Correspondence 1907 spermatogenesis continues from puberty up to old age, there is more Alaez, Miriam Va´zquez and Gabriela de la Rosa for their very opportunity for preconceptional mutant gene accumulation in men helpful discussions. We also thank Mtra Sylvia Garcı´a of the John than in women. Benzo[a]pyrene is a potent carcinogen in cigarette Langdon Down Institute and to Dra Susana Ramı´rez Robles, Lic Ma smoke, its reactive metabolite induces DNA adducts, which can de los Angeles Rojas Ramı´rez and Dr Pedro Gonza´lez Vivanco of cause mutations. These DNA adducts were found in spermatozoa of the Integral Care for Persons with Down’s Syndrome (CTDUCA) for a smoker and his embryo.6 The 8-hydroxy-20- deoxyguanosine (8- providing the DS children included in this study. OhdG), a biomarker for oxidative DNA damage associated with 1,2 1 decreases in indices of sperm quality such as sperm number and JM Mejı´a-Arangure´ The Medical Research Unit on Clinical A Fajardo-Gutie´rrez1 Epidemiology, Hosp. de Pediatrı´a, sperm motility, was also found to be increased in these cases, 1,2 damaging the offspring. The early age peak in ALL (2–5 years) and H Flores-Aguilar Centro Me´dico Nacional Siglo XXI, IMSS, MC Martı´nez-Garcı´a1 Mexico; below 1 year in AML, support the hypothesis of environmental 3 2The Deptartment of Immunogenetics, exposure during gestation and preconception as being involved in F Salamanca-Go´mez V Palma-Padilla3 Instituto de Diagno´stico y Referencia its development. It is unknown as to which events might precipitate 4 Epidemiolo´gicos, SS, Mexico; R Paredes-Aguilera 3 the chromosome breaks whose improper repair initiates or promotes R Berna´ldez-Rı´os5 The Unit of Medical Research on Genetics, childhood AL. For paternal alcohol consumption, the mechanisms A Ortiz-Ferna´ndez6 Hosp. de Pediatrı´a, Centro Me´dico Nacional related with AL development, in their offspring, are similar to those 7 Siglo XXI, IMSS, Mexico; A Martı´nez-Avalos 4 described for smoking.7 2 The Department of Haematology, C Gorodezky Inst. Nacional de Pediatrı´a, SS, Mexico; Passive child exposure to tobacco smoke had a higher risk than the 5 one reported elsewhere. As shown by others,8 when several subjects The Department of Haematology, Hospital de Pediatrı´a, Centro Me´dico Nacional Siglo XXI, smoked in front of the child, the risk was evident; large amounts of IMSS, Mexico; carcinogenic, volatile nitrosamines and aromatic amines are present 6The Department of Haematology, Hospital in the inhaled smoke stream, although the concentration of these General, Centro Me´dico Nacional La Raza, compounds is about two orders of magnitude lower than IMSS, Mexico; in active cigarette smokers, suggesting that some risk genotypes 7The Department of Oncology, Hospital Infantil are particularly susceptible to low doses of carcinogens. It has de Me´xico Federico Go´mez, SS, Mexico been claimed that smoke exposure is prevalent among Hispanics and Afro-Americans. In these groups, the population of children is larger than in Caucasians and they are more vulnerable to the toxic effects of environmental tobacco smoke.8 Other possible mechanisms may References include stimulation of angiogenesis and tumor growth promotion by nicotine. Angiogenesis has indeed been associated with AL. 1 Robison LL. Down Syndrome and leukemia. Leukemia 1992; 6: In conclusion, childhood leukemia is a heterogeneous disease with 5–7. individual subtypes in which the response to chemotherapy and its 2 Peto J. Cancer Epidemiology in the last century and the next decade. causes may be different. It is possible that acute leukemia share Nature 2001; 411: 390–395. 3 Siegel M. Smoking and leukaemia: evaluation of causal hypothesis. Am etiologies, as shown for lymphoma or thyroid cancer in children. The J Epidemiol 1993; 138: 1–9. results of this study are encouraging, but the sample size should be 4 Greaves M. Childhood leukaemia. Br Med J 2002; 324: 283–287. increased and other studies in different populations should be 5 Sorahan T, McKinney PA, Mann JR, Lancashire RJ, Stiller CA, Birch JM performed to confirm these data. Research of the risk factors leading et al. Childhood cancer and parental use of tobacco: findings from the to leukemia is relevant to identify strategies to develop protective inter-regional epidemiological study of childhood cancer (IRESCC). Br J policies and interventions. Cancer 2001; 84: 141–146. 6 Zenzes MT, Puy LA, Bielecki R, Reed TE. Detection of benzo[a]pyrene diol eposide-DNA adducts in embryos from smoking couples: evidence for transmission by spermatozoa. Mol Hum Reprod 1999; Acknowledgements 5: 125–131. 7 Infante-Rivard C, Krajinovic M, Labuda D, Sinnett D. Childhood acute This study was supported by Grant G30670-M of the Consejo lymphoblastic leukemia associated with parental alcohol consumption Nacional de Ciencia y Tecnologı´a (CONACyT) and FP-00038/218/ and polymorphisms of carcinogen-metabolizing genes. Epidemiology 415/458/459 of the Instituto Mexicano del Seguro Social. We are 2002; 13: 277–281. 8 Perera FP, Illman SM, Kinney PL, Whyatt RM, Kelvin EA, Shepard P also indebted to the Instituto de Diagno´stico y Referencia et al. The challenge of preventing environmentally related disease in Epidemiolo´gicos who partly supported the study. We are very young children: community-based research in New York City. Environ grateful to Dod Stewart for revising the manuscript; to Carmen Health Perspect 2002; 110: 197–204.

Molecular identification of CBFb-MYH11 fusion transcripts in an AML M4Eo patient in the absence of inv16 or other abnormality by cytogenetic and FISH analyses – a rare occurrence

Leukemia (2003) 17, 1907–1910. doi:10.1038/sj.leu.2403056 16 abnormalities, which are closely associated with the FAB subtype M4Eo, result in the creation of a fusion gene between the smooth muscle myosin-heavy chain gene (MYH11) at 16p13 and The prognostic and therapeutic significance of karyotype at the core binding factor b (CBFb) gene at 16q22. The fusion protein diagnosis in patients with AML is now fully established. Two of product, CBFb-MYH11, interacts with nuclear corepressors, leading the most common recurring cytogenetic abnormalities in AML are to dysregulation of transcription. Patients with ‘CBF leukemias’ t(8;21)(q22;q22) and the pericentric inversion of chromosome 16, including those with inv(16)/t(16;16) account for up to 20% of inv(16)(p13;q22), or its variant t(16;16)(p13;q22). The chromosome young adult cases of de novo AML. Such patients have a more

Leukemia Correspondence 1908 favorable prognosis, particularly when treated with intensive postremission therapy including high-dose cytarabine. Therefore, accurate identification of these patients at diagnosis is of therapeutic significance. a Several recent reports have examined the utility of cytogenetics, FISH, and molecular analyses to detect CBFb–MYH11 fusion transcripts in patients with AML.1–7 In initial reports, patients expressing the CBFb–MYH11 chimeric gene in the absence of b chromosome 16 aberrations were reported to account for up to 43% of all molecularly positive patients.2–4 Other studies have reported a much lower incidence of such discordance between cytogenetic c and molecular analyses.1,5–7 These discrepancies may be a consequence of the difficulty in detecting the inv(16) cytogeneti- cally.8 In all these reports, the expression of CBFb–MYH11 fusion transcripts in the presence of a normal karyotype without chromo- some 16 abnormalities and other cytogenetic aberrations was rare. In the studies providing information on the number of patients with a normal karyotype, the incidence of molecularly positive disease was 1.5% (one of 65),2 1.1% (one of 87),7 and 0.8% (one of 124)1. In the latter study, the single patient initially reported as having a normal karyotype was found to have inv(16) on re-examination.1 In the study of 412 patients by Rowe et al.,5 no instances of a positive PCR result without a cytogenetically detectable chromosome 16 aberration were reported. Ritter et al 4 reported three such patients with normal cytogenetics and the presence of the fusion gene by molecular analysis. Our patient, a 23-year-old African-American male, presented in December of 2001 with a 1-month history of fatigue, progressive shortness of breath and abdominal pain. At the time of diagnosis, he had an elevated white blood cell (WBC) count of 265  109/l with 30% leukemic blasts, hemoglobin of 8.3 g/dl, and a platelet  9 count of 109 10 /l. Other significant abnormal laboratory findings Figure 1 Normal chromosomes 16 as demonstrated by cytoge- included a serum LDH of 1641 m/l and a pO2 of 62 mmHg. On netic and fluorescence in situ hybridization analyses. (a) Ideogram of examination he was dyspneic and tachypneic but afebrile, with chromosome 16 and two pairs of chromosomes 16 from the initial stable hemodynamic indices. He also had clinically evident diagnostic specimen. (b) Ideogram and three pairs of chromosomes 16 bilateral pleural effusions and generalized abdominal discomfort from the most recent study at relapse. The two pairs on the right are with no rebound tenderness or rigidity. Bone marrow examination from cells that also contained the deleted chromosome 7. (c) showed extensive replacement with leukemic cells, which were Hybridization of the Vysis CBFb probe to a metaphase and an positive for surface markers CD13, CD33, HLA-DR, CD14, CD15, interphase cell from the most recent study. This probe, break apart in CD11C, CD11b, and MPO, supporting the diagnosis of AML M4. design, is the one most commonly used for clinical detection of the inverted chromosome 16. Normal cells, such as the ones shown here, A relative increase in eosinophilic precursors was also noted. demonstrate 2 fused signals that are yellow in color or a red and green Cytogenetic analysis of the bone marrow including FISH analysis signal next to each other; an abnormal cell will have one yellow, one of CBFb showed a normal male karyotype and the absence of red, and one green signal, indicating separation of the two parts of the chromosome 16 abnormalities (Figure 1a). Molecular analysis CBFb gene by the inversion. was positive for the CBFb–MYH11 fusion transcripts by RT-PCR. These initial diagnostic studies were performed by the Cancer and Leukemia Group B (CALGB), as well as by Genzyme Genetics of the metaphases did have a deletion of the long arm of laboratories. He was initiated on leukapheresis, supportive care and chromosome 7 [del(7)(q31q36)] as the sole abnormality. After a chemotherapy with cytosine arabinoside (ara-C), daunorubicin, second CR with salvage chemotherapy, the karyotype was again and etoposide in addition to the multidrug-resistance (MDR) normal. modulating drug PSC833 on a cooperative group clinical trial. He Cytogenetic analysis at second relapse performed at UIC still did responded satisfactorily and achieved a complete remission (CR) not reveal inversion 16, but detected the del(7) in 45% of the cells with the first induction course. The remission was consolidated by (Figure 1b). FISH analysis of interphase and metaphase cells using three cycles of high-dose ara-C and he remained in CR until 10 the Vysis dual color, break apart probe for CBFb failed to detect any months later when his leukemia relapsed. Repeat analyses for rearrangement, either in interphase cells or in metaphase cells CBFb–MYH11 fusion were performed by cytogenetic, FISH, and RT- evidencing the del(7) (Figure 1c). PCR methods at our institution (Figures 1b, c and 2, respectively). A Molecular analysis of patient RNA at relapse by one-step RT-PCR second CR was achieved using salvage chemotherapy, and he (Qiagen, Inc., Valencia, CA, USA) followed by nested PCR subsequently underwent an unrelated donor transplant. At the time amplification showed a 268 bp product (Figure 2), which comi- of this report, he had fully engrafted without any significant grated with the product from the positive control cell line, ME-1f2. complications at day 80. The first-round primers were sense: 50GCAGGGAGAACAG The initial cytogenetic analyses at Genzyme Genetics and CGACAAACA30, antisense: 50TCTGGAGGCACGGGCATC30. CALGB laboratories showed a normal male karyotype with- Nested primers were sense: 50ATGGGCTGTCTGGAGTTTGAT30, out evidence of inversion or translocation 16 (Figure 1a); antisense: 50GCGCCTGCATGTTGACTT30. ME-1f2, which is a studies at 1 and 6 months (in CR) after initial presentation subline of ME-1, expresses CBFb–MYH11 fusion transcripts (perso- were also normal. Cytogenetic analysis at first relapse, performed nal communications with Dr Sakai, Japan). In addition, the nested by Genzyme Genetics, 10 months after initial presentation, PCR product was sub-cloned into the pCRII TOPO vector and still failed to detect inv(16) or t(16:16), but at this point 20% sequenced to further confirm product identity and to determine the

Leukemia Correspondence 1909 M 1 2 345 M the resolution of standard cytogenetic or FISH analysis with the probes commonly used for clinical detection of this rearrangement. Moreover, conventional cytogenetic analysis cannot detect cryptic deletions of sequences centromeric to the p-arm breakpoint described in a subset of patients.10 Investigation of this possibility would require the use of specially designed FISH probes or special FISH techniques not normally used in routine practice.10 Our report further emphasizes the importance of routine molecular analysis in addition to cytogenetic and FISH studies to detect CBFb–MYH11 fusion transcripts in cases of AML suspected to harbor CBF rearrangements. Furthermore, molecular analysis can provide rapid results to aid in the decision-making process 268 bp and identify breakpoints that may have potential prognostic significance. Molecular analysis can also be used in monitoring remission in these patients.11 Although several investigators have argued that molecular testing may not be justified in patients with a successful cytogenetic study and a normal karyotype (particularly if this is confirmed by FISH),1 our case illustrates the existence of rare patients with a cryptic molecular abnormality. Other cytogenetic Figure 2 RT-PCR analysis of CBFb–MYH11 fusion transcripts abnormalities such as +22 have been commonly associated with in AML. RNA was analyzed by reverse transcription and nested PCR inv(16)/t(16;16) and a search for cryptic transcripts in patients amplification. Lanes M – 1 kb + ladder, lane 1 – patient sample 1 mg, harboring them is also important.1,8 lane 2 – ME-1f2 100 pg, lane 3 – ME-1f2 20 pg, lane 4 – HL-60 1 mg, Patients with abnormalities involving CBF have the highest CR lane 5 – water control. rates, the longest CR duration, and overall survival times. Our patient was treated with an anthracycline-containing regimen and received three cycles of consolidation with high-dose cytarabine, but had a remission of short duration confirming that other, as yet breakpoints in the CBFb and MYH11 genes. Sequence analysis unknown, molecular events are of prognostic significance in CBF showed that the breakpoint was at nucleotide position 495 in CBFb leukemias. At relapse, a deletion of the long arm of chromosome (Genbank sequence AF294326, gi: 9885832) and at nucleotide 7 appeared. The significance of such secondary cytogenetic changes position 1921 in MYH11 (Genbank sequence D10667, gi: 532875). and their role in causing relapse and disease progression remain Thus, our patient’s leukemic cells expressed the typical Type A undetermined. However, these secondary molecular abnormalities fusion transcript. ME-1f2 cells appeared to show two additional faint may contribute to disease progression, as hypothesized in the bands upon higher exposure of the gel. These bands probably multihit theory of leukemogenesis. represent alternatively spliced products. Such alternatively spliced products have been previously reported from clinical samples.9 The focus of this report was to determine whether the patient expressed Acknowledgements inversion 16 fusion transcripts and hence we concentrated on the 268 bp product, which was the predominant product from both the The expert technical assistance of Andrew Miner is gratefully patient and ME-1f2 cells. Furthermore, we confirmed the identity of acknowledged. We also thank Drs K Richkind and P Rushton of the fusion transcript by sequence analysis. ME-1f2 cells were solely Genzyme Genetics for their kind contribution of Figure 1a. used to serve as a positive control for the Type A fusion transcript in F Ravandi and SS Kadkol contributed equally to this work. our assay and it is quite possible that they express fusion transcripts 1 1 other than Type A. F Ravandi Departments of Medicine, University of Illinois SS Kadkol2 at Chicago, Chicago, IL, USA; Acute myeloid leukemias that express fusion transcripts J Ridgeway1 2Departments of Pathology, University of Illinois containing CBF sequences are associated with a more favorable A Bruno2 at Chicago, Chicago, IL, USA prognosis, particularly if treated with intensive postremission C Dodge2 therapy including high-dose cytarabine. Therefore, accurate identi- V Lindgren2 fication of these patients at diagnosis will allow the benefit of such therapy, while sparing them the more aggressive and potentially more toxic therapeutic interventions such as allogeneic transplantation. Inversion 16 and its variant translocation are References subtle changes that can be relatively difficult to identify by standard cytogenetics.1,8 Although the breakpoints in the CBFb and MYH11 1 Mrozek K, Prior TW, Edwards C, Marcucci G, Carroll AJ, Snyder PJ et al. genes are variable and more than 10 different transcripts Comparison of cytogenetic and molecular genetic detection of t(8;21) have been reported, the majority of patients (85%) have the and inv(16) in a prospective series of adults with de novo acute myeloid type A transcript. Several studies have examined the frequency leukemia: a Cancer and Leukemia Group B Study. J Clin Oncol 2001; of patients with the CBFb–MYH11 transcripts, who do not have 19: 2482–2492. detectable chromosome 16 aberrations. Although initial 2 Krauter J, Peter W, Pascheberg U, Heinze B, Bergmann L, Hoelzer D reports suggested a high incidence of such patients, recent reports et al. Detection of karyotypic aberrations in acute myeloblastic leukaemia: a prospective comparison between PCR/FISH and standard have suggested a far lower frequency of such discordance. In cytogenetics in 140 patients with de novo AML. Br J Haematol 1998; particular, the presence of the fusion transcript in patients with a 103: 72–78. completely normal karyotype by cytogenetic and/or FISH analysis is 3 Langabeer SE, Walker H, Gale RE, Wheatley K, Burnett AK, Goldstone exceedingly rare, with only 7 reported patients including the one AH et al. Frequency of CBF beta/MYH11 fusion transcripts in patients reported here. entered into the U.K. MRC AML trials. The MRC Adult Leukaemia Working Party. Br J Haematol 1997; 96: 736–739. Three independent laboratories failed to detect a chromosome 4 Ritter M, Thiede C, Schakel U, Schmidt M, Alpen B, Pascheberg U et al. 16 abnormality in our patient. Therefore, we believe that the Underestimation of inversion (16) in acute myeloid leukaemia using amount of genetic material involved is small in size and below standard cytogenetics as compared with polymerase chain reaction:

Leukemia Correspondence 1910 results of a prospective investigation. Br J Haematol 1997; 98: 8 Grimwade D. Screening for core binding factor gene rearrangements in 969–972. acute myeloid leukemia. Leukemia 2002; 16: 964–969. 5 Rowe D, Cotterill SJ, Ross FM, Bunyan DJ, Vickers SJ, Bryon J et al. 9 van der Reijden BA, Lombardo M, Dauwerse HG, Giles RH, Cytogenetically cryptic AML1-ETO and CBF beta-MYH11 gene Muhlematter D, Bellomo MJ et al. RT-PCR diagnosis of patients with rearrangements: incidence in 412 cases of acute myeloid leukaemia. acute nonlymphocytic leukemia and inv(16)(p13q22) and identifi- Br J Haematol 2000; 111: 1051–1056. cation of new alternative splicing in CBFB-MYH11 transcripts. Blood 6 Poirel H, Radford-Weiss I, Rack K, Troussard X, Veil A, Valensi F 1995; 86: 277–282. et al. Detection of the chromosome 16 CBF beta-MYH11 10 Mancini M, Cedrone M, Diverio D, Emanuel B, Stul M, Vranckx H et al. fusion transcript in myelomonocytic leukemias. Blood 1995; 85: Use of dual-color interphase FISH for the detection of inv(16) in acute 1313–1322. myeloid leukemia at diagnosis, relapse and during follow-up: a study of 7 Mitterbauer M, Laczika K, Novak M, Mitterbauer G, Hilgarth B, 23 patients. Leukemia 2000; 14: 364–368. Pirc-Danoewinata H et al. High concordance of karyotype analysis 11 Guerrasio A, Pilatrino C, De Micheli D, Cilloni D, Serra A, Gottardi E and RT-PCR for CBF beta/MYH11 in unselected patients with acute et al. Assessment of minimal residual disease (MRD) in CBFbeta/MYH11- myeloid leukemia. A single center study. Am J Clin Pathol 2000; 113: positive acute myeloid leukemias by qualitative and quantitative RT-PCR 406–410. amplification of fusion transcripts. Leukemia.2002;16: 1176–1181.

Generation of immunostimulatory dendritic cells from the malignant clone in patients with juvenile myelomonocytic leukemia

Leukemia (2003) 17, 1910–1912. doi:10.1038/sj.leu.2403059 activated, mature state.7 Therefore, we next attempted to activate the in vitro cultured immature DC with lipopolysaccharide (LPS). TO THE EDITOR Immature DC populations generated from normal, JMML-1, and JMML-2 PBMC upregulated HLA-DR, CD83 and CD86 expression A unique property of myeloid lineage leukemia cells is their following 24-h exposure to LPS, acquiring a mature dendritic potential to be differentiated into dendritic cells (DC), both in vitro phenotype (Figure 1). These mature DC therefore expressed the and in vivo. These leukemic DC have potential therapeutic necessary cell surface molecules required for efficient antigen applications, such as stimulation of autologous anti leukemia T-cell responses in leukemia patients, or allogeneic responses in presentation and costimulation. However, the DC cultured from the post bone marrow transplantation (BMT) setting. Several studies JMML-3 PBMC failed to upregulate HLA-DR and CD83 following have demonstrated that leukemic cells from a proportion of patients addition of LPS (data not shown). with acute myeloid leukemia (AML)1 or chronic myeloid leukemia The leukemic cells in two of the patients (JMML-2 and -3) (CML)2 can be differentiated into functionally active DC capable of exhibited monosomy 7, a commonly observed chromosomal inducing antileukemia T-cell responses.3,4 abnormality of this disease. We were able to use this as a marker of malignant origin, and interphase fluorescence in situ hybridiza- We were interested in the utilization of such an immunothera- + peutic approach for patients with juvenile myelomonocytic tion (FISH) analysis revealed that the vast majority of CD86 -purifed leukemia (JMML), a rare condition with poor prognosis. This mature DC generated from these patients displayed monosomy 7 approach is attractive because allogeneic BMT is considered (98% of JMML-2 DC and 91% of JMML-3 DC). In contrast, necessary for cure, and the graft-versus-leukemia (GVL) effect is DC cultured from PBMC from a normal donor all possessed two critically important.5,6 copies of chromosome 7. This finding confirmed that virtually all the We initially assessed whether immature DC could be generated in DC cultured in vitro from these JMML patients were of leukemic vitro from plastic adherent peripheral blood mononuclear cells origin. (PBMC) from three JMML patients (JMML-1, -2, -3). After 6 days of Several experiments were performed to investigate the functional culture with granulocyte–macrophage colony-stimulating factor activity of these leukemic DC. Limited sample sizes prevented us (GM-CSF) and interleukin-4 (IL-4) in the presence of 10% fetal calf from examining the functional activity of DC cultured from all three serum, cells from normal donors and all three JMML patients JMML patients in each assay. To examine further the ability of demonstrated a typical immature monocyte-derived DC (MoDC) in vitro cultured DC to provide the costimulatory signal required to surface phenotype. This was inferred from their high expression activate naı¨ve T cells, we measured DC production of IL-12 by levels of the myeloid marker CD11c, intermediate levels of the ELISA (Becton Dickinson, San Diego, CA, USA). Secretion of IL-12 MHC class II molecule HLA-DR and the costimulatory molecule by mature DC is required for T-cell activation, and is associated with CD86 (B7-2), and undetectable levels of the dendritic activation a Th-1 response. Consistent with published data, immature DC marker CD83 and the monocytic marker CD14 (Figure 1). Typically, generated in vitro from normal donor and JMML-2 PBMC did not 10 ml of peripheral blood from JMML patients yielded about 5 Â 107 secrete IL-12 (o7.5 pg/150 000 cells). However, LPS-matured adherent cells and the final yield of viable MoDC was between 25 MoDC from a normal donor and LPS-matured DC from JMML-2 and 50% of this starting population. The cells generated from produced large amounts of IL-12 (210 pg/150 000 cells and 320 pg/ normal donors and JMML patients formed nonadherent clusters and 150 000 cells, respectively). These results provide additional possessed short cytoplasmic projections, characteristic of immature evidence for the stimulatory phenotype of mature DC generated DC morphology.7 from JMML-2 PBMC. In contrast, incubation of immature DC Immature DC are specialized at capturing and processing cultured from JMML-3 PBMC with LPS for 24 h resulted in the antigens; however, optimal presentation of potential leukemia- secretion of minimal amounts of IL-12 (15 pg/150 000 cells), specific antigens to T lymphocytes requires that the DC are in an significantly less than that observed in normal mature MoDC (Po0.05, Student’s t-test). This abnormal secretion of IL-12 by JMML-3 DC following incubation with LPS is consistent with the Correspondence: Dr J Anderson, Molecular Haematology and Cancer flow cytometric data, demonstrating that the DC cultured from this Biology Unit, Institute of Child Health, 30 Guilford Street, London patient were resistant to activation with LPS. The variability in the WC1N 1EH, UK; Fax: +44 20 8813 8100 phenotypes of the DC generated from the three JMML patients might Received 10 April 2003; accepted 13 May 2003 reflect the heterogeneity of this disorder.

Leukemia