DOCSLIB.ORG

YEAST CELLS MAY USE AUC OR AAG AS INITIATION CODON for PROTEIN SYNTHESIS by OLE OLSEN

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
YEAST CELLS MAY USE AUC OR AAG AS INITIATION CODON for PROTEIN SYNTHESIS by OLE OLSEN Carlsberg Res. Commun. Vol. 52, p. 83-90, 1987 YEAST CELLS MAY USE AUC OR AAG AS INITIATION CODON FOR PROTEIN SYNTHESIS by OLE OLSEN Department of Physiology, Carlsberg Laboratory, Gamle Cadsbergvej 10, DK-2500 Copenhagen Valby Keywords: Recombinant DNA, translation initiation, secretion A yeast expression plasmid without an ATG codon for initiation of mouse a-amylase protein synthesis directs the synthesis and secretion of active enzyme indistinguishable from both native mouse a-amylase and amylase synthesized from plasmids with normal AT(3 initiation codons. The initiation of amylase synthesis directed by this plasmid is at either an AUC or an AAG codon. In either case the amino acid sequence of the hydrophobic core and peptidase cleaving region of the signal peptide are normal, and the protein translation remains in frame with the structural gene of the mouse a-amylase. 1. INTRODUCTION mal context for initiation was 6NNAUGGA A where Initiation of protein synthesis in eukaryotes is a purine in position -3 (three nucleotides up- catalysed by a relatively large number of specific stream of the AUG initiator codon) is most eukaryotic initation factors (eIFs) bringing highly conserved. about the formation of the 80S initiation com- Until recently it was generally believed that plex composed ofmRNA, an 80S ribosome and eukaryotic ribosomes initiate exclusively at met-tRNAi (l 3). Eukaryotic met-tRNAi differs AUG codons although it had been shown by from its prokaryotic counterpart by being asso- RAJBHANDARYand GHOSH (24) that yeast met- ciated with the 40S pre-initation complex before tRNAi may function with either AUG or GUG binding to mRNA (13). This suggests that the as initiation codon in a cell-free translation cell has a requirement for met-tRNA~ during an system from E. coli. At present, a few examples early step of the initiation process leading to of non-AUG codons for initiation of protein assembly of the 80S complex. The ability of the synthesis are known from eukaryotes. In yeast 40S complex to recognize an AUG initiation cells UUG- and AUA-codons may be used in codon in proper context is probably dependent initiation of protein synthesis (34) but it is on codon-anticodon interaction. Among the emphasized that the start codon must appear in important features (13), the cap structure a proper context. BECERRAet at. (2) have shown (mTG5'pppN) at the 5" end ofeukaryotic mRNA that the methionyl-tRNA dependent initiation is essential for efficient initiation which usually ofadeno-associated virus (AAV) B protein starts occurs at the first AUG triplet downstream from from an ACG codon, and ANDERSON et al. (1) the cap structure. From a survey of published have shown that an ACG codon (replacing the DNA sequences it was concluded that the opti- AUG used in vivo to initiate the synthesis of Abbreviations: ADHI (PR) = alcohol dehydrogenase I (promoter); bp = base pair(s). Springer-Verlag 0105-1938/87/0052]0083/$01.60 O. OLSEN:Non-AUG initiation of translation bacteriophage T7 gene 0,3 protein) may func- yeast cells as follows. Total DNA was prepared tion as initiation codon in a wheat germ cell-free as described by STRUHLet al. (28). After incuba- protein synthesizing system. tion with RNase A, the DNA samples were In the present study a yeast plasmid directing extracted twice with an equal volume of phenol the synthesis and secretion of low amounts of and once with chloroform, precipitated from mouse salivary a-amylase has been sequenced in 70% ethanol, washed, and resuspended in 10 the region flanking the promoter and the cDNA mM-Tris-HCl, 1 mM-EDTA (pH 7.5). This solu- coding for the secreted protein. It was found that tion was used to transform competent E. coli the a-amylase coding region was without an JM83 cells. ATG codon for initiation of translation. This E. coli plasmid DNA was prepared by the example of a heterologous gene in yeast cells method of BmNBOIM and DOLV (3) which for being expressed without an AUG initiation large scale preparations was followed by caesium codon shows that yeast cells may use either AAG chloride equilibrium centrifugation. Purifica- or AUC codons for translation initiation. The tion of specific DNA fragments from low melt- secretion level of a-amylase directed from this ing temperature agarose gels was carried out as plasmid is low compared to plasmids with an described by MANIATlSet al. (16). ATG start codon. However, the pre-a-amylase synthesized from mRNA without an AUG codon is apparently processed and secreted in 2.4. Transformations the same manner as a-amylase initiated from an Transformation ofE. coli with plasmid DNA AUG codon. was performed as described by COHEN et al. (8). Yeast cells were transformed according to the method OfITo et al. (12) using lithium acetate to 2. MATERIALS AND METHODS induce competence. Yeast transformants were 2.1. Strains and media selected on SC medium without tryptophan and E. coil K-12 strain JM101 (17) was used to cells secreting a-amylase were detected on simi- propagate M 13mp phage vectors as described by lar medium supplied with 1% starch (29). MESSING (18). Otherwise the E. coli K-12 strain JM83 (17) was used as host in bacterial cloning experiments as described by VIEIRAand MESS- 2.5. DNA sequence determination ING (30). The Saccharomyces cerevisiae strain The nucleotide sequence of the a-amylase DBY746 (29) was grown in either YPD or SC cDNA gene (9) and its 5' flanking regions was media (22). determined by the dideoxynucleotide chain ter- mination method of SANGER et al. (25, 26) except that the elongation reaction temperature 2.2. Enzymes and chemicals was 55 ~ Radioactive nucleotides were purchased from New England Nuclear. All enzymes as well as deoxy- ~nd dideoxynucleotides were from 2.6. Activity staining of secreted a-amylase Boehringer Mannheim. Yeast cells grown in liquid medium were spun down. The supernatant was concentrated and dialysed in an Amicon ultrafiltration unit. Non- 2.3. Plasmids and DNA purification denaturing electrophoretic separation of the The yeast expression plasmid, pMA56, was concentrated supernatant polypeptides was car- kindly provided by Dr. B.D. HALL,University of fled out in 13% polyacrylamide gels using a Washington, Seattle, USA. pMS 15 was one of Tris-glycine buffer system, pH 8,3 (14). several plasmids constructed by inserting a Amylase activity was visualized by incubating mouse a-amylase cDNA gene behind the ADH! the gels for 2 hours at 37 ~ in a 50 mM-phos- gene promoter of plasmid pMA56 (29). phate buffer (pH 6,9) containing 4% starch and Recombinant plasmids were recovered from 0,08% NaCI (4, 27). After rinsing in water the 84 Carlsberg Res. Commun. Vol. 52, p. 83-90, 1987 O. OLSEN: Non-AUG initiation of translation E A E E directing different levels of a-amylase secretion from yeast (Figure 1). The plasmids were con- structed by inserting Bal31 exonuclease treated a-amylase eDNA in the yeast expression vector B, C E pMA56 using EcoRI linkers (29). Among these plasmids one, pMS 15, gave rise to low level of amylase secretion from yeast. It was chosen for further analysis and the nucle- otide sequence flanking the ADHI gene pro- moter and the a-amylase cDNA was deter- mined. In Figure 2 the nucleotide sequence is shown in comparison with the sequence of the // analagous region from plasmid pMSI2 which directs high level of amylase secretion from yeast cells. While plasmid pMS 12 contains a complete a-amylase coding region the nucleotide se- quence found in pMS15 seems to represent an aberrant cloning event where the a-amylase Figure 1. Physical map of a-amylase expression plas- mids. Mouse salivary a-amylase eDNA is inserted eDNA has been inserted in the vector via an adjacent to the yeast ADHI gene promoter. The plas- EcoRI* site present in position +5 of the coding mid contains a yeast TRP1 gene for selection and the region, i.e. within the second codon. origin of replication from the yeast 2Ix circular plasmid. The sequence specificity of EcoRI* activity is The plasmid also contains most of the E. coli plasmid not quite clear, but the activity may be induced pBR322 including both the ampicillin resistance gene as a result of increased glycerol concentration in and the origin of replication. Cleavage sites for restric- the reaction mixture (6). POLISKY et al. (23) tion enzymes Apa| (A), BamHI (B), ClaI (C) and EcoRI observed EcoRI* activity under conditions of (E) are shown. elevated pH and low ionic strength. They sug- gest that EcoRI* cleaves between the first and second base of the sequence NAATTN thereby generating the same type of 5' protruding ends gels were stained for 5-15 minutes in a 1% I2-KI as normal EcoRI digestion. During the con- solution. Bands with amylase activity appeared struction of the pMS plasmid series a 30 fold as clear regions against a dark background. molar excess of EcoRI linker was used; subse- quently the linkers were digested with EcoRI using standard conditions. Yet it seems that a 3. RESULTS AND DISCUSSION few EcoRI* sites were cleaved. The generated This report presents results of the analysis of restriction fragments were cloned in the EcoRI an aberrant plasmid among a series of plasmids site of the vector pMA56. ,,, CCAAG~ATACAATCAAG6AATTCC~6~AAGAATACTG~AA~A~CATA~CAAAAT~AAATTCTTCCTGCT(~:TTTCC~' . , pMS12 , , , ~GTTC~TAT~TTAGTTCCTTA'~CCCTTCTTAT~AC~TT~TCGTATC~TTTTACTTTAA~AA66ACGAC~AAA6~'~- , , ,,, CC~AGCATACA~TC~AG G~,ATTCTTC CTGCTGCTTTCCC, , , pMS15 ,,, GGTTCGTATGTTAGTTCCTTA~GAAG~iACGACGAAAGG6.,, Figure 2. Comparison of the nucleotide sequence flanking the promoter and the a-amylase eDNA of plasmids pMS 12 and pMSl 5. Vertical an-rows indicate where the a-amylase eDNA is inserted into the EcoRI site of the yeast expression plasmid pMA56.
Load more

Recommended publications
  • Effects of Single Amino Acid Deficiency on Mrna Translation Are Markedly
    www.nature.com/scientificreports OPEN Efects of single amino acid defciency on mRNA translation are markedly diferent for methionine Received: 12 December 2016 Accepted: 4 May 2018 versus leucine Published: xx xx xxxx Kevin M. Mazor, Leiming Dong, Yuanhui Mao, Robert V. Swanda, Shu-Bing Qian & Martha H. Stipanuk Although amino acids are known regulators of translation, the unique contributions of specifc amino acids are not well understood. We compared efects of culturing HEK293T cells in medium lacking either leucine, methionine, histidine, or arginine on eIF2 and 4EBP1 phosphorylation and measures of mRNA translation. Methionine starvation caused the most drastic decrease in translation as assessed by polysome formation, ribosome profling, and a measure of protein synthesis (puromycin-labeled polypeptides) but had no signifcant efect on eIF2 phosphorylation, 4EBP1 hyperphosphorylation or 4EBP1 binding to eIF4E. Leucine starvation suppressed polysome formation and was the only tested condition that caused a signifcant decrease in 4EBP1 phosphorylation or increase in 4EBP1 binding to eIF4E, but efects of leucine starvation were not replicated by overexpressing nonphosphorylatable 4EBP1. This suggests the binding of 4EBP1 to eIF4E may not by itself explain the suppression of mRNA translation under conditions of leucine starvation. Ribosome profling suggested that leucine deprivation may primarily inhibit ribosome loading, whereas methionine deprivation may primarily impair start site recognition. These data underscore our lack of a full
    [Show full text]
  • Detecting Translational Regulation by Change Point Analysis of Ribosome Profiling Datasets
    bioRxiv preprint doi: https://doi.org/10.1101/003210; this version posted March 5, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Detecting translational regulation by change point analysis of ribosome profiling datasets Zupanic A1, Meplan C2, Grellscheid SN3, Mathers JC1, Kirkwood TBL1, Hesketh JE2, Shanley DP1 1Centre for Integrated Systems Biology of Ageing & Nutrition, Institute for Ageing and Health, Newcastle University, Newcastle-upon-Tyne, NE4 5PL, UK 2Institute for Cell and Molecular Biosciences and Human Nutrition Research Centre, Newcastle University, Newcastle-upon-Tyne, NE2 4HH, UK 3School of Biological and Biomedical Sciences, Durham University, Durham DH1 3LE, UK Running title: Translational regulation in ribosome profiles Keywords: ribosome profiling, translation regulation, change point, mathematical model Corresponding author: Daryl Shanley Centre for Integrated Systems Biology of Ageing & Nutrition, Institute for Ageing and Health, Newcastle University, NE4 5PL, UK Email: [email protected] Fax: +441912481101 1 bioRxiv preprint doi: https://doi.org/10.1101/003210; this version posted March 5, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Ribo-Seq maps the location of translating ribosomes on mature mRNA transcripts. While ribosome density is constant along the length of the mRNA coding region, it can be altered by translational regulatory events.
    [Show full text]
  • Bio 102 Practice Problems Genetic Code and Mutation
    Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Choose the one best answer: Beadle and Tatum mutagenized Neurospora to find strains that required arginine to live. Based on the classification of their mutants, they concluded that: A. one gene corresponds to one protein. B. DNA is the genetic material. C. "inborn errors of metabolism" were responsible for many diseases. D. DNA replication is semi-conservative. E. protein cannot be the genetic material. 2. Choose the one best answer. Which one of the following is NOT part of the definition of a gene? A. A physical unit of heredity B. Encodes a protein C. Segement of a chromosome D. Responsible for an inherited characteristic E. May be linked to other genes 3. A mutation converts an AGA codon to a TGA codon (in DNA). This mutation is a: A. Termination mutation B. Missense mutation C. Frameshift mutation D. Nonsense mutation E. Non-coding mutation 4. Beadle and Tatum performed a series of complex experiments that led to the idea that one gene encodes one enzyme. Which one of the following statements does not describe their experiments? A. They deduced the metabolic pathway for the synthesis of an amino acid. B. Many different auxotrophic mutants of Neurospora were isolated. C. Cells unable to make arginine cannot survive on minimal media. D. Some mutant cells could survive on minimal media if they were provided with citrulline or ornithine. E. Homogentisic acid accumulates and is excreted in the urine of diseased individuals. 5.
    [Show full text]
  • Ef-G:Trna Dynamics During the Elongation Cycle of Protein Synthesis
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2015 Ef-G:trna Dynamics During the Elongation Cycle of Protein Synthesis Rong Shen University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biochemistry Commons Recommended Citation Shen, Rong, "Ef-G:trna Dynamics During the Elongation Cycle of Protein Synthesis" (2015). Publicly Accessible Penn Dissertations. 1131. https://repository.upenn.edu/edissertations/1131 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1131 For more information, please contact [email protected]. Ef-G:trna Dynamics During the Elongation Cycle of Protein Synthesis Abstract During polypeptide elongation cycle, prokaryotic elongation factor G (EF-G) catalyzes the coupled translocations on the ribosome of mRNA and A- and P-site bound tRNAs. Continued progress has been achieved in understanding this key process, including results of structural, ensemble kinetic and single- molecule studies. However, most of work has been focused on the pre-equilibrium states of this fast process, leaving the real time dynamics, especially how EF-G interacts with the A-site tRNA in the pretranslocation complex, not fully elucidated. In this thesis, the kinetics of EF-G catalyzed translocation is investigated by both ensemble and single molecule fluorescence resonance energy transfer studies to further explore the underlying mechanism. In the ensemble work, EF-G mutants were designed and expressed successfully. The labeled EF-G mutants show good translocation activity in two different assays. In the smFRET work, by attachment of a fluorescent probe at position 693 on EF-G permits monitoring of FRET efficiencies to sites in both ribosomal protein L11 and A-site tRNA.
    [Show full text]
  • Measurements of Translation Initiation from All 64 Codons in E. Coli
    bioRxiv preprint doi: https://doi.org/10.1101/063800; this version posted July 14, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Measurements of translation initiation from all 64 codons in E. coli Ariel Hecht1,2,3,‡, Jeff Glasgow1,2,3,‡, Paul R. Jaschke3,4,‡, Lukmaan Bawazer1,2,3,‡, Matthew S. Munson1,2,3, Jennifer Cochran1,3, Drew Endy1,3,* and Marc Salit1,2,3,* 1Joint Initiative for Metrology in Biology, Stanford, CA, 2Genome-scale Measurements Group, National Institute of Standards and Technology, Stanford, CA, 3Department of Bioengineering, Stanford, CA, 4Department of Chemistry and Biomolecular Sciences, Macquarie University, Sydney, NSW, Australia *To whom correspondence should be addressed. Email: [email protected]. Correspondence may also be addressed to Drew Endy. Email: [email protected]. ‡These authors contributed equally. ABSTRACT Our understanding of translation is one cornerstone of molecular biology that underpins our capacity to engineer living matter. The canonical start codon (AUG) and a few near-cognates (GUG, UUG) are typically considered as the “start codons” for translation initiation in Escherichia coli (E. coli). Translation is typically not thought to initiate from the 61 remaining codons. Here, we systematically quantified translation initiation in E. coli from all 64 triplet codons. We detected protein synthesis above background initiating from at least 46 codons. Translation initiated from these non-canonical start codons at levels ranging from 0.01% to 2% relative to AUG.
    [Show full text]
  • Genes Preferring Non-AUG Start Codons in Bacteria Abstract
    Genes Preferring Non-AUG Start Codons in Bacteria 1,2 2,3,4 Anne Gvozdjak ​ and Manoj P. Samanta ​ ​ 1. Bellevue High School, 10416 SE Wolverine Way, Bellevue, WA 98004 2. Coding for Life Science, Redmond, WA 98053 3. Systemix Institute, Redmond, WA 98053 4. [email protected] Abstract Here we investigate translational regulation in bacteria by analyzing the distribution of start codons in fully assembled genomes. We report 36 genes (infC, rpoC, rnpA, etc.) showing a preference for non-AUG start codons in evolutionarily diverse phyla (“non-AUG genes”). Most of the non-AUG genes are functionally associated with translation, transcription or replication. In E. ​ coli, the percentage of essential genes among these 36 is significantly higher than among all ​ genes. Furthermore, the functional distribution of these genes suggests that non-AUG start codons may be used to reduce gene expression during starvation conditions, possibly through translational autoregulation or IF3-mediated regulation. Introduction Understanding the regulation of gene expression at the transcriptional and translational levels is a key step in deciphering the information contained by genomes. Whereas inexpensive, high-throughput technologies (ChIP-seq, RNAseq) are helping in extensive experimental investigation of transcriptional regulation [1,2], the measurement of translational regulation using ​ ​ high-throughput mass spectroscopy [3] is less widely adopted. Bioinformatics provides another ​ avenue to leverage the rapidly falling cost of DNA sequencing to explore translational regulation. Prior to 2000, computational researchers identified a number of relevant patterns through the comparative analysis of gene sequences [4,5] . With the availability of ~250,000 ​ prokaryotic genomes, thousands of eukaryotic genomes, and additional metagenomic sequences, those patterns can now be studied at a significantly larger scale, and new patterns may also be identified.
    [Show full text]
  • Rps3/Us3 Promotes Mrna Binding at the 40S Ribosome Entry Channel and Stabilizes Preinitiation Complexes at Start Codons
    Rps3/uS3 promotes mRNA binding at the 40S ribosome entry channel and stabilizes preinitiation complexes at start codons Jinsheng Donga, Colin Echeverría Aitkenb, Anil Thakura, Byung-Sik Shina, Jon R. Lorschb,1, and Alan G. Hinnebuscha,1 aLaboratory of Gene Regulation and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892; and bLaboratory on the Mechanism and Regulation of Protein Synthesis, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892 Contributed by Alan G. Hinnebusch, January 24, 2017 (sent for review December 15, 2016; reviewed by Jamie H. D. Cate and Matthew S. Sachs) Met The eukaryotic 43S preinitiation complex (PIC) bearing Met-tRNAi rearrangement to PIN at both near-cognate start codons (e.g., in a ternary complex (TC) with eukaryotic initiation factor (eIF)2-GTP UUG) and cognate (AUG) codons in poor Kozak context; hence scans the mRNA leader for an AUG codon in favorable “Kozak” eIF1 must dissociate from the 40S subunit for start-codon rec- context. AUG recognition provokes rearrangement from an open ognition (Fig. 1A). Consistent with this, structural analyses of PIC conformation with TC bound in a state not fully engaged with partial PICs reveal that eIF1 and eIF1A promote rotation of the “ ” the P site ( POUT ) to a closed, arrested conformation with TC tightly 40S head relative to the body (2, 3), thought to be instrumental bound in the “P ” state. Yeast ribosomal protein Rps3/uS3 resides IN in TC binding in the POUT conformation, but that eIF1 physically in the mRNA entry channel of the 40S subunit and contacts mRNA Met clashes with Met-tRNAi in the PIN state (2, 4), and is both via conserved residues whose functional importance was unknown.
    [Show full text]
  • Mouse Hdgf Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Hdgf Knockout Project (CRISPR/Cas9) Objective: To create a Hdgf knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Hdgf gene (NCBI Reference Sequence: NM_008231 ; Ensembl: ENSMUSG00000004897 ) is located on Mouse chromosome 3. 6 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 6 (Transcript: ENSMUST00000005017). Exon 1~6 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a targeted disruption of this gene are viable and fertile and display no major morphological, biochemical or behavioral phenotypes except for a significant reduction in rearing activity. Exon 1 starts from about 0.14% of the coding region. Exon 1~6 covers 100.0% of the coding region. The size of effective KO region: ~8278 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 Legends Exon of mouse Hdgf Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats.
    [Show full text]
  • Translation | Principles of Biology from Nature Education
    contents Principles of Biology 50 Translation Translation is the process by which a cell assembles proteins from the genetic code. The Rosetta stone. To translate from one language to another, you need a set of comparative rules that act as a template. The Rosetta stone is concrete evidence of how languages were first translated in early human cultures. By displaying the same story in different languages, it served as a template for comparison, a reference for how to get from one language to another. In cells, microscopic structures called ribosomes serve as key sites that support the translation of the mRNA language into the protein language. Archiv/Photo Researchers/Science Source. Topics Covered in this Module Translating DNA into Proteins Major Objectives of this Module Describe the molecular structures involved in translation. Explain the process of translation in detail. Explain how post-translational processes prepare proteins for their functions. page 256 of 989 3 pages left in this module contents Principles of Biology 50 Translation How does a genetic code with only four nucleotides provide the information needed to generate proteins containing up to 20 different amino acids? For this process to occur, many enzymes with specific structures and function are required. Translating DNA into Proteins Translation is the process of converting the information stored in mRNA into protein (Figure 1). Proteins are made up of a series of amino acids. With the help of adapter molecules called transfer RNAs (tRNAs) the appropriate amino acid is added for each set of three adjacent nucleotides in the mRNA, called a codon (Figure 2).
    [Show full text]
  • Aminoacyl-Trna Synthetases Trna Structure: at Least 4 Arms
    Last Friday: test #2 Chem 431c-Lecture 9b Mean = 63/90 (70%) highest = 88/90 Cut off: A ≥80, B≥ 70, C≥55, D≥ 45 Lehninger Principles of --------- future graded activities ----- Biochemistry Quiz# 7 on Monday, Nov 30 - on Translation Fourth Edition Research paper due Monday, Nov. 30 Chapter 27: penalty for lateness: 10 pts/day late Protein Metabolism Quiz #8 on Fri., Dec 4 - on gene regulation (No more furloughs next week for our class! Final exam Dec 9, 8-1030 am) Copyright © 2004 by W. H. Freeman & Company Lecture Topics: Aminoacyl-tRNA synthetases 1) the genetic code : triplet codons; degeneracy; • Aminoacyl-tRNA synthetase attaches aa to their tRNAs. : wobble rules (*know these) aa + tRNA+ATPaa-tRNA + AMP+PPi (ester linkage; 2 high energy bonds broken; highly exergonic, irrev) 2) Open reading frames (ORFs) 3) Transfer RNA - • how is accuracy ensured? 3 steps: Today: (a) selective binding of aa to enzyme to form aa-AMP, 1) tRNA (structure:4 common arms) (b) binding of incorrect aa-AMP products to hydrolysis separate site (c) inherent hydrolysis activity of synthetase enhanced by wrong 2) aminoacyl-tRNA synthetases-steps combos of aa and tRNA. 3) Steps of translation: • How does the synthetase recognize the right tRNA? 4) Protein processing post translation – Mostly thru the amino acyl arm and anticodon arms. aa =amino acid 2 types of aa-tRNA synthetases tRNA structure: at least 4 arms • tRNA has cloverleaf 2nd struc with 4 or 5 arms. 73-93 nts. • Amino acid arm (CCA-3’) • D arm (contains 2-3 D residues=5,6 dihydrouridine) • TΨC arm (contains this conserved seq; Ψ = pseudouridine; T=ribothymidine • Anticodon arm (contains anti codon) • each aa’s carboxyl group is Type II dimer attached to its corresp tRNA in Type I monomer the cytosol.
    [Show full text]
  • Insert Overview of Translation Here 2 Pages. Between Sections 5 and 6 Translation Continued
    Insert Overview of Translation here 2 pages. Between sections 5 and 6 Translation continued 3' TAC CCC CAG GAC TGC ACC TAC TCA TTT ATG AAA ATG 5' 5' ATG GGG GTC CTG ACG TGG ATG AGT AAA TAC TTT TAG 3' Transcription of this DNA produces the following mRNA. 5' AUG GGG GUC CUG ACG UGG AUG AGU AAA UAC UUU UAG 3' Translation of this mRNA produces the following protein NH3 M G V L T W M S K Y F COOH The ribosomes begin translating at the start codon, move down the mRNA in the 5' to 3' direction and stop translating when they encounter a stop codon. The protein is being synthesized in the amino to carboxy direction. For simplicity's sake, we will discuss in detail only prokaryotic translation. Before we proceed let's define two regions of the ribosome. P-site stands for Peptidyl-site. The P-site is the area of the ribosome that holds a tRNA that is attached to the growing polypeptide chain. A-site stands for Acceptor-site. The A-site is an area of the ribosome that accepts the next charged tRNA. A charged tRNA is attached to the amino acid that it encodes. P site A site The complete P and A sites are present only in the 70 ribosome. By itself, the 30S subunit has what we call a partial P-site and a partial A-site. 5' AUG GGG 3' page 6.1 Initiation Initiation is not a function of the complete ribosome but is undertaken by the separate subunits which assemble on the mRNA.
    [Show full text]
  • Fail-Safe Control of Translation Initiation by Dissociation of Eif2a
    RESEARCH ARTICLE Fail-safe control of translation initiation by dissociation of eIF2a phosphorylated ternary complexes Martin D Jennings1,2, Christopher J Kershaw1,2, Tomas Adomavicius1,2, Graham D Pavitt1,2* 1Division of Molecular and Cellular Function, Faculty of Biology Medicine and Health, The University of Manchester, Manchester, United Kingdom; 2Manchester Academic Health Science Centre, The University of Manchester, Manchester, United Kingdom Abstract Phosphorylation of eIF2a controls translation initiation by restricting the levels of active eIF2-GTP/Met-tRNAi ternary complexes (TC). This modulates the expression of all eukaryotic mRNAs and contributes to the cellular integrated stress response. Key to controlling the activity of eIF2 are translation factors eIF2B and eIF5, thought to primarily function with eIF2-GDP and TC respectively. Using a steady-state kinetics approach with purified proteins we demonstrate that eIF2B binds to eIF2 with equal affinity irrespective of the presence or absence of competing guanine nucleotides. We show that eIF2B can compete with Met-tRNAi for eIF2-GTP and can destabilize TC. When TC is formed with unphosphorylated eIF2, eIF5 can out-compete eIF2B to stabilize TC/eIF5 complexes. However when TC/eIF5 is formed with phosphorylated eIF2, eIF2B outcompetes eIF5 and destabilizes TC. These data uncover competition between eIF2B and eIF5 for TC and identify that phosphorylated eIF2-GTP translation initiation intermediate complexes can be inhibited by eIF2B. DOI: 10.7554/eLife.24542.001 *For correspondence: graham. [email protected] Competing interests: The Introduction authors declare that no In eukaryotic translation initiation, initiator tRNA (Met-tRNAi) recognises AUG start codons in mRNA competing interests exist.
    [Show full text]