DOCSLIB.ORG

Guidelines for the Use and Interpretation of Assays for Monitoring Autophagy (3Rd Edition)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

AUTOPHAGY 2016, VOL. 12, NO. 1, 1–222 http://dx.doi.org/10.1080/15548627.2015.1100356 EDITORIAL Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition) Daniel J Klionsky1745,1749*, Kotb Abdelmohsen840, Akihisa Abe1237, Md Joynal Abedin1762, Hagai Abeliovich425, Abraham Acevedo Arozena789, Hiroaki Adachi1800, Christopher M Adams1669, Peter D Adams57, Khosrow Adeli1981, Peter J Adhihetty1625, Sharon G Adler700, Galila Agam67, Rajesh Agarwal1587, Manish K Aghi1537, Maria Agnello1826, Patrizia Agostinis664, Patricia V Aguilar1960, Julio Aguirre-Ghiso784,786, Edoardo M Airoldi89,422, Slimane Ait-Si-Ali1376, Takahiko Akematsu2010, Emmanuel T Akporiaye1097, Mohamed Al-Rubeai1394, Guillermo M Albaiceta1294, Chris Albanese363, Diego Albani561, Matthew L Albert517, Jesus Aldudo128, Hana Algul€ 1164, Mehrdad Alirezaei1198, Iraide Alloza642,888, Alexandru Almasan206, Maylin Almonte-Beceril524, Emad S Alnemri1212, Covadonga Alonso544, Nihal Altan-Bonnet848, Dario C Altieri1205, Silvia Alvarez1497, Lydia Alvarez-Erviti1395, Sandro Alves107, Giuseppina Amadoro860, Atsuo Amano930, Consuelo Amantini1554, Santiago Ambrosio1458, Ivano Amelio756, Amal O Amer918, Mohamed Amessou2089, Angelika Amon726, Zhenyi An1538, Frank A Anania291, Stig U Andersen6, Usha P Andley2079, Catherine K Andreadi1690, Nathalie Andrieu-Abadie502, Alberto Anel2027, David K Ann58, Shailendra Anoopkumar-Dukie388, Manuela Antonioli832,858, Hiroshi Aoki1791, Nadezda Apostolova2007, Saveria Aquila1500, Katia Aquilano1876, Koichi Araki292, Eli Arama2098, Agustin Aranda456, Jun Araya591, Alexandre Arcaro1472, Esperanza Arias26, Hirokazu Arimoto1225, Aileen R Ariosa1749, Jane L Armstrong1930, Thierry Arnould1773, Ivica Arsov2120, Katsuhiko Asanuma675, Valerie Askanas1924, Eric Asselin1867, Ryuichiro Atarashi794, Sally S Atherton369, Julie D Atkin713, Laura D Attardi1131, Patrick Auberger1787, Georg Auburger379, Laure Aurelian1727, Riccardo Autelli1992, Laura Avagliano1029,1755, Maria Laura Avantaggiati364, Limor Avrahami1166, Suresh Awale1986, Neelam Azad404, Tiziana Bachetti568, Jonathan M Backer28, Dong-Hun Bae1933, Jae-sung Bae677, Ok-Nam Bae409, Soo Han Bae2117, Eric H Baehrecke1729, Seung-Hoon Baek17, Stephen Baghdiguian1368, Agnieszka Bagniewska-Zadworna2, Hua Bai90, Jie Bai667, Xue-Yuan Bai1133, Yannick Bailly884, Kithiganahalli Narayanaswamy Balaji473, Walter Balduini2002, Andrea Ballabio316, Rena Balzan1711, Rajkumar Banerjee239, Gabor Banhegyi1052, Haijun Bao2109, Benoit Barbeau1363, Maria D Barrachina2007, Esther Barreiro467, Bonnie Bartel997, Alberto Bartolome222, Diane C Bassham550, Maria Teresa Bassi1046, Robert C Bast Jr1273, Alakananda Basu1798, Maria Teresa Batista1578, Henri Batoko1336, Maurizio Battino970, Kyle Bauckman2085, Bradley L Baumgarner1909, K Ulrich Bayer1594, Rupert Beale1553, Jean-Francois¸ Beaulieu1360, George R. Beck Jr48,294, Christoph Becker336, J David Beckham1595, Pierre-AndreB edard 749, Patrick J Bednarski301, Thomas J Begley1135, Christian Behl1419, Christian Behrends757, Georg MN Behrens406, Kevin E Behrns1627, Eloy Bejarano26, Amine Belaid490, Francesca Belleudi1041, Giovanni Benard 497, Guy Berchem706, Daniele Bergamaschi983, Matteo Bergami1401, Ben Berkhout1441, Laura Berliocchi714, Amelie Bernard1749, Monique Bernard1354, Francesca Bernassola1880, Anne Bertolotti791, Amanda S Bess272,Sebastien Besteiro1351, Saverio Bettuzzi1828, Savita Bhalla913, Shalmoli Bhattacharyya973, Sujit K Bhutia838, Caroline Biagosch1159, Michele Wolfe Bianchi520,1378,1381, Martine Biard-Piechaczyk210, Viktor Billes298, Claudia Bincoletto1314, Baris Bingol350, Sara W Bird1128, Marc Bitoun1112, Downloaded by [Institute of Research] at 01:03 12 February 2016 Ivana Bjedov1258, Craig Blackstone843, Lionel Blanc1183, Guillermo A Blanco1496, Heidi Kiil Blomhoff1812, Emilio Boada-Romero1297, Stefan Bockler€ 1464, Marianne Boes1423, Kathleen Boesze-Battaglia1835, Lawrence H Boise286,287, Alessandra Bolino2063, Andrea Boman693, Paolo Bonaldo1823, Matteo Bordi897,Jurgen€ Bosch608, Luis M Botana1308, Joelle Botti1375, German Bou1405, Marina Bouche1038, Marion Bouchecareilh1331, Marie-Josee Boucher1901, Michael E Boulton481, Sebastien G Bouret1926, Patricia Boya133, Michael€ Boyer-Guittaut1345, Peter V Bozhkov1141, Nathan Brady374, Vania MM Braga469, Claudio Brancolini1997, Gerhard H Braus353, Jose M Bravo-San Pedro299,393,508,1374, Lisa A Brennan322, Emery H Bresnick2022, Patrick Brest490, Dave Bridges1939, Marie-Agnes Bringer124, Marisa Brini1822, Glauber C Brito1311, Bertha Brodin631, Paul S Brookes1872, Eric J Brown352, Karen Brown1690, Hal E Broxmeyer480, Alain Bruhat486,1339, Patricia Chakur Brum1893, John H Brumell446, Nicola Brunetti-Pierri315,1171, Robert J Bryson-Richardson781, Shilpa Buch1777, Alastair M Buchan1819, Hikmet Budak1022, Dmitry V Bulavin118,505,1789, Scott J Bultman1792, Geert Bultynck665, Vladimir Bumbasirevic1470, Yan Burelle1356, Robert E Burke216,217, Margit Burmeister1750, Peter Butikofer€ 1473, Laura Caberlotto1987, Ken Cadwell896, Monika Cahova112, Dongsheng Cai24, Jingjing Cai2099, Qian Cai1018, Sara Calatayud2007, Nadine Camougrand1343, Michelangelo Campanella1700, Grant R Campbell1525, Matthew Campbell1249, Silvia Campello556,1876, Robin Candau1769, Isabella Caniggia1983, Lavinia Cantoni560, Lizhi Cao116, Allan B Caplan1656, Michele Caraglia1051, Claudio Cardinali1043, CONTACT Daniel J Klionsky [email protected] Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109-2216. © 2016 Taylor & Francis Group, LLC 2 D. J. KLIONSKY ET AL. Sandra Morais Cardoso1579, Jennifer S Carew208, Laura A Carleton874, Cathleen R Carlin101, Silvia Carloni2002, Sven R Carlsson1267,DidacCarmona-Gutierrez1643, Leticia AM Carneiro312, Oliana Carnevali971, Serena Carra1318, Alice Carrier120, Bernadette Carroll900, Caty Casas1324, Josefina Casas1116, Giuliana Cassinelli324, Perrine Castets1462, Susana Castro-Obregon214, Gabriella Cavallini1841, Isabella Ceccherini568, Francesco Cecconi253,555,1884, Arthur I Cederbaum459, Valentın Cena~ 199,1281, Simone Cenci1323,2064, Claudia Cerella444, Davide Cervia1996, Silvia Cetrullo1478, Hassan Chaachouay2028, Han-Jung Chae187, Andrei S Chagin634, Chee-Yin Chai626,628, Gopal Chakrabarti1502, Georgios Chamilos1601, Edmond YW Chan1142, Matthew TV Chan181, Dhyan Chandra1003, Pallavi Chandra548, Chih-Peng Chang818, Raymond Chuen-Chung Chang1653, Ta Yuan Chang345, John C Chatham1434, Saurabh Chatterjee1910, Santosh Chauhan527, Yongsheng Che62, Michael E Cheetham1263, Rajkumar Cheluvappa1783, Chun-Jung Chen1153, Gang Chen598,1676, Guang-Chao Chen9, Guoqiang Chen1078, Hongzhuan Chen1077, Jeff W Chen1514, Jian-Kang Chen370,371, Min Chen249, Mingzhou Chen2104, Peiwen Chen1823, Qi Chen1674, Quan Chen172, Shang-Der Chen138, Si Chen325, Steve S-L Chen10, Wei Chen2125, Wei-Jung Chen829, Wen Qiang Chen979, Wenli Chen1113, Xiangmei Chen1133, Yau-Hung Chen1157, Ye-Guang Chen1250, Yin Chen1447, Yingyu Chen953,955, Yongshun Chen2135, Yu-Jen Chen712, Yue-Qin Chen1145, Yujie Chen1208, Zhen Chen339, Zhong Chen2123, Alan Cheng1702, Christopher HK Cheng184, Hua Cheng1728, Heesun Cheong814, Sara Cherry1836, Jason Chesney1703, Chun Hei Antonio Cheung817, Eric Chevet1359, Hsiang Cheng Chi140, Sung-Gil Chi656, Fulvio Chiacchiera308, Hui-Ling Chiang958, Roberto Chiarelli1826, Mario Chiariello235,567,577, Marcello Chieppa835, Lih-Shen Chin290, Mario Chiong1285, Gigi NC Chiu878, Dong-Hyung Cho676, Ssang-Goo Cho650, William C Cho982, Yong-Yeon Cho105, Young-Seok Cho1064, Augustine MK Choi2095, Eui-Ju Choi656, Eun-Kyoung Choi387,400,685, Jayoung Choi1563, Mary E Choi2093, Seung-Il Choi2116, Tsui-Fen Chou412, Salem Chouaib395, Divaker Choubey1574, Vinay Choubey1936, Kuan-Chih Chow822, Kamal Chowdhury730, Charleen T Chu1856, Tsung-Hsien Chuang827, Taehoon Chun657, Hyewon Chung652, Taijoon Chung978, Yuen-Li Chung1194, Yong-Joon Chwae18, Valentina Cianfanelli254, Roberto Ciarcia1775, Iwona A Ciechomska886, Maria Rosa Ciriolo1876, Mara Cirone1042, Sofie Claerhout1694, Michael J Clague1698, Joan Claria1457, Peter GH Clarke1687, Robert Clarke361, Emilio Clementi1045,1398,Cedric Cleyrat1781, Miriam Cnop1366, Eliana M Coccia574, Tiziana Cocco1459, Patrice Codogno1375,Jorn€ Coers271, Ezra EW Cohen1533, David Colecchia235,567,577, Luisa Coletto25,Nuria S Coll123, Emma Colucci-Guyon516, Sergio Comincini1829, Maria Condello578, Katherine L Cook2073, Graham H Coombs1929, Cynthia D Cooper2076, J Mark Cooper1395, Isabelle Coppens601, Maria Tiziana Corasaniti1387, Marco Corazzari485,1884, Ramon Corbalan1566, Elisabeth Corcelle-Termeau251, Mario D Cordero1899, Cristina Corral-Ramos1289, Olga Corti507,1109, Andrea Cossarizza1767, Paola Costelli1993, Safia Costes1518, Susan L Cotman721, Ana Coto-Montes946, Sandra Cottet566,1688, Eduardo Couve1301, Lori R Covey1015, L Ashley Cowart762, Jeffery S Cox1536, Fraser P Coxon1427, Carolyn B Coyne1846, Mark S Cragg1919, Rolf J Craven1679, Tiziana Crepaldi1995, Jose L Crespo1300, Alfredo Criollo1285, Valeria Crippa558, Maria Teresa Cruz1576, Ana Maria Cuervo26, Jose M Cuezva1277, Taixing Cui1907, Pedro R Cutillas987, Mark J Czaja27, Maria F Czyzyk-Krzeska1572, Ruben K Dagda2068, Uta Dahmen1404, Chunsun Dai800, Wenjie Dai1187, Yun Dai2059, Kevin N Dalby1940, Luisa Dalla Valle1822, Guillaume Dalmasso1340, Marcello D’Amelio557, Markus Damme188, Arlette Darfeuille-Michaud1340, Catherine Dargemont950, Victor M Darley-Usmar1433, Srinivasan Dasarathy205, Biplab Dasgupta202, Srikanta Dash1254, Crispin R Dass242, Hazel Marie Davey8, Lester M Davids1560, David Davila227, Roger J Davis1731,
Recommended publications
  • A Day in Luxembourg, LUXEMBOURG

    A Day in Luxembourg, LUXEMBOURG

    A Day in Luxembourg, LUXEMBOURG Why you should visit Luxembourg Luxembourg is the epitome of “the charming European city” we all grew up imagining. It’s amazingly cosmopolitan but not overwhelming, except for its extremely complex history. Its gorges traverse the city, making it a spectacular three-dimensional city, with lit-up fortifications along the walls of the gorges -- perfect for the historian and the romantic. And the food is a lovely mix of French, German, Italian and of course Luxembourgish. Three things you might be surprised to learn about Luxembourg and the people 1. Luxembourg is listed as a UNESCO World Heritage Site due to its old quarters and fortifications. 2. General George Patton is buried here 3. Villeroy & Boch ceramics started in Luxembourg Favorite Walks/areas of town Go to the visitors center in Place Guillaume to sign up for any of the many fantastic—and reasonably priced—group or individual walking, biking or driving (even in your own car) historic tours with an official guide. The tours can include visits to: • Historic city center • The Petrusse gorge next to the city center • The historic Grund, down below the city center • Clausen, near the Grund • Petrusse and Bock Casemates Other very good things to do/see • American Military Cemetery, Hamm: A beautiful cemetery with more than 5,000 soldiers, most of whom fell in the Battle of the Bulge of WWII in 1944-45. The cemetery also has an impressive chapel and is the burial place of General George Patton. www.abmc.gov/cemeteries/cemeteries/lx.php • German Military Cemetery, Sandweiler: A short drive from the Hamm cemetery, this cemetery has a much more somber feel to it, containing more than 10,000 German soldiers who perished in the Battle of the Bulge in 1944-45.
  • Novel Insights Into Autophagy from Multicellular Model Systems

    Novel Insights Into Autophagy from Multicellular Model Systems

    Feature Review Eaten alive: novel insights into autophagy from multicellular model systems 1 2 Hong Zhang and Eric H. Baehrecke 1 Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China 2 Department of Molecular, Cell, and Cancer Biology, University of Massachusetts Medical School, Worcester, MA 01605, USA Autophagy delivers cytoplasmic material to lysosomes are essential for autophagosome formation [7,8]. Remark- for degradation. First identified in yeast, the core genes ably, the core autophagy machinery that is encoded by that control this process are conserved in higher organ- these genes is conserved between yeast and humans isms. Studies of mammalian cell cultures have expanded [6]. Many studies of immortalized mammalian cell lines our understanding of the core autophagy pathway, but indicate that, as in yeast, nutrient-limiting conditions cannot reveal the unique animal-specific mechanisms induce autophagy that is dependent on ATG genes. How- for the regulation and function of autophagy. Multicel- ever, several aspects of the autophagy pathway in higher lular organisms have different types of cells that possess eukaryotes are distinct from that in yeast. In yeast, all distinct composition, morphology, and organization of autophagosomes arise from the single perivacuolar preau- intracellular organelles. In addition, the autophagic ma- tophagosomal structure (PAS). In higher eukaryotes, there chinery integrates signals from other cells and environ- is no evidence for a PAS and isolation membranes can be mental conditions to maintain cell, tissue and organism generated simultaneously at multiple sites, implicating homeostasis. Here, we highlight how studies of autop- more complex sources for autophagosomal membranes. hagy in flies and worms have identified novel core Indeed, the endoplasmic reticulum (ER), mitochondria, autophagy genes and mechanisms, and provided insight plasma membrane, and recycling endosomes have been into the context-specific regulation and function of shown to contribute to autophagosomal membranes autophagy.
  • Expert Group Meeting to Enhance Health 2020 Monitoring and Reporting Piecing Together the Health Information Puzzle

    Expert Group Meeting to Enhance Health 2020 Monitoring and Reporting Piecing Together the Health Information Puzzle

    The WHO Regional Office for Europe The World Health Organization (WHO) is a specialized agency of the United Nations created in 1948 with the primary responsibility for international health matters and public health. The WHO Regional Office for Europe is one of six regional offices throughout the world, each with its own programme geared to the particular health conditions of the countries it serves. Member States Albania Copenhagen, Denmark, 1–2 September 2016 Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Cyprus Czechia Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Montenegro Netherlands Norway Poland Portugal Republic of Moldova Expert group meeting to enhance Romania Russian Federation San Marino Serbia Health 2020 monitoring and reporting Slovakia Slovenia Spain World Health Organization Sweden Piecing together the health Switzerland Regional Office for Europe Tajikistan The former Yugoslav UN City, Marmorvej 51, DK-2100 Copenhagen Ø, Denmark information puzzle Republic of Macedonia Turkey Tel.: +45 45 33 70 00 Fax: +45 45 33 70 01 Turkmenistan Email: [email protected] Ukraine United Kingdom Website: www.euro.who.int Uzbekistan WORLD HEALTH ORGANIZATION ORGANISATION MONDIALE DE LA SANTÉ REGIONAL OFFICE FOR EUROPE BUREAU RÉGIONAL DE L'EUROPE WELTGESUNDHEITSORGANISATION ВСЕМИРНАЯ ОРГАНИЗАЦИЯ REGIONALBÜRO FÜR EUROPA ЗДРАВООХРАНЕНИЯ ЕВРОПЕЙСКОЕ РЕГИОНАЛЬНОЕ БЮРО Expert group meeting to enhance Health 2020 monitoring and reporting Piecing together the health information puzzle Copenhagen, Denmark 1–2 September 2016 Abstract The WHO Regional Office for Europe convened the first meeting of the expert group on enhancing Health 2020 monitoring and reporting on 1–2 September 2016.
  • Focus on European Cities 12 Focus on European Cities

    Focus on European Cities 12 Focus on European Cities

    Focus on European cities 12 Focus on European cities Part of the Europe 2020 strategy focuses on sustainable and There were 36 cities with a population of between half a socially inclusive growth within the cities and urban areas million and 1 million inhabitants, including the following of the European Union (EU). These are often major centres capital cities: Amsterdam (the Netherlands), Riga (Latvia), for economic activity and employment, as well as transport Vilnius (Lithuania) and København (Denmark). A further network hubs. Apart from their importance for production, 85 cities were in the next tier, with populations ranging be- cities are also focal points for the consumption of energy and tween a quarter of a million and half a million, including other materials, and are responsible for a high share of total Bratislava, Tallinn and Ljubljana, the capital cities of Slova- greenhouse gas emissions. Furthermore, cities and urban re- kia, Estonia and Slovenia. Only two capital cities figured in gions often face a range of social difficulties, such as crime, the tier of 128 cities with 150 000 to 250 000 people, namely poverty, social exclusion and homelessness. The Urban Audit Lefkosia (Cyprus) and Valletta (Malta). The Urban Audit also assesses socioeconomic conditions across cities in the EU, provides results from a further 331 smaller cities in the EU, Norway, Switzerland, Croatia and Turkey, providing valuable with fewer than 150 000 inhabitants, including the smallest information in relation to Europe’s cities and urban areas. capital
  • INTERNATIONAL ACCOUNTING STUDY ABROAD SPRING 2019 (For Accounting Majors Only)

    INTERNATIONAL ACCOUNTING STUDY ABROAD SPRING 2019 (For Accounting Majors Only)

    INTERNATIONAL ACCOUNTING STUDY ABROAD SPRING 2019 (for Accounting Majors only) BECOME A GLOBALLY-MINDED ACCOUNTING PROFESSIONAL AND EXPERIENCE EUROPEAN CULTURE You will gain a new perspective of international accounting as you learn about challenges and opportunities facing global companies and organizations in a variety of industries, including banking, automotive, and standard setting. You will experience the rich diversity of European cultures as you travel through seven countries. In Poland, you will participate in “International Week” at the University of Economics in Katowice. This will be an opportunity to collaborate with local university students in classes led by professors from around the world. BUSINESS VISITS (tentative): You will expand your business acumen by visiting international companies and organizations such as Disney, MiniCooper (owned by BMW), Cargill, DHL, Mercer, Criteo, , GPS Capital, Bank of England, the he Organisation for Economic Co-operation and Development, the European Commission, dōTERRA WalInternationales. Accounting Standards Board, t the Association of Chartered Certified Accountants, and the Institute of Chartered Accountants in England and CULTURAL VISITS (tentative): In Rome, Italy, we will visit the historic Colosseum, the Vatican and the Sistine Chapel, and . In Paris, France, we will visit the astonishingly opulent Palace of Versailles, see the Eiffel Tower and Notre Dame Cathedral, and visit the Paris Temple. In Katowice, Poland, theCologne, Rome GermanyTemple , we will explore one of the oldest cities in Germany and visit the magnificent Cologne Cathedral. We will walk the cobblestone streets of the Old City of Luxembourg, foundedwe inwill the visit year the 96 sobering. We Auschwitz will enjoy concentration the Old Market camp.
  • Summer Compass 24

    Summer Compass 24

    SUMMER COMPASS TRIP CODE: EESCLL-9 TOPDECKER, meet Europe WHAT YOU NEED TO KNOW Spin the compass and let us take you along the vibrant path from London to some of the most popular regions in Europe. We're talking culture, history and food (and lots of it) as we wander 24 through France, Spain, Italy, the Vatican City, Switzerland, Luxembourg and the Netherlands. Lucky you! It's going to be an incredible adventure. Jump on and get excited. Hostel Plus Nights Android/iPhone This is a principal app download package. info HI, and thanks for choosing to holiday with Topdeck You can rest assured that we’ll pull out all the stops to make your trip unforgettable. Now it’s time to get excited about your holiday... ON THE BUCKET LIST (INCLUDED) ABOUT YOUR TRIP NOTES + Visit Pisa and the famous Leaning Tower + Canal dinner cruise in Amsterdam These Trip Notes contain everything you need to know before your trip departs – including where to meet and what to bring. We + Visit the Loire Valley recommend that you read these notes thoroughly so you know + Driving tour of Madrid what to expect on your trip of a lifetime. Also, you can easily download and print this document off so you can bring it with you + Driving tour of Paris and gourmet picnic by when you travel. the Eiffel Tower + Vaporetto ride in Venice Please bear in mind that some points should be taken as a guide + Walking tour of Verona only – after all, everyone’s different! For example, daily spending + Bordeaux winery experience money and clothing lists can vary from one person to the next, so don't be alarmed if you don't expect to spend (or even wear) so + Walking tour of Florence with a local guide much! + Walking tour of Venice PLEASE NOTE: We strongly urge you to refresh this + Walking tour of Marseille document as close to the time of your departure as possible to + Walking tour of Valencia ensure you have the most up-to-date accommodation list and information available.
  • Identification of a Novel Autophagy-Related Gene Signature

    Identification of a Novel Autophagy-Related Gene Signature

    Identication of a novel autophagy-related gene signature for predicting metastasis and survival in patients with osteosarcoma Guangzhi Zhang Lanzhou University Second Hospital https://orcid.org/0000-0003-3193-0297 Yajun Deng Lanzhou University Second Hospital Zuolong Wu Lanzhou University Second Hospital Enhui Ren Lanzhou University Second Hospital Wenhua Yuan Lanzhou University Second Hospital Qiqi Xie ( [email protected] ) Lanzhou University Second Hospital https://orcid.org/0000-0003-4099-5287 Primary research Keywords: osteosarcoma, autophagy-related genes, signature, survival, metastasis Posted Date: March 26th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-19384/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/20 Abstract Background: Osteosarcoma (OS) is a bone malignant tumor that occurs in children and adolescents. Due to a lack of reliable prognostic biomarkers, the prognosis of OS patients is often uncertain. This study aimed to construct an autophagy-related gene signature to predict the prognosis of OS patients. Methods: The gene expression prole data of OS and normal muscle tissue samples were downloaded separately from the Therapeutically Applied Research To Generate Effective Treatments (TARGET) and Genotype-Tissue Expression (GTEx) databases . The differentially expressed autophagy-related genes (DEARGs) in OS and normal muscle tissue samples were screened using R software, before being subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. A protein-protein interaction (PPI) network was constructed and hub autophagy-related genes were screened. Finally, the screened autophagy-related genes were subjected to univariate Cox regression, Lasso Cox regression, survival analysis, and clinical correlation analysis.
  • The Functional and Pathologic Relevance of Autophagy Proteases

    The Functional and Pathologic Relevance of Autophagy Proteases

    The functional and pathologic relevance of autophagy proteases Álvaro F. Fernández, Carlos López-Otín J Clin Invest. 2015;125(1):33-41. https://doi.org/10.1172/JCI73940. Review Autophagy is a well-conserved catabolic process essential for cellular homeostasis. First described in yeast as an adaptive response to starvation, this pathway is also present in higher eukaryotes, where it is triggered by stress signals such as damaged organelles or pathogen infection. Autophagy is characterized at the cellular level by the engulfment of portions of the cytoplasm in double-membrane structures called autophagosomes. Autophagosomes fuse with lysosomes, resulting in degradation of the inner autophagosomal membrane and luminal content. This process is coordinated by complex molecular systems, including the ATG8 ubiquitin–like conjugation system and the ATG4 cysteine proteases, which are implicated in the formation, elongation, and fusion of these autophagic vesicles. In this Review, we focus on the diverse functional roles of the autophagins, a protease family formed by the four mammalian orthologs of yeast Atg4. We also address the dysfunctional expression of these proteases in several pathologic conditions such as cancer and inflammation and discuss potential therapies based on their modulation. Find the latest version: https://jci.me/73940/pdf The Journal of Clinical Investigation REVIEW SERIES: AUTOPHAGY Series Editor: Guido Kroemer The functional and pathologic relevance of autophagy proteases Álvaro F. Fernández and Carlos López-Otín Departamento de Bioquímica y Biología Molecular, Instituto Universitario de Oncología (IUOPA), Universidad de Oviedo, Oviedo, Spain. Autophagy is a well-conserved catabolic process essential for cellular homeostasis. First described in yeast as an adaptive response to starvation, this pathway is also present in higher eukaryotes, where it is triggered by stress signals such as damaged organelles or pathogen infection.
  • Biotechnology Field

    Biotechnology Field

    A USERS' GUIDE FOR SMES IN THE BIOTECHNOLOGY FIELD May 1999 35()$&( %\0DUWLQ%DQJHPDQQ 0HPEHURIWKH(XURSHDQ&RPPLVVLRQ In the present emerging global market, new technological advance represents one of the main ways to guarantee EU competitiveness. This is why new technologies constitute a key for our future economic development. Among those, information technologies and biotechnology probably present the biggest opportunities. Modern biotechnology is one of these key emerging technologies which Europe must harness successfully to sustain economic growth and competitiveness. Today, biotechnology related sectors employ between 300,000 and 400,000 people in 1995. In 2005, this could rise to as much as 3,000,0001. The emergence of new technologies is presenting challenges to both industry and the public sector. Some of these technologies have far reaching implications for a large number of industrial sectors, creating wealth and employment, resulting in the increased competitiveness of Europe’s economy. Modern biotechnology in its many guises has developed pharmaceutical products which are viewed as medical milestones. The direct benefits for human beings are without precedence. Human insulin (against diabetes), Interferon (against cancer) and EPO (erythropoietin, against blood deficiencies) are amongst the most famous. Biotechnology doesn’t, however, only encompass health care and diagnostics. For example, food products with higher nutritional values and longer shelf lives as well as dietary and hypo- allergenic products are now being developed. For example, a strain of rice is now being developed which those with gluten allergies could consume. Furthermore, the application of modern biotechnological techniques will have environmental implications: pollution from industry, households and agriculture can indeed be significantly reduced.
  • Molecular Mechanism and Regulation of Autophagy in Saccharomyces Cerevisiae

    Molecular Mechanism and Regulation of Autophagy in Saccharomyces Cerevisiae

    Molecular Mechanism and Regulation of Autophagy in Saccharomyces cerevisiae by Zhiyuan Yao A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Molecular, Cellular and Developmental Biology) in the University of Michigan 2018 Doctoral Committee: Professor Daniel J. Klionsky, Chair Professor Laura Olsen Professor Lois S. Weisman Professor Haoxing Xu Zhiyuan Yao [email protected] ORCID iD: 0000-0002-5759-9822 © Zhiyuan Yao 2018 Dedication This thesis is dedicated to my beloved wife Jie Li, and to my parents Cai Yao and Hexiang Liu for their unconditional support. This thesis is also dedicated to Saber, Artoria Pendragon, who always inspires me with her strong will and noble spirit. ii Acknowledgements First I want to thank my mentor, Dr. Daniel J. Klionsky, for his continuous support and patient guidance during my Ph.D. works. Dan is a great scientist as well as a wise advisor. His passion in science and helpful advice on my projects always encouraged me to plan ahead and consider potential problems before they develop. Five years’ experience in one’s 20s will greatly shape his view in both career and life, and I feel so lucky to have Dan as my example during my graduate life. I also want to thank my thesis committee members, Professor Haoxing Xu, Professor Lois S. Weisman and Professor Laura Olsen. Your generous support and immense knowledge provided me with invaluable suggestions and criticisms for my research. Without all this help, I could not finish this thesis. Here I would like to express my sincere thanks for all of the efforts you made.
  • ATG4A Antibody (RQ5946)

    ATG4A Antibody (RQ5946)

    ATG4A Antibody (RQ5946) Catalog No. Formulation Size RQ5946 0.5mg/ml if reconstituted with 0.2ml sterile DI water 100 ug Bulk quote request Availability 1-3 business days Species Reactivity Human Format Antigen affinity purified Clonality Polyclonal (rabbit origin) Isotype Rabbit IgG Purity Affinity purified Buffer Lyophilized from 1X PBS with 2% Trehalose and 0.025% sodium azide UniProt Q8WYN0 Applications Western blot : 0.5-1ug/ml Immunohistochemistry : 1-2ug/ml Flow cytometry : 1-3ug/million cells Limitations This ATG4A antibody is available for research use only. IHC staining of FFPE human rectal cancer with ATG4A antibody. HIER: boil tissue sections in pH8 EDTA for 20 min and allow to cool before testing. IHC staining of FFPE human lung cancer with ATG4A antibody. HIER: boil tissue sections in pH8 EDTA for 20 min and allow to cool before testing. Western blot testing of human 1) HeLa, 2) HepG2, 3) PC-3 and 4) A549 lysate with ATG4A antibody. Predicted molecular weight ~45 kDa, commonly observed between 45-60 kDa. Flow cytometry testing of human PC-3 cells with ATG4A antibody at 1ug/million cells (blocked with goat sera); Red=cells alone, Green=isotype control, Blue= ATG4A antibody. Description Cysteine protease ATG4A is an enzyme that in humans is encoded by the ATG4A gene. It is mapped to Xq22.3. Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed.
  • ATG4A (NM 052936) Human Tagged ORF Clone Product Data

    ATG4A (NM 052936) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC218030 ATG4A (NM_052936) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ATG4A (NM_052936) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ATG4A Synonyms: APG4A; AUTL2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC218030 representing NM_052936 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGTCAGTTTTATCCAAGTATGAAGATCAGATTACTATTTTCACTGACTACCTAGAAGAATATCCAG ATACAGATGAGCTGGTATGGATCTTAGGGAAGCAGCATCTCCTTAAAACAGAAAAATCTAAGCTGTTGTC TGATATAAGTGCTCGTCTATGGTTTACATACAGAAGGAAATTTTCACCAATTGGTGGAACGGGCCCTTCA TCAGATGCTGGTTGGGGATGTATGCTACGCTGTGGACAGATGATGCTGGCTCAAGCCCTTATCTGTAGAC ACTTGGGAAGGGACTGGAGCTGGGAGAAACAAAAAGAACAACCCAAAGAATACCAACGCATCCTACAGTG CTTCTTAGATAGAAAAGATTGTTGCTACTCTATCCATCAAATGGCACAAATGGGTGTAGGAGAAGGGAAA TCAATTGGAGAATGGTTTGGACCAAATACAGTTGCACAGGTGTTAAAAAAACTTGCTTTATTTGACGAAT GGAATTCCTTGGCTGTTTATGTTTCAATGGATAACACAGTGGTCATTGAAGATATCAAAAAAATGTGCCG TGTCCTTCCCTTGAGTGCTGACACAGCTGGTGACAGGCCTCCCGATTCTTTAACTGCTTCAAACCAGAGT AAGGGCACCTCTGCCTACTGCTCAGCCTGGAAACCCCTGCTGCTCATTGTGCCCCTTCGCCTGGGCATAA ACCAAATCAATCCTGTCTATGTTGATGCATTCAAAGAGTGTTTTAAGATGCCACAGTCTTTAGGGGCATT AGGAGGAAAACCAAATAACGCGTATTATTTCATAGGATTCTTAGGTGACGAGCTCATCTTCTTGGACCCT CATACAACCCAGACCTTTGTTGACACTGAAGAGAATGGAACGGTTAATGACCAGACTTTCCATTGCCTGC