Bio102 Problems Translation
1. If a eukaryotic protein needs to be secreted from the cell into the bloodstream, it must be synthesized A. in the nucleus. B. in the Golgi apparatus. C. by a soluble ribosome. D. on the rough ER. E. on the spliceosome. 2. For each event listed below, indicate if it happens in prokaryotes, eukaryotes, both or neither by circling your answer. Prokaryotes Eukaryotes tRNA molecules are transcribed by RNA polymerase III. Both Neither Prokaryotes Eukaryotes A terminator sequence causes replication to end. Both Neither Prokaryotes Eukaryotes The large subunit of the ribosome binds to the 5′ cap on the mRNA. Both Neither Prokaryotes tRNA molecules become ‘charged’ when an amino acid is covalently Eukaryotes attached. Both Neither Prokaryotes Some mRNA molecules contain more than one functional start Eukaryotes codon. Both Neither Prokaryotes Eukaryotes RNA molecules are made more stable by making them longer. Both Neither
3. If a protein is synthesized on a free ribosome (in other words, not part of the rough ER), which cellular compartment could that protein end up in? A. Cytosol B. Golgi C. Rough ER D. Lysosome E. Secreted outside the cell
4. Used tRNAs exit the ribosome from what site? A. P B. M C. E D. A E. T
5. The aminoacyl-tRNA synthetases are a set of enzymes that catalyze which chemical reaction? A. Termination of transcription B. Capping C. Translation D. Polyadenylation E. Charging
6. Which one regulatory sequence is found in RNA (not DNA)? A. Enhancer B. Terminator C. Origin D. Promoter E. Shine-Dalgarno sequence
7. Matching. Each statement below describes one of the terms listed on the right. Write the number of the correct term in the corresponding blank.
1. -10/-35 boxes 11. RNA polymerase I
The protein that polymerizes nucleotides to form a structural part of the ribosome in 2. Cap 12. RNA polymerase II 11 human cells A polymer of nucleotides that can be 3. Enhancer 13. RNA polymerase III 18 covalently attached to a specific amino acid The nucleotide sequence that is responsible for determining where transcription begins in 4. Exon 14. Shine-Dalgarno Sequence 19 eukaryotes The sequence of mRNA that is discarded after 5. Intron 15. Sigma Factor 5 splicing A DNA sequence that binds a specific 6. mRNA 16. Start Codon 3 activator to increase the rate of transcription
A modification to the 3’ end of mRNAs 7. PolyA tail 17. Stop Codon 7
Contains the codons 8. Promoter 18. tRNA 4 Protein that causes protein synthesis to stop 9. Release Factor 19. TATA box 9 after the last amino acid has been polymerized
10. rRNA 20. None of these
8. Which one event happens in prokaryotes? A. tRNA charging B. 5’ capping C. nuclear export D. polyadenylation E. splicing
9. Which one statement does NOT correctly describe tRNAs? A. Many tRNA molecules exist within every cell. B. tRNA molecules have intramolecular basepairing, which is antiparallel. C. In eukaryotes, tRNA molecules are made by RNA polymerase II. D. tRNA molecules contain the anticodon. E. tRNA molecules are substrates for aminoacyl tRNA synthetase enzymes.
10. Which one statement does NOT correctly describe prokaryotic ribosomes? A. Ribosomes can associate with a specific sequence of RNA. B. Ribosomes are able to act as enzymes by catalyzing a chemical reaction. C. Ribosomes contain many proteins. D. Some ribosomes are associated with the endoplasmic reticulum. E. Ribosomes contain large amounts of RNA.
11. If an intron isn’t correctly removed, the most probable result is A. the polyA tail won’t be added properly. B. a frameshift mutation. C. replication of the lagging strand will cease. D. a substitution mutation. E. that there will be no effect on gene expression.
12. A tRNA has an anticodon sequence of 5’ GAU 3’. What amino acid should be attached to this tRNA? Ile 13. A tRNA from a prokaryotic cell has the anticodon 5’-GAA-3’. What amino acid should be covalently linked to this tRNA molecule? Phe 14. Name one anticodon sequence that is not found on any prokaryotic tRNA. 5’-UCA-3’ (orUUA or CUA)
15. Many regulatory processes are controlled by proteins that bind to specific sequences. Name the regulatory sequence bound by each of the following proteins, circle which process is being regulated and what type(s) of organism it is found in. Protein Name of Sequence Process Organism(s) Replication Prokaryotes Transcription Eukaryotes TFIID TATA box Splicing Both Translation Neither Replication Prokaryotes Transcription Eukaryotes Initiator Protein Origin of Replication Splicing Both Translation Neither Replication Prokaryotes Transcription Eukaryotes Lac Repressor lac operator Splicing Both Translation Neither Replication Prokaryotes Transcription Eukaryotes Estrogen Receptor estrogen response element Splicing Both Translation Neither
16. Amino acids and nucleic acids are connected together by a covalent bond in which molecule? A. 5’ cap B. mRNA C. Okazaki fragment D. tRNA E. Amino acids and nucleic acids are never covalently connected.
17. Release Factor is needed to stop A. transcription. B. polyadenylation. C. replication. D. splicing. E. translation.
18. VEGF is a molecule that is secreted into the blood by many human cancer cells and is a polymer of 154 amino acids. The peptide bonds of this molecule must have been made A. in the Golgi apparatus. B. on free ribosomes. C. outside of the cell. D. in or near the nucleolus. E. on the rough endoplasmic reticulum.
19. Prokaryotic cells can have more than one functional start codon per mRNA because: A. They have no introns. B. Both transcription and translation happen in the same cellular compartment. C. The activity of the lac repressor is regulated based on the physiological conditions. D. Prokaryotic promoters consist of two separated sequences: the -10 box and the -35 box. E. Prokaryotic ribosomes bind to Shine-Dalgarno sequences
20. Which enzyme charges tRNAs? A. Aminoacyl-tRNA synthetase B. Hexosaminidase A C. RNA ligase D. RNA polymerase E. Topoisomerase
21. An mRNA molecule which contains the following sequence was purified from the cytosol of a wild-type plant cell: 3’…UGAUGCUACGAUAAUAAAUCGGAGUACCUAGCUAU…5’
21A. Write out the sequence of the template strand of DNA for this gene. Be sure to label your ends. Terminator 5’ACTACGATGCTATTATTTAGCCTCATGGATCGATA 3’ Promoter
21B. On your DNA sequence in 26A, show which side the promoter would be found on. Also indicate what important sequence is found on the other side. 21C. There is more than one potential start codon in this mRNA. How does the cell select which start codon to use? The small subunit of the ribosome binds to the 5’ cap structure then slides towards the 3’ end of the mRNA. Translation initiates at the first AUG codon that is found.
21D. Give the correct amino-acid sequence of the protein encoded by this gene. Be sure to label the ends. N-Met-Arg-Leu-Asn-Asn-Ser-Ile-Val-… -C
21E. What is sequence of the anticodon found on the tRNA needed to translate the second amino acid of this protein? 5’ CCU 3’
21F. Make a single nucleotide change in the mRNA above that you are confident will not affect the phenotype of this plant. Draw a circle around this change. Change the circled U to any other nucleotide
21G. Make a single nucleotide change in the mRNA above that you are confident will affect the phenotype of this plant. Draw a square around this change. Changing the circled A to any other nucleotide disrupts the start codon
22. Consider the double-stranded DNA sequence of a prokaryotic gene shown below. template 5’ CCCTGCAAGATGCCTAACGTCTCATTGCCATACCTCCTAGCATGC 3’ -10 &- 35 3’ GGGACGTTCTACGGATTGCAGAGTAACGGTATGGAGGATCGTACG 5’ to C After transcription, the following mRNA is produced. The Shine-Dalgarno sequence is underlined.
5’-GCAUGCUAAGGAGGUAUGGCAAUGAGACGUUAGGCAUCUUGCAGGG-3’ 5’ UTR 3’UTR
22A. Label the 5′ and 3′ ends on the DNA sequence and indicate which one is the template strand. 22B. Label and name both UTRs.
22C. The promoter consists of two key sequences. Name both of them and show where on the DNA or RNA sequence they would be expected. (You do not have to know or find their actual DNA sequences.) In the space below, explain how you chose where to place these two key sequences. The -10 and -35 boxes need to be located to the right of the gene above. This allows transcription from right-to-left, to make the indicated mRNA from it’s 5’ to it’s 3’ end.
22D. What is the sequence of the protein made from this gene? Be sure to label both ends.
N-Met-Ala-Met-Arg-Arg-C
22E. The amino acids are connected with ___peptide__ bonds. 22F. As we learned in lab, sodium azide introduces base substitution mutations. Show one base substitution in the DNA sequence above that would be a missense mutation and show the new protein sequence below. N-Met-Arg-Met-Arg-Arg-C
22G. What is the sequence of the anticodon on the last tRNA that is needed to translate this protein? 5’ACG3’