Microrna-145 Suppresses Mouse Granulosa Cell Proliferation by Targeting Activin Receptor IB

CORE Metadata, citation and similar papers at core.ac.uk

Provided by Elsevier - Publisher Connector

FEBS Letters 586 (2012) 3263–3270

journal homepage: www.FEBSLetters.org

MicroRNA-145 suppresses mouse granulosa cell proliferation by targeting activin receptor IB ⇑ ⇑ Guijun Yan 1, Lianxiao Zhang 1, Ting Fang, Qun Zhang, Shaogen Wu, Yue Jiang, Haixiang Sun , Yali Hu

Reproductive Medicine Center, The Afﬁliated Drum Tower Hospital of Nanjing University Medical School, Nanjing, People’s Republic of China

article info abstract

Article history: MicroRNAs (miRNAs) are a class of 21- to 25-nucleotide non-coding RNAs, some of which are impor- Received 14 February 2012 tant gene regulators involved in folliculogenesis. In this study, we used CCK-8, real-time PCR and Revised 28 June 2012 Western blot assays to demonstrate that miR-145 inhibits mouse granulosa cell (mGC) proliferation. Accepted 28 June 2012 Combined with the results of luciferase reporter assays that studied the 30-untranslated region of Available online 13 July 2012 ACVRIB mRNA, these assays identiﬁed ACVRIB as a direct target of miR-145. The ectopic expression Edited by Tamas Dalmay of miR-145 reduced the levels of both ACVRIB mRNA and protein and also interfered with activin- induced Smad2 phosphorylation. Altogether, this study revealed that miR-145 suppresses mGC proliferation by targeting ACVRIB. Keywords: MicroRNA-145 Ó 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Activin receptor IB Granulosa cell Proliferation Smad

1. Introduction involved in reproductive dysfunction and cancer, and that they apparently play important roles in the regulation of folliculogene- Previous studies have shown that follicles, the functional units sis and follicular function [8–11]. Activins have been shown to pro- of the ovary, consist of a central oocyte surrounded by one or more mote the maturation of oocytes and regulate the proliferation of layers of somatic granulosa cells (GCs). Folliculogenesis is a com- GCs, and the different expression of TGF-b proteins (such as inhi- plex process during which oocytes increase in size and develop bins, activins and follistatin) imply a significant functional role into a mature form, accompanied by the proliferation and differen- for these peptides in the development of follicles within the ovary tiation of the surrounding granulosa cells [1–3]. The pituitary [12–14]. gonadotropins FSH and LH play an important role in stimulating The two types of activin receptors that have intrinsic serine/ folliculogenesis during follicular development. This process is also threonine kinase activity are designated as type I (ACVRIA and regulated by various extra- and intraovarian factors such as activ- ACVRIB) and type II (ACVRIIA and ACVRIIB). Activin binds directly ins, inhibins, BMPs and GDF-9 [4–6]. to the type II activin receptor, leading to the phosphorylation and Activins belong to the transforming growth factor b (TGF-b) activation of the type I activin receptor (also known as ALK4). Acti- superfamily, are made up of two subunits (bA and bB) and are clas- vated ALK4 transiently interacts with and phosphorylates two sified into three types: activin A (bAbA), activin B (bBbB) and acti- intracellular signal transducers, Smad2 and Smad3 (R-Smads), vin AB (bAbB) [7]. Increasing evidence suggests that activins are which, upon phosphorylation, form complexes with the common partner Smad4 (Co-Smad). Subsequently, the Smad complexes translocate into the nucleus and bind to the promoters of target Abbreviations: FSH, follicle-stimulating hormone; LH, luteinizing hormone; genes to regulate their expression [15–17]. BMPs, bone morphogenetic proteins; GDF-9, growth differentiation factor-9; TGF-b, MicroRNAs (miRNAs) are a class of 21- to 25-nucleotide non- transforming growth factor-b; mGCs, mouse granulosa cells; 30-UTR, 30-untranslated region; ACVRIA, activin receptor typeIA; ACVRIB, activin receptor typeIB; coding RNAs that have been recognized as important gene regula- ACVRIIA, activin receptor typeIIA; ACVRIIB, activin receptor typeIIB; ER-alpha, tors. miRNAs function as regulators of gene expression by targeting estrogen receptor-a; OCT4, octamer-binding transcription factor-4; SOX9, SRY- mRNAs for degradation or blocking mRNA translation by binding to related high mobility group-box gene-9; ITGB8, integrin, beta-8; CCND2, cyclin D2; the 30-untranslated region (30-UTR) [18,19]. Hundreds of miRNAs Smad, Sma and Mad related family; POF, premature ovarian failure ⇑ Corresponding authors. Fax: +86 25 83107188. have been identified and shown to participate in the regulation E-mail addresses: [email protected] (H. Sun), [email protected] (Y. Hu). of various biological processes, such as cell proliferation, differen- 1 G. Yan and L. Zhang contributed equally to this work. tiation and apoptosis [19–21]. For example, miR-145 is capable of

0014-5793/$36.00 Ó 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.febslet.2012.06.048 3264 G. Yan et al. / FEBS Letters 586 (2012) 3263–3270 inhibiting tumor cell growth and invasion by targeting genes such 2.5. Cell proliferation assays as c-Myc, mucin 1 and ER-alpha [22–24]. In addition, miR-145 targets pluripotency factors such as OCT4, SOX9 and ITGB8 and func- The cell proliferation assays were conducted using a Cell Count- tions as a key regulator of human stem cells [25–27]. Evidence ing Kit-8 (CCK-8, Dojindo Laboratories, Kumamoto, Japan) accord- indicates that some miRNAs may play critical roles in controlling ing to the manufacturer’s instructions. The cells were seeded in 96- the expression of genes that are essential for ovarian folliculogen- well plates at approximately 0.5–1 104 cells per well and cul- esis and endocrine function [28,29], which suggests that miRNAs tured in growth medium. The level of cellular proliferation was de- may be important for follicular development. However, miRNAs tected 48 h after treatment with Ad-miR-145 or the miR-145 involvement in the regulation of ovarian function has not been inhibitor (Ribobio, Guangzhou, China). A 10-ll aliquot of CCK-8 re- well documented. agent was added to each well, and the plates were then incubated Therefore, this study aimed to investigate the effects that miR- for 1–3 h. The cell numbers were detected on a microplate reader 145 have on mouse granulosa cell proliferation. In addition, ACV- by measuring the absorbance at 450 nm (OD450). RIB was identiﬁed as a miR-145 target that may be mediated in the process of regulating mouse granulosa cell proliferation. 2.6. RNA isolation and quantitative real-time PCR

2. Materials and methods Total RNA was isolated from tissues and cultured cells using Tri- zol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized 2.1. Animals from 1 lg of purified RNA using a PrimeScript RT reagent kit (Bio- Rad Laboratories, Hercules, CA, USA) according to the manufac- Three-week-old ICR mice were purchased from the Lab Animal turer’s protocol. The specific primers used for the quantitative Center of Yangzhou University (Yangzhou, China) and maintained polymerase chain reaction (PCR) analysis are listed in Table 1. Each in the Animal Laboratory Center of Drum Tower Hospital (Nanjing, sample was analyzed in triplicate, and the experiment was re- China) on a 12:12 h light/dark cycle (lights off at 19:00) with food peated three times. Each real-time PCR reaction was composed of and water available ad libitum. All of the experiments involving 1 ll RT product, 10 ll SYBR Green PCR Master Mix (Bio-Rad Labo- animals were performed according to the guidelines of the Exper- ratories, Hercules, CA, USA), and 500 nM forward and reverse prim- imental Animal Management Committee (Jiangsu Province, China). ers. The real-time PCR was performed on a MyiQ Single Color Real- time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, 2.2. Cell lines USA) in 40 cycles (miRNAs: 95 °C for 15 s, 60 °C for 1 min after an initial 15 min incubation at 95 °C. Genes: 95 °C for 10 s, 60 °C HEK293 cells and HEK293A cells were maintained in DMEM/ for 30 s, 72 °C for 30 s after an initial 3 min incubation at 95 °C). High Glucose (Gibco BRL/Invitrogen, Carlsbad, CA, USA) supple- The data were analyzed with the 2-DDCT method [31], and the fold mented with 10% fetal bovine serum (FBS, Gibco BRL/Invitrogen, changes in gene expression were normalized to 18S rRNA or U6 as Carlsbad, CA, USA) and antibiotics (100 IU/ml penicillin and endogenous controls. 100 lg/ml streptomycin, Gibco BRL/Invitrogen, Carlsbad, CA, USA). The cells were kept at 37 °C in a humidified environment 2.7. Western blotting with 5% CO2. Total protein was isolated from mGCs, which were harvested at 2.3. Mouse primary granulosa cell collection and culture 48 h after treatment. The cells were rinsed with ice-cold PBS (pH 7.4) and lysed with whole cell lysis buffer (50 mM Tris–HCl pH Mouse granulosa cells (mGCs) were collected from the ovaries 7.6, 150 mM NaCl, 1.0% NP-40, Protease Inhibitor Cocktail, Phos- of 21-day-old immature ICR mice using the follicle puncture meth- phatase Inhibitor Cocktail (Sigma, St. Louis, MO, USA)). The protein od, as described previously [30]. The mGCs were cultured in concentrations were determined by a Bradford assay (Bio-Rad Lab- DMEM/F12 (Gibco BRL/Invitrogen, Carlsbad, CA, USA) supple- oratories, Hercules, CA, USA). Equal amounts of total protein mented with 10% FBS, 1% sodium pyruvate (Gibco BRL/Invitrogen, (30 lg) were separated on a 10% SDS–polyacrylamide gel, trans- Carlsbad, CA, USA), 1% glutamine (Gibco BRL/Invitrogen, Carlsbad, ferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, CA, USA), 100 IU/ml penicillin, and 100 lg/ml streptomycin in Billerica, MA, USA), incubated with antibodies, and visualized using the presence or absence of activin A (R&D Systems, Minneapolis, a chemiluminescence detection kit (Amersham Biosciences Corp., MN, USA). The cells were incubated at 37 °C and supplemented Piscataway, NJ, USA). The following antibodies were used for with 5% CO2 in a humidified chamber. immunoblotting: anti-phospho-Smad2 (1:800, Cell Signaling Tech- nology, Danvers, MA, USA), anti-Smad2 (1:1000, Cell Signaling Technology, Danvers, MA, USA), anti-cyclin D2 (1:500, Cell Signal- 2.4. Construction of recombinant adenovirus

Adenoviruses harboring a 441-bp DNA fragment encompassing the has-miR-145 gene (Ad-miR-145), Flag-tagged mouse ACVRIB Table 1 DNA sequences of primers used for real-time PCR. without 30-UTR (Ad-flag-mACVRIB), Flag-tagged mouse ACVRIB with wild-type 30-UTR (Ad-flag-mACVRIB-30-UTR) and flag-tagged Genes Primers(50–3) Products size (bp) 0 0 mouse ACVRIB with 3 -UTR-mutant (Ad-flag-mACVRIB -3 -UTR miR-145 CGCGCTCGAGCCCAGAGCAATAAGCCACAT 69 mu) were generated using the AdMax (Microbix) system according GGTGTCGTGGAGTCGGCAATTCAGTTGAG to the manufacturer’s recommendations. The adenovirus bearing U6 CTCGCTTCGGCAGCACA 94 AACGCTTCACGAATTTGCGT LacZ (Ad-LacZ) was obtained from Clontech. The viruses were mCCND2 ACACCGACAACTCTGTGAAGC 79 packaged and amplified in HEK293A cells and purified using CsCl GCCAGGTTCCACTTCAGCTTA banding followed by dialysis against 10 mM Tris-buffered saline mACVRIB GCTTGCATGGTCTCCATCTT 176 with 10% glycerol. The viral titer was determined using HEK293A GGGACCCTGAGGTCAATCTT cells and the Adeno-X Rapid Titer kit (BD Biosciences Clontech, m18S rRNA ATGGCCGTTCTTAGTTGGTG 183 CGGACATCTAAGGGCATCAC Palo Alto, CA, USA) according to the manufacturer’s instructions. G. Yan et al. / FEBS Letters 586 (2012) 3263–3270 3265 ing Technology, Danvers, MA, USA), anti-ACVRIB (1:500, Bioworld 2.9. Statistical analysis Technology Inc. Minneapolis, MN, USA), anti-Flag (1:2000, Invitro- gen, Carlsbad, CA, USA), anti-Smad4 (1:500, Bioworld Technology All experiments were repeated at least three times, and the data Inc. Minneapolis, MN, USA), anti-b-actin (1:5000, Sigma, St. Louis, are expressed as the mean ± S.E.M. The Student’s t-test was used MO, USA) Goat anti-rabbit (1:5000, Bio-Rad Laboratories, Hercules, for statistical comparisons. P values less than 0.05 were considered CA, USA) and goat anti-mouse (1:10000, Bio-Rad Laboratories, Her- statistically significant. cules, CA, USA) secondary antibodies were used. 3. Results 2.8. Transient transfection and luciferase reporter assay 3.1. MiR-145 inhibits mouse granulosa cell proliferation Based on the mouse ACVRIB mRNA sequence (accession No. NM_007395.3) and mouse CCND2 mRNA sequence (accession No. We successfully produced 8.91 1010 ifu/ml Ad-miR-145 in NM_009829.3) deposited in the GenBank database, the fire lucifer- the laboratory and examined miR-145 expression in mGCs after ase cDNA fused with the 30UTR fragments of mouse ACVRIB mRNA treatment with Ad-miR-145 or the miR-145 inhibitor. As ex- (694nt, 549–1242) and the mouse CCND2 mRNA (726nt, 2684– pected, miR-145 expression increased after infection with Ad- 3589) containing the putative miR-145 binding site were amplified miR-145 and decreased after transfection of the miR-145 inhibi- separately from mGCs cDNA and cloned into the region down- tor. Both of these effects were dose-dependent (Fig. 1A and stream of the firefly luciferase gene in the pGL3-promoter lucifer- C).miR-145 has been reported to inhibit tumor cell growth and ase reporter vector (Promega, Madison, USA) and the resulting invasion [22–24], so we investigated whether miR-145 plays a plasmid was sequenced to confirm its identity. Preconfluent (75– role in the proliferation of mGCs. We first found that the prolifer- 80%) HEK293 cells in 12-well plates were transfected with the ation of mGCs was dose-dependently suppressed after infection appropriate plasmids using the NanoFectin transfection reagent with Ad-miR-145, but increased upon transfection with a miR- (PAA, Pasching, Austria). The Renilla luciferase reporter plasmid 145 inhibitor (Fig. 1B and D). Because cyclin D2 (CCND2) is an pRL-RSV (Promega, Madison, WI, USA) was included as a control important protein in the cell cycle [32], we also investigated for transfection efficiency. After 48 h, the cells were harvested the expression of CCND2 in mGCs after treatment with Ad-miR- and lysed for use in the luciferase reporter assay, which was per- 145 or the miR-145 inhibitor. As shown in Fig. 2C and E, the re- formed using the Luciferase Assay System (Promega, Madison, sults indicate that the overexpression of miR-145 decreased both WI, USA) and measured with a Centro XS3 LB 960 luminescence the mRNA and protein levels of CCND2 in mGCs. Furthermore, the counter (Berthold Technologies, GmbH Co. KG, Germany). At least miR-145 inhibitor enhanced the mRNA and protein expressions of three transfection assays were performed to obtain statistically CCND2 (Fig. 2D and F). significant data.

Fig. 1. The effect of miR-145 on mGC proliferation. Mouse granulosa cells were infected with Ad-miR-145 or transfected with miR-145 inhibitor at the MOI or nM indicated for 48 h. (A and C) miR-145 expression increased in a dose-dependent manner after infection with Ad-miR-145, but was reduced after transfection of the miR-145 inhibitor. (B and D) Result of a Cell Counting Kit-8 assay examining the proliferation of mouse granulosa cells. ⁄, P < 0.05, compared with Ad-LacZ group; #, P < 0.05, compared with control group. 3266 G. Yan et al. / FEBS Letters 586 (2012) 3263–3270

Fig. 2. MiR-145 directly inhibits expression of CCND2 via its 30UTR. Putative binding sites for mouse miR-145 in the 30UTR of CCND2 mRNA, seed match region was shown in brown and seed mutant region was shown in red. (B) mGCs were transfected with or without miR-145, and mouse CCND2 gene 30UTR luciferase activity was inhibited by miR-145, but had no effect on the activity of luciferase fused with CCND2 30UTR mutant. ⁄, P < 0.05, compared with control. (C and E) CCND2 mRNA expression and protein level in mouse granulosa cells was down-regulated by overexpression of miR-145, ⁄, P < 0.05, compared with Ad-LacZ group. (D and F) CCND2 mRNA expression and mRNA expression and protein level in mouse granulosa cells was examined after treated with the miR-145 inhibitor at the nM indicted for 48 h through qRT-PCR and Western blot. #, P < 0.05, compared with control.

3.2. MiR-145 directly inhibits expression of CCND2 and ACVRIB via miR-145 inhibitor (Figs. 2D and 3E). To further verifyCCND2 and their 30UTR ACVRIB as a target of miR-145, we performed Western blot analysis to look at the expression of endogenous CCND2 and ACVR1B in MiR-145 has been reported to regulate target gene expression mGCs transduced with Ad-miR145. As shown in Figs. 2E and 3F, in through direct binding to the 30-untranslated region (30-UTR) of a dose-dependent manner, overexpressing miR-145 markedly target mRNAs [18,19]. Thus, we used the online miRNA target gene inhibited endogenous CCND2 and ACVR1B expression, and the prediction program miRanda (http://www.miRbase.org/) to iden- expression of CCND2 and ACVRIB protein was stimulated by the tify candidate target genes for miR-145, and found that CCND2 miR-145 inhibitor (Figs. 2F and 3G). All of these data indicate that and ACVRIB are potential miR-145 targets (Figs. 2A and 3A). miR-145 targets CCND2 and ACVRIB by binding to their 30-UTR. Accordingly, we constructed a luciferase reporter plasmids containing the 30UTR region of mouse CCND2 and ACVRIB with the 3.3. MiR-145 inhibits activin A-induced mGC proliferation putative miR-145 binding site. After overexpression of miR-145 in mGCs, luciferase activity was indeed decreased significantly Activin A is an important regulator of follicle development and (Figs. 2B and 3B). In contrast, overexpression of miR-145 had no ef- can promote granulosa cell proliferation [8,12,13]. As described fect on the activity of luciferase gene fused with the CCND2 and above, we showed that miR-145 inhibited the proliferation of ACVRIB 30-UTR mutant (Figs. 2B and 3B). To confirm the result, mGC. Therefore, we further investigated whether miR-145 plays we also generated adenoviruses harboring Flag-ACVR1B with the a role in activin A-induced mGC proliferation. First, we investigated 30UTR of ACVR1B gene, then co-infected with Ad-miR-145 in the level of miR-145 in mGCs after treatment with activin A (50 ng/ mouse granulosa cells. As showed in Fig. 3C, overexpression miR- ml) for 48 h, finding that activin A significantly reduced the expres- 145 suppressed the Flag-tagged ACVR1B expression, but when sion of miR-145 (Fig. 4A). We confirmed that activin A increased co-infected with ACVR1B without its 30UTR and mutant sequence, the expression of CCND2 mRNA and protein, as reported previously miR-145 had no effect on Flag-ACVR1B expression. Moreover, qRT- [32]. Moreover, our results showed that the overexpression of miR- PCR results showed that the CCND2 and ACVRIB mRNA level de- 145 decreased the activin A-induced increase in CCND2 mRNA and creased when mGCs were infected with Ad-miR-145 (Figs. 2C protein levels in mGCs (Fig. 4B and C). We also investigated the le- and 3D), but increased when the cells were treated with the vel of miR-145 in mGCs 48 h after treatment with activin A (50 ng/ G. Yan et al. / FEBS Letters 586 (2012) 3263–3270 3267

Fig. 3. MiR-145 targets the ACVR1B in mouse granulosa cells. (A) Putative binding sites for mouse miR-145 in the 30UTR of ACVR1B mRNA and its seed sequence mutant were shown in red. (B) HEK293 cells were transfected with or without miR-145, and mouse ACVR1B gene 30UTR luciferase activity was inhibited by miR-145, but had no effect on the activity of luciferase fused with ACVR1B 30UTR mutant. ⁄, P < 0.05, compared with control. (C) Adenoviruses harboring Flag-ACVR1B with or without the 30UTR of ACVR1B gene were co-infected with Ad-miR-145 in mouse granulosa cells 48 h later, the ACVR1B expression was immunoblotted with horseradish peroxidase (HRP)-conjugated anti- Flag antibody. (D and E) ACVR1B mRNA expression in mouse granulosa cells was down-regulated by overexpression of miR-145 and was increased by miR-145 inhibitor. ⁄, P < 0.05, compared with control. (F and G) Endogenous ACVR1B protein level in mouse granulosa cells was examined after treated with the Ad-miR-145 and miR-145 inhibitor at the concentration indicted for 48 h through Western blot. ml), ﬁnding that activin A signiﬁcantly reduced the expression of creased (Fig. 5C). As shown in Fig. 5D, overexpression of ACVRIB miR-145 (Fig. 4C). These data suggest that miR-145 modulates increased the proliferation of mGCs apparently, importantly while activin A-induced mGC proliferation. increased the expression of ACVRIB in mGCs could attenuate the proliferation suppressing effects of overexpression miR-145. All 3.4. MiR-145 inactivates the intracellular activin-induced Smad of these data suggest that miR-145 inhibits mGC proliferation by signaling pathway targeting ACVRIB.

To characterize the function of miR-145 in the activin-induced 4. Discussion Smad signaling pathway, we investigated the expression and phosphorylation of Smad2 in mGCs by Western blot. The results Recently, many research groups have begun studying microR- showed that activin A treatment (50 ng/ml) significantly increased NAs, which target a variety of genes and have predictable charac- the level of phosphorylated Smad2 (Ser465/467) and that miR-145 teristics. Some miRNAs appear to play important roles in treatment attenuated this effect. However, Smad2 expression per regulating the expression of genes that are essential for ovarian fol- se was not significantly changed by the different treatments liculogenesis and endocrine function [28,29]. Recent evidence has (Fig. 4D). What’s more, neither activin A nor miR-145 had any ef- shown that hundreds of miRNAs participate in the regulation of fect on Smad4 expression. various cellular processes, and miR-145 appears to be one such regulatory miRNA. For example, miR-145 inhibits breast cancer cell 3.5. MiR-145 inhibits mGC proliferation by targeting ACVRIB proliferation by targeting mucin 1 [23]. Thus, we hypothesized that miR-145 might have an impact on the proliferation of mouse gran- To further substantiate that miR-145 inhibits granulosa cell ulosa cells. proliferation by targeting ACVR1B, we performed loss-of-function In addition, our previous microarray studies investigating the studies using RNA interference (Fig. 5A and B). Although ACVRIB expression profiles of plasma microRNAs have shown that miR- knockdown in mGCs had a weak inhibiton of proliferation, when 145 expression is much higher in patients who experience prema- the endogenous ACVRIB protein expression was inhibited, the pro- ture ovarian failure (POF) than in women with normal ovarian motion of proliferation in mGCs by activin A was significantly de- function (data not shown). POF is characterized by amenorrhoea, 3268 G. Yan et al. / FEBS Letters 586 (2012) 3263–3270

Fig. 4. MiR-145 inhibits activin A-induced mGC proliferation and inactivates the intracellular activin Smad signaling pathway. (A) Mouse granulosa cells were cultured in low-serum media (containing 2.5% c-FBS) and treated with 50 ng/ml activin A for up to 48 h. miR-145 expression was examined by qRT-PCR. ⁄, P < 0.05, compared with untreated group. (B) qRT-PCR showed the mRNA level of CCND2 in mGCs infected with or without Ad-miR-145 in the presence or absence of activin A for 48 h. ⁄, P < 0.05. #, P < 0.05. (C) Western blot showed the protein expression of CCND2 in mGCs infected with or without Ad-miR-145 in the presence or absence of activin A for 48 h. (D) Western blot showed the protein expressions of Smad2 phosphorylation, Smad2 and Smad4 in mGCs infected with or without Ad-miR-145 in the presence or absence of activin A for 48 h.

Fig. 5. MiR-145 inhibits mGC proliferation by targeting ACVRIB.(A and B) qRT-PCR and Western blot showed expression of ACVR1B in mGCs transfected with si-CTL or si- ACVR1B (50nM) for 3 days. ⁄, P < 0.05, compared with si-CTL group. (C) Mouse granulosa cells were transfected with 50 nM si-ACVR1B for 48 h. Cell Counting Kit-8 assay examining the proliferation of mouse granulosa cells in the presence or absence of activin A for 24 h. ⁄, P < 0.05, compared with si-CTL alone; #, P < 0.05, compared with si-CTL treated with activin A group. (D) Result of a Cell Counting Kit-8 assay examining the proliferation of mouse granulosa cells were infected with Ad-flag-ACVR1B and/or Ad- miR-145 for 48 h. #, P < 0.05, compared with Ad-flag-ACVR1B and Ad-miR-145 alone. infertility, hypoestrogenism and elevated gonadotropin concentra- experience follicle depletion or follicle dysfunction [33–35]. Folli- tions in women under 40 years of age. Most women with POF culogenesis includes the maturation of oocytes and the prolifera- G. Yan et al. / FEBS Letters 586 (2012) 3263–3270 3269 tion and differentiation of their surrounding granulosa cells [1–3]. References Therefore, this study may help us understand whether miR-145 plays a causative role in POF. [1] Eppig, J.J. (1985) Oocyte-somatic cell interactions during oocyte growth and maturation in the mammal. Dev. Biol. (N Y 1985) 1, 313–347 [PubMed: In this study, we have confirmed that miR-145 inhibits the pro- 3917204]. liferation of mGCs. Our luciferase assays demonstrated that ACV- [2] Vanderhyden, B.C. and Macdonald, E.A. (1998) Mouse oocytes regulate RIB is a target of miR-145 and that miR-145 down-regulates the granulosa cell steroidogenesis throughout follicular development. Biol. expression of ACVRIB mRNA and protein by targeting the 30-UTR Reprod. 59 (6), 1296–1301 [PubMed: 9828170]. [3] Oktem, O. and Urman, B. (2010) Understanding follicle growth in vivo. Hum. of ACVRIB mRNA. Furthermore, we found that miR-145 reduced Reprod. 25 (12), 2944–2954 [PubMed: 20937745]. activin-mediated Smad2 phosphorylation and attenuated the tran- [4] Knight, P.G. and Glister, C. (2006) TGF-beta superfamily members and ovarian scriptional response to activin. It is known that activin binds to the follicle development. Reproduction 132 (2), 191–206 [PubMed: 16885529]. [5] Gilchrist, R.B., Lane, M. and Thompson, J.G. (2008) Oocyte-secreted factors: type II activin receptor directly, activating ACVRIB and the down- regulators of cumulus cell function and oocyte quality. Hum. Reprod. Update stream Smad signaling pathway to regulate the expression of tar- 14 (2), 159–177 [PubMed: 18175787]. get genes [15–17]. Our Western blot results showed that Smad2 [6] Webb, R., Garnsworthy, P.C., Gong, J.G. and Armstrong, D.G. (2004) Control of follicular growth: local interactions and nutritional influences. J. Anim. Sci. 82, was phosphorylated as an immediate response to activin A. How- E63–E74 [PubMed: 15471816]. ever, neither Smad2 nor Smad4 protein expression was signifi- [7] Burger, H.G. and Igarashi, M. (1988) Inhibin: definition and nomenclature, cantly changed by the different treatments, and no Smad3 including related substances. Mol. Endocrinol. 2 (4), 391–392 [PubMed: 3380105]. phosphorylation was detected after any of the treatments. Previous [8] Findlay, J.K. (1993) An update on the roles of inhibin, activin, and follistatin as studies have shown that activin A can specifically promote the local regulators of folliculogenesis. Biol. Reprod. 48 (1), 15–23 [PubMed: phosphorylation and nuclear translocation of Smad2 but not 8418903]. [9] Shukovski, L., Dyson, M. and Findlay, J.K. (1993) The effects of follistatin, Smad3 [36]. This difference may be because Smad2 and Smad3 activin and inhibin on steroidogenesis by bovine thecal cells. Mol. Cell have different Smad4 binding sites [37,38]. In addition, activin A Endocrinol. 97 (1–2), 19–27 [PubMed: 8143902]. significantly reduced the expression of miR-145, and the overex- [10] Mather, J.P., Moore, A. and Li, R.H. (1997) Activins, inhibins, and follistatins: pression of miR-145 attenuated the function of activin A. This re- further thoughts on a growing family of regulators. Proc. Soc. Exp. Biol. Med. 215 (3), 209–222 [PubMed: 9207855]. sult suggests that miR-145 inhibits mGC proliferation maybe [11] Drummond, A.E., Le, M.T., Ethier, J.F., Dyson, M. and Findlay, J.K. (2002) partly by targeting ACVRIB directly. Further studies are needed to Expression and localization of activin receptors, Smads, and beta glycan to the address the precise molecular mechanisms involved in miR-145 postnatal rat ovary. Endocrinology 143 (4), 1423–1433 [PubMed: 11897700]. [12] Knight, P.G. and Glister, C. (2001) Potential local regulatory functions of inhibits activin A induced mGC proliferation. inhibins, activins and follistatin in the ovary. Reproduction 121 (4), 503–512 Cyclin D proteins, including cyclin D1, cyclin D2, and cyclin [PubMed: 11277869]. D3, are cell cycle activators and previous researches showed that [13] Lovell, T.M., Gladwell, R.T., Groome, N.P. and Knight, P.G. (2003) Ovarian follicle development in the laying hen is accompanied by divergent changes in cyclin D1 and cyclin D3 in ovarian follicles were mainly expressed inhibin A, inhibin B, activin A and follistatin production in granulosa and theca in theca cells, while cyclin D2 was specifically localized in granu- layers. J. Endocrinol. 177 (1), 45–55 [PubMed: 12697036]. losa cells as an important regulator inducing their G1/S phase [14] Myers, M., Middlebrook, B.S., Matzuk, M.M. and Pangas, S.A. (2009) Loss of inhibin alpha uncouples oocyte-granulosa cell dynamics and disrupts transition [39]. Activin has been demonstrated to activate cyclin postnatal folliculogenesis. Dev Biol 334 (2), 458–467 [PubMed: 19666016]. D2 transcription through its signaling pathway [40]. Our lucifer- [15] Feng, X.H. and Derynck, R. (2005) Specificity and versatility in TGF-beta ase assays and Western blot results showed that miR-145 targets signaling through Smads. Annu. Rev. Cell Dev. Biol. 21, 659–693 [PubMed: 0 16212511]. CCND2 directly by binding to its 3 -UTR. What’s more, CCND2 [16] Florio, P., Gabbanini, M., Borges, L.E., Bonaccorsi, L., Pinzauti, S., Reis, F.M., Boy protein level was decreased after the activin-induced Smad sig- Torres, P., Rago, G., Litta, P. and Petraglia, F. (2010) Activins and related naling pathway was blocked by si-Smad2, and this suppression proteins in the establishment of pregnancy. Reprod. Sci. 17 (4), 320–330 was attenuated by miR-145 inhibitor (data not shown). These [PubMed: 20228378]. [17] Miyazawa, K., Shinozaki, M., Hara, T., Furuya, T. and Miyazono, K. (2002) Two data indicate that CCND2 is regulated by miR-145 directly and major Smad pathways in TGF-beta superfamily signaling. Genes Cells 7 (12), indirectly in mGCs. 1191–1204 [PubMed: 12485160]. In summary, our study suggests that miR-145 inhibits the pro- [18] Bartel, D.P. (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116 (2), 281–297 [PubMed: 14744438]. 0 liferation of mGCs by targeting the 3 -UTR of ACVRIB mRNA. This [19] Ambros, V. (2004) The functions of animal microRNAs. Nature 431 (7006), study provides new insights into how miR-145 functions in the fe- 350–355 [PubMed: 15372042]. male reproductive system. Understanding the crosstalk between [20] Mees, S.T., Mardin, W.A., Sielker, S., Willscher, E., Senninger, N., Schleicher, C., Colombo-Benkmann, M. and Haier, J. (2009) Involvement of CD40 targeting miR-145 and mGC proliferation helps us understand the mecha- miR-224 and miR-486 on the progression of pancreatic ductal nisms underlying follicle growth, which is a key process in the adenocarcinomas. Ann. Surg. Oncol. 16 (8), 2339–2350 [PubMed: 19475450]. pathology of POF. This study has provided a new potential target [21] Lee, Y.S., Kim, H.K., Chung, S., Kim, K.S. and Dutta, A. (2005) Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of for the diagnosis and treatment of POF. It will be important to differentiated cells but not for the down-regulation of putative targets during investigate these findings further in future studies. differentiation. J. Biol. Chem. 280 (17), 16635–16641 [PubMed: 15722555]. [22] Sachdeva, M., Zhu, S., Wu, F., Wu, H., Walia, V., Kumar, S., Elble, R., Watabe, K. and Mo, Y.Y. (2009) P53 represses c-Myc through induction of the tumor Sources of funding suppressor miR-145. Proc. Natl. Acad. Sci. U S A 106, 3207–3212 [PubMed: 19202062]. This work was supported by a State Key Development Program of [23] Sachdeva, M. and Mo, Y.Y. (2010) MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1. Cancer Res. 70 (1), 378–387 Basic Research of China Grant (973 Project No. 2010CB945104), the [PubMed: 19996288]. National Natural Science Foundation of China (Nos. 81070508, [24] Spizzo, R., Nicoloso, M.S., Lupini, L., Lu, Y., Fogarty, J., Rossi, S., Zagatti, B., 30900727, 81070492, 81170570), a Special Grant for Principal Inves- Fabbri, M., Veronese, A., Liu, X., Davuluri, R., Croce, C.M., Mills, G., Negrini, M. and Calin, G.A. (2010) MiR-145 participates with TP53 in a death-promoting tigators from the Health Department of Jiangsu Province (Nos. regulatory loop and targets estrogen receptor-alpha in human breast cancer XK201102, LJ201102, RC2011005) and a Grant from the Natural Sci- cells. Cell Death Differ. 17 (2), 246–254 [PubMed: 19730444]. ence Foundation of Jiangsu Province, PR China (No. BK2009038). [25] Zhang, S., Wu, Y., Feng, D., Zhang, Z., Jiang, F., Yin, R. and Xu, L. (2011) MiR-145 inhibits lung adenocarcinoma stem cells proliferation by targeting OCT4 Gene. Zhongguo Fei Ai Za Zhi 14 (4), 317–322 [PubMed: 21496429]. Disclosures [26] Yang, B., Guo, H., Zhang, Y., Chen, L., Ying, D. and Dong, S. (2011) MicroRNA- 145 regulates chondrogenic differentiation of mesenchymal stem cells by targeting Sox9. PLoS ONE 6 (7), e21679 [PubMed: 21799743]. No. [27] Lee, S.K., Teng, Y., Wong, H.K., Ng, T.K., Huang, L., Lei, P., Choy, K.W., Liu, Y., Zhang, M., Lam, D.S., Yam, G.H. and Pang, C.P. (2011) MicroRNA-145 regulates 3270 G. Yan et al. / FEBS Letters 586 (2012) 3263–3270

human corneal epithelial differentiation. PLoS ONE 6 (6), e21249 [PubMed: [35] Shelling, A.N., Burton, K.A., Chand, A.L., van Ee, C.C., France, J.T., Farquhar, C.M., 21701675]. Milsom, S.R., Love, D.R., Gersak, K., Aittomäki, K. and Winship, I.M. (2000) [28] Toloubeydokhti, T., Bukulmez, O. and Chegini, N. (2008) Potential regulatory Inhibin: a candidate gene for premature ovarian failure. Hum. Reprod. 15 (12), functions of microRNAs in the ovary. Semin Reprod. Med. 26 (6), 469–478 2644–2649 [PubMed: 11098038]. [PubMed: 18951329]. [36] Schmierer, B., Schuster, M.K., Shkumatava, A. and Kuchler, K. (2003) Activin A [29] Ro, S., Song, R., Park, C., Zheng, H., Sanders, K.M. and Yan, W. (2007) Cloning signaling induces Smad2, but not Smad3, requiring protein kinase A activity in and expression proﬁling of small RNAs expressed in the mouse ovary. RNA 13, granulosa cells from the avian ovary. J. Biol. Chem. 278 (23), 21197–21203 2366–2380 [PubMed: 17951331]. [PubMed: 12665510]. [30] Kipp, J.L., Kilen, S.M., Woodruff, T.K. and Mayo, K.E. (2007) Activin regulates [37] Chen, X., Weisberg, E., Fridmacher, V., Watanabe, M., Naco, G. and Whitman, estrogen receptor gene expression in the mouse ovary. J. Biol. Chem. 282, M. (1997) Smad4 and FAST-1 in the assembly of activin-responsive factor. 36755–36765 [PubMed: 17951260]. Nature 389 (6646), 85–89 [PubMed: 9288972]. [31] Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression [38] Dennler, S., Itoh, S., Vivien, D., ten Dijke, P., Huet, S. and Gauthier, J.M. (1998) data using real-time quantitative PCR and the 2(-DDC(T)) method. Methods Direct binding of Smad3 and Smad4 to critical TGF beta-inducible elements in 25, 402–408 [PubMed: 11846609]. the promoter of human plasminogen activator inhibitor-type 1 gene. EMBO J. [32] Park, Y., Maizels, E.T., Feiger, Z.J., Alam, H., Peters, C.A., Woodruff, T.K., 17 (11), 3091–3100 [PubMed: 9606191]. Unterman, T.G., Lee, E.J., Jameson, J.L. and Hunzicker-Dunn, M. (2005) [39] Robker, R.L. and Richards, J.S. (1998) Hormone-induced proliferation and Induction of cyclin D2 in rat granulosa cells requires FSH-dependent relief differentiation of granulosa cells: a coordinated balance of the cell cycle from FOXO1 repression coupled with positive signals from Smad. J. Biol. Chem. regulators cyclin D2 and p27Kip1. Mol. Endocrinol. 12 (7), 924–940 [PubMed: 280 (10), 9135–9148 [PubMed: 15613482]. 9658398]. [33] Kalantaridou, S.N., Davis, S.R. and Nelson, L.M. (1998) Premature ovarian [40] Park, Y., Maizels, E.T., Feiger, Z.J., Alam, H., Peters, C.A., Woodruff, T.K., failure. Endocrinol. Metab. Clin. North Am. 27 (4), 989–1006 [PubMed: Unterman, T.G., Lee, E.J., Jameson, J.L. and Hunzicker-Dunn, M. (2005) 9922918]. Induction of cyclin D2 in rat granulosa cells requires FSH-dependent relief [34] Santoro, N. (2003) Mechanisms of premature ovarian failure. Ann. Endocrinol. from FOXO1 repression coupled with positive signals from Smad. J. Biol. Chem. (Paris) 64 (2), 87–92 [PubMed: 12773939]. 280 (10), 9135–9148 [PubMed: 15613482].