DOCSLIB.ORG

Bio102 Problems Translation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Bio102 Problems Translation Bio102 Problems Translation 1. If a eukaryotic protein needs to be secreted from the cell into the bloodstream, it must be synthesized A. in the nucleus. B. in the Golgi apparatus. C. by a soluble ribosome. D. on the rough ER. E. on the spliceosome. 2. For each event listed below, indicate if it happens in prokaryotes, eukaryotes, both or neither by circling your answer. Prokaryotes Eukaryotes tRNA molecules are transcribed by RNA polymerase III. Both Neither Prokaryotes Eukaryotes A terminator sequence causes replication to end. Both Neither Prokaryotes Eukaryotes The large subunit of the ribosome binds to the 5′ cap on the mRNA. Both Neither Prokaryotes tRNA molecules become ‘charged’ when an amino acid is covalently Eukaryotes attached. Both Neither Prokaryotes Some mRNA molecules contain more than one functional start Eukaryotes codon. Both Neither Prokaryotes Eukaryotes RNA molecules are made more stable by making them longer. Both Neither 3. If a protein is synthesized on a free ribosome (in other words, not part of the rough ER), which cellular compartment could that protein end up in? A. Cytosol B. Golgi C. Rough ER D. Lysosome E. Secreted outside the cell 4. Used tRNAs exit the ribosome from what site? A. P B. M C. E D. A E. T 5. The aminoacyl-tRNA synthetases are a set of enzymes that catalyze which chemical reaction? A. Termination of transcription B. Capping C. Translation D. Polyadenylation E. Charging 6. Which one regulatory sequence is found in RNA (not DNA)? A. Enhancer B. Terminator C. Origin D. Promoter E. Shine-Dalgarno sequence 7. Matching. Each statement below describes one of the terms listed on the right. Write the number of the correct term in the corresponding blank. 1. -10/-35 boxes 11. RNA polymerase I The protein that polymerizes nucleotides to form a structural part of the ribosome in 2. Cap 12. RNA polymerase II 11 human cells A polymer of nucleotides that can be 3. Enhancer 13. RNA polymerase III 18 covalently attached to a specific amino acid The nucleotide sequence that is responsible for determining where transcription begins in 4. Exon 14. Shine-Dalgarno Sequence 19 eukaryotes The sequence of mRNA that is discarded after 5. Intron 15. Sigma Factor 5 splicing A DNA sequence that binds a specific 6. mRNA 16. Start Codon 3 activator to increase the rate of transcription A modification to the 3’ end of mRNAs 7. PolyA tail 17. Stop Codon 7 Contains the codons 8. Promoter 18. tRNA 4 Protein that causes protein synthesis to stop 9. Release Factor 19. TATA box 9 after the last amino acid has been polymerized 10. rRNA 20. None of these 8. Which one event happens in prokaryotes? A. tRNA charging B. 5’ capping C. nuclear export D. polyadenylation E. splicing 9. Which one statement does NOT correctly describe tRNAs? A. Many tRNA molecules exist within every cell. B. tRNA molecules have intramolecular basepairing, which is antiparallel. C. In eukaryotes, tRNA molecules are made by RNA polymerase II. D. tRNA molecules contain the anticodon. E. tRNA molecules are substrates for aminoacyl tRNA synthetase enzymes. 10. Which one statement does NOT correctly describe prokaryotic ribosomes? A. Ribosomes can associate with a specific sequence of RNA. B. Ribosomes are able to act as enzymes by catalyzing a chemical reaction. C. Ribosomes contain many proteins. D. Some ribosomes are associated with the endoplasmic reticulum. E. Ribosomes contain large amounts of RNA. 11. If an intron isn’t correctly removed, the most probable result is A. the polyA tail won’t be added properly. B. a frameshift mutation. C. replication of the lagging strand will cease. D. a substitution mutation. E. that there will be no effect on gene expression. 12. A tRNA has an anticodon sequence of 5’ GAU 3’. What amino acid should be attached to this tRNA? Ile 13. A tRNA from a prokaryotic cell has the anticodon 5’-GAA-3’. What amino acid should be covalently linked to this tRNA molecule? Phe 14. Name one anticodon sequence that is not found on any prokaryotic tRNA. 5’-UCA-3’ (orUUA or CUA) 15. Many regulatory processes are controlled by proteins that bind to specific sequences. Name the regulatory sequence bound by each of the following proteins, circle which process is being regulated and what type(s) of organism it is found in. Protein Name of Sequence Process Organism(s) Replication Prokaryotes Transcription Eukaryotes TFIID TATA box Splicing Both Translation Neither Replication Prokaryotes Transcription Eukaryotes Initiator Protein Origin of Replication Splicing Both Translation Neither Replication Prokaryotes Transcription Eukaryotes Lac Repressor lac operator Splicing Both Translation Neither Replication Prokaryotes Transcription Eukaryotes Estrogen Receptor estrogen response element Splicing Both Translation Neither 16. Amino acids and nucleic acids are connected together by a covalent bond in which molecule? A. 5’ cap B. mRNA C. Okazaki fragment D. tRNA E. Amino acids and nucleic acids are never covalently connected. 17. Release Factor is needed to stop A. transcription. B. polyadenylation. C. replication. D. splicing. E. translation. 18. VEGF is a molecule that is secreted into the blood by many human cancer cells and is a polymer of 154 amino acids. The peptide bonds of this molecule must have been made A. in the Golgi apparatus. B. on free ribosomes. C. outside of the cell. D. in or near the nucleolus. E. on the rough endoplasmic reticulum. 19. Prokaryotic cells can have more than one functional start codon per mRNA because: A. They have no introns. B. Both transcription and translation happen in the same cellular compartment. C. The activity of the lac repressor is regulated based on the physiological conditions. D. Prokaryotic promoters consist of two separated sequences: the -10 box and the -35 box. E. Prokaryotic ribosomes bind to Shine-Dalgarno sequences 20. Which enzyme charges tRNAs? A. Aminoacyl-tRNA synthetase B. Hexosaminidase A C. RNA ligase D. RNA polymerase E. Topoisomerase 21. An mRNA molecule which contains the following sequence was purified from the cytosol of a wild-type plant cell: 3’…UGAUGCUACGAUAAUAAAUCGGAGUACCUAGCUAU…5’ 21A. Write out the sequence of the template strand of DNA for this gene. Be sure to label your ends. Terminator 5’ACTACGATGCTATTATTTAGCCTCATGGATCGATA 3’ Promoter 21B. On your DNA sequence in 26A, show which side the promoter would be found on. Also indicate what important sequence is found on the other side. 21C. There is more than one potential start codon in this mRNA. How does the cell select which start codon to use? The small subunit of the ribosome binds to the 5’ cap structure then slides towards the 3’ end of the mRNA. Translation initiates at the first AUG codon that is found. 21D. Give the correct amino-acid sequence of the protein encoded by this gene. Be sure to label the ends. N-Met-Arg-Leu-Asn-Asn-Ser-Ile-Val-… -C 21E. What is sequence of the anticodon found on the tRNA needed to translate the second amino acid of this protein? 5’ CCU 3’ 21F. Make a single nucleotide change in the mRNA above that you are confident will not affect the phenotype of this plant. Draw a circle around this change. Change the circled U to any other nucleotide 21G. Make a single nucleotide change in the mRNA above that you are confident will affect the phenotype of this plant. Draw a square around this change. Changing the circled A to any other nucleotide disrupts the start codon 22. Consider the double-stranded DNA sequence of a prokaryotic gene shown below. template 5’ CCCTGCAAGATGCCTAACGTCTCATTGCCATACCTCCTAGCATGC 3’ -10 &- 35 3’ GGGACGTTCTACGGATTGCAGAGTAACGGTATGGAGGATCGTACG 5’ to C After transcription, the following mRNA is produced. The Shine-Dalgarno sequence is underlined. 5’-GCAUGCUAAGGAGGUAUGGCAAUGAGACGUUAGGCAUCUUGCAGGG-3’ 5’ UTR 3’UTR 22A. Label the 5′ and 3′ ends on the DNA sequence and indicate which one is the template strand. 22B. Label and name both UTRs. 22C. The promoter consists of two key sequences. Name both of them and show where on the DNA or RNA sequence they would be expected. (You do not have to know or find their actual DNA sequences.) In the space below, explain how you chose where to place these two key sequences. The -10 and -35 boxes need to be located to the right of the gene above. This allows transcription from right-to-left, to make the indicated mRNA from it’s 5’ to it’s 3’ end. 22D. What is the sequence of the protein made from this gene? Be sure to label both ends. N-Met-Ala-Met-Arg-Arg-C 22E. The amino acids are connected with ___peptide__ bonds. 22F. As we learned in lab, sodium azide introduces base substitution mutations. Show one base substitution in the DNA sequence above that would be a missense mutation and show the new protein sequence below. N-Met-Arg-Met-Arg-Arg-C 22G. What is the sequence of the anticodon on the last tRNA that is needed to translate this protein? 5’ACG3’ .
Load more

Recommended publications
  • Effects of Single Amino Acid Deficiency on Mrna Translation Are Markedly
    www.nature.com/scientificreports OPEN Efects of single amino acid defciency on mRNA translation are markedly diferent for methionine Received: 12 December 2016 Accepted: 4 May 2018 versus leucine Published: xx xx xxxx Kevin M. Mazor, Leiming Dong, Yuanhui Mao, Robert V. Swanda, Shu-Bing Qian & Martha H. Stipanuk Although amino acids are known regulators of translation, the unique contributions of specifc amino acids are not well understood. We compared efects of culturing HEK293T cells in medium lacking either leucine, methionine, histidine, or arginine on eIF2 and 4EBP1 phosphorylation and measures of mRNA translation. Methionine starvation caused the most drastic decrease in translation as assessed by polysome formation, ribosome profling, and a measure of protein synthesis (puromycin-labeled polypeptides) but had no signifcant efect on eIF2 phosphorylation, 4EBP1 hyperphosphorylation or 4EBP1 binding to eIF4E. Leucine starvation suppressed polysome formation and was the only tested condition that caused a signifcant decrease in 4EBP1 phosphorylation or increase in 4EBP1 binding to eIF4E, but efects of leucine starvation were not replicated by overexpressing nonphosphorylatable 4EBP1. This suggests the binding of 4EBP1 to eIF4E may not by itself explain the suppression of mRNA translation under conditions of leucine starvation. Ribosome profling suggested that leucine deprivation may primarily inhibit ribosome loading, whereas methionine deprivation may primarily impair start site recognition. These data underscore our lack of a full
    [Show full text]
  • Detecting Translational Regulation by Change Point Analysis of Ribosome Profiling Datasets
    bioRxiv preprint doi: https://doi.org/10.1101/003210; this version posted March 5, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Detecting translational regulation by change point analysis of ribosome profiling datasets Zupanic A1, Meplan C2, Grellscheid SN3, Mathers JC1, Kirkwood TBL1, Hesketh JE2, Shanley DP1 1Centre for Integrated Systems Biology of Ageing & Nutrition, Institute for Ageing and Health, Newcastle University, Newcastle-upon-Tyne, NE4 5PL, UK 2Institute for Cell and Molecular Biosciences and Human Nutrition Research Centre, Newcastle University, Newcastle-upon-Tyne, NE2 4HH, UK 3School of Biological and Biomedical Sciences, Durham University, Durham DH1 3LE, UK Running title: Translational regulation in ribosome profiles Keywords: ribosome profiling, translation regulation, change point, mathematical model Corresponding author: Daryl Shanley Centre for Integrated Systems Biology of Ageing & Nutrition, Institute for Ageing and Health, Newcastle University, NE4 5PL, UK Email: [email protected] Fax: +441912481101 1 bioRxiv preprint doi: https://doi.org/10.1101/003210; this version posted March 5, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Ribo-Seq maps the location of translating ribosomes on mature mRNA transcripts. While ribosome density is constant along the length of the mRNA coding region, it can be altered by translational regulatory events.
    [Show full text]
  • YEAST CELLS MAY USE AUC OR AAG AS INITIATION CODON for PROTEIN SYNTHESIS by OLE OLSEN
    Carlsberg Res. Commun. Vol. 52, p. 83-90, 1987 YEAST CELLS MAY USE AUC OR AAG AS INITIATION CODON FOR PROTEIN SYNTHESIS by OLE OLSEN Department of Physiology, Carlsberg Laboratory, Gamle Cadsbergvej 10, DK-2500 Copenhagen Valby Keywords: Recombinant DNA, translation initiation, secretion A yeast expression plasmid without an ATG codon for initiation of mouse a-amylase protein synthesis directs the synthesis and secretion of active enzyme indistinguishable from both native mouse a-amylase and amylase synthesized from plasmids with normal AT(3 initiation codons. The initiation of amylase synthesis directed by this plasmid is at either an AUC or an AAG codon. In either case the amino acid sequence of the hydrophobic core and peptidase cleaving region of the signal peptide are normal, and the protein translation remains in frame with the structural gene of the mouse a-amylase. 1. INTRODUCTION mal context for initiation was 6NNAUGGA A where Initiation of protein synthesis in eukaryotes is a purine in position -3 (three nucleotides up- catalysed by a relatively large number of specific stream of the AUG initiator codon) is most eukaryotic initation factors (eIFs) bringing highly conserved. about the formation of the 80S initiation com- Until recently it was generally believed that plex composed ofmRNA, an 80S ribosome and eukaryotic ribosomes initiate exclusively at met-tRNAi (l 3). Eukaryotic met-tRNAi differs AUG codons although it had been shown by from its prokaryotic counterpart by being asso- RAJBHANDARYand GHOSH (24) that yeast met- ciated with the 40S pre-initation complex before tRNAi may function with either AUG or GUG binding to mRNA (13).
    [Show full text]
  • Bio 102 Practice Problems Genetic Code and Mutation
    Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Choose the one best answer: Beadle and Tatum mutagenized Neurospora to find strains that required arginine to live. Based on the classification of their mutants, they concluded that: A. one gene corresponds to one protein. B. DNA is the genetic material. C. "inborn errors of metabolism" were responsible for many diseases. D. DNA replication is semi-conservative. E. protein cannot be the genetic material. 2. Choose the one best answer. Which one of the following is NOT part of the definition of a gene? A. A physical unit of heredity B. Encodes a protein C. Segement of a chromosome D. Responsible for an inherited characteristic E. May be linked to other genes 3. A mutation converts an AGA codon to a TGA codon (in DNA). This mutation is a: A. Termination mutation B. Missense mutation C. Frameshift mutation D. Nonsense mutation E. Non-coding mutation 4. Beadle and Tatum performed a series of complex experiments that led to the idea that one gene encodes one enzyme. Which one of the following statements does not describe their experiments? A. They deduced the metabolic pathway for the synthesis of an amino acid. B. Many different auxotrophic mutants of Neurospora were isolated. C. Cells unable to make arginine cannot survive on minimal media. D. Some mutant cells could survive on minimal media if they were provided with citrulline or ornithine. E. Homogentisic acid accumulates and is excreted in the urine of diseased individuals. 5.
    [Show full text]
  • Ef-G:Trna Dynamics During the Elongation Cycle of Protein Synthesis
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2015 Ef-G:trna Dynamics During the Elongation Cycle of Protein Synthesis Rong Shen University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biochemistry Commons Recommended Citation Shen, Rong, "Ef-G:trna Dynamics During the Elongation Cycle of Protein Synthesis" (2015). Publicly Accessible Penn Dissertations. 1131. https://repository.upenn.edu/edissertations/1131 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1131 For more information, please contact [email protected]. Ef-G:trna Dynamics During the Elongation Cycle of Protein Synthesis Abstract During polypeptide elongation cycle, prokaryotic elongation factor G (EF-G) catalyzes the coupled translocations on the ribosome of mRNA and A- and P-site bound tRNAs. Continued progress has been achieved in understanding this key process, including results of structural, ensemble kinetic and single- molecule studies. However, most of work has been focused on the pre-equilibrium states of this fast process, leaving the real time dynamics, especially how EF-G interacts with the A-site tRNA in the pretranslocation complex, not fully elucidated. In this thesis, the kinetics of EF-G catalyzed translocation is investigated by both ensemble and single molecule fluorescence resonance energy transfer studies to further explore the underlying mechanism. In the ensemble work, EF-G mutants were designed and expressed successfully. The labeled EF-G mutants show good translocation activity in two different assays. In the smFRET work, by attachment of a fluorescent probe at position 693 on EF-G permits monitoring of FRET efficiencies to sites in both ribosomal protein L11 and A-site tRNA.
    [Show full text]
  • Lectins in the Cell Nucleus
    Glycoblotogy vol. 1 no. 3 pp. 243-252, 1991 MINI REVIEW Lectins in the cell nucleus John L.Wang, James G.Laing and Richard L.Anderson Nuclear binding of neoglycoproteins implicates lectins Department of Biochemistry, Michigan State University, East Lansing, The existence of lectin molecules in the cell nucleus was first MI 48824, USA inferred from the binding of neoglycoproteins (see Hubert et al., 1989). These neoglycoproteins were derived by coupling specific saccharide structures onto a polypeptide backbone that normally bears no carbohydrate moiety [e.g. bovine serum albumin, Downloaded from https://academic.oup.com/glycob/article/1/3/243/610598 by guest on 27 September 2021 Key words: carbohydrate recognition/neoglycoproteins/ (BSA)]. Fluorescence microscopy and quantitative flow micro- nuclear glycoconjugates/S-type lectins/subcellular localization fluorometry were carried out with fluorescein-labelled neoglyco- proteins and, in certain instances, ultrastructural analyses were performed with mannose (Man)-conjugated ferritin. When Triton-permeabilized baby hamster kidney (BHK) cells Introduction were incubated with fluorescein-labelled neoglycoprotein, fluorescence was observed in both the cytoplasm and the There is a general consensus that the potential to encode nucleus (Seve et al., 1985, 1986). Strongest binding was observed information in carbohydrate structures is enormous. Many of the for neoglycoproteins bearing a-L-rhamnose, whose structure possibilities of carbohydrate recognition in cellular function have resembles that of /S-D-galactose (Gal) (Monsigny et al., 1983). been explored for extracellular molecules and events such as Significant binding (> 3-fold over fluorescein-conjugated BSA) specific cell-cell recognition and cell adhesion to the extracellular was also observed for BSA bearing glucose (Glc), A'-acetyl- matrix.
    [Show full text]
  • Rapamycin Maintains NAD+/NADH Redox Homeostasis in Muscle Cells
    www.aging-us.com AGING 2020, Vol. 12, No. 18 Priority Research Paper Rapamycin maintains NAD+/NADH redox homeostasis in muscle cells Zhigang Zhang1,2, He N. Xu3,6, Siyu Li1, Antonio Davila Jr2, Karthikeyani Chellappa2, James G. Davis2, Yuxia Guan4, David W. Frederick2, Weiqing Chu2, Huaqing Zhao5, Lin Z. Li3,6, Joseph A. Baur2,6 1College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, China 2Institute for Diabetes, Obesity, and Metabolism, Department of Physiology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA 3Britton Chance Laboratory of Redox Imaging, Department of Radiology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA 4Division of Trauma, Critical Care, and Emergency Surgery, University of Pennsylvania, Philadelphia, PA 19104, USA 5Department of Clinical Sciences, Temple University School of Medicine, Philadelphia, PA 19140, USA 6Institute of Translational Medicine and Therapeutics, University of Pennsylvania, Philadelphia, PA 19104, USA Correspondence to: Zhigang Zhang, Joseph A. Baur, Lin Z. Li; email: [email protected], [email protected], [email protected] Keywords: rapamycin, optical redox imaging, aging, NAD+/NADH ratio, redox state Received: May 18, 2020 Accepted: August 3, 2020 Published: September 22, 2020 Copyright: © 2020 Zhang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Rapamycin delays multiple age-related conditions and extends lifespan in organisms ranging from yeast to mice. However, the mechanisms by which rapamycin influences longevity are incompletely understood.
    [Show full text]
  • Measurements of Translation Initiation from All 64 Codons in E. Coli
    bioRxiv preprint doi: https://doi.org/10.1101/063800; this version posted July 14, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Measurements of translation initiation from all 64 codons in E. coli Ariel Hecht1,2,3,‡, Jeff Glasgow1,2,3,‡, Paul R. Jaschke3,4,‡, Lukmaan Bawazer1,2,3,‡, Matthew S. Munson1,2,3, Jennifer Cochran1,3, Drew Endy1,3,* and Marc Salit1,2,3,* 1Joint Initiative for Metrology in Biology, Stanford, CA, 2Genome-scale Measurements Group, National Institute of Standards and Technology, Stanford, CA, 3Department of Bioengineering, Stanford, CA, 4Department of Chemistry and Biomolecular Sciences, Macquarie University, Sydney, NSW, Australia *To whom correspondence should be addressed. Email: [email protected]. Correspondence may also be addressed to Drew Endy. Email: [email protected]. ‡These authors contributed equally. ABSTRACT Our understanding of translation is one cornerstone of molecular biology that underpins our capacity to engineer living matter. The canonical start codon (AUG) and a few near-cognates (GUG, UUG) are typically considered as the “start codons” for translation initiation in Escherichia coli (E. coli). Translation is typically not thought to initiate from the 61 remaining codons. Here, we systematically quantified translation initiation in E. coli from all 64 triplet codons. We detected protein synthesis above background initiating from at least 46 codons. Translation initiated from these non-canonical start codons at levels ranging from 0.01% to 2% relative to AUG.
    [Show full text]
  • Genes Preferring Non-AUG Start Codons in Bacteria Abstract
    Genes Preferring Non-AUG Start Codons in Bacteria 1,2 2,3,4 Anne Gvozdjak ​ and Manoj P. Samanta ​ ​ 1. Bellevue High School, 10416 SE Wolverine Way, Bellevue, WA 98004 2. Coding for Life Science, Redmond, WA 98053 3. Systemix Institute, Redmond, WA 98053 4. [email protected] Abstract Here we investigate translational regulation in bacteria by analyzing the distribution of start codons in fully assembled genomes. We report 36 genes (infC, rpoC, rnpA, etc.) showing a preference for non-AUG start codons in evolutionarily diverse phyla (“non-AUG genes”). Most of the non-AUG genes are functionally associated with translation, transcription or replication. In E. ​ coli, the percentage of essential genes among these 36 is significantly higher than among all ​ genes. Furthermore, the functional distribution of these genes suggests that non-AUG start codons may be used to reduce gene expression during starvation conditions, possibly through translational autoregulation or IF3-mediated regulation. Introduction Understanding the regulation of gene expression at the transcriptional and translational levels is a key step in deciphering the information contained by genomes. Whereas inexpensive, high-throughput technologies (ChIP-seq, RNAseq) are helping in extensive experimental investigation of transcriptional regulation [1,2], the measurement of translational regulation using ​ ​ high-throughput mass spectroscopy [3] is less widely adopted. Bioinformatics provides another ​ avenue to leverage the rapidly falling cost of DNA sequencing to explore translational regulation. Prior to 2000, computational researchers identified a number of relevant patterns through the comparative analysis of gene sequences [4,5] . With the availability of ~250,000 ​ prokaryotic genomes, thousands of eukaryotic genomes, and additional metagenomic sequences, those patterns can now be studied at a significantly larger scale, and new patterns may also be identified.
    [Show full text]
  • Rps3/Us3 Promotes Mrna Binding at the 40S Ribosome Entry Channel and Stabilizes Preinitiation Complexes at Start Codons
    Rps3/uS3 promotes mRNA binding at the 40S ribosome entry channel and stabilizes preinitiation complexes at start codons Jinsheng Donga, Colin Echeverría Aitkenb, Anil Thakura, Byung-Sik Shina, Jon R. Lorschb,1, and Alan G. Hinnebuscha,1 aLaboratory of Gene Regulation and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892; and bLaboratory on the Mechanism and Regulation of Protein Synthesis, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892 Contributed by Alan G. Hinnebusch, January 24, 2017 (sent for review December 15, 2016; reviewed by Jamie H. D. Cate and Matthew S. Sachs) Met The eukaryotic 43S preinitiation complex (PIC) bearing Met-tRNAi rearrangement to PIN at both near-cognate start codons (e.g., in a ternary complex (TC) with eukaryotic initiation factor (eIF)2-GTP UUG) and cognate (AUG) codons in poor Kozak context; hence scans the mRNA leader for an AUG codon in favorable “Kozak” eIF1 must dissociate from the 40S subunit for start-codon rec- context. AUG recognition provokes rearrangement from an open ognition (Fig. 1A). Consistent with this, structural analyses of PIC conformation with TC bound in a state not fully engaged with partial PICs reveal that eIF1 and eIF1A promote rotation of the “ ” the P site ( POUT ) to a closed, arrested conformation with TC tightly 40S head relative to the body (2, 3), thought to be instrumental bound in the “P ” state. Yeast ribosomal protein Rps3/uS3 resides IN in TC binding in the POUT conformation, but that eIF1 physically in the mRNA entry channel of the 40S subunit and contacts mRNA Met clashes with Met-tRNAi in the PIN state (2, 4), and is both via conserved residues whose functional importance was unknown.
    [Show full text]
  • Mouse Hdgf Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Hdgf Knockout Project (CRISPR/Cas9) Objective: To create a Hdgf knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Hdgf gene (NCBI Reference Sequence: NM_008231 ; Ensembl: ENSMUSG00000004897 ) is located on Mouse chromosome 3. 6 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 6 (Transcript: ENSMUST00000005017). Exon 1~6 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a targeted disruption of this gene are viable and fertile and display no major morphological, biochemical or behavioral phenotypes except for a significant reduction in rearing activity. Exon 1 starts from about 0.14% of the coding region. Exon 1~6 covers 100.0% of the coding region. The size of effective KO region: ~8278 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 Legends Exon of mouse Hdgf Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats.
    [Show full text]
  • Translation | Principles of Biology from Nature Education
    contents Principles of Biology 50 Translation Translation is the process by which a cell assembles proteins from the genetic code. The Rosetta stone. To translate from one language to another, you need a set of comparative rules that act as a template. The Rosetta stone is concrete evidence of how languages were first translated in early human cultures. By displaying the same story in different languages, it served as a template for comparison, a reference for how to get from one language to another. In cells, microscopic structures called ribosomes serve as key sites that support the translation of the mRNA language into the protein language. Archiv/Photo Researchers/Science Source. Topics Covered in this Module Translating DNA into Proteins Major Objectives of this Module Describe the molecular structures involved in translation. Explain the process of translation in detail. Explain how post-translational processes prepare proteins for their functions. page 256 of 989 3 pages left in this module contents Principles of Biology 50 Translation How does a genetic code with only four nucleotides provide the information needed to generate proteins containing up to 20 different amino acids? For this process to occur, many enzymes with specific structures and function are required. Translating DNA into Proteins Translation is the process of converting the information stored in mRNA into protein (Figure 1). Proteins are made up of a series of amino acids. With the help of adapter molecules called transfer RNAs (tRNAs) the appropriate amino acid is added for each set of three adjacent nucleotides in the mRNA, called a codon (Figure 2).
    [Show full text]