DOCSLIB.ORG

Respiratory Behaviour of a Zymomonas Mobilis Adhb::Kan Mutant Supports the Hypothesis of Two Alcohol Dehydrogenase Isoenzymes Ca

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Respiratory Behaviour of a Zymomonas Mobilis Adhb::Kan Mutant Supports the Hypothesis of Two Alcohol Dehydrogenase Isoenzymes Ca View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 580 (2006) 5084–5088 Respiratory behaviour of a Zymomonas mobilis adhB::kanr mutant supports the hypothesis of two alcohol dehydrogenase isoenzymes catalysing opposite reactions U. Kalnenieksa,*, N. Galininaa, M.M. Tomaa, J.L. Pickfordb, R. Rutkisa, R.K. Pooleb a Institute of Microbiology and Biotechnology, University of Latvia, Kronvalda Boulv. 4, LV-1586, Riga, Latvia b Department of Molecular Biology and Biotechnology, The University of Sheffield, Firth Court, Western Bank, Sheffield S10 2TN, UK Received 10 July 2006; revised 9 August 2006; accepted 11 August 2006 Available online 28 August 2006 Edited by Barry Halliwell However, under aerobic growth conditions, ethanol synthe- Abstract Perturbation of the aerobic steady-state in a chemo- stat culture of the ethanol-producing bacterium Zymomonas sis competes for reducing equivalents with respiration. Re- mobilis with a small pulse of ethanol causes a burst of ethanol cently, we found that competition between the two ADH oxidation, although the reactant ratio of the alcohol dehydroge- isoenzymes and the respiratory chain may lead to aerobic stea- nase (ADH) reaction ([NADH][acetaldehyde][H+])/([etha- dy-states with unexpected properties. Perturbation of the aer- + nol][NAD ]) remains above the Keq value. Simultaneous obic steady-state in a chemostat culture with a small pulse of catalysis of ethanol synthesis and oxidation by the two ADH iso- ethanol caused a rapid, transient burst of ethanol oxidation, enzymes, residing in different redox microenvironments, has been seen as a rise of acetaldehyde concentration and intracellular proposed previously. In the present study, this hypothesis is ver- NADH [7], and a fall of pO2 in the culture. Notably, a slow ified by construction of an ADH-deficient strain and by demon- net synthesis of ethanol was taking place during the aerobic stration that it lacks the oxidative burst in response to steady-state, in full accordance with the measured bulk reac- perturbation of its aerobic steady-state with ethanol. Ó 2006 Federation of European Biochemical Societies. Pub- tant ratio, which was well above Keq even after addition of lished by Elsevier B.V. All rights reserved. the ethanol pulse. In order to explain our finding, we proposed operation of an ‘‘ethanol cycle’’ – a novel redox-driven futile Keywords: Alcohol dehydrogenase; Continuous culture; cycle, involving both ADH isoenzymes, simultaneously cata- Respiration; Metabolic channelling; Zymomonas mobilis lysing opposite reactions (Fig. 1A). Both reactions were sup- posed to proceed several times faster than the resulting slow net synthesis of ethanol, thus explaining the rapid burst of oxi- dation upon ethanol addition by perturbation of the cycle [7]. It must be noted that a simultaneous catalysis of opposite reac- 1. Introduction tions by two isoenzymes in a homogeneous medium as pic- tured in Fig. 1A would not be thermodynamically feasible Reversible reduction of acetaldehyde to ethanol, which ter- without an external energy supply to one of the reactions. As minates the fermentative pathways of various ethanol-produc- the possibility of energization of the ADH reaction by ATP ing microorganisms, is catalysed by NAD(P)H-dependent or by other metabolically available energy source seems highly unlikely, we proposed that the reaction medium should be het- alcohol dehydrogenases (ADH) [1]. Keq for the ethanol oxida- tion reaction ([NADH][acetaldehyde][H+])/([ethanol][NAD+]) erogeneous. In other words, for the operation of ethanol cycle, is as low as 6.92 · 10À12 M, hence the reaction equilibrium is a different redox microenvironment for each reaction must be shifted far towards ethanol synthesis [2]. For the Gram-nega- expected, which in the single compartment of the bacterial cell tive, aerotolerant ethanol producer Zymomonas mobilis, the would imply some kind of enzyme–enzyme interaction and reaction is catalysed by two ADH isoenzymes: the zinc-con- substrate channelling [8,9]. taining ADH I, encoded by adhA, and the iron-containing Although the ethanol cycle hypothesis largely helps to ADH II, encoded by adhB [3–6]. Both of them are NAD+- understand the response of aerobic steady-state culture to per- dependent, and under anaerobic conditions they carry out turbations, it still lacks direct experimental verification. First the rapid and efficient synthesis of ethanol seen in this bacte- of all, it would be necessary to demonstrate that the burst of rium. ethanol oxidation, following the ethanol pulse, does not take place with only one of the ADH isoenzymes present. In partic- ular, the hypothesis proposes that ADH II is the enzyme pri- marily responsible for ethanol oxidation. Studies of this type *Corresponding author. Fax: +371 703 4885. have been hampered by the limited availability of Z. mobilis E-mail address: [email protected] (U. Kalnenieks). knockout mutants of respiratory and fermentative catabolism, obtained by molecular cloning methods. Here, we describe Abbreviations: ADH, alcohol dehydrogenase; E-D, Entner-Doudoroff construction of an ADH II-deficient Z. mobilis strain, with a glycolytic pathway; YETOH, ethanol yield (grams of synthesised etha- kanamycin-resistance gene inserted in the coding region of nol per gram of consumed glucose); Qglucose, specific rate of glucose consumption (millimoles of consumed glucose per gram of dry weight adhB. We show that the response of the recombinant strain per hour) to ethanol pulse indeed dramatically differs from that of the 0014-5793/$32.00 Ó 2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2006.08.034 U. Kalnenieks et al. / FEBS Letters 580 (2006) 5084–5088 5085 was used. The Z. mobilis adhB gene (GenBank accession number A Electron transport chain NADH M15398) was amplified by PCR, using primers Zm1 (CGGAATTCAAAATCGGTAACCACATCTCAATTA) and Zm2 (CGCTGCAGTGGCAAATTATTTATGACGGTAGGC) supplied ADH II by Sigma Genosys; the engineered restriction sites for EcoRI and PstI, respectively, are underlined. PCR reactions were carried out in a Ther- moHybaid gradient thermocycler, using Accuzyme DNA polymerase +NAD+ (Bioline). Purification of the obtained PCR products was done with the QIAquick PCR purification kit, while for the recovery of plasmids Ethanol E-D Acetaldehyde and PCR products from agarose gels the QIAquick gel extraction kit +NADH was used (Qiagen). T4 DNA ligase (Fermentas) was used for ligation. ADH I Restriction, ligation and cloning assays essentially followed standard procedures [12]. All constructs were confirmed by DNA sequencing done by Lark Technologies Inc. 2.3. Continuous cultivation B Electron transport chain NADH Continuous cultivation was carried out in a Labfors fermenter (Inf- ors), of 1 L working volume, at 30 °C, pH 5.5 and 0.25 hÀ1 dilution rate. The growth medium contained 20 g LÀ1 glucose, 5 g LÀ1 yeast ex- ADH II tract and mineral salts, as described previously [10]. Growth was initi- ated under anaerobic conditions, gassing the culture with nitrogen at 0.4 L minÀ1 flow rate. After anaerobic steady-state was reached, aera- tion of the culture was started, and gradually increased, until aerobic +NAD+ steady-state was established, with air flow 2 L minÀ1 and stirring rate ADH II Ethanol E-D Acetaldehyde 550 r.p.m. The pO2 level was not feedback-regulated by either stirring +NADH speed or air flow; however it was maintained remarkably stable by the ADH I steady-state culture itself (see Section 3). 2.4. Analytical methods Alcohol dehydrogenase activity was estimated in the direction of Fig. 1. The ethanol cycle. (A) ADH I catalysing ethanol synthesis, and ethanol oxidation, as described by Neale et al. [4]. The total ADH ADH II catalysing ethanol oxidation; (B) ADH I and part of ADH II activity and the activity of ADH I were measured spectrophotometri- catalysing ethanol synthesis, with part of ADH II catalysing ethanol cally at 340 nm after transfer of an aliquot (10–20 ll) of the cell suspen- oxidation. sion into a cuvette with 1.5 ml of 30 mM Tris/HCl buffer, pH 8.5, containing 1 mM NAD+. Alcohol dehydrogenase isoenzymes were dif- ferentiated according to Kinoshita et al. [3]. For measurement of the parent strain under similar culture conditions, and that in gen- total activity of both isoenzymes, 1 M ethanol was added to the buffer. eral, ADH II-deficiency causes marked alterations of the respi- Discrimination between the two isoenzyme activities was based on the ratory catabolism of Z. mobilis. fact that only ADH I, but not ADH II, could oxidise butanol. For measurement of the ADH I butanol-oxidising activity, which was ta- ken to be half of the ADH I ethanol-oxidising activity, 200 mM buta- nol was added in place of ethanol. ADH II activity was found by 2. Materials and methods subtraction of the estimated ADH I ethanol-oxidising activity from the total ethanol-oxidising activity. 2.1. Bacterial strains, plasmids and transformation Intracellular NADH was determined luminometrically, as described Escherichia coli JM109 and plasmid pGEM-3Zf(+) were purchased previously [11]. Ethanol concentration was determined by gas chroma- from Promega, and the strain JM109 was used as the host strain for tography (Varian). Acetaldehyde was assayed using the alcohol dehy- cloning of recombinant plasmids. Z. mobilis ATCC 29191 (ZM6) drogenase reaction, and glucose was assayed with the glucose oxidase was grown and maintained as described previously [10,11]. Plasmids, method, as described previously [15]. Cell concentration was deter- constructed and used in the present study, are shown in Table 1. mined as optical density at 550 nm, and dry cell mass of the suspen- sions was calculated by reference to a calibration curve. All results E. coli was transformed by the CaCl2 procedure as described by Sam- brook et al. [12]. Z. mobilis was transformed by electroporation [13]. are means of at least three replicates. Standard errors are given in brackets in Table 2.
Load more

Recommended publications
  • Xylose Fermentation to Ethanol by Schizosaccharomyces Pombe Clones with Xylose Isomerase Gene." Biotechnology Letters (8:4); Pp
    NREL!TP-421-4944 • UC Category: 246 • DE93000067 l I Xylose Fermenta to Ethanol: A R ew '.) i I, -- , ) )I' J. D. McMillan I ' J.( .!i �/ .6' ....� .T u�.•ls:l ., �-- • National Renewable Energy Laboratory II 'J 1617 Cole Boulevard Golden, Colorado 80401-3393 A Division of Midwest Research Institute Operated for the U.S. Department of Energy under Contract No. DE-AC02-83CH10093 Prepared under task no. BF223732 January 1993 NOTICE This report was prepared as an account of work sponsored by an agency of the United States government. Neither the United States government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, com­ pleteness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise does not necessarily con­ stitute or imply its endorsement, recommendation, or favoring by the United States government or any agency thereof. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States government or any agency thereof. Printed in the United States of America Available from: National Technical Information Service U.S. Department of Commerce 5285 Port Royal Road Springfield, VA22161 Price: Microfiche A01 Printed Copy A03 Codes are used for pricing all publications. The code is determined by the number of pages in the publication. Information pertaining to the pricing codes can be found in the current issue of the following publications which are generally available in most libraries: Energy Research Abstracts (ERA); Govern­ ment Reports Announcements and Index ( GRA and I); Scientific and Technical Abstract Reports(STAR); and publication NTIS-PR-360 available from NTIS at the above address.
    [Show full text]
  • Zymomonas Mobilis in Bread Dough: Characterization of Dough Leavening Performance in Presence of Sucrose
    foods Article Zymomonas mobilis in Bread Dough: Characterization of Dough Leavening Performance in Presence of Sucrose Alida Musatti * , Carola Cappa * , Chiara Mapelli, Cristina Alamprese and Manuela Rollini Dipartimento di Scienze per gli Alimenti, la Nutrizione, l’Ambiente, Università degli Studi di Milano, Via G. Celoria, 2-20133 Milano, Italy; [email protected] (C.M.); [email protected] (C.A.); [email protected] (M.R.) * Correspondence: [email protected] (A.M.); [email protected] (C.C.); Tel.: +39-02-5031-9150 (A.M.); +39-02-5031-9179 (C.C.) Received: 21 December 2019; Accepted: 11 January 2020; Published: 15 January 2020 Abstract: Zymomonas mobilis, because of its fermentative metabolism, has potential food applications in the development of leavened baked goods consumable by people with adverse responses to Saccharomyces cerevisiae. Since Z. mobilis is not able to utilize maltose present in flour, the effect of sucrose addition (2.5 g/100 g flour) on bread dough leavening properties was studied. For comparison purposes, leavening performances of S. cerevisiae with and without sucrose were also investigated. Doughs leavened by Z. mobilis without sucrose addition showed the lowest height development (14.95 0.21 mm) and CO production (855 136 mL). When sucrose was added, fermentative ± 2 ± performances of Z. mobilis significantly (p < 0.05) improved (+80% and +85% of gas production and retention, respectively), with a dough maximum height 2.6 times higher, results indicating that Z. mobilis with sucrose can be leavened in shorter time with respect to the sample without addition. S. cerevisiae did not benefit the sucrose addition in terms of CO2 production and retention, even if lag leavening time was significantly (p < 0.05) shorter (about the half) and time of porosity appearance significantly (p < 0.05) longer (about 26%) with respect to S.
    [Show full text]
  • Engineering Zymomonas Mobilis for the Production of Biofuels and Other Value-Added Products
    © 2015 Kori Lynn Dunn ENGINEERING ZYMOMONAS MOBILIS FOR THE PRODUCTION OF BIOFUELS AND OTHER VALUE-ADDED PRODUCTS BY KORI LYNN DUNN DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Chemical Engineering in the Graduate College of the University of Illinois at Urbana-Champaign, 2015 Urbana, Illinois Doctoral Committee: Associate Professor Christopher V. Rao, Chair Associate Professor Yong-Su Jin Associate Professor Hyunjoon Kong Associate Professor Mary Kraft Abstract Zymomonas mobilis is a promising organism for lignocellulosic biofuel production as it can efficiently produce ethanol from simple sugars using unique metabolic pathways. Z. mobilis displays what is known as the “uncoupled growth” phenomenon, meaning cells will rapidly convert sugars to ethanol regardless of their energy requirements for growth. This makes Z. mobilis attractive not only for ethanol production, but for alternative product synthesis as well. One limitation of Z. mobilis for cellulosic ethanol production is that this organism cannot natively ferment the pentose sugars, like xylose and arabinose, which are present in lignocellulosic hydrolysates. While it has been engineered to do so, the fermentation rates of these sugars are still extremely low. In this work, we have investigated sugar transport as a possible bottleneck in the fermentation of xylose by Z. mobilis. We showed that transport limits xylose fermentations in this organism, but only when the starting sugar concentration is high. To discern additional bottlenecks in pentose fermentations by Z. mobilis, we then used adaptation and high-throughput sequencing to pinpoint genetic mutations responsible for improved growth phenotypes on these sugars. We found that the transport of both xylose and arabinose through the native sugar transporter, Glf, limits pentose fermentations in Z.
    [Show full text]
  • Cofermentation of Glucose, Xylose and Arabinose by Genomic DNA
    GenomicCopyright © DNA–Integrated2002 by Humana Press Zymomonas Inc. mobilis 885 All rights of any nature whatsoever reserved. 0273-2289/02/98-100/0885/$13.50 Cofermentation of Glucose, Xylose, and Arabinose by Genomic DNA–Integrated Xylose/Arabinose Fermenting Strain of Zymomonas mobilis AX101 ALI MOHAGHEGHI,* KENT EVANS, YAT-CHEN CHOU, AND MIN ZHANG Biotechnology Division for Fuels and Chemicals, National Renewable Energy Laboratory, 1617 Cole Boulevard, Golden, CO 80401, E-mail: [email protected] Abstract Cofermentation of glucose, xylose, and arabinose is critical for complete bioconversion of lignocellulosic biomass, such as agricultural residues and herbaceous energy crops, to ethanol. We have previously developed a plas- mid-bearing strain of Zymomonas mobilis (206C[pZB301]) capable of cofer- menting glucose, xylose, and arabinose to ethanol. To enhance its genetic stability, several genomic DNA–integrated strains of Z. mobilis have been developed through the insertion of all seven genes necessay for xylose and arabinose fermentation into the Zymomonas genome. From all the integrants developed, four were selected for further evaluation. The integrants were tested for stability by repeated transfer in a nonselective medium (containing only glucose). Based on the stability test, one of the integrants (AX101) was selected for further evaluation. A series of batch and continuous fermenta- tions was designed to evaluate the cofermentation of glucose, xylose, and L-arabinose with the strain AX101. The pH range of study was 4.5, 5.0, and 5.5 at 30°C. The cofermentation process yield was about 84%, which is about the same as that of plasmid-bearing strain 206C(pZB301). Although cofer- mentation of all three sugars was achieved, there was a preferential order of sugar utilization: glucose first, then xylose, and arabinose last.
    [Show full text]
  • Production of Alcohol for Fuel and Organic Solvents - M
    BIOTECHNOLOGY – Vol. VII - Production of Alcohol for Fuel and Organic Solvents - M. Bekers and A. Vigants PRODUCTION OF ALCOHOL FOR FUEL AND ORGANIC SOLVENTS M. Bekers and A. Vigants Institute of Microbiology and Biotechnology, University of Latvia, Riga, Latvia Keywords: fuel ethanol, yeasts, organic solvents, biomass, liquefaction, saccharification, fermentation Contents 1. Production of Fuel Ethanol 1.1. Introduction 1.1.1. History and Actuality 1.1.2. Environmental Effects of Fuel Ethanol 1.1.3. Economic Aspects and Government Policies Affecting Fuel Ethanol Production and Marketing 1.2. Background 1.2.1. Producers and Regulation of Metabolism of Ethanol Synthesis 1.2.2. Raw Materials—Renewable Resources 1.3. Industrial Technologies 1.3.1. Medium Preparation 1.3.2. Fermentation 1.3.3. Distillation and Waste Utilization 1.4. Laboratory and Pilot Scale Technologies 1.4.1. Ethanol Production by the Bacterium Zymomonas mobilis 1.4.2. Immobilized, Flocculating and Recycling Systems 1.4.3. Vacuum and Extractive Fermentation 1.4.4. CASH Process and the Fermentation of Cellulosic Hydrolysates 2. Production of Organic Solvents 2.1. Introduction 2.1.1. History 2.1.2. Use and Properties of Solvents 2.2. Background 2.3. Technology 2.3.1. BatchUNESCO Process – EOLSS 2.3.2. Semicontinuous Process 2.3.3. Continuous Process 2.3.4. ImprovementsSAMPLE of Technology CHAPTERS 2.3.5. Utilization of Stillage 3. Conclusion Glossary Bibliography Biographical Sketches Summary The presented article describes the production of fuel ethanol and organic solvent ©Encyclopedia of Life Support Systems (EOLSS) BIOTECHNOLOGY – Vol. VII - Production of Alcohol for Fuel and Organic Solvents - M.
    [Show full text]
  • Ecological Assessment After the Addition of Genetically Engineered
    AN ABSTRACT OF THE THESIS OF Michael T. Holmes for the degree of Doctor of Philosophy in Botany and Plant Pathology presented on June 19, 1995. Title: Ecological Assessment After the Addition of Genetically Engineered Klebsiella planticola SDF20 Into Soil. Redacted for Privacy Abstract approved: Elaine R. Ingham The objectives in this research were to assess whether Klebsiella planticola SDF20 could survive in soil and result in ecological effects to soil foodweb organisms and plant growth. Four experiments were conducted using soil microcosms. Klebsiella planticola SDF20 has been genetically engineered to produce ethanol from agricultural waste for use in alternative fuels. Theoretically, after ethanol is removed from fermentors, the remaining residue that includes SDF20 would be spread onto crop fields as organic amendments. The parent strain SDF15 and genetically engineered strain SDF20 were added to sandy and clay soils with varying organic matter content. Alterations to soil foodweb organisms and plant growth were assessed using direct methods. These alterations were considered to be ecological effects if changes in nutrient cycling processes and plant growth would result. Ethanol produced by SDF20 was detected in the headspace of microcosms that demonstrated that SDF20 can survive and express its novel function in high organic matter clay soil. Soil containing higher organic matter and higher clay content may have increased the survival of SDF20 due to less competition with indigenous microbiota for substrates and protection from bacterial predators in clay soil with smaller pore sizes, thereby allowing SDF20 to produce a detectable concentration of ethanol. Significant changes to soil foodweb organisms were not detected using this soil type.
    [Show full text]
  • Bio-Refinery – Concept for Sustainability and Human Development - Horst W
    BIOTECHNOLOGY – Vol. VII - Bio-Refinery – Concept for Sustainability and Human Development - Horst W. Doelle, Edgar J. DaSilva BIO-REFINERY - CONCEPT FOR SUSTAINABILITY AND HUMAN DEVELOPMENT Horst W. Doelle MIRCEN-Biotechnology Brisbane and Pacific Regional Network, Brisbane, Australia Edgar J. DaSilva Section of Life Sciences, Division of Basic and Engineering Sciences, UNESCO, France Keywords: Sustainability, Green Biorefinery, fructose syrup, lignocellulose, anaerobic digestion, acetogenesis, syntrophism, Aquaculture, plant biomass. Contents 1. Introduction 1.1. Developed Countries 1.2. Developing Countries 2. Bio-Refinery Concept 3. Lignocellulosic biomass 3.1. Energy production 3.1.1. Direct combustion 3.1.2. Cofiring 3.1.3. Cogeneration 3.1.4. Gasification 3.2. Mushroom production 3.3. Composting 3.4. Silage 4. Multiproduct formation from biomass crops 4.1. Enzyme production 4.2. Grain 4.3. Sugarcane 4.4. Sagopalm 4.5. Palm Oil industry 4.6. Fish processing industry 5. Product formation from biomass, human and animal wastes 5.1. BiogasUNESCO – EOLSS 5.2. Aquaculture 6. Conclusion Glossary SAMPLE CHAPTERS Bibliography Biographical Sketches Summary Our planet’s abundant life is nature’s storehouse of solar energy and chemical resources. Whether cultivated by man, or growing wild, plant matter represents a huge quantity of a renewable resource that we call biomass. This biomass is the most important ©Encyclopedia of Life Support Systems (EOLSS) BIOTECHNOLOGY – Vol. VII - Bio-Refinery – Concept for Sustainability and Human Development - Horst W. Doelle, Edgar J. DaSilva renewable resource to sustain life on this planet. Sustainability can therefore be maintained only through an improvement of the natural cycles of matter. The question arises, of course, how nature is able to cope with an increasing human population, which automatically results in a higher animal population and demands for food, feed, energy and commodity products.
    [Show full text]
  • The Quorum Sensing Auto-Inducer 2 (AI-2) Stimulates Nitrogen Fixation and Favors Ethanol Production Over Biomass Accumulation in Zymomonas Mobilis
    International Journal of Molecular Sciences Article The Quorum Sensing Auto-Inducer 2 (AI-2) Stimulates Nitrogen Fixation and Favors Ethanol Production over Biomass Accumulation in Zymomonas mobilis Valquíria Campos Alencar 1,2, Juliana de Fátima dos Santos Silva 1, Renata Ozelami Vilas Boas 2, Vinícius Manganaro Farnézio 1, Yara N. L. F. de Maria 2, David Aciole Barbosa 2 , Alex Tramontin Almeida 3, Emanuel Maltempi de Souza 3, Marcelo Müller-Santos 3, Daniela L. Jabes 2 , Fabiano B. Menegidio 2, Regina Costa de Oliveira 2, Tiago Rodrigues 1 , Ivarne Luis dos Santos Tersariol 4, Adrian R. Walmsley 5 and Luiz R. Nunes 1,* 1 Centro de Ciências Naturais e Humanas, Universidade Federal do ABC (UFABC), Alameda da Universidade, s/n, São Bernardo do Campo 09606-045, SP, Brazil; [email protected] (V.C.A.); [email protected] (J.d.F.d.S.S.); [email protected] (V.M.F.); [email protected] (T.R.) 2 Núcleo Integrado de Biotecnologia, Universidade de Mogi das Cruzes (UMC), Av. Dr. Cândido Xavier de Almeida Souza, 200, Mogi das Cruzes 08780-911, SP, Brazil; [email protected] (R.O.V.B.); [email protected] (Y.N.L.F.d.M.); [email protected] (D.A.B.); [email protected] (D.L.J.); [email protected] (F.B.M.); [email protected] (R.C.d.O.) 3 Setor de Ciências Biológicas-Departamento de Bioquímica e Biologia Molecular, Universidade Federal do Citation: Alencar, V.C.; Silva, Paraná (UFPR), Rua Cel. Francisco H. dos Santos, 100, Curitiba 81531-980, PR, Brazil; [email protected] (A.T.A.); J.d.F.d.S.; Vilas Boas, R.O.; Farnézio, [email protected] (E.M.d.S.); [email protected] (M.M.-S.) 4 V.M.; de Maria, Y.N.L.F.; Aciole Departamento de Bioquímica, Universidade Federal de São Paulo (UNIFESP), Rua Três de Maio, 100, Barbosa, D.; Almeida, A.T.; de Souza, São Paulo 04044-020, SP, Brazil; [email protected] 5 Department of Biosciences, Durham University, South Road, Durham DH1 3LE, UK; E.M.; Müller-Santos, M.; Jabes, D.L.; [email protected] et al.
    [Show full text]
  • Enhanced Bioethanol Production by Zymomonas Mobilis in Response to the Quorum Sensing Molecules AI-2
    Durham E-Theses Enhanced bioethanol production by Zymomonas mobilis in response to the quorum sensing molecules AI-2 YANG, JUNG,WOO How to cite: YANG, JUNG,WOO (2011) Enhanced bioethanol production by Zymomonas mobilis in response to the quorum sensing molecules AI-2, Durham theses, Durham University. Available at Durham E-Theses Online: http://etheses.dur.ac.uk/3231/ Use policy The full-text may be used and/or reproduced, and given to third parties in any format or medium, without prior permission or charge, for personal research or study, educational, or not-for-prot purposes provided that: • a full bibliographic reference is made to the original source • a link is made to the metadata record in Durham E-Theses • the full-text is not changed in any way The full-text must not be sold in any format or medium without the formal permission of the copyright holders. Please consult the full Durham E-Theses policy for further details. Academic Support Oce, Durham University, University Oce, Old Elvet, Durham DH1 3HP e-mail: [email protected] Tel: +44 0191 334 6107 http://etheses.dur.ac.uk 2 Enhanced bioethanol production by Zymomonas mobilis in response to the quorum sensing molecules AI-2 By Jungwoo Yang B. Sc. A thesis submitted for the degree of Doctor of Philosophy In The School of Biological and Biomedical Sciences University of Durham Oct. 2011 Abstract The depletion of non-renewable energy resources, the environmental concern over the burning of fossil fuels, and the recent price rises and instability in the international oil markets have all combined to stimulate interest in the use of fermentation processes for the production of alternative bio-fuels.
    [Show full text]
  • Engineering Lactic Acid Bacteria with Pyruvate Decarboxylase and Alcohol Dehydrogenase Genes for Ethanol Production from Zymomonas Mobilis
    J Ind lvlicrobiol Biotechnol (2003) 30: 315-321 860 DOl 10.1007s10295-003-0055-z ORIGINAL PAPER Nancy N. Nichols' Bruce S. Dien . Rodney J. Bothast Engineering lactic acid bacteria with pyruvate decarboxylase and alcohol dehydrogenase genes for ethanol production from Zymomonas mobilis Received: 12 December 2002 Accepted: 12 March 2003 Published online: 15 May 2003 © Society for Industrial l"licrobiology 2003 Abstract Lactic acid bacteria are candidates for eng:i­ Introduction neered production of ethanol from biomass because th~y are food-grade microorganisms that can. in many case;. Agricultural biomass has the potential to supplement metabolize a variety of sugars and grow unde;' harsh starch as a feedstock for fuel ethanol production. conditions. In an effort to divert fermentation from Hydrolysis of the lignocellulose in biomass yields a production of lactic acid to ethanoL plasmids were mixture of hexose and pentose sugars. including glucose. constructed to express pyruvate decarboxylase (PDC) galactose, xylose. and arabinose. However, the current and alcohol dehydrogenase (ADH), encoded by the pdc starch-based technology has not yet been extended to a and adhB genes of Zymomonas mobilis, in lactic acid biomass-to-ethanol process. in part because the veast bacteria. Several strains were transformed with the Saccharomyces cerevisiae does not metabolize pentoses. plasmids. and transcription of pdc and adhB was con­ Naturally occurring yeasts that ferment xylose have lmv firmed by northern hybridization analvsis of transfor­ ethanol yields and production rates [3]. ·Consequently. mants. PDC and ADH enzyme activities were at least ethanol fermentation from biomass-derived sugars must 5- to 10-fold lower in these bacteria compared to employ new fermentative microorg:anisms with an Escherichia coli transformed with the same plasmid.
    [Show full text]
  • Metabolic Engineering of Zymomonas Mobilis for Anaerobic Isobutanol Production
    Qiu et al. Biotechnol Biofuels (2020) 13:15 https://doi.org/10.1186/s13068-020-1654-x Biotechnology for Biofuels RESEARCH Open Access Metabolic engineering of Zymomonas mobilis for anaerobic isobutanol production Mengyue Qiu1†, Wei Shen1†, Xiongyin Yan1†, Qiaoning He1, Dongbo Cai1, Shouwen Chen1, Hui Wei2, Eric P. Knoshaug3, Min Zhang2, Michael E. Himmel2 and Shihui Yang1* Abstract Background: Biofuels and value-added biochemicals derived from renewable biomass via biochemical conversion have attracted considerable attention to meet global sustainable energy and environmental goals. Isobutanol is a four-carbon alcohol with many advantages that make it attractive as a fossil-fuel alternative. Zymomonas mobilis is a highly efcient, anaerobic, ethanologenic bacterium making it a promising industrial platform for use in a biorefnery. Results: In this study, the efect of isobutanol on Z. mobilis was investigated, and various isobutanol-producing recombinant strains were constructed. The results showed that the Z. mobilis parental strain was able to grow in the presence of isobutanol below 12 g/L while concentrations greater than 16 g/L inhibited cell growth. Integration of the heterologous gene encoding 2-ketoisovalerate decarboxylase such as kdcA from Lactococcus lactis is required for isobutanol production in Z. mobilis. Moreover, isobutanol production increased from nearly zero to 100–150 mg/L in recombinant strains containing the kdcA gene driven by the tetracycline-inducible promoter Ptet. In addition, we determined that overexpression of a heterologous als gene and two native genes (ilvC and ilvD) involved in valine metabolism in a recombinant Z. mobilis strain expressing kdcA can divert pyruvate from ethanol production to isobutanol biosynthesis.
    [Show full text]
  • GENETIC MANIPULATION of ZYMOMONAS MOBILIS: Gene Transfer Systems, Cloning and Expression of Genes Involved in Cellulosic Bioconversion
    GENETIC MANIPULATION OF ZYMOMONAS MOBILIS: Gene Transfer Systems, Cloning and Expression of Genes Involved in Cellulosic Bioconversion A thesis submitted for the degree of DOCTOR OF PHILOSOPHY by PING SU January, 1989 Department of Biotechnology University of New South Wales UNIVERSITY CF N.S.W. 2 8 MAR 1990 B'OMED’CAL LIBRARY ACKNOWLEDGEMENTS I wish to thank Professor Pamela Rickard for allowing me to undertake a Ph.D. in the Department and for her interest in my progress. I am indebted to my supervisors, Dr.Stephen Delaney and Associate Professor Peter Rogers, for their valuable time, advice and encouragement. Special thanks are due to Associate Professor Noel Dunn and Dr. Amanda Goodman for their helpful suggestions and advice. I would also like to thank all the academic staff and students of the Department, especially Liu, Rachel, Russell, Paul, Aneta, Pittaya, Glenda, Wolf, Janette, Geoff, Phil, Baha, Rose, John and Cho for their help and friendship. I am grateful for the Postgraduate Scholarships provided by Mr. Martial Lawson of Lily vale Mushrooms Pty. Ltd. and by the University of New South Wales. Finally, I thank Jenny for her excellent typing of this thesis. w I ABSTRACT Zymomonas mobilis has been evaluated as being "an ideal ethanol producer" if the problem of its narrow substrate range could be overcome. Cellobiose is one of the main products of cellulase-catalysed breakdown of cellulose, which is the most abundant organic compound in the world. This thesis reports the development of efficient recombinant DNA techniques in Z. mobilis and construction of Zymomonas strains capable of converting cellobiose to ethanol.
    [Show full text]