that these strains may be novel entities, though further taxonomic studies are necessary to confirm this hypothesis (Fig. 8A). None of the branches shows evidence of a possible new fungal strain (Fig. 8B).

FCUP 36 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

A FCUP 37 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Figure 8. Phylogenetic tree of bacterial (A) and fungal (B) isolates obtained from the leaves and stems of D. cymosum and from its surrounding soil. Only bootstrap values higher than 60% are indicated in the trees. Numbers in parenthesis correspond to GenBank accession numbers. FCUP 38 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

2. Investigation of the presence of fluorinase gene by dot blot hybridization

Dot blot hybridization is a technique used to detect nucleic acids, holding the advantage to screen simultaneously dozens of templates. In this work, in order to investigate the presence of the fluorinase enzyme in microbial isolates obtained from D. cymosum, the DNA of 37 isolates was assayed by dot blot hybridization with Probe 1 and 16 with Probe 2, specifically designed to target the fluorinase gene. To increase the reliability of the experiments which was shown to be particularly important considering the poor signals obtained with the two positive controls (S. cattleya and S. xinghaiensis), the assays were performed at least once for both probes and, when possible, were repeated 2-3 times, depending on the quantity of DNA available. The results (Fig 9.) indicate that most of the tested isolates showed a positive result, meaning that Probes 1 and 2 were able to hybridize with the genome of the tested isolates suggesting either the presence of the fluorinase gene, or unspecific hybridization reaction which cannot be excluded taking into account the faint hybridization signals and regardless the high-stringency hybridization conditions used. The best results, i.e. the ones corresponding to stronger hybridization signals, were obtained for isolates FEP 8, FEP9, FEP20 and CEN38 (Fig. 9). Interestingly, FEP8 and FEP9 are Proteobacteria (likely a Methylobacterium sp.), while FEP20 is an Actinobacteria (likely a Microbacterium sp.) and CEN38 was not possible to identify by 16S rRNA gene sequencing. It should be noted that although both positive controls showed to hybridize with both probes, S. cattleya showed more defined dots than S. xinghaiensis. Furthermore, with exception for isolates FEP9 and CEN38, the dot signals obtained with the positive controls were stronger that the dot signals obtained with the isolates tested.

Figure 9. Dot blot signals obtained for some microbial strains isolated from D. cymosum. C – Positive control Streptomyces cattleya; X – Positive control Streptomyces xinghaiensis

FCUP 39 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

In order to confirm if the dot blot signals produced could be due to the presence of the fluorinase gene in the genome of the tested isolates, conventional PCRs were performed employing the same pairs of primers used to create Probes 1 (Flu1) and 2 (Flu2). For all the isolates retrieving a positive dot blot hybridization signal, only isolate FEN2 showed an amplification band of approximately 1000bp obtained with primer pair Flu226F and Flu435R corresponding to Probe 1 (Flu1) (Fig. 10), which does not match with the 210bp that should be obtained with these primer pairs as observed for the positive controls (Fig. 10). This indicates that most likely this amplicon results from unspecific amplification. Sequencing analysis of this 1000bp amplicon followed by blast revealed a high similarity of this amplicon to TonB-dependent transporters (TBDTs), which are bacterial outer membrane proteins that bind and transport ferric chelates called siderophores, as well as vitamin B12, nickel complexes, and carbohydrates. Nevertheless, we cannot exclude the hypothesis of a specific dot-blot positive hybridization and unspecific PCR amplification for isolate FEN2. Altogether, these results foster the need to use other methodological approaches to fully confirm or dismiss the presence of fluorinase gene in the tested isolates showed to hybridize at least with one or the two probes, for example addressing the presence of the enzyme.

Figure 10. PCR results obtained for the isolate FEN2 with primers used to construct Probe 2 (Flu524F and Flu721R). C – Positive control Streptomyces cattleya; X – Positive control Streptomyces xinghaiensis.

FCUP 40 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

3. Metagenomics analysis of the microbial community associated with D. cymosum

Scientific knowledge regarding environmental microbial communities is tremendously limited by the fact that less than 1% of the microorganisms can be cultivable under laboratory conditions, leaving hidden more than 99% of the microbial world. The main reason for this is the inability to mimic in laboratory the nutritional requirements, the physical-chemical conditions or the biological signals/symbiotic interactions essential for the growth of the microorganisms (Schloss and Handelsman, 2005; Stewart, 2012; Shaw et al., 2016). Metagenomics is a revolutionary culturable-independent method that directly allows the knowledge of genetic and physiological information of uncultured microorganisms, promptly and at a very low cost (Handelsman, 2004; Schloss and Handelsman, 2005; Kalyuzhnaya, 2011; Thomas et al., 2012). In this study, metagenomics analysis was performed in order to have a general view of the microbial community of the leaves and stems of D. cymosum and of the soil in its vicinity. The results obtained are shown in Fig. 11.

FCUP 41 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

47% 51%

2% 12%

30% 14%

4% 2%

35%

Acidobacteria

13% Actinobacteria 18% Bacteroidetes

Chloroflexi

Cyanobacteria

17% Firmicutes

37% Gemmatimonadetes

5% Planctomycetes 1% 5% Proteobacteria 4% C Other

Figure 11. Distribution of the main bacterial phyla according to the metagenomics analysis of the leaves (A) and stems (B) of D. cymosum and of the soil (C) in the neighborhood of the plant.

FCUP 42 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

The results revealed that the stems of D. cymosum and the surrounding soil had a high diversity in terms of bacterial phyla, whereas the leaves of the plant only presented two major phyla. Stems of D. cymosum were very rich in microorganisms associated to the phyla Cyanobacteria, Proteobacteria, Actinobacteria and Acidobacteria, while leaves mainly included microorganisms belonging to Cyanobacteria and Proteobacteria, which were found with a very similar predominance. The soil in the vicinity of the studied plant was abundant in microorganisms affiliated with the phyla Actinobacteria, Proteobacteria and Acidobacteria, with the first two phyla being present in higher predominance. The phylum Firmicutes was only found in stems of D. cymosum and the phyla Gemmatimonadetes and Bacteroidetes were solely found in the soil (Fig. 12). Table 4 shows the relative abundance of each taxonomic group identified in the leaves, stems and surrounding soil of D. cymosum. Two orders of the phylum Proteobacteria were found in the leaves of D. cymosum: Sphingomonadales and Burkholderiales. The leaves were also rich in microorganisms of the order Streptophyta belonging to the phylum Cyanobacteria. These main orders do not match those of the microbial strains isolated from the leaves of the studied plant that mainly belonged to the orders Rhizobiales, Pseudomonadales and Caulobacterales. Consequently, the families and genera identified by the two methods were also different (Table 4), indicating that the results of culture independent and dependent methods may not be necessarily similar but rather complement each other and that both methods are necessary for a deeper comprehension of the bacterial community associated with D. cymosum. Metagenomics analysis revealed that the genus Sphingobium was highly predominant in the leaves of D. cymosum, though no isolates belonging to this genus were obtained by culture dependent methods (Tables 3 and 4). Members of Sphingobium genus have been implicated in the protection of plants from bacterial pathogens, avoiding severe disease symptoms, being also efficient degraders of chlorinated and aromatic hydrocarbons (Innerebne et al., 2011; Verma, 2014). In the stems of D. cymosum, the microbial community was mainly distributed by the orders Acidobacteriales and Solibacterales (phylum Acidobacteria), Acidimicrobiales and Solirubrobacterales (phylum Actinobacteria), Streptophyta (phylum Cyanobacteria), Rhizobiales, Caulobacterales, Rhodospirillales, Rickettsiales Burkholderiales and Xanthomonadales (phylum Proteobacteria) and, once again, no similarities in the taxonomic groups identified by culture dependent and independent methods were found for this part of the plant. The only genera that could be identified in the stems through metagenomics were Phenylobacterium, Rhodoplanes and Burkholderia, all belonging to Proteobacteria (Table 4). Phenylobacterium members are common inhabitants of soils (Khan et al., 2018), while Rhodoplanes strains have been associated to the rhizosphere FCUP 43 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome of plants, being involved in denitrification reactions (Rosenzweig et al., 2013). The Burkholderia genus is very peculiar as it comprises strains that may be either highly pathogenic or may be valuable plant symbionts, with some members having the capacity to fix nitrogen (Angus, 2014). The soil in the vicinity of D. cymosum showed, as expected, the highest diversity in terms of taxonomic groups, especially for the phylum Actinobacteria, where the orders Actinomycetales and Solirubrobacterales were the most predominant, but the orders Acidimicrobiales and Gaiellales were also present (Table 4). It also showed a good representation of microorganisms belonging to the orders Rhizobiales and Rhodospirillales whithin the phylum Proteobacteria. Metagenomics analysis also identified several genera in the studied soil, which included Gaiella, Geodermatophilus, Mycobacterium, Pseudonocardia and Blastococcus, all affiliated with the phylum Actinobacteria, Flavisolibacter of the phylum Bacteroidetes, Ktedonobacter belonging to the phylum Chloroflexi and Gemmatimonas associated with the phylum Gemmatimonadetes. No genera within the phylum Proteobacteria could be identified in the soil samples by metagenomics analysis. Once again, none of the genera identified by culture independent analysis matched with those obtained by culture dependent methods. FCUP 44 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Phylum Class Order Family Genus Soil Stems leaves Acidobacteria Acidobacteria Acidobacteriales Acidobacteriaceae Solibacteres Solibacterales Solibacteraceae Actinobacteria Actinobacteria Actinomycetales Geodermatophilaceae Blastococcus Geodermatophilus Mycobacteriaceae Mycobacterium Pseudonocardiaceae Pseudonocardia Gaiellales Gaiellaceae Gaiella Acidimicrobiia Acidimicrobiales Thermoleophilia Solirubrobacterales Conexibacteraceae Bacteroidetes Sphingobacteriia Sphingobacteriales Chitinophagaceae Flavisolibacter Chloroflexi Ktedonobacteria Ktedonobacterales Ktedonobacteraceae Ktedonobacter Cyanobacteria Chloroplast Streptophyta Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatimonas Planctomycetes Planctomycetia Gemmatales Isosphaeraceae Planctomycetales Planctomycetaceae Proteobacteria Alphaproteobacteria Caulobacterales Caulobacteraceae Phenylobacterium Rhizobiales Beijerinckiaceae Bradyrhizobiaceae Hyphomicrobiaceae Rhodoplanes Rhodospirillales Acetobacteraceae

Rickettsiales Sphingomonadales Sphingomonadaceae Sphingobium Betaproteobacteria Burkholderiales Comamonadaceae

Burkhlderiaceae Burkholderia Gammaproteobacteria Xanthomonadales Sinobacteraceae Xanthomonadaceae

0% 5% 10% 15% 20% 25% 30% 35% 40% 45% 50% FCUP 45 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

V. Conclusions and future perspectives

Some tropical and sub-tropical plants are known to accumulate/produce the very toxic compound, FA, but the mechanisms underlying this process is completely unknown. In fact, it is not clear if these plants may produce FA or if the microbial communities associated with them are responsible for this, highlighting the importance of studying the microbial community associated with these plants, especially the actinobacterial community since, until now, only a few of these microorganisms revealed to be capable of producing FA. The present study aimed to investigate the culturable and unculturable microbial community associated with the South African plant D. cymosum, as well as to investigate by dot blot hybridization the possible presence of the fluorinase gene in the microbial isolates obtained from the plant. Culture-dependent methods led to the identification of a total of 18 genera distributed by the phyla Proteobacteria, Actinobacteria, Firmicutes and Ascomycota. Five of these genera were found to belong to the Actinobacteria phylum: Brevibacterium, Curtobacterium, Micrococcus, Rhodococcus and Streptomyces. Metagenomics analysis of the leaves, stems and neighboring soil of D. cymosum revealed different taxonomic groups of those identified by culture-dependent methods, indicating that both methods provide important and complementary information for the whole knowledge of the microbial community associated with the plant. According to metagenomics results, leaves and stems of D. cymosum were found to be abundant in microorganisms belonging to Proteobacteria and Cyanobacteria (leaves) and Cyanobacteria, Proteobacteria, Actinobacteria and Acidobacteria (stems), while the soil in the vicinity of this plant was highly rich in Actinobacteria and Proteobacteria. The dot blot technique revealed not to be efficient for the identification of the fluorinase gene in the DNA of the microbial strains isolated from D. cymosum, as all the results obtained were confirmed to be false positive. However, this does not mean that the fluorinase gene is not present in the microbiome of D. cymosum plant. In order to help clarifying this issue, both next generation sequencing and whole genome sequencing of the actinobacterial isolates may be reliable approaches to consider in the future. Though the presence of microorganisms carrying the fluorinase gene was not possible to be confirmed in the current study, it contributed to elucidate for the first time the microbiome o the FA accumulating/producing plant D. cymosum.

FCUP 46 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

VI. References

Akimitsu, K., Tsuge, T., Kodama, M., Yamamoto, M. & Otani, H. 2014. Alternaria host- selective toxins: determinant factors of plant disease. Journal of general plant pathology, 80, 109-122. Allender, W. J. 1990. Determination of Sodium Fluoroacetate (Compound 1080) in Biological Tissues. Journal of Analytical Toxicology, 14, 45-49. Angus, A. A., Agapakis, C. M., Fong, S., Yerrapragada, S., Estrada-de los Santos, P., Yang, P., Song, N., Kano, S., Caballero-Mellado, J., Faria, S. M., Dakora, F. D., Weinstock, G. & Hirsch, A. 2014. M. Plant-Associated Symbiotic Burkholderia Species Lack Hallmark Strategies Required in Mammalian Pathogenesis. PLoS One, 9. Aplin, T. 1971. Poison plants of Western Australia: the toxic species of the genera Gastrolobium and Oxylobium. J. Agric. West. Austral, 12, 12-18. Araújo, W. L., Marcon, J., Maccheroni, W., Van Elsas, J. D., Van Vuurde, J. W. & Azevedo, J. L. 2002. Diversity of endophytic bacterial populations and their interaction with Xylella fastidiosa in citrus plants. Applied and environmental microbiology, 68, 4906-4914. Barka, E. A., Vatsa, P., Sanchez, L., Gaveau-Vaillant, N., Jacquard, C., Klenk, H.-P., Clément, C., Ouhdouch, Y. & Van Wezel, G. P. 2016. Taxonomy, physiology, and natural products of Actinobacteria. Microbiology and Molecular Biology Reviews, 80, 1- 43. Bascom-Slack, C. A., Ma, C., Moore, E., Babbs, B., Fenn, K., Greene, J. S., Hann, B. D., Keehner, J., Kelley-Swift, E. G., Kembaiyan, V., Lee, S. J., Puyao Li, P., Light, D. Y., Lin, E. H., Schorn, M. A., Vekhter, D., Boulanger, L-A., Hess, W. M., Vargas, P. N., Strobel, G. A., & Strobe, S. A. 2009. Multiple, Novel Biologically Active Endophytic Actinomycetes Isolated from Upper Amazonian Rainforests. Microb Ecol, 58, 374-383. Bensch, K., Braun, U., Groenewald, J. Z., & Crous, P. W. 2012. The genus cladosporium. Studies in mycology, 72, 1-401. Chen, Y-F., Yin, Y-N., Zhang, X-M. & Guo, J-H. 2007. Curtobacterium flaccumfaciens pv. beticola , A New Pathovar of Pathogens in Sugar Beet. Plant Disease, 91, 677-684. Carvalho, M. F. & Oliveira, R. S. Natural production of fluorinated compounds and biotechnological prospects of the fluorinase enzyme, Critical Reviews in Biotechnology, 37, 880-897. Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F. D., Costello, D. K., Fierer, N., Pena, A. G., Goodrich, J. K. & Gordon, J. I. 2010. QIIME allows analysis of high-throughput community sequencing data. Nature methods, 7, 335-336. FCUP 47 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Couto, Z. 2016. Study of the microbiome of the fluoroacetate producing plant Dichapetalum cymosum: Investigation of microbial community (MSc Dissertation). Retrieved from https://repositorio-aberto.up.pt (http://hdl.handle.net/10216/102009). Cui, H., Yang, X., Lu, D., Jin, H., Yan, Z., Chen, J., Li, X. & Qin, B. 2014. Isolation and characterization of bacteria from the rhizosphere and bulk soil of Stellera chamaejasme L. Canadian journal of microbiology, 61, 171-181. Das, M., Royer, T. V. & Leff, L. G. 2007. Diversity of Fungi, Bacteria, and Actinomycetes on Leaves Decomposing in a Stream. Applied and environmental microbiology, 73, 756- 767. Dean, R., Van Kan, J. A., Pretorius, Z. A., Hammond‐Kosack, K. E., Di Pietro, A., Spanu, P. D., Rudd, J. J., Dickman, M., Kahmann, R. & Ellis, J. 2012. The Top 10 fungal pathogens in molecular plant pathology. Molecular plant pathology, 13, 414-430. Deng, H., Cobb, S. L. McEwan, A. R., McGlinchey, R. P., Naismith, J. H., O’Hagan, D., Robinson, D. A. & Spencer, J. B. 2006. The Fluorinase from Streptomyces cattleya Is Also a Chlorinase. Angewandte Chemie International Edition, 45, 759-762. Deng, H., Ma, L., Bandaranayaka, N., Qin, Z., Mann, G., Kyeremeh, K., Yu, Y., Shepherd, T., Naismith, J. H. & O'hagan, D. 2014. Identification of fluorinases from Streptomyces sp MA37, Norcardia brasiliensis, and Actinoplanes sp N902‐109 by Genome Mining. ChemBioChem, 15, 364-368. Dong, C., Huang, F., Deng, H., Schaffrath, C., Spencer, J.B., O'Hagan, D. & Naismith, J. H. 2004. Crystal structure and mechanism of a bacterial fluorinating enzyme. Nature 427, 561-565. Dourado, M., Neves, A. A. C., Santos, D. S., & Araújo, W. L. 2015. Biotechnological and Agronomic Potential of Endophytic Pink-Pigmented Methylotrophic Methylobacterium spp. BioMed Research International, 19 pp. Dunleavy, J. M. 1989. Curtobacterium plantarum sp. nov. Is Ubiquitous in Plant Leaves and Is Seed Transmitted in Soybean and Corn. International Journal of Systematic Bacteriology, 30, 240-249. Eason, C., Miller, A., Ogilvie, S. & Fairweather, A. 2011. An updated review of the toxicology and ecotoxicology of sodium fluoroacetate (1080) in relation to its use as a pest control tool in New Zealand. New Zealand Journal of Ecology, 1-20. Edgar, R. C. 2013. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature methods, 10, 996-998. Elbendary, A. A., Hessain, A. M., El-Hariri, M. D., Seida, A. A., Moussa, I. M., Mubarak. A. S., Kabli, S. A., Hemeg, H. A., & Jakee, J. K. 2018. Isolation of antimicrobial producing Actinobacteria from soil samples. Saudi Journal of Biological Sciences, 25, 44-46. FCUP 48 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Ercolani, G. 1991. Distribution of epiphytic bacteria on olive leaves and the influence of leaf age and sampling time. Microbial Ecology, 21, 35-48. Eustáquio, A. S., O’hagan, D. & Moore, B. S. 2010. Engineering Fluorometabolite Production: Fluorinase Expression in Salinispora tropica Yields Fluorosalinosporamide. Journal of natural products, 73, 378-382. Eloff, J. & Von Sydow, B. 1971. Experiments on the fluoroacetate metabolism of Dichapetalum cymosum (Gifblaar). Phytochemistry, 10, 1409-1415. Goncharov, N. V., Jenkins, R. O. & Radilov, A. S. 2006. Toxicology of fluoroacetate: a review, with possible directions for therapy research. Journal of Applied Toxicology, 26, 148-161. Gong, Y., Bai, J-L., Yang, H-T., Zhang, W-D., Xiong, Y-W., Ding, P., Qin, S. 2018. Phylogenetic diversity and investigation of plant growth-promoting traits of actinobacteria in coastal salt marsh plant rhizospheres from Jiangsu, China. Systematic and Applied Microbiology, 41, 516-527. Gopalakrishnan, S., Vadlamudi, S., Bandikinda, P., Sathya, A., Vijayabharathi,R., Rupela, O., Kudapa, H., Katta, K. & Varshney, R. K. 2014. Evaluation of Streptomyces strains isolated from herbal vermicompost for their plant growth-promotion traits in rice. Microbiological. Research, 169, 40-48. Gribble, G. W. 2002. Naturally Occurring Organofluorines. Organofluorines. Springer. Grobbelaar, N., Meyer, J. J. M. 1990. Fluoroacetate Production by Dichapetalum cymosum. Journal of plant physiology, 135, 550-553. Gurtler, V. & Seviour, R. J. 2010. Systematics of Members of the Genus Rhodococcus (Zopf 1891) Emend Goodfellow et al. 1998. Biology of Rhodococcus. Vol. 16. Hall, R. & Cain, R. 1972. Organic fluorine in tropical soils. New phytologist, 71, 839-853. Handelsman, J. 2004. Metagenomics: Application of Genomics to Uncultured Microorganisms. Microbiology and Molecular Biology Reviews, 68, 669-685. Harper, D. B. & O’Hagan, D. 1994. The fluorinated natural products. Natural Product Reports, 11, 123. Harper, D. B., O’hagan, D. & Murphy, C. D. 2003. Fluorinated natural products: Occurrence and biosynthesis. Natural Production of Organohalogen Compounds. Springer. Holstege, C. P. 2010. Criminal Poising. Jones & Bartlett Publishers. 246pp. Hong, S., Bunge, J., Leslin, C., Jeon, S. & Epstein, S. S. 2009. Polymerase chain reaction primers miss half of rRNA microbial diversity. The ISME journal, 3, 1365-1373. Huang, H., Erickson, R., Yanke, L., Chelle, C. & Mündel, H.-H. 2006. First report of the purple variant of Curtobacterium flaccumfaciens pv. flaccumfaciens, causal agent of bacterial wilt of bean, in Canada. Plant Disease, 90, 1262-1262. FCUP 49 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Huang, S., Ma, L., Tong, M. H., Yu, Y., O’hagan, D. & Deng, H. 2014. Fluoroacetate biosynthesis from the marine-derived bacterium Streptomyces xinghaiensis NRRL B- 24674. Organic & Biomolecular Chemistry 12: 4828–4831. Innerebne, G., Knief, C. & Vorholt, J. A. 2011. Protection of Arabidopsis thaliana against Leaf-Pathogenic Pseudomonas syringae by Sphingomonas Strains in a Controlled Model System. Applied and Environmental Microbiology, 77, 3202-3210. Jung, M-S., Quan, X-T., Siddiqi, M. Z. Liu, Q., Kim, S. Y., Wee, J-H. & Im, W. T. 2018. Brevibacterium anseongense sp. nov., isolated from soil of ginseng field. Journal of Microbiology. Key, B. D., Howell, R. D. & Criddle, C. S. 1997. Fluorinated organics in the biosphere. Environmental Science & Technology, 31, 2445–2454. Khan, I. U., Habib, N., Xiao, M., Huang, X., Khan, N. U., Im, W.-T., Ahmed, I., Zhi, X-Y. & Li, W.-J. 2018. Phenylobacterium terrae sp. nov., isolated from a soil sample of Khyber- Pakhtun-Khwa, Pakistan. Antonie van Leeuwenhoek, 111, 1767-1775. Kalyuzhnaya, M. G., Beck, D. A. C. & Chistoserdova, L. 2011. Chapter six - Functional Metagenomics of Methylotrophs. Methods in Enzymlogy, 495, 81-98. Key, B. D., Howell, R. D. & Criddle, C. S. 1997. Fluorinated organics in the biosphere. Environmental Science & Technology, 31, 2445–2454. Kirms M. A. & Kirms, L. M. 2002. The identification of sodium fluoro acetate (Compound 1080) employing NMR spectroscopy. J Forensic Sci 47, 573-577. Kumar, M. & Shukla, P. K. 2005. Use of PCR Targeting of Internal Transcribed Spacer Regions and Single-Stranded Conformation Polymorphism Analysis of Sequence Variation in Different Regions of rRNA Genes in Fungi for Rapid Diagnosis of Mycotic Keratitis. Journal of Clinical Microbiology, 43, 662-668. Kumar, P., Dubey, R. & Maheshwari, D. 2012. Bacillus strains isolated from rhizosphere showed plant growth promoting and antagonistic activity against phytopathogens. Microbiological research, 167, 493-499. Kuo, V., Shoemaker W. R, Muscarella M. E. & Lennon J. T. 2017. Whole-genome sequence of the soil bacterium Micrococcus sp. KBS0714. Genome Announc, 5, e00697-17. Lane, D. J. 1991. 16S/23S rRNA sequencing. Nucleic acid techniques in bacterial systematics (Stackebrandt, E., Goodfellow, M., Eds.), pp.115-175 Wiley, Chichester, UK. Lee, L.-H., Chan, K.-G., Stach, J., Wellington, E. M. H., & Goh, B.-H. 2018. Editorial: The Search for Biological Active Agent(s) From Actinobacteria. Frontiers in Microbiology, 9, 824. FCUP 50 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Leong, L. E. X., Khan, S., Davis, C. K., Denman, S. E. & McSweeney, C. S. 2017. Fluoroacetate in plants - a review of its distribution, toxicity to livestock and microbial detoxification. Journal of Animal Science and Biotechnology, 8. Lewandowski, G., Meissner, E. & Milchert, E. 2006. Special applications of fluorinated organic compounds. Journal of Hazardous Materials, 136, 385–391. Ma, L., Bartholome, A., Tong, M. H., Qin, Z., Yu, Y., Shepherd, T., Kyeremeh, K., Deng, H. & O’Hagan. D. 2015. Identification of a fluorometabolite from Streptomyces sp. MA37: (2R,3S,4S)-5-Fluoro-2,3,4-trihydroxypentanoic acid. Chemical Science, 6, 1414-1419. Magoč, T. & Salzberg, S. L. 2011. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics, 27, 2957-2963. Madhaiyan, M., Poonguzhali, S., Kwon, S.-W. & Sa, T.-M. 2010. Bacillus methylotrophicus sp. nov., a methanol-utilizing, plant-growth-promoting bacterium isolated from rice rhizosphere soil. International journal of systematic and evolutionary microbiology, 60, 2490-2495. Madhaiyan, M., Poonguzhali, S., Senthilkumar, M., Lee J. S., & Lee K.-C. 2012. Methylobacterium gossipiicola sp. nov., a pink-pigmented, facultatively methylotrophic bacterium isolated from the cotton phyllosphere. International Journal of Systematic and Evolutionary Microbiology, 62, 162–167. Marais, J. 1943. The isolation of the toxic principle potassium cymonate from gifblaar Dichapetalum cymosum (Hook) Engl. Onderstepoort Journal of Veterinary Science and Animal Husbandry, 18, 203-206. Marais, J. 1944. Monofluoroacetic acid, the toxic principle of “gifblaar” Dichapetalum cymosum (Hook) Engl. Onderstepoort Journal of Veterinary Science and Animal Industry, 20, 67-73. Martins, G., Lauga, B., Miot-Sertier, C., Mercier, A., Lonvaud, A., Soulas, L., Soulas, G. & Masneuf-Pomarède, I. 2013. Characterization of Epiphytic Bacterial Communities from Grapes, Leaves, Bark and Soil of Grapevine Plants Grown, and Their Relations. PLoS ONE, 8. Meyer, J. M. & Grobbelaar, N. 1991. Fluoroacetate Degradation by Dichapetalum cymosum. Journal of Plant Physiology, 138, 122-124. Meyer, J. M. & Grobbelaar, N. 1990. The determination, uptake and transport of fluoroacetate in Dichapetalum cymosum. Journal of plant physiology, 135, 546-549. Murphy, C. D., Schaffrath, C. & O’Hagan, D. 2003a. Fluorinated natural products: the biosynthesis of fluoroacetate and 4-fluorothreonine in Streptomyces cattleya. Chemosphere, 52, 455-461. Murphy, C. D. 2003b. New frontiers in biological halogenation. J Appl Microbiol. 94, 539– 548. FCUP 51 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Naraghi, L., Heydari, A., Rezaee, S., & Razavi, M. 2012. Biocontrol agent Talaromyces flavus stimulates the growth of cotton and potato. Journal of plant growth regulation, 31, 471-477. O'hagan, D., Perry, R., Lock, J. M., Meyer, J. M., Dasaradhi, L., Hamilton, J. T. & Harper, D. B. 1993. High levels of monofluoroacetate in Dichapetalum braunii. Phytochemistry, 33, 1043-1045. O'hagan, D., Schaffrath, C., Cobb, S. L., Hamilton, J. T. & Murphy, C. D. 2002. Biochemistry: biosynthesis of an organofluorine molecule. Nature, 416, 279. O’hagan, D. & Deng, H. 2015. Enzymatic fluorination and biotechnological developments of the fluorinase. Chemical reviews, 115, 634-649. Okazoe, T. 2009. Overview on the history of organofluorine chemistry from the viewpoint of material industry. Proceedings of the Japan Academy, Series B Physical and Biological Sciences, 85, 276-289. Phillips, M.C., Riches, C. R. & Sweet, R. J. 1993. Chemical control of the poisonous plant Dichapetalum cymosum (Hook) Engl, International Journal of Pest Management, 39, 358-365. Preston, G. M. 2004. Plant perceptions of plant growth-promoting Peudomonas. Philosophical Transactions of the Royal Society B. Biological Sciences, 359, 907-918. Pusz, W. Plaskowska, E., Yildirim, I. & Weber, R. 2015. Fungi occurring on the plants of the genus Amaranthus L. Turkish Journal of Botany, 39, 147-161. Qin, S., Chen, H., Zhao,G., Li, J., Zhu, W., Xu, L., Jiang, J., & Li, W. 2012. Abundant and diverse endophytic actinobacteria associated with medicinal plant Maytenus austroyunnanensis in Xishuangbanna tropical rainforest revealed by culture-dependent and culture-independent methods. Environmental Microbiology Reports, 4, 522-531. Qin, S., Li, J., Chen, H.-H., Zhao, G.-Z., Zhu, W.-Y., Jiang, C.-L., Xu, L.-H. & Li, W.-J. 2009. Isolation, diversity, and antimicrobial activity of rare actinobacteria from medicinal plants of tropical rain forests in Xishuangbanna, China. Applied and environmental microbiology, 75, 6176-6186. Qin, S., Miao, Q., Feng, W.-W., Wang, Y., Zhu, X., Xing, K. & Jiang, J.-H. 2015. Biodiversity and plant growth promoting traits of culturable endophytic actinobacteria associated with Jatropha curcas L. growing in Panxi dry-hot valley soil. Applied Soil Ecology, 93, 47-55. Qin, S., Zhu, W.-Y., Jiang, J.-H., Klenk, H.-P., Li, J., Zhao, G.-Z., Xu, L.-H. & Li, W.-J. 2010. Pseudonocardia tropica sp. nov., an endophytic actinomycete isolated from the stem of Maytenus austroyunnanensis. International journal of systematic and evolutionary microbiology, 60, 2524-2528. Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J. & Glöckner, F. O. 2013. The SILVA ribosomal RNA gene database project: improved data FCUP 52 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

processing and web-based tools. Nucleic acids research, 41, D590-D596. Reva, O. N., Smirnov, V. V., Pettersson, B. & Priest, F. G. 2002. Bacillus endophyticus sp. nov., isolated from the inner tissues of cotton plants (Gossypium sp.). International journal of systematic and evolutionary microbiology, 52, 101-107. Rosenzweig, N., Bradeen, J. M., Tu, Z. J., McKay, S. J. & Kinkel, L. L. 2013. Rhizosphere bacterial communities associated with long-lived perennial prairie plants vary in diversity, composition, and structure. Canadian Journal of Microbiology, 59, 494–502. Saddler, G. S., Guimarães, P. M., Hamada, M. & Suzuki, K. 2017. Curtobacterium. Bergey’s Manual of Systematics of Archaea and Bacteria, 1-16. Saile, E. & Koehler, T. M. 2006. Bacillus anthracis multiplication, persistence, and genetic exchange in the rhizosphere of grass plants. Applied and environmental microbiology, 72, 3168-3174. Schloss, P. & Handelsman, J. 2005. Metagenomics for studying unculturable microorganisms: cutting the Gordian knot. Genome biology, 6:229. Shah, P. & Westwell A. D. 2007. The role of fluorine in medicinal chemistry. Journal of Enzyme Inhibition and Medicinal Chemistry, 22, 527–540 Shaw, G. T-W., Pao, Y-Y. & Wang, D. 2016. MetaMIS: a metagenomic microbial interaction simulator based on microbial community profiles. BMC Bioinformatics, 17. Sherley, M. 2004. The traditional categories of fluoroacetate poisoning signs and symptoms belie substantial underlying similarities. Toxicology letters, 151, 399- 406. Sherley, M. 2007. Is sodium fluoroacetate (1080) a humane poison? Animal Welfare. 16, 449. Stewart, E. J. 2012. Growing Unculturable Bacteria. Journal of Bacteriology. 194, 4151- 4160. Steyn, D. 1928. Gifblaar poisoning: a summary of our present knowledge in respect of poisoning. Pretoria: Government Printer and Stationery Office. Tani, A., Sahin, N. & Kimbara, K. 2012. Methylobacterium oxalidis sp. nov., isolated from leaves of Oxalis corniculata. International journal of systematic and evolutionary microbiology, 62, 1647-1652. Tarkka, M. T., Lehr, N-A., Hampp, R. & Schrey, S. D. 2008. Plant behavior upon contact with Streptomycetes. Plant Signaling & Behavior, 3, 917-919. Thayer, A. M. 2006. Fabulous fluorine. Chemical & Engineering News, 84, 15-24. Thomas, T., Gillbert, J., Meyer, F. 2012. Metagenomics - a guide from sampling to data analysis. Microbial Informatics and Experimentation. 2, 3. Thompson, S., Onega, M., Ashworth, S., Fleming, I. N., Passchier, J. & O'hagan, D. 2015. A two-step fluorinase enzyme mediated 18 F labelling of an RGD peptide for positron emission tomography. Chemical Communications, 51, 13542-13545. FCUP 53 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Twigg, L. E., King, D. R., Bowen, L. H., Wright, G. R. & Eason, C. T. 1996. Fluoroacetate content of some species of the toxic Australian plant genus, Gastrolobium, and its environmental persistence. Natural Toxins, 4, 122-127. Van der Merwe, D. & Du Plessis, L. 2006. Microscopic morphology of Dichapetalum cymosum (Hook.) Engl. as an aid in the identification of leaf fragments from the digestive tract of poisoned animals. Journal of the South African Veterinary Association. 77, 197– 201. Ventura, M., Canchaya, C., Tauch, A., Chandra, G., Fitzgerald, G. F., Chater, K. F. & Van Sinderen, D. 2007. Genomics of Actinobacteria: tracing the evolutionary history of an ancient phylum. Microbiology and Molecular Biology Reviews, 71, 495-548. Verma, H., Kumar, R., Oldach, P., Sangwan, N., Khurana, J. P., Gilbert, J. A. & Lal, R. 2014. Comparative genomic analysis of nine Sphingobium strains: insights into their evolution and hexachlorocyclohexane (HCH) degradation pathways. BMC Genomics, 15. Vurukonda, S. S. K. P., Giovanardi, D. & Stefani, E. 2018. Plant Growth Promoting and Biocontrol Activity of Streptomyces spp. as Endophytes. International Journal of. Molecular Sciences, 19, 952. Walker, M. C. & Chang, M. C. 2014. Natural and engineered biosynthesis of fluorinated natural products. Chemical Society Reviews, 43, 6527-6536. Wasai, S. & Minamisawa, K. 2018. Plant-Associated Microbes: From Rhizobia to plant Microbiomes. Microbes Environ, 33, 1-3. Wahyudi, A. T., Astuti, R. P., Widyawati, A., Mery, A. & Nawangsih, A. A. 2011. Characterization of Bacillus sp. strains isolated from rhizosphere of soybean plants for their use as potential plant growth for promoting rhizobacteria. Journal of Microbiology and Antimicrobials, 3, 34-40. Weisburg, W. G., Barns, S. M., Pelletier, D. A. & Lane, D. J. 1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of bacteriology, 173, 697-703. White, T. J., Bruns, T., Lee, S. & Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications, 18, 315-322. Wisniak, J. 2002. Henri Moissan - The Discoverer of Fluorine, Educación Química., 13, 267-274. Xia, Y., Greissworth, E., Mucci, C., Williams, M. A. & De Bolt, S. 2013. Characterization of culturable bacterial endophytes of switchgrass (Panicum virgatum L.) and their capacity to influence plant growth. GCB Bioenergy, 5, 674-682. Yu, J., Zhang, L., Liu, Q., Qi, X., Ji Y., & Kim, B. S. 2015. Isolation and characterization of actinobacteria from Yalujiang coastal wetland, North China. Asian Pacific Journal of FCUP 54 Investigation of the microbial community associated with the fluoracetate-producing plant Dichapetalum cymosum and of the presence of fluorinase gene in its microbiome

Tropical Biomedicine, 5, 555-560. Zhao, K., Penttinen, P., Guan, T., Xiao, J., Chen, Q., Xu, J., Lindström, K., Zhang, L., Zhang, X. & Strobel, G. A. 2011. The diversity and anti-microbial activity of endophytic actinomycetes isolated from medicinal plants in Panxi plateau, China. Current microbiology, 62, 182-190.