DOCSLIB.ORG

Supplementary Information

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Information 1 Supplementary Information 2 Electron transfer complexes in the gut dictate high abundance circulating 3 metabolites 4 Yuanyuan Liu1,2, William Van Treuren2, Bi-Huei Hou1,2, Steven K. Higginbottom2, Justin 5 L. Sonnenburg2,3,4, and Dylan Dodd1,2† 6 7 1Department of Pathology Stanford University School of Medicine, Stanford, CA, USA; 8 2Department of Microbiology and Immunology, Stanford University School of Medicine, 9 Stanford, CA, USA; 3Chan Zuckerburg Biohub, San Francisco, CA, USA; 4Center for 10 Human Microbiome Studies, Stanford, CA, USA. 11 12 † Correspondence: [email protected] 13 14 Supplementary Tables Supplementary Table 1. Estimates of ATP levels during Stickland metabolism of Phe. Phenylalanine disproportionation Considerations Oxidative Pathway Reductive Pathway Stoichiometry for redox 1 mole Phe 2 moles Phe balance NADH reducing equivalents 2 NADH produced (total) 2 NADH produced 4 NADH consumed Net: 2 NADH consumed ATP from substrate level 1 ATP phosphorylation Ferredoxin reduced (2 e- 1 mole Fdred 2 moles Fdred reduction) Protons translocated through Rnf complex 2 protons 4 protons (assuming 2 protons per mole Fdred)a ATP from ETP (assuming 4 0.5 ATP 1 ATP protons per mole ATP)a Total ATP 1.5 ATP 1 ATP Percentage of total ATP 60% 40% a Estimates are from Buckel and Thauer25. 15 16 Supplementary Table 2. Homologs of electron transfer complexes identified by BLASTp Query (% identity # hits # Phyla (Phylum names) # Families (family names) cutoff)a,b,c Clostridium 551 5 phyla (Firmicutes, 19 families (Clostridiaceae, Lachnospiraceae, kluyveri Bcd Thermotogae, Ruminococcaceae, Christensenellaceae, (65%) Bacteroidetes, Peptostreptococcaceae, Oscillospiraceae, Proteobacteria, Proteinivoraceae, Peptoniphilaceae, Fusobacteria) Eubacteriaceae, Thermoanaerobacteraceae, Tissierellaceae, Thermotogaceae, Fervidobacteriaceae, Marinifilaceae, Porphyromonadaceae, Odoribacteraceae, Rikenellaceae, Moraxellaceae, Fusobacteriaceae) Clostridium 53 1 phylum (Firmicutes) 4 families (Clostridiaceae, Lachnospiraceae, sporogenes AcdA Peptostreptococcaceae, Eubacteriaceae) (65%) Clostridium 99 3 phyla (Firmicutes, 6 families (Clostridiaceae, Lachnospiraceae, sporogenes AcdB Proteobacteria, Peptostreptococcaceae, Peptoniphilaceae, (65%) Fusobacteria) Moraxellaceae, Fusobacteriaceae) Clostridium 179 3 phyla (Firmicutes, 9 families (Clostridiaceae, Lachnospiraceae, sticklandii PrdA Proteobacteria, Peptostreptococcaceae, Eubacteriaceae, (65%) Fusobacteria) Ruminococcaceae, Halanaerobiaceae, Veillonellaceae, Moraxellaceae, Fusobacteriaceae) Clostridium 108 2 phyla (Firmicutes, 9 families (Clostridiaceae, Peptostreptococcaceae, sporogenes FldZ Proteobacteria) Lachnospiraceae, Paenibacillaceae, (65%) Pectobacteriaceae, Saccharospirillaceae, Vibrionaceae, Methylocystaceae, Hyphomicrobiaceae) Clostridium 558 5 phyla (Firmicutes, 17 families (Clostridiaceae, Vallitaleaceae, sporogenes RnfB Chloroflexi, Synergistetes, Eubacteriaceae, Lachnospiraceae, (50%) Bacteroidetes, Defluviitaleaceae, Peptostreptococcaceae, Proteobacteria) Syntrophomonadaceae, Ruminococcaceae, Caldicoprobacteraceae, Peptococcaceae, Thermoanaerobacteraceae, Peptoniphilaceae, Tissierellaceae, Anaerolineaceae, Synergistaceae, Bacteroidaceae, Enterobacteriaceae) aGenBank accession numbers for query proteins are as follows: Bcd, EDK32509.1; AcdA, EDU39257.1; AcdB, EDU36591.1; FldZ, EDU36612.1; RnfB, EDU37753.1. bPercent amino acid identity values were determined by first perform performing BLASTp searches of the GenBank database such that known homologs from distantly related organisms were retrieved in the results. cA query coverage cutoff of 80% was also applied. 17 Supplementary Table 3. Primers used in this study. Sequencing primers for ClosTron mutants Gene (Locus ID) Targeted Regiona Sequencing Primersb,c rnfB (CLOSPO_00568) 422s rnfBF: TTTACCAGGAGCTAACTGTG rnfBR: TGGCAAATATCTTTAACAGC rnfE (CLOSPO_00570) 61s rnfEF: TTTAGAAGTTGTTAAGACAGC rnfBR: TATTGAAGATACTGGACCAT Q-PCR primers Primer Orientation Sequence (5′→3′) c Clostridium sporogenes total Forward TTGGCTCTGCACCGGGAATC Reverse CTGCAAACGCCGTCCCTCTT rnfB mutant Forward AGAGCAACCCTAGTGTTCGGTGA Reverse TTGAAAGCCATGCGTCTGACATCT a Targeting regions were designed using the Intron design tool on the ClosTron website (http://www.clostron.com/clostron2.php). The regions listed indicate the nucleotide position within the gene where the intron is inserted and the a/s designation indicates whether the intron integrates in the antisense or sense strand. b Primers were designed to amplify the region containing the expected intron after integration. c Primers were synthesized by Integrated DNA Technologies (Coralville, IA). 18 19 Supplementary Figures 20 21 22 Supplementary Figure 1. Acetate supplementation influences synergism of 23 branched chain amino acids with proline and trans-4-hydroxyproline. C. 24 sporogenes was grown in basal medium devoid of acetate, with the indicated substrates 25 (25 mM) for 48 h and the maximum optical density at 600nm was recorded using a 26 microplate spectrophotometer. 27 28 Supplementary Figure 2. Reductive metabolism of phenyllactic acid is coupled to 29 ATP formation involving acdA. A) DL-Phenyllactic acid was added (1 mM) to resting 30 cell suspensions of C. sporogenes, and ATP levels were measured at indicated 31 timepoints using a luciferase based assay. B) Reductive (PPA) and oxidative (PAA) 32 pathway end products were measured by tandem mass spectrometry during D- 33 phenyllactic acid metabolism. PPA, phenylpropionic acid; PAA, phenylacetic acid. C-D) 34 Phenylacetic acid (C) or phenylpropionic acid (D) were added (1 mM) to resting cell 35 suspensions of C. sporogenes, and ATP levels were measured at indicated timepoints 36 using a luciferase based assay. E) D- or L-phenyllactic acid was added (1 mM) to 37 resting cell suspensions of C. sporogenes, and ATP levels were measured at indicated 38 timepoints using a luciferase based assay. F) DL-phenyllactic acid was added (1 mM) to 39 resting cell suspensions of WT or acdA mutant C. sporogenes, and ATP levels were 40 measured at indicated timepoints using a luciferase based assay. G) Pathways for 41 oxidative and reductive metabolism of phenylalanine. For A-F, experiments were 42 repeated independently three times and representative data are shown. 43 44 Supplementary Figure 3. Proposed ATP yield from the Stickland reaction 45 involving disproportionation of phenylalanine. The Gibbs free energy was 46 calculated from the free energy of formation for reactants and products as given in 47 Thauer et al.26 with the following substitutions (alanine for phenylalanine; acetate for 48 phenylacetate; propionate for phenylpropionate). These estimates suggest that the 49 oxidative pathway contributes 1.5 ATP (1 via substrate level phosphorylation and 0.5 via 50 electron transport phosphorylation), and the reductive pathway contributes 1 ATP (via 51 electron transport phosphorylation). 52 .
Load more

Recommended publications
  • A Systems-Level Investigation of the Metabolism of Dehalococcoides Mccartyi and the Associated Microbial Community
    A Systems-Level Investigation of the Metabolism of Dehalococcoides mccartyi and the Associated Microbial Community by Mohammad Ahsanul Islam A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Chemical Engineering and Applied Chemistry University of Toronto © Copyright by Mohammad Ahsanul Islam 2014 A Systems-Level Investigation of the Metabolism of Dehalococcoides mccartyi and the Associated Microbial Community Mohammad Ahsanul Islam Doctor of Philosophy Department of Chemical Engineering and Applied Chemistry University of Toronto 2014 Abstract Dehalococcoides mccartyi are a group of strictly anaerobic bacteria important for the detoxification of man-made chloro-organic solvents, most of which are ubiquitous, persistent, and often carcinogenic ground water pollutants. These bacteria exclusively conserve energy for growth from a pollutant detoxification reaction through a novel metabolic process termed organohalide respiration. However, this energy harnessing process is not well elucidated at the level of D. mccartyi metabolism. Also, the underlying reasons behind their robust and rapid growth in mixed consortia as compared to their slow and inefficient growth in pure isolates are unknown. To obtain better insight on D. mccartyi physiology and metabolism, a detailed pan- genome-scale constraint-based mathematical model of metabolism was developed. The model highlighted the energy-starved nature of these bacteria, which probably is linked to their slow growth in isolates. The model also provided a useful framework for subsequent analysis and visualization of high-throughput transcriptomic data of D. mccartyi. Apart from confirming expression of the majority genes of these bacteria, this analysis helped review the annotations of ii metabolic genes.
    [Show full text]
  • Microbial Diversity of Drilling Fluids from 3000 M Deep Koyna Pilot
    Science Reports Sci. Dril., 27, 1–23, 2020 https://doi.org/10.5194/sd-27-1-2020 © Author(s) 2020. This work is distributed under the Creative Commons Attribution 4.0 License. Microbial diversity of drilling fluids from 3000 m deep Koyna pilot borehole provides insights into the deep biosphere of continental earth crust Himadri Bose1, Avishek Dutta1, Ajoy Roy2, Abhishek Gupta1, Sourav Mukhopadhyay1, Balaram Mohapatra1, Jayeeta Sarkar1, Sukanta Roy3, Sufia K. Kazy2, and Pinaki Sar1 1Environmental Microbiology and Genomics Laboratory, Department of Biotechnology, Indian Institute of Technology Kharagpur, Kharagpur, 721302, West Bengal, India 2Department of Biotechnology, National Institute of Technology Durgapur, Durgapur, 713209, West Bengal, India 3Ministry of Earth Sciences, Borehole Geophysics Research Laboratory, Karad, 415114, Maharashtra, India Correspondence: Pinaki Sar ([email protected], [email protected]) Received: 24 June 2019 – Revised: 25 September 2019 – Accepted: 16 December 2019 – Published: 27 May 2020 Abstract. Scientific deep drilling of the Koyna pilot borehole into the continental crust up to a depth of 3000 m below the surface at the Deccan Traps, India, provided a unique opportunity to explore microbial life within the deep granitic bedrock of the Archaean Eon. Microbial communities of the returned drilling fluid (fluid re- turned to the mud tank from the underground during the drilling operation; designated here as DF) sampled during the drilling operation of the Koyna pilot borehole at a depth range of 1681–2908 metres below the surface (m b.s.) were explored to gain a glimpse of the deep biosphere underneath the continental crust. Change of pH 2− to alkalinity, reduced abundance of Si and Al, but enrichment of Fe, Ca and SO4 in the samples from deeper horizons suggested a gradual infusion of elements or ions from the crystalline bedrock, leading to an observed geochemical shift in the DF.
    [Show full text]
  • EXPERIMENTAL STUDIES on FERMENTATIVE FIRMICUTES from ANOXIC ENVIRONMENTS: ISOLATION, EVOLUTION, and THEIR GEOCHEMICAL IMPACTS By
    EXPERIMENTAL STUDIES ON FERMENTATIVE FIRMICUTES FROM ANOXIC ENVIRONMENTS: ISOLATION, EVOLUTION, AND THEIR GEOCHEMICAL IMPACTS By JESSICA KEE EUN CHOI A dissertation submitted to the School of Graduate Studies Rutgers, The State University of New Jersey In partial fulfillment of the requirements For the degree of Doctor of Philosophy Graduate Program in Microbial Biology Written under the direction of Nathan Yee And approved by _______________________________________________________ _______________________________________________________ _______________________________________________________ _______________________________________________________ New Brunswick, New Jersey October 2017 ABSTRACT OF THE DISSERTATION Experimental studies on fermentative Firmicutes from anoxic environments: isolation, evolution and their geochemical impacts by JESSICA KEE EUN CHOI Dissertation director: Nathan Yee Fermentative microorganisms from the bacterial phylum Firmicutes are quite ubiquitous in subsurface environments and play an important biogeochemical role. For instance, fermenters have the ability to take complex molecules and break them into simpler compounds that serve as growth substrates for other organisms. The research presented here focuses on two groups of fermentative Firmicutes, one from the genus Clostridium and the other from the class Negativicutes. Clostridium species are well-known fermenters. Laboratory studies done so far have also displayed the capability to reduce Fe(III), yet the mechanism of this activity has not been investigated
    [Show full text]
  • Wedding Higher Taxonomic Ranks with Metabolic Signatures Coded in Prokaryotic Genomes
    Wedding higher taxonomic ranks with metabolic signatures coded in prokaryotic genomes Gregorio Iraola*, Hugo Naya* Corresponding authors: E-mail: [email protected], [email protected] This PDF file includes: Supplementary Table 1 Supplementary Figures 1 to 4 Supplementary Methods SUPPLEMENTARY TABLES Supplementary Tab. 1 Supplementary Tab. 1. Full prediction for the set of 108 external genomes used as test. genome domain phylum class order family genus prediction alphaproteobacterium_LFTY0 Bacteria Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae Unknown candidatus_nasuia_deltocephalinicola_PUNC_CP013211 Bacteria Proteobacteria Gammaproteobacteria Unknown Unknown Unknown candidatus_sulcia_muelleri_PUNC_CP013212 Bacteria Bacteroidetes Flavobacteriia Flavobacteriales NA Candidatus Sulcia deinococcus_grandis_ATCC43672_BCMS0 Bacteria Deinococcus-Thermus Deinococci Deinococcales Deinococcaceae Deinococcus devosia_sp_H5989_CP011300 Bacteria Proteobacteria Unknown Unknown Unknown Unknown micromonospora_RV43_LEKG0 Bacteria Actinobacteria Actinobacteria Micromonosporales Micromonosporaceae Micromonospora nitrosomonas_communis_Nm2_CP011451 Bacteria Proteobacteria Betaproteobacteria Nitrosomonadales Nitrosomonadaceae Unknown nocardia_seriolae_U1_BBYQ0 Bacteria Actinobacteria Actinobacteria Corynebacteriales Nocardiaceae Nocardia nocardiopsis_RV163_LEKI01 Bacteria Actinobacteria Actinobacteria Streptosporangiales Nocardiopsaceae Nocardiopsis oscillatoriales_cyanobacterium_MTP1_LNAA0 Bacteria Cyanobacteria NA Oscillatoriales
    [Show full text]
  • Groundwater Cable Bacteria Conserve Energy by Sulfur Disproportionation
    The ISME Journal (2020) 14:623–634 https://doi.org/10.1038/s41396-019-0554-1 ARTICLE Groundwater cable bacteria conserve energy by sulfur disproportionation 1 2 1 1 Hubert Müller ● Sviatlana Marozava ● Alexander J. Probst ● Rainer U. Meckenstock Received: 3 July 2019 / Revised: 28 October 2019 / Accepted: 4 November 2019 / Published online: 14 November 2019 © The Author(s) 2019. This article is published with open access Abstract Cable bacteria of the family Desulfobulbaceae couple spatially separated sulfur oxidation and oxygen or nitrate reduction by long-distance electron transfer, which can constitute the dominant sulfur oxidation process in shallow sediments. However, it remains unknown how cells in the anoxic part of the centimeter-long filaments conserve energy. We found 16S rRNA gene sequences similar to groundwater cable bacteria in a 1-methylnaphthalene-degrading culture (1MN). Cultivation with elemental sulfur and thiosulfate with ferrihydrite or nitrate as electron acceptors resulted in a first cable bacteria enrichment culture dominated >90% by 16S rRNA sequences belonging to the Desulfobulbaceae. Desulfobulbaceae-specific fluorescence in situ hybridization (FISH) unveiled single cells and filaments of up to several hundred micrometers length to fi 1234567890();,: 1234567890();,: belong to the same species. The Desulfobulbaceae laments also showed the distinctive cable bacteria morphology with their continuous ridge pattern as revealed by atomic force microscopy. The cable bacteria grew with nitrate as electron acceptor and elemental sulfur and thiosulfate as electron donor, but also by sulfur disproportionation when Fe(Cl)2 or Fe (OH)3 were present as sulfide scavengers. Metabolic reconstruction based on the first nearly complete genome of groundwater cable bacteria revealed the potential for sulfur disproportionation and a chemo-litho-autotrophic metabolism.
    [Show full text]
  • Microbial Communities in Biogas Reactors and Their Link to Stability and Performance
    Microbial communities in biogas reactors and their link to stability and performance Mikrobielle samfunn i biogass reaktorer og deres kobling til stabilitet og ytelse Philosophiae Doctor (PhD) Thesis Live Heldal Hagen Department of Chemistry, Biotechnology and Food Science Faculty of Veterinary Medicine and Bioscience Norwegian University of Life Sciences Ås (2016) Thesis number 2016:60 ISSN 1894-6402 ISBN 978-82-575-1380-1 Table of Contents ACKNOWLEDGEMENTS .................................................................................................................. III SUMMARY ........................................................................................................................................... V SAMMENDRAG ................................................................................................................................. VII ABBREVIATIONS .............................................................................................................................. XI LIST OF PAPERS ................................................................................................................................ IX 1 INTRODUCTION ............................................................................................................................... 1 1.1 BIOGAS PRODUCTION FOR A SUSTAINABLE BIO-ECONOMY........................................................... 1 1.2 Biogas in Europe and Norway .................................................................................................. 2 1.2
    [Show full text]
  • Mahella Australiensis Type Strain (50-1 BONT)
    Standards in Genomic Sciences (2011) 4:331-341 DOI:10.4056/sigs.1864526 Complete genome sequence of Mahella australiensis type strain (50-1 BONT) Johannes Sikorski1, Hazuki Teshima2,3, Matt Nolan2, Susan Lucas2, Nancy Hammon2, Shweta Deshpande2, Jan-Fang Cheng2, Sam Pitluck2, Konstantinos Liolios2, Ioanna Pagani2, Natalia Ivanova2, Marcel Huntemann2, Konstantinos Mavromatis2, Galina Ovchinikova2, Amrita Pati2, Roxanne Tapia2,3, Cliff Han2,3, Lynne Goodwin2,3, Amy Chen4, Krishna Palaniappan4, Miriam Land2,5, Loren Hauser2,5, Olivier D. Ngatchou-Djao6, Manfred Rohde6, Rüdiger Pukall1, Stefan Spring1, Birte Abt1, Markus Göker1, John C. Detter2,3, Tanja Woyke2, James Bristow2, Victor Markowitz4, Philip Hugenholtz2,7, Jonathan A. Eisen2,8, Nikos C. Kyrpides2, Hans-Peter Klenk1, and Alla Lapidus2* 1 DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany 2 DOE Joint Genome Institute, Walnut Creek, California, USA 3 Los Alamos National Laboratory, Bioscience Division, Los Alamos, New Mexico, USA 4 Biological Data Management and Technology Center, Lawrence Berkeley National Laboratory, Berkeley, California, USA 5 Oak Ridge National Laboratory, Oak Ridge, Tennessee, USA 6 HZI – Helmholtz Centre for Infection Research, Braunschweig, Germany 7 Australian Centre for Ecogenomics, School of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, Australia 8 University of California Davis Genome Center, Davis, California, USA *Corresponding author: Alla Lapidus Keywords: strictly anaerobic, motile, spore-forming, Gram-positive, moderately thermophilic, chemoorganotrophic, Thermoanaerobacteraceae, GEBA Mahella australiensis Bonilla Salinas et al. 2004 is the type species of the genus Mahella, which belongs to the family Thermoanaerobacteraceae. The species is of interest because it differs from other known anaerobic spore-forming bacteria in its G+C content, and in certain phenotypic traits, such as carbon source utilization and relationship to temperature.
    [Show full text]
  • Chasing the Metabolism of Novel Syntrophic Acetate-Oxidizing Bacteria In
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.06.451242; this version posted July 6, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Chasing the metabolism of novel syntrophic acetate-oxidizing bacteria in 2 thermophilic methanogenic chemostats 3 4 Yan Zenga, Dan Zhengb, Min Gouc, Zi-Yuan Xiac, Ya-Ting Chenc,d*, Masaru Konishi 5 Nobue,*, Yue-Qin Tanga,c,* 6 7 a Institute of New Energy and Low-carbon Technology, Sichuan University, No. 24, 8 South Section 1, First Ring Road, Chengdu, Sichuan 610065, China 9 b Biogas Institute of Ministry of Agriculture and Rural Affairs, Section 4-13, Renmin 10 Road South, Chengdu 610041, P. R. China 11 c College of Architecture and Environment, Sichuan University, No. 24, South Section 12 1, First Ring Road, Chengdu, Sichuan 610065, China 13 d Institute for Disaster Management and Reconstruction, Sichuan University–Hong 14 Kong Polytechnic University, Chengdu, Sichuan 610207, China 15 e Bioproduction Research Institute, National Institute of Advanced Industrial Science 16 and Technology (AIST), Central 6, Higashi 1-1-1, Tsukuba, Ibaraki 305-8566, Japan 17 18 *Correspondence: Ya-Ting Chen, Institute for Disaster Management and 19 Reconstruction, Sichuan University–Hong Kong Polytechnic University, Chengdu, 20 Sichuan 610207, China 21 and Masaru Konishi Nobu, Bioproduction Research Institute, National Institute of 22 Advanced Industrial Science and Technology (AIST), Central 6, Higashi 1-1-1, 23 Tsukuba, Ibaraki 305-8566, Japan 24 and Yue-Qin Tang, College of Architecture and Environment, Sichuan University, No.
    [Show full text]
  • Genome Diversity of Spore-Forming Firmicutes MICHAEL Y
    Genome Diversity of Spore-Forming Firmicutes MICHAEL Y. GALPERIN National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD 20894 ABSTRACT Formation of heat-resistant endospores is a specific Vibrio subtilis (and also Vibrio bacillus), Ferdinand Cohn property of the members of the phylum Firmicutes (low-G+C assigned it to the genus Bacillus and family Bacillaceae, Gram-positive bacteria). It is found in representatives of four specifically noting the existence of heat-sensitive vegeta- different classes of Firmicutes, Bacilli, Clostridia, Erysipelotrichia, tive cells and heat-resistant endospores (see reference 1). and Negativicutes, which all encode similar sets of core sporulation fi proteins. Each of these classes also includes non-spore-forming Soon after that, Robert Koch identi ed Bacillus anthracis organisms that sometimes belong to the same genus or even as the causative agent of anthrax in cattle and the species as their spore-forming relatives. This chapter reviews the endospores as a means of the propagation of this orga- diversity of the members of phylum Firmicutes, its current taxon- nism among its hosts. In subsequent studies, the ability to omy, and the status of genome-sequencing projects for various form endospores, the specific purple staining by crystal subgroups within the phylum. It also discusses the evolution of the violet-iodine (Gram-positive staining, reflecting the pres- Firmicutes from their apparently spore-forming common ancestor ence of a thick peptidoglycan layer and the absence of and the independent loss of sporulation genes in several different lineages (staphylococci, streptococci, listeria, lactobacilli, an outer membrane), and the relatively low (typically ruminococci) in the course of their adaptation to the saprophytic less than 50%) molar fraction of guanine and cytosine lifestyle in a nutrient-rich environment.
    [Show full text]
  • Long-Term Phenotypic Evolution of Bacteria
    LETTER doi:10.1038/nature13827 Long-term phenotypic evolution of bacteria Germa´n Plata1,2, Christopher S. Henry3 & Dennis Vitkup1,4 For many decades comparative analyses of protein sequences and is sometimes observed within the same species, a transition from high structures have been used to investigate fundamental principles of to low phenotypic similarity occurs primarily at the genus level. molecular evolution1,2. In contrast, relatively little is known about Analyses of phenotypic evolution, such as the morphological varia- the long-term evolution of species’ phenotypic and genetic properties. tion of beaks in Darwin’s finches3, provided the original impetus and This represents an important gap in our understanding of evolu- context for understanding natural selection. Because the evolutionary tion, as exactly these proprieties play key roles in natural selection importance and physiological role of specific phenotypic traits change and adaptation to diverse environments. Here we perform a com- over time, it is often difficult to connect genotype to phenotype to fit- parative analysis of bacterial growth and gene deletion phenotypes ness across long evolutionary distances, especially for metazoan organ- using hundreds of genome-scale metabolic models. Overall, bacte- isms. For microbial species, on the other hand, the ability to metabolize rial phenotypic evolution can be described by a two-stage process different nutrient sources, although clearly not the only important phe- with a rapid initial phenotypic diversification followed by a slow notype, always remains an essential determinant of their fitness and long-term exponential divergence. The observed average divergence lifestyle. Even though a large-scale comparative analysis of microbial trend, with approximately similar fractions of phenotypic properties phenotypes—such as growth on different nutrients or the impact of changing per unit time, continues for billions of years.
    [Show full text]
  • The Rumen Bacterial Community of Reindeer in Different Age Periods from Russian Arctic Regions
    AGRICULTURAL SCIENCES (CROP SCIENCES, ANIMAL SCIENCES) DOI: 10.22616/rrd.24.2018.062 THE RUMEN BACTERIAL COMMUNITY OF REINDEER IN DIFFERENT AGE PERIODS FROM RUSSIAN ARCTIC REGIONS Larisa Ilina1, Valentina Filippova1, Andrey Dubrovin1, Elena Yildirim1, Timur Dunyashev1, Georgiy Laptev1, Kasim Laishev2 1BIOTROF+ LTD, Russia 2North-West Center for Interdisciplinary Research on Food Security Problems, Russia [email protected] Abstract Rangifer tarandus (reindeer) – is actively bred in the northern regions of different countries. Therefore, an urgent task is to deepen information about the features of reindeer adaptations. Rumen symbiotic microorganisms play an important role in the life of Rangifer tarandus, allowing animals to efficiently use scarce nutrient resources of the tundra and forest-tundra. The microbial community of the reindeer rumen, as well as its age-related changes, are the least studied compared to other ruminants. The comparative analysis results of rumen bacterial community composition of calf (4 months), young animals (1–2 years) and adults (3–6 years) Rangifer tarandus of the Russian Arctic are presented for the first time. The reindeer ruminal bacterial community composition was analyzed in the laboratory of the ‘BIOTROF+’ Ltd by T-RFLP method. In the ontogenesis, significant changes in the microorganism representation were noticed, the greatest of which was noted in microorganism involved in carbohydrate fermentation. The content of cellulolytic Clostridia and the acid-utilizing species of the Negativicutes (P<0.05) decreased with age, but bacteria with the amylo- and cellulosolytic properties of the phylum Bacteroidetes increased (P<0.05). A wide range of microorganisms which traditionally belong to the pathogens of various animals and humans diseases was revealed.
    [Show full text]
  • Community Analysis of Plant Biomass-Degrading Microorganisms from Obsidian Pool, Yellowstone National Park
    Microb Ecol DOI 10.1007/s00248-014-0500-8 ENVIRONMENTAL MICROBIOLOGY Community Analysis of Plant Biomass-Degrading Microorganisms from Obsidian Pool, Yellowstone National Park Tatiana A. Vishnivetskaya & Scott D. Hamilton-Brehm & Mircea Podar & Jennifer J. Mosher & Anthony V. Palumbo & Tommy J. Phelps & Martin Keller & James G. Elkins Received: 12 May 2014 /Accepted: 16 September 2014 # Springer Science+Business Media New York (outside the USA) 2014 Abstract The conversion of lignocellulosic biomass into (OBP), was examined for potential biomass-active microorgan- biofuels can potentially be improved by employing robust mi- isms using cultivation-independent and enrichment techniques. croorganisms and enzymes that efficiently deconstruct plant Analysis of 33,684 archaeal and 43,784 bacterial quality-filtered polysaccharides at elevated temperatures. Many of the geother- 16S rRNA gene pyrosequences revealed that archaeal diversity mal features of Yellowstone National Park (YNP) are surrounded in the main pool was higher than bacterial; however, in the by vegetation providing a source of allochthonic material to vegetated area, overall bacterial diversity was significantly support heterotrophic microbial communities adapted to utilize higher. Of notable interest was a flooded depression adjacent to plant biomass as a primary carbon and energy source. In this OBP supporting a stand of Juncus tweedyi, a heat-tolerant rush study, a well-known hot spring environment, Obsidian Pool commonly found growing near geothermal features in YNP. The microbial community from heated sediments surrounding the The submitted manuscript has been authored by a contractor of the U.S. plants was enriched in members of the Firmicutes including Government under contract DE-AC05-00OR22725. Accordingly, the potentially (hemi)cellulolytic bacteria from the genera U.S.
    [Show full text]