Published OnlineFirst January 17, 2019; DOI: 10.1158/1541-7786.MCR-18-1039 Oncogenes and Tumor Suppressors Molecular Cancer Research The RUNX Transcriptional Coregulator, CBFb, Suppresses Migration of ERþ Breast Cancer Cells by Repressing ERa-Mediated Expression of the Migratory Factor TFF1 Henry J Pegg, Hannah Harrison, Connor Rogerson, and Paul Shore Abstract Core binding factor b (CBFb), the essential coregulator of anism revealed that the increase in migration is driven by the RUNX transcription factors, is one of the most frequently coregulation of Trefoil factor 1 (TFF1) by CBFb and ERa. þ mutated genes in estrogen receptor–positive (ER ) breast RUNX1–CBFb acts to repress ERa-activated expression of cancer. Many of these mutations are nonsense mutations and TFF1. TFF1 is a motogen that stimulates migration and we À À are predicted to result in loss of function, suggesting a tumor show that knockdown of TFF1 in CBFb / cells inhibits the suppressor role for CBFb. However, the impact of missense migratory phenotype. Our findings reveal a new mechanism þ mutations and the loss of CBFb in ER breast cancer cells have by which RUNX1–CBFb and ERa combine to regulate gene not been determined. Here we demonstrate that missense expression and a new role for RUNX1–CBFb in the prevention mutations in CBFb accumulate near the Runt domain–bind- of cell migration by suppressing the expression of the motogen ing region. These mutations inhibit the ability of CBFb to form TFF1. CBFb–Runx–DNA complexes. We further show that deletion þ of CBFb, using CRISPR-Cas9, in ER MCF7 cells results in an Implications: Mutations in CBFb contribute to the develop- increase in cell migration. This increase in migration is depen- ment of breast cancer by inducing a metastatic phenotype that dent on the presence of ERa. Analysis of the potential mech- is dependent on ER. reported. However, the effects of these mutations have not been Introduction established. All CBFb mutations reported appear to been in – þ b Core binding factor b (CBFb) is the obligate binding partner estrogen receptor positive (ER ) breast cancer, with CBF muta- – þ of all three mammalian Runx transcription factors, Runx1, 2, tions estimated to occur in approximately 2.6% 4.7% of all ER – a þ and 3 (1). Knockout of CBFb in mouse phenocopies Runx- breast cancers (7 9). ER is a key driver of cell proliferation in ER loss and is embryonic lethal (2, 3). CBFb binding to Runx breast cancer, and it has recently been shown that RUNX1 pre- a proteins protects Runx from proteasomal degradation and vents ER -mediated repression of the Wnt pathway repressor, causes a conformational change in the runt domain, the AXIN1, suggesting one explanation for the role of RUNX1 and b DNA-binding domain, which increases its affinity for DNA CBF in this context (10). a binding (4, 5). Trefoil factor 1 (TFF1) is a well-established ER target gene and a We have previously shown that CBFb has a proinvasive role in is often used as a robust marker of activated ER . TFF1 is essential triple-negative breast cancer cells (6). More recently, mutations in for normal function of the gastric mucosa; it is a small, secreted CBFb (and RUNX1) were reported in breast tumors and are protein that has been described as a "motogen" needed for repair among the most frequently reported for breast cancer tumors of the gastric epithelia following damage (11). In breast cancer, it (7–9). Many of these mutations are nonsense mutations predicted has been demonstrated to play a role in cell migration (12) and to result in loss of function, suggesting a tumor suppressor role for chemotaxis (13). b þ CBFb. In addition, numerous missense mutations have also been To investigate the role of CBF in ER breast cancer, we initially evaluated the mechanistic function of CBFb missense mutations that occur in patients with breast cancer. All of the missense mutations we studied suppress the formation of the CBFb– Runx–DNA complex. We then used CRISPR-Cas9 to delete CBFb þ Faculty of Biology, Medicine and Health, The University of Manchester, in ER MCF7 cells and we show that loss of CBFb leads to an Manchester, United Kingdom. increase in cell migration. Subsequent analysis revealed that the Note: Supplementary data for this article are available at Molecular Cancer increased migration is mediated, at least in part, by the derepres- Research Online (http://mcr.aacrjournals.org/). sion of TFF1 and we demonstrate that the increased TFF1 expres- Corresponding Author: Paul Shore, University of Manchester, Michael Smith sion is mediated by loss of ERa repression by CBFb. Importantly, Building, Oxford Road, Manchester M13 9PT, United Kingdom. Phone: 44-0161- this mechanism is distinct from the coactivator role of Runx1 2755978; Fax: 44-0161-2745978; E-mail: [email protected] previously reported for AXIN1 regulation and reflects a novel þ doi: 10.1158/1541-7786.MCR-18-1039 explanation for the occurrence of CBFb mutations in ER breast Ó2019 American Association for Cancer Research. cancer. www.aacrjournals.org OF1 Downloaded from mcr.aacrjournals.org on September 29, 2021. © 2019 American Association for Cancer Research. Published OnlineFirst January 17, 2019; DOI: 10.1158/1541-7786.MCR-18-1039 Pegg et al. Materials and Methods Fluorescent electrophoretic mobility shift assays CBFb (WT and mutant) and Runt domain were expressed Cells and culture conditions and purified from Bl21-gold DE3 Cells (Agilent Technologies) Human HeLa, MCF7, MDA-MB-231, and T47D cell lines were using a GST tag that was cleaved off during purification. obtained from LGC Standards and were maintained in DMEM Electrophoretic mobility shift assays (EMSA) performed (Sigma-Aldrich) supplemented with 10% FBS (Biowest), 1% L- using the Odyssey Infrared EMSA Kit (LI-COR Biosciences) glutamine (Sigma-Aldrich), and 1% penicillin–streptomycin using a double-stranded fluorescently labeled DNA probe 50- (Sigma). Charcoal-stripped FBS (cs-FBS) was generated by incu- ATTO700-TCTGAAAACCACAGCCGCCA-30.CBFb (5 mg; WT or bation of FBS with 3% (m/v) dextran-coated charcoal (Sigma- mutant) was used per well alongside 0.6-mg Runt domain per Aldrich) at 4 C for 72 hours before filter (0.22 mmol/L) sterili- reaction. An SDS-PAGE gel was also run and stained with zation. For estrogen stimulation experiments, cells were grown in InstandBlue (Expedeon) to confirm equal loading of each phenol red–free DMEM (Life Technologies), supplemented with protein. 5% cs-FBS, 1% L-glutamine (Sigma-Aldrich), and 1% penicillin– streptomycin (Sigma-Aldrich) for 4 days prior to 10 nmol/L – b-estradiol stimulation (4–24 hours depending on the CRISPR-Cas9 mediated gene knockout b experiment). CBF gene knockout was performed using a double nickase CRISPR-Cas9 strategy as described previously (14). Guide RNA sequences were designed using E-CRISP (15) to minimize off- Preparation of conditioned media 6 2 target effects. Cells were fluorescence-activated cell sorted for GFP- A total of 1 Â 10 cells were plated in a 10-cm dish and grown Cas9 expression 48 hours after transfection and grown up from in complete media supplemented with 10 nmol/L estrogen (17b- single colonies prior to genomic DNA PCR and Western blotting Estradiol, Sigma-Aldrich) for 3 days. Media were removed from screening. cells, spun at 4,000 Â g for 15 minutes to remove dead cells, and stored at À20C. Genomic DNA PCR CBFb plasmid mutagenesis Genomic DNA was isolated using a Purelink gDNA Extraction To introduce specific mutations into the CBFb sequence, a Kit (Invitrogen) as per the manufacturer's protocol. The genomic fi QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Tech- region around the CRISPR-Cas9 target site was ampli ed using fi nologies) was used with primers designed using the complemen- nested PCR. Initially, a larger fragment was ampli ed using tary QuikChange Primer Design Program (Agilent Technologies, external-F: GAATGGTGCGTCTTGTTTGC; external-R: AAGACG- fi 2017). All plasmids were DNA sequenced by Manchester Uni- GCCCGAAATCAGG. DNA was puri ed and PCR repeated using fi versity DNA Sequencing Facility to confirm the presence of the primers inside the previously ampli ed piece; internal-F: mutation. GGCGGCAGGCAACGGCTGAG and internal-R: CCTCACACT- CGCGGCTCAGC. Cell lysis and Western blotting Briefly, cells were twice washed in ice-cold PBS and lysed in Quantitative reverse transcription PCR RIPA buffer (Sigma-Aldrich) supplemented with protease inhib- RNA was extracted using RNeasy Mini Kit (Qiagen) as per the fi itor cocktail (Roche) for 15 minutes on ice. Lysates were cold spun manufacturer's protocol. RNA was quanti ed using a Nanodrop fi for 15 minutes at 16,000 Â g and cleared supernatant was 2000 (Thermo Fisher Scienti c) and 50 ng used per reaction using transferred to new tubes. Protein concentration was determined Quantitect RT-PCR SYBR Green Kit (Qiagen). Primer sequences using the DC Protein Assay (Bio-Rad) and equal amounts of used: TFF1-F GTGTCACGCCCTCCCAGT; TFF1-R GGACCCCAC- protein run on 12% tris-glycine gels. Protein was transferred to GAACGGTG; RPLO-F GGCGACCTGGAAGTCCAA; and RPLO-R 0.45 mmol/L nitrocellulose membrane (GE Healthcare) and CCATCAGCACCACAGCCTT. membrane was blocked for 1 hour with 5% nonfat dry milk prior to incubation with primary antibodies overnight: AXIN1- Migration assay C76H11 (Cell Signaling Technology), CBFb- ab33516 (Abcam), Briefly, 5 Â 104 cells in serum-free media were placed in a ERa- sc-8002 (Santa Cruz Biotechnology), FLAG- F1804 (Sigma- Boyden chamber insert (Corning) and allowed to migrate for 24 Aldrich), H3- 9715 (Cell Signaling Technology), RUNX1- sc-8563 hours at 37 C. Nonmigrating cells were removed from the top of (Santa Cruz Biotechnology), TFF1- ab92377 (Abcam), and Vin- the filter by scrubbing with a cotton swab.