DOCSLIB.ORG

Resveratrol Induces Apoptosis in K562 (Chronic Myelogenous

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Resveratrol Induces Apoptosis in K562 (Chronic Myelogenous ResveratrolBlackwell Publishing Ltd induces apoptosis in K562 (chronic myelogenous leukemia) cells by targeting a key survival protein, heat shock protein 70 Prabir K. Chakraborty,1 Soumyajit Banerjee Mustafi,1 Sudipto Ganguly,2 Mitali Chatterjee2 and Sanghamitra Raha1,3 1Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, 1/AF Bidhan Nagar, Kolkata-700064; 2Department of Pharmacology, Institute of Post Graduate Medical Education and Research, 244B Acharya JC Bose Road, Kolkata-700020, India (Received October 15, 2007/Revised February 10, 2008/Accepted February 12, 2008/Online publication April 21, 2008) Chronic myelogenous leukemia (CML) is a myeloproliferative disease reports has documented a lack of patient response to imatinib. associated with a characteristic chromosomal translocation called This might be due to point mutations resulting in impaired the Philadelphia chromosome. This results in the expression of the imatinib binding at the kinase activity site of Bcr-abl.(11–13) Bcr-Abl fusion protein, a constitutively active protein tyrosine Therefore, the search for other novel targets and new strategies kinase. Although there are a few treatment options with Bcr-Abl for the management of CML continues. Numerous natural kinase inhibitors, drug resistance is often encountered. One of the products are under investigation for their clinical efficacy in major obstacles in overcoming drug resistance in CML is the high prevention and treatment of a wide array of diseases including endogenous levels of heat shock protein 70 (Hsp70). Resveratrol cancer.(14,15) Among these, trans-resveratrol (trans-3,4′,5-tri is a phytoalexin produced by several plants. We studied the hydroxyl stilbenes), found in considerable amounts in grapes, chemotherapeutic effects and mode of action of resveratrol on red wine, peas, nuts, and mullberries, has attracted attention due K562 (CML) cells. Resveratrol induced apoptosis in K562 cells in a to its many beneficial effects.(16) Different studies have established time-dependent manner. This was established by increased annexin the beneficial effects of resveratrol in cancer therapy, showing V binding, corroborated with an enhanced caspase-3 activity and a inhibition of proliferation and induction of apoptosis in various rise in the sub-G0/G1 population. Resveratrol treatment also caused tumor cell lines (of different origin). Resveratrol was found to suppression of Hsp70 both in mRNA and protein levels. The have pro-apoptotic effects on cancer cells but displayed minimal downregulation of Hsp70 by resveratrol exposure was correlated toxicity to human peripheral blood lymphocytes, indicating its with a diminished presence of heat shock factor 1 (HSF1) in the lack of toxicity for normal cells.(17) Efficacy of resveratrol has nucleus, and the downregulation of transcriptional activity of HSF1. been shown in rodent models of carcinogenesis.(18) Interestingly, High endogenous levels of Hsp70 have been found to be a deterrent resveratrol also acts as a sensitizer in drug-induced apoptosis.(19) for sensitivity to chemotherapy. We show here that resveratrol In spite of these findings, the key molecular targets and the could considerably enhance the apoptosis induction in K562 cells by precise mechanisms by which resveratrol exerts its anticancer 17-allylamino-17-demethoxygeldanamycin, an anticancer agent effect remain largely unknown. that inhibits Hsp90 but augments Hsp70 levels. We conclude that The heat shock proteins or stress proteins Hsp70 and Hsp90 resveratrol significantly downregulated Hsp70 levels through have been identified as contributors to oncogenesis, suggested inhibition of HSF1 transcriptional activity and appreciably augmented by the fact that overexpression of Hsp70 and Hsp90 leads to the the pro-apoptotic effects of 17-allylamino-17-demethoxygeldanamycin. tumor-promoting potential of cells.(20) The expression of these (Cancer Sci 2008; 99: 1109–1116) proteins is under the tight regulation of transcription factor HSF1. HSF1 becomes phosphorylated due to induction by heat, other forms of stress, or any other imbalance in cellular ML is characterized by the balanced reciprocal translocation homeostasis, and phopho-HSF1 trimerizes and translocates to Cbetween chromosomes 9 and 22 t (9:22) q (34:11) the nucleus to switch on the expression of Hsp70 and Hsp90.(21,22) giving rise to the Philadelphia chromosome.(1) As a consequence The cytoprotective role of the Hsps is attributed to their powerful of this translocation, a chimerical Bcr-Abl fusion protein is chaperoning activity, their ability to modulate the signal expressed. This protein has constitutively active non-receptor transduction pathways, and their role in proteasome-mediated TK activity and plays a pivotal role in the pathogenesis of degradation of the apoptotic and survival proteins.(22) Hsp90 the disease.(1) Bcr-Abl TK activity modulates a wide range of inhibition is thought to be a powerful tool in cancer therapy by cellular activities and signaling pathways that confer resistance virtue of its involvement in chaperoning dozens of proteins to chemotherapeutic drugs such as Ara-C and etoposide.(2,3) For known to be associated with oncogenesis.(23) The Hsp90 inhibitor example, Bcr-Abl TK activity leads to phosphorylation and geldanamycin is reported to selectively sensitize Bcr-Abl- activation of PI-3kinase,(4) p38 mitogen-activated protein expressing leukemia cells to cytotoxic chemotherapy.(24) kinase,(5) and c-jun N-terminal kinase.(6) Furthermore, Bcr-Abl Unfortunately, Hsp90 inhibition induces Hsp70 expression regulates the activation of transcription factors like nuclear at the mRNA and protein level.(25) K562 cells also have high factor κB(7) and Stat5(8) that play important roles in the genesis endogenous levels of Hsp70. Also, anti-apoptotic effects of of leukemia. The universal presence of Bcr-Abl fusion protein in CML patients and its diverse range of substrates made it an obvious target for drug development. This has led to the 3To whom correspondence should be addressed. E-mail: [email protected] development of specific small molecule kinase inhibitors against Abbreviations: 17-AAG, 17-allylamino-17-demethoxygeldanamycin; CML, chronic myelogenous leukemia; HSE, heat shock element; HSF1, heat shock factor 1; Hsp, Bcr-Abl. Imatinib mesylate (STI571) is one such TK inhibitor heat shock protein; PBS, phosphate-buffered saline; PCR, polymerase chain reac- of Bcr-Abl and cAbl that was approved for treatment for all tion; pHSE-SEAP, vector containing heat shock element which controls the expres- (9,10) sion of secreted alkaline phosphatase; pTAL-SEAP, vector containing TATA-like stages of the disease. Unfortunately, resistance to imatinib (11–13) promoter expressing secreted alkaline phosphatase; PS, phosphatidylserine; TK, mesylate also occurs, and an increasing number of recent tyrosine kinase; WBC, white blood cells. doi: 10.1111/j.1349-7006.2008.00809.x Cancer Sci | June 2008 | vol. 99 | no. 6 | 1109–1116 © 2008 Japanese Cancer Association Bcr-Abl are found to be partially mediated by Hsp70 upregula- Reverse transcription–PCR. Total RNA (2.5 µg) was reverse tion.(25) Current reports also link the increased expression of Hsp70 transcribed with oligo(dT) primer using 0.2 mM dNTP mix, 25 in Ph1+ leukemia cells with imatinib resistance.(26) Even a weak U RNase inhibitor, and 100 U Moloney murine leukemia virus overexpression of Hsp70 is enough to make the CML cells reverse transcriptase. For PCR, 1 µL cDNA from the reverse insensitive to treatment with imatinib as well as second generation transcription reaction mixture was taken to amplify in a 25 µL TK inhibitor nilotinib.(26) This is a major drawback in successfully reaction volume containing 10 pmol of each primer, 200 µM treating CML patients, especially those in the advanced stages each dNTP, in buffer containing 1.5 mM MgCl2 and 5 U of Taq of disease. Abrogation of Hsp70 induction by small interfering polymerase. A 10 µL portion of PCR product was electrophoresed RNA has been shown to increase antileukemia activity of Hsp90 in a 1.0% agarose gel. The following primers were used for inhibitor geldanamycin.(25) However, at present the small interfering Hsp70 (forward, 5′-ACCCTGTCGTCCAGCACCCA3′; reverse, RNA approach as a therapy can not be accomplished because 5′CTGCGTCTGCTTGGTGGGGA3′) and β-Actin (forward, the extent of inhibition can not be modulated. Therefore, the 5′-GAAGCA TTTGCGGTGGACCAT-3′; reverse, 5′-TCCTGTGG search for such a small molecule is warranted that would CATCCACCAAACT-3′). The primer sequence of Hsp70 was directly compromise without completely inhibiting the chaper- taken from the sequence of the inducible form of Hsp70 oning activities of Hsp70. In our present study we put forward (GenBank accession number NM-005346). resveratrol as such a small molecule that induces apoptosis in Promoter assay: measurement of transcription factor-induced Ph1+ leukemia cells (K562) by targeting Hsp70, one of the chief gene expression. Transcription factor-induced gene regulation players involved in the pathogenesis of CML. Furthermore, we was monitored by Mercury Pathway Profiling SEAP system kit elucidate some causative mechanisms by which resveratrol from Clontech following the manufacturer’s instructions. Cells influences the expression of Hsp70. were transfected by corresponding plasmids as described in the manuals. Mercury vectors are engineered in such a way that Materials and Methods they contain a specific cis-acting DNA
Load more

Recommended publications
  • Combination of Anti-Cancer Drugs with Molecular Chaperone Inhibitors
    International Journal of Molecular Sciences Review Combination of Anti-Cancer Drugs with Molecular Chaperone Inhibitors Maxim Shevtsov 1,2,3,4,5,6,* , Gabriele Multhoff 1 , Elena Mikhaylova 2, Atsushi Shibata 7 , Irina Guzhova 2 and Boris Margulis 2,* 1 Center for Translational Cancer Research, TUM (TranslaTUM), Technische Universität München (TUM), Klinikum rechts der Isar, Radiation Immuno Oncology, Einsteinstr. 25, 81675 Munich, Germany; gabriele.multhoff@tum.de 2 Institute of Cytology of the Russian Academy of Sciences (RAS), Tikhoretsky Ave., 4, St. Petersburg 194064, Russia; [email protected] (E.M.); [email protected] (I.G.) 3 Department of Biotechnology Pavlov First Saint Petersburg State Medical University, L’va Tolstogo str., 6/8, St. Petersburg 197022, Russia 4 Almazov National Medical Research Centre, Polenov Russian Scientific Research Institute of Neurosurgery, Mayakovskogo str., 12, St. Petersburg 191014, Russia 5 Department of Biomedical Cell Technologies Far Eastern Federal University, Russky Island, Vladivostok 690000, Russia 6 National Center for Neurosurgery, Turan Ave., 34/1, Nur-Sultan 010000, Kazakhstan 7 Signal Transduction Program, Gunma University Initiative for Advanced Research (GIAR), Gunma University, Maebashi, Gunma 371-8511, Japan; [email protected] * Correspondence: [email protected] (M.S.); [email protected] (B.M.) Received: 31 August 2019; Accepted: 22 October 2019; Published: 24 October 2019 Abstract: Most molecular chaperones belonging to heat shock protein (HSP) families are known to protect cancer cells from pathologic, environmental and pharmacological stress factors and thereby can hamper anti-cancer therapies. In this review, we present data on inhibitors of the heat shock response (particularly mediated by the chaperones HSP90, HSP70, and HSP27) either as a single treatment or in combination with currently available anti-cancer therapeutic approaches.
    [Show full text]
  • Geldanamycin and Its 17-Allylamino-17-Demethoxy
    [CANCER RESEARCH 63, 3241–3246, June 15, 2003] Geldanamycin and its 17-Allylamino-17-Demethoxy Analogue Antagonize the Action of Cisplatin in Human Colon Adenocarcinoma Cells: Differential Caspase Activation as a Basis for Interaction1 Irina A. Vasilevskaya,2 Tatiana V. Rakitina, and Peter J. O’Dwyer University of Pennsylvania Cancer Center, Philadelphia, Pennsylvania 19104 ABSTRACT mal degradation (10, 11). The ability of GA to deplete Raf1, ErbB2, and mutant p53 in breast cancer cells was found to correlate with its Several chaperone-binding drugs based on geldanamycin (GA) have antiproliferative activity (12), making it a plausible candidate for use been synthesized, and one of them, 17-allylamino-17-demethoxygeldana- mycin (17-AAG), is being developed in the clinic. Interest in the use of in cancer treatment. However, GA caused liver toxicity in preclinical 17-AAG in combination with cytotoxic drugs led us to study both GA and studies (13). A search for more tolerable derivatives has yielded 17-AAG with cisplatin (DDP) in the human colon adenocarcinoma cell 17-AAG, a less toxic analogue that retains the tumoricidal features of lines HT29 and HCT116. We performed isobologram analysis of combi- GA. Like its parent compound, 17-AAG inhibits several signaling nations of DDP with GA or 17-AAG in these cell lines using the standard pathways through binding to Hsp 90, which results in destabilization 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay to of signaling complexes and degradation of its client proteins by the evaluate cell survival. In HCT116, the effects of GA and 17-AAG with proteasome in a variety of cell lines (14–16).
    [Show full text]
  • Cell Surface GRP94 As a Novel Emerging Therapeutic Target for Monoclonal Antibody Cancer Therapy
    cells Review Cell Surface GRP94 as a Novel Emerging Therapeutic Target for Monoclonal Antibody Cancer Therapy Ji Woong Kim † , Yea Bin Cho † and Sukmook Lee * Biopharmaceutical Chemistry Major, School of Applied Chemistry, Kookmin University, Seoul 02707, Korea; [email protected] (J.W.K.); [email protected] (Y.B.C.) * Correspondence: [email protected]; Tel.: +82-2-910-6763 † These authors contributed equally to this work. Abstract: Glucose-regulated protein 94 (GRP94) is an endoplasmic reticulum (ER)-resident member of the heat shock protein 90 (HSP90) family. In physiological conditions, it plays a vital role in regulating biological functions, including chaperoning cellular proteins in the ER lumen, maintaining calcium homeostasis, and modulating immune system function.‘Recently, several reports have shown the functional role and clinical relevance of GRP94 overexpression in the progression and metastasis of several cancers. Therefore, the current review highlights GRP94’s physiological and pathophysiological roles in normal and cancer cells. Additionally, the unmet medical needs of small chemical inhibitors and the current development status of monoclonal antibodies specifically targeting GRP94 will be discussed to emphasize the importance of cell surface GRP94 as an emerging therapeutic target in monoclonal antibody therapy for cancer. Keywords: GRP94; cancer; therapeutic target; therapy; monoclonal antibody Citation: Kim, J.W.; Cho, Y.B.; Lee, S. Cell Surface GRP94 as a Novel 1. Introduction Emerging Therapeutic Target for Cancer, the second leading cause of death behind cardiovascular disease, remains a Monoclonal Antibody Cancer major global public health problem [1]. Overall, the burden of cancer incidence and mortal- Therapy. Cells 2021, 10, 670.
    [Show full text]
  • Resveratrol Induces Apoptosis in K562 Cells
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Publications of the IAS Fellows ResveratrolBlackwell Publishing Ltd induces apoptosis in K562 (chronic myelogenous leukemia) cells by targeting a key survival protein, heat shock protein 70 Prabir K. Chakraborty,1 Soumyajit Banerjee Mustafi,1 Sudipto Ganguly,2 Mitali Chatterjee2 and Sanghamitra Raha1,3 1Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, 1/AF Bidhan Nagar, Kolkata-700064; 2Department of Pharmacology, Institute of Post Graduate Medical Education and Research, 244B Acharya JC Bose Road, Kolkata-700020, India (Received October 15, 2007/Revised February 10, 2008/Accepted February 12, 2008/Online publication April 21, 2008) Chronic myelogenous leukemia (CML) is a myeloproliferative disease reports has documented a lack of patient response to imatinib. associated with a characteristic chromosomal translocation called This might be due to point mutations resulting in impaired the Philadelphia chromosome. This results in the expression of the imatinib binding at the kinase activity site of Bcr-abl.(11–13) Bcr-Abl fusion protein, a constitutively active protein tyrosine Therefore, the search for other novel targets and new strategies kinase. Although there are a few treatment options with Bcr-Abl for the management of CML continues. Numerous natural kinase inhibitors, drug resistance is often encountered. One of the products are under investigation for their clinical efficacy in major obstacles in overcoming drug resistance in CML is the high prevention and treatment of a wide array of diseases including endogenous levels of heat shock protein 70 (Hsp70). Resveratrol cancer.(14,15) Among these, trans-resveratrol (trans-3,4′,5-tri is a phytoalexin produced by several plants.
    [Show full text]
  • The Hsp90 Inhibitor Geldanamycin Selectively Sensitizes Bcr-Abl
    Leukemia (2001) 15, 1537–1543 2001 Nature Publishing Group All rights reserved 0887-6924/01 $15.00 www.nature.com/leu The Hsp90 inhibitor geldanamycin selectively sensitizes Bcr-Abl-expressing leukemia cells to cytotoxic chemotherapy MV Blagosklonny1, T Fojo1, KN Bhalla3, J-S Kim1, JB Trepel1, WD Figg1, Y Rivera2 and LM Neckers2 Departments of 1Developmental Therapeutics and 2Cell and Cancer Biology, Medicine Branch, National Cancer Institute, NIH, Bethesda and Rockville, MD, USA; and 3Moffitt Cancer Center, Tampa, FL, USA The Bcr-Abl fusion protein drives leukemogenesis and can ren- Materials and methods der leukemia cells resistant to conventional chemotherapy. Geldanamycin (GA), a drug which destabilizes Hsp90- associated proteins, depletes cells of Bcr-Abl, an Hsp90 client, Cell lines and reagents but not of Abl. Both HL60 cells transfected with Bcr-Abl and naturally Ph1-positive K562 leukemia cells are resistant to most HL60 and Jurkat, human leukemia cell lines, were obtained cytotoxic drugs, but were found to be sensitive to GA. Further- from American Type Culture Collection (Manassas, VA, USA). more, GA sensitized Bcr-Abl-expressing cells to doxorubicin (DOX) and paclitaxel (PTX). In contrast, in parental HL60 cells, HL60-Bcr-Abl, a Bcr-Abl stable transfected HL-60 cells, were 8,16 90 nM GA inhibited PARP cleavage, nuclear fragmentation, and described previously. Paclitaxel (Taxol), was Bristol-Myers cell death caused by 500 ng/ml DOX. Like GA, STI 571 (an (Princeton, NJ, USA) product. Adriamycin (doxorubicin) was inhibitor of the Abl kinase) sensitized Bcr-Abl-expressing cells obtained from Sigma (St Louis, MO, USA) and dissolved in to DOX.
    [Show full text]
  • Cytotoxicity Activity of Geldanamycin Derivatives Against Various Cancer Cell Lines
    Journal of Applied Pharmaceutical Science Vol. 10(06), pp 012-021, June, 2020 Available online at http://www.japsonline.com DOI: 10.7324/JAPS.2020.10603 ISSN 2231-3354 Cytotoxicity activity of geldanamycin derivatives against various cancer cell lines Thongchai Taechowisan1*, Tipparat Samsawat1, Winyou Puckdee1, Waya S. Phutdhawong2 1Department of Microbiology, Faculty of Science, Silpakorn University, Nakhon Pathom 7300, Thailand. 2Department of Chemistry, Faculty of Science Silpakorn University, Nakhon Pathom 7300, Thailand. ARTICLE INFO ABSTRACT Received on: 12/10/2019 Geldanamycin (1) was isolated as a major compound from Streptomyces zerumbet W14. It was then used as a precursor to Accepted on: 02/04/2020 synthesize two new geldanamycins: 17-(tryptamine)-17-demethoxygeldanamycin (2) and 17-(5′-methoxytryptamine)- Available online: 05/06/2020 17-demethoxygeldanamycin (3). The cytotoxicity activity of these two new compounds was evaluated and compared with the cytotoxicity of compound 1. Cytotoxicity activity was evaluated against a normal cell line, and three cancer cell lines using an 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) colorimetric assay. The Key words: solubility of these compounds was also determined. The solubility of compounds 2 and 3 in water was 290.69 Anticancer activity, cancer and 348.18 µM, higher than that of compound 1 by about 1.91 and 2.29 times, respectively. Compounds 2 and 3 cell lines, cytotoxicity showed moderate cytotoxic activity on Vero and human cervical carcinoma cells with IC50 values of >200.00 µg/ activity, solubility, ml. The strongest cytotoxicity of compound 3 was observed in human breast carcinoma cells (MCF-7) and human tryptamine-geldanamycin hepatocellular carcinoma cell line (HepG2) cells with IC50 values of 82.50 and 114.35 µg/ml, respectively, while the hybrids.
    [Show full text]
  • Heat Shock Protein 90 and Role of Its Chemical Inhibitors in Treatment of Hematologic Malignancies
    Pharmaceuticals 2012, 5, 779-801; doi:10.3390/ph5080779 OPEN ACCESS Pharmaceuticals ISSN 1424-8247 www.mdpi.com/journal/pharmaceuticals Review Heat Shock Protein 90 and Role of Its Chemical Inhibitors in Treatment of Hematologic Malignancies Ngoc Ho, Adam Li †, Shaoguang Li and Haojian Zhang * Division of Hematology and Oncology, Department of Medicine, University of Massachusetts Medical School, 364 Plantation Street, Worcester, MA 01605, USA † Adam Li is currently a high school student at Xaverian Brothers High School, 800 Clapboardtree Street, Westwood, MA 02090, USA. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-508-856-1691; Fax: +1-508-856-6797. Received: 4 June 2012; in revised form: 9 July 2012 / Accepted: 16 July 2012 / Published: 25 July 2012 Abstract: Heat shock protein 90 (Hsp90) is a conserved and constitutively expressed molecular chaperone and it has been shown to stabilize oncoproteins and facilitate cancer development. Hsp90 has been considered as a therapeutic target for cancers and three classes of Hsp90 inhibitors have been developed: (1) benzoquinone ansamycin and its derivatives, (2) radicicol and its derivates, and (3) small synthetic inhibitors. The roles of these inhibitors in cancer treatment have been studied in laboratories and clinical trials, and some encouraging results have been obtained. Interestingly, targeting of Hsp90 has been shown to be effective in inhibition of cancer stem cells responsible for leukemia initiation and progression, providing a strategy for finding a cure. Because cancer stem cells are well defined in some human leukemias, we will focus on hematologic malignancies in this review. Keywords: heat shock protein 90; chemical inhibitors; hematologic malignancies 1.
    [Show full text]
  • Www .Alfa.Com
    Bio 2013-14 Alfa Aesar North America Alfa Aesar Korea Uni-Onward (International Sales Headquarters) 101-3701, Lotte Castle President 3F-2 93 Wenhau 1st Rd, Sec 1, 26 Parkridge Road O-Dong Linkou Shiang 244, Taipei County Ward Hill, MA 01835 USA 467, Gongduk-Dong, Mapo-Gu Taiwan Tel: 1-800-343-0660 or 1-978-521-6300 Seoul, 121-805, Korea Tel: 886-2-2600-0611 Fax: 1-978-521-6350 Tel: +82-2-3140-6000 Fax: 886-2-2600-0654 Email: [email protected] Fax: +82-2-3140-6002 Email: [email protected] Email: [email protected] Alfa Aesar United Kingdom Echo Chemical Co. Ltd Shore Road Alfa Aesar India 16, Gongyeh Rd, Lu-Chu Li Port of Heysham Industrial Park (Johnson Matthey Chemicals India Toufen, 351, Miaoli Heysham LA3 2XY Pvt. Ltd.) Taiwan England Kandlakoya Village Tel: 866-37-629988 Bio Chemicals for Life Tel: 0800-801812 or +44 (0)1524 850506 Medchal Mandal Email: [email protected] www.alfa.com Fax: +44 (0)1524 850608 R R District Email: [email protected] Hyderabad - 501401 Andhra Pradesh, India Including: Alfa Aesar Germany Tel: +91 40 6730 1234 Postbox 11 07 65 Fax: +91 40 6730 1230 Amino Acids and Derivatives 76057 Karlsruhe Email: [email protected] Buffers Germany Tel: 800 4566 4566 or Distributed By: Click Chemistry Reagents +49 (0)721 84007 280 Electrophoresis Reagents Fax: +49 (0)721 84007 300 Hydrus Chemical Inc. Email: [email protected] Uchikanda 3-Chome, Chiyoda-Ku Signal Transduction Reagents Tokyo 101-0047 Western Blot and ELISA Reagents Alfa Aesar France Japan 2 allée d’Oslo Tel: 03(3258)5031 ...and much more 67300 Schiltigheim Fax: 03(3258)6535 France Email: [email protected] Tel: 0800 03 51 47 or +33 (0)3 8862 2690 Fax: 0800 10 20 67 or OOO “REAKOR” +33 (0)3 8862 6864 Nagorny Proezd, 7 Email: [email protected] 117 105 Moscow Russia Alfa Aesar China Tel: +7 495 640 3427 Room 1509 Fax: +7 495 640 3427 ext 6 CBD International Building Email: [email protected] No.
    [Show full text]
  • Phase I Study of the Heat Shock Protein 90 Inhibitor Alvespimycin (KOS-1022, 17-DMAG) Administered Intravenously Twice Weekly to Patients with Acute Myeloid Leukemia
    Leukemia (2010) 24, 699–705 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Phase I study of the heat shock protein 90 inhibitor alvespimycin (KOS-1022, 17-DMAG) administered intravenously twice weekly to patients with acute myeloid leukemia JE Lancet1, I Gojo2, M Burton1, M Quinn2, SM Tighe3, K Kersey4, Z Zhong4, MX Albitar5, K Bhalla6, AL Hannah4 and MR Baer2,3 1H Lee Moffitt Cancer Center and Research Institute, Tampa, FL, USA; 2University of Maryland, Greenebaum Center, Baltimore, MD, USA; 3Roswell Park Cancer Institute, Buffalo, NY, USA; 4Kosan Biosciences, Hayward, CA, USA; 5Department of Hematopathology, Nichols Institute, San Juan Capistrano, CA, USA and 6Medical College of Georgia Cancer Center, Augusta, GA, USA Heat shock protein 90 (Hsp90) is a molecular chaperone with water-soluble analog of tanespimycin (17-allylamino- many oncogenic client proteins. The small-molecule Hsp90 17-demethoxygeldanamycin (17-AAG)). When compared with inhibitor alvespimycin, a geldanamycin derivative, is being tanespimycin, alvespimycin has higher potency against Hsp90, developed for various malignancies. This phase 1 study 7,8 examined the maximum-tolerated dose (MTD), safety and longer plasma half-life and oral bioavailability. Because of the pharmacokinetic/pharmacodynamic profiles of alvespimycin high incidence of activated Hsp90 client proteins in acute in patients with advanced acute myeloid leukemia (AML). myeloid leukemia (AML), we undertook a phase I study to Patients with advanced AML received escalating doses of delineate the safety and biologic profile of alvespimycin in 2 intravenous alvespimycin (8–32 mg/m ), twice weekly, for 2 of 3 advanced AML.
    [Show full text]
  • A Novel Hsp90 Inhibitor to Disrupt Hsp90/Cdc37 Complex Against Pancreatic Cancer Cells
    162 A novel Hsp90 inhibitor to disrupt Hsp90/Cdc37 complex against pancreatic cancer cells Tao Zhang,1 Adel Hamza,2 Xianhua Cao,1 Introduction 1 1 2 Bing Wang, Shuwen Yu, Chang-Guo Zhan, Pancreatic cancer is the fourth leading cause of cancer and Duxin Sun1 death in the United States (1). The overall 5-year survival 1 rate for pancreatic cancer patients is only 4% due to the lack Division of Pharmaceutics, College of Pharmacy, The Ohio State of treatment options (2). Currently, targeted therapy University, Columbus, Ohio and 2Department of Pharmaceutical Sciences, College of Pharmacy, University of Kentucky, against a malfunctioning molecule or pathway has pro- Lexington, Kentucky duced promising results for various solid tumors, such as Gefitinib against lung cancer, Avastin and Ebitux against colon cancer, Herceptin against breast cancer, and SU- Abstract 011248 against kidney cancer (3, 4). However, clinical trials Pancreatic cancer is an aggressive disease with multiple using antibodies against epidermal growth factor receptor, biochemical and genetic alterations. Thus, a single agent vascular endothelial growth factor, and HER-2 in pancre- to hit one molecular target may not be sufficient to treat atic cancer have had minimal benefits (5–7). Considering this disease. The purpose of this study is to identify a the complexity of pancreatic cancer with its multiple novel Hsp90 inhibitor to disrupt protein-protein interac- genetic abnormalities, targeting a single pathway is tions of Hsp90 and its cochaperones for down-regulating unlikely to be effective. Thus, identification of new targets many oncogenes simultaneously against pancreatic that modulate multiple signaling pathways would be cancer cells.
    [Show full text]
  • 17-AAG) on Pediatric Acute Lymphoblastic Leukemia (ALL) with Respect to Bcr-Abl Status and Imatinib Mesylate Sensitivity
    0031-3998/05/5703-0430 PEDIATRIC RESEARCH Vol. 57, No. 3, 2005 Copyright © 2005 International Pediatric Research Foundation, Inc. Printed in U.S.A. Effects of 17-Allylamino-17-Demethoxygeldanamycin (17-AAG) on Pediatric Acute Lymphoblastic Leukemia (ALL) with Respect to Bcr-Abl Status and Imatinib Mesylate Sensitivity LINDSAY M. HAWKINS, AARTHI A. JAYANTHAN, AND ARU NARENDRAN Center for Experimental and Molecular Therapeutics for Childhood Cancers, Southern Alberta Children’s Cancer Program, Alberta Children’s Hospital, Calgary, Alberta T2T 5C7, Canada ABSTRACT As more and more effective targeted therapeutics have been 17-AAG greatly increased imatinib sensitivity in vitro. A de- developed to treat adults with cancer, it is of critical importance crease in p53, survivin, Her2/neu, and WT1 was seen in cells that to devise appropriate in vitro experimental models to study their expressed these proteins. With some notable exceptions, when use in pediatric patients. Acute lymphoblastic leukemia (ALL) combined with 17-AAG, the IC50 of most of the common with Bcr-Abl translocation is one of the most difficult to treat and chemotherapeutic agents decreased. We describe an experimen- deadly diseases in children. The targeted kinase inhibitor ima- tal approach to investigate the complex interaction between tinib mesylate has been shown to induce an initial response but Bcr-Abl status, imatinib mesylate sensitivity, and 17-AAG in resistance often develops. Recently, the geldanamycin family of pediatric ALL. Information from such an approach will provide antibiotics has been found to induce apoptosis in many malignant means to devise combined treatment approaches and to follow cells, including adult CML and AML.
    [Show full text]
  • Heat Shock Protein 90 Inhibitors Suppress Pyroptosis in THP-1 Cells
    Heat Shock Protein 90 Inhibitors Suppress Pyroptosis in THP-1 Cells Zhou Zhou1, Xiuzhen Li1, 2, Yisong Qian1, 3, Cynthia Liu1, Xiaotian Huang2 and Mingui Fu1‡ Biochemical Journal. This is an Accepted Manuscript. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date-version available at https://doi.org/10.1042/BCJ20200351 1Department of Biomedical Science, School of Medicine, University of Missouri Kansas City, 2411 Holmes Street, Kansas City, MO 64108, USA; 2Department of Microbiology, School of Medicine, Nanchang University, NO 461 Bayi Road, Donghu District, Nanchang, 330006, China; Downloaded from http://portlandpress.com/biochemj/article-pdf/doi/10.1042/BCJ20200351/883258/bcj-2020-0351.pdf by guest on 19 September 2020 3The National Engineering Research Center for Bioengineering Drugs and the Technologies, Institute of Translational Medicine, Nanchang University, 1299 Xuefu Rd, Honggu District, Nanchang, 330031, China Running head: Heat shock protein 90 and pyroptosis Key words: Pyroptosis, GSDMD, THP-1, HSP90, Geldanamycin. Abbreviation: HSP90, heat shock protein 90; HSP70, heat shock protein 70; LPS, Lipopolysaccharides; GSDMD, gasdermin D; FBS, fetal bovine serum; PBS, phosphate-buffered saline; IL-1, interleukin-1; NLRP3, NACHT, LRR and Pyrin domains-containing protein 3; DAMP, damage-associated molecular pattern; 17-DMAG, 17-Dimethylaminoethylamino-17- demethoxygeldanamycin; 17-AAG, 17-N-allylamino-17-demethoxygeldanamycin; LDH, Lactate dehydrogenase; MTT, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. ‡To whom correspondence should be addressed: Mingui Fu, Shock/Trauma Research Center & Department of Basic Medical Science, School of Medicine, University of Missouri Kansas City, MO 64108.
    [Show full text]