DOCSLIB.ORG

RB1 and CDKN2A Functional Defects Resulting in Retinoblastoma O

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
RB1 and CDKN2A Functional Defects Resulting in Retinoblastoma O Molecular Biology, Vol. 36, No. 5, 2002, pp. 625–630. Translated from Molekulyarnaya Biologiya, Vol. 36, No. 5, 2002, pp. 777–783. Original Russian Text Copyright © 2002 by Babenko, Zemlyakova, Saakyan, Brovkina, Strelnikov, Zaletaev, Nemtsova. GENOMICS. TRANSCRIPTOMICS. PROTEOMICS UDC 577.218 RB1 and CDKN2A Functional Defects Resulting in Retinoblastoma O. V. Babenko1, V. V. Zemlyakova1, S. V. Saakyan2, A. F. Brovkina2, V. V. Strelnikov1, D. V. Zaletaev1, and M. V. Nemtsova1 1 Medical Genetic Research Center, Russian Academy of Medical Sciences, Moscow, 115478 Russia: E-mail: [email protected] 2 Moscow Institute of Eye Diseases, Ministry of Health of the Russian Federation, Moscow, 103064 Russia Received October 25, 2001 Abstract—Multiplex methylation-sensitive PCR was employed in studying the methylation of the RB1 and CDKN2A/p16 promoter regions in 52 retinoblastomas. Aberrant methylation inactivating RB1 was detected in 14 (27%) tumors. Methylation of p16 was for the first time observed in retinoblastoma (9 tumors, 17%). Both promoters proved to be methylated in two tumors. In four tumors, aberrant methylation was combined with structural defects of both RB1 alleles. Aberrant methylation of the p16 promoter was the second mutation event in two tumors and was not accompanied by RB1 defects in one tumor. Complex testing for RB1 mutations, loss of heterozygosity, and functional inactivation of the two genes revealed molecular defects in at least one allele in 51 (98%) tumors. Key words: retinoblastoma, RB1, CDKN2A/p16, promoter region, CpG methylation, methylation-sensitive PCR INTRODUCTION tural organization of chromatin and in regulation of the gene functional activity [4]. The role of genetic factors in carcinogenesis in now beyond doubt. As shown by numerous studies, By now, ample data have been accumulated on the malignant cells arise upon structural alterations of role of epigenetic events, including disturbed DNA certain genes. Increasing importance is also attached methylation, in carcinogenesis [1, 5]. Methylation dis- to epigenetic gene regulation, whereby the expression balance has been observed in virtually all types of of a gene is altered without changes in its nucleotide neoplastic cells. The average genome methylation is sequence [1]. An example is DNA methylation, i.e., low (hypomethylated are single CpG dinucleotides enzymatic addition of the methyl group to C5 of the scattered through the genome), while hypermethyla- pyrimidine ring in cytosine. Only cytosines in CpG tion occurs in CpG islands located in the promoter dinucleotides are thus methylated. The modification is regions of several genes involved in controlling the stable and heritable, although demethylating agents or cell cycle, differentiation, and apoptosis [4, 6]. In car- enzymes may cause reversion. cinogenesis, substantial changes in DNA methylation are maintained through tumor cell generations and, DNA methylation plays an important role in regu- what is more, progressively extend to other genes. lating the mammalian genome and underlies such bio- This problem has received increasing attention in logical phenomena as inactivation of the X chromo- recent years. Methylation of CpG islands in the pro- some, monoallelic expression in imprinting, and sup- moter region and subsequent gene inactivation have pression of foreign DNA (e.g., methylation of been demonstrated for numerous tumor suppressor, transposons suppresses their transcriptional activity metastasis-associated, and DNA repair genes [7]. In and protects the host cell) [1, 3]. Methylation and certain tumors, aberrant methylation involves several demethylation alternate in a regular fashion during genes to produce a certain methylation profile, which may serve as a marker of malignancy and may corre- embryo development, resulting in a strictly specified late with disease severity, rapid metastatic spread, or methylation profile of individual genes and the whole with resistance to chemo- and radiotherapy [1, 8]. genome. Normally, the profile is maintained stable through generations of a given somatic cell lineage. In The contribution of DNA methylation to carcino- the mature organism, methylation substantially affects genesis is not restricted to the epigenetic effect. Being DNA–protein interactions without changing the unstable, 5-methylcytosine may be spontaneously genetic information, and thereby participates in struc- deaminated to yield thymine (about 30% point muta- 0026-8933/02/3605-0625 $27.00 © 2002 MAIK “Nauka /Interperiodica” 626 BABENKO et al. tions), which is unrecognizable for repair systems. RESULTS AND DISCUSSION The resulting ë í transition may change the struc- Detection of Aberrant Methylation ture and function of the corresponding protein [9]. in the RB1 Promoter Region As a process inactivating tumor suppressor genes, Along with structural mutations and loss of het- methylation has first been described for RB1 [10]. erozygosity, methylation of the promoter region and Methylation of the RB1 promoter is involved in subsequent gene inactivation initiate carcinogenesis. Epigenetic alterations have been found to inactivate retinoblastoma development [10–12]. The normal various genes in tumor cells. For example, aberrant function of RB1 is essential for the cell-cycle control. methylation is the major inactivation mechanism of However, rather than acting alone, RB1 is functionally p16 in lung carcinoma and in various leukemias. The associated with other suppressor genes and protoon- gene for E-cadherin, which is involved in cell-to-cell cogenes, which code for modifiers of the RB1 activity. contacts, is methylated in mammary and bladder car- cinomas. MLH1, which participates in repair of Nuclear protein p16/CDKN2A inhibits cyclin- unpaired DNA, is methylated in almost all colorectal dependent kinases (CDK4/6) and prevents their com- carcinomas associated with microsatellite instability. plexation with cyclins D, which phosphorylate and The estrogen receptor gene (ER) is aberrantly methy- thereby inactivate RB1 to release transcription factor lated in 20–30% mammary carcinomas and in 60– E2F from its complex with RB1. As a result, E2F is 70% acute leukemias. The promoter region of the activated, transcription of various cell genes transcription factor WT1 gene is methylated in 90% enhanced, and the cell proceeds to the S phase. Inhibi- mammary carcinomas, 50% colorectal carcinomas, tion of cyclin-dependent kinases by p16 is the best- and in 10% Wilms tumors [17]. studied mechanism controlling the RB1 activity in the Methylation of the RB1 promoter leads to retino- cell [13]. blastoma [12, 18, 19]. We tested 52 tumors for this alteration by means of MS-PCR. The gist of the tech- In this work, we studied the methylation of the RB1 nique is selective hydrolysis of DNA sites containing and p16/CDKN2A promoter regions in 52 retinoblas- 5-methylcytosine with methylation-sensitive restric- toma specimens, and determined the spectrum of tion enzymes. DNA regions devoid of modified molecular defects leading to tumorigenesis. cytosines are cleaved, and subsequent PCR yields no product. When 5-methylcytosine is in the recognition site of a restriction enzyme, the region is not cleaved, EXPERIMENTAL and a PCR product of a certain size can be detected in the gel. The method is highly sensitive and allows Tumor specimens were obtained from patients detection of rare methylated alleles in the presence of with various forms of retinoblastoma, who were sub- excess wild-type alleles. The GC-rich RB1 promoter jected to surgery in the Oncoophthalmological fragment under study contains four HpaII (CCGG) Department, Moscow Institute of Eye Diseases. and four HhaI (CGCG) sites. MS-PCR revealed RB1 Genomic DNA was isolated from the surgery material promoter methylation in 14 (27%) tumors. Methyla- and from peripheral blood lymphocytes according to tion was combined with loss of heterozygosity in ten the standard protocol [14]. tumors and with RB1 mutations in three tumors. No RB1 defects other than methylation were found in one Methylation of CG-rich promoter regions of RB1 tumor. and p16 was probed by methylation-sensitive PCR The RB1 promoter region has 27 CpG dinucle- (MS-PCR). Genomic DNA (1 µg) was digested with otides, which can be methylated throughout the CpG 10 units of HpaII in 10 µl of the reaction mixture overnight. island to produce a specimen-specific pattern [19]. The product (150 ng) was amplified in multiplex PCR [15] The number of methylated cytosines is not associated with primers prRBF (CTGGACCCACGCCAGGTTTC), with the extent of gene inactivation [20]. Methylation prRBR (ATTGGTACCCGACTCCCGTTACAAAAT), mostly occurs in sporadic retinoblastoma (10–15% pr16F (AGCCAGCCCCTCCTCTTTCTTC), and pr16R tumors) [21] and is less frequent (6–9%) in congenital retinoblastoma [18, 22]. In addition to aberrant meth- (GAACGCACTCAAACACGC). For a positive internal ylation of the promoter, methylated cytosines have control of amplification, multiplex PCR was run been found in CGA codons of exons 8 and 14. The with primers Ext2-8F (TCTAGTTTTCCCACTCT- resulting ë í transition yields the TGA stop GTCTC) and Ext2-8R (TTCCTTCCACCCACCCT- codon and leads to premature termination of RB1 syn- GAC), which are directed to EXT2 exon 8 lacking the thesis [20]. This mechanism has not been observed for HpaII site. The amplification product was resolved in other RB1 regions containing CGA codons, suggest- 8% PAG and silver stained [16] or in 2% agarose gel ing that methylation of individual CpG in exons and stained with
Load more

Recommended publications
  • The P16 (Cdkn2a/Ink4a) Tumor-Suppressor Gene in Head
    The p16 (CDKN2a/INK4a) Tumor-Suppressor Gene in Head and Neck Squamous Cell Carcinoma: A Promoter Methylation and Protein Expression Study in 100 Cases Lingbao Ai, M.D., Krystal K. Stephenson, Wenhua Ling, M.D., Chunlai Zuo, M.D., Perkins Mukunyadzi, M.D., James Y. Suen, M.D., Ehab Hanna, M.D., Chun-Yang Fan, M.D., Ph.D. Departments of Pathology (LA, KKS, CZ, PM, CYF) and Otolaryngology-Head and Neck Surgery (CYF, JYS, EH), University of Arkansas for Medical Sciences; and School of Public Health (LA, WL), Sun-Yat Sen University, Guangzhou, China apparent loss of p16 protein expression appears to The p16 (CDKN2a/INK4a) gene is an important be an independent prognostic factor, although loss tumor-suppressor gene, involved in the p16/cyclin- of p16 protein may be used to predict overall pa- dependent kinase/retinoblastoma gene pathway of tient survival in early-stage head and neck squa- cell cycle control. The p16 protein is considered to mous cell carcinoma. be a negative regulator of the pathway. The gene encodes an inhibitor of cyclin-dependent kinases 4 KEY WORDS: Gene inactivation, Head and and 6, which regulate the phosphorylation of reti- neck squamous cell carcinoma, p16, Promoter noblastoma gene and the G1 to S phase transition of hypermethylation. the cell cycle. In the present study, p16 gene pro- Mod Pathol 2003;16(9):944–950 moter hypermethylation patterns and p16 protein expression were analyzed in 100 consecutive un- The development of head and neck squamous cell treated cases of primary head and neck squamous carcinoma is believed to be a multistep process, in cell carcinoma by methylation-specific PCR and im- which genetic and epigenetic events accumulate as munohistochemical staining.
    [Show full text]
  • Infrequent Methylation of CDKN2A(Mts1p16) and Rare Mutation of Both CDKN2A and CDKN2B(Mts2ip15) in Primary Astrocytic Tumours
    British Joumal of Cancer (1997) 75(1), 2-8 © 1997 Cancer Research Campaign Infrequent methylation of CDKN2A(MTS1p16) and rare mutation of both CDKN2A and CDKN2B(MTS2Ip15) in primary astrocytic tumours EE Schmidt, K Ichimura, KR Messerle, HM Goike and VP Collins Institute for Oncology and Pathology, Division of Tumour Pathology, and Ludwig Institute for Cancer Research, Stockholm Branch, Karolinska Hospital, S-171 76 Stockholm, Sweden Summary In a series of 46 glioblastomas, 16 anaplastic astrocytomas and eight astrocytomas, all tumours retaining one or both alleles of CDKN2A (48 tumours) and CDKN2B (49 tumours) were subjected to sequence analysis (entire coding region and splice acceptor and donor sites). One glioblastoma with hemizygous deletion of CDKN2A showed a missense mutation in exon 2 (codon 83) that would result in the substitution of tyrosine for histidine in the protein. None of the tumours retaining alleles of CDKN2B showed mutations of this gene. Glioblastomas with retention of both alleles of CDKN2A (14 tumours) and CDKN2B (16 tumours) expressed transcripts for these genes. In contrast, 7/13 glioblastomas with hemizygous deletions of CDKN2A and 8/11 glioblastomas with hemizygous deletions of CDKN2B showed no or weak expression. Anaplastic astrocytomas and astrocytomas showed a considerable variation in the expression of both genes, regardless of whether they retained one or two copies of the genes. The methylation status of the 5' CpG island of the CDKN2A gene was studied in all 15 tumours retaining only one allele of CDKN2A as well as in the six tumours showing no significant expression of transcript despite their retaining both CDKN2A alleles.
    [Show full text]
  • Increased Expression of Unmethylated CDKN2D by 5-Aza-2'-Deoxycytidine in Human Lung Cancer Cells
    Oncogene (2001) 20, 7787 ± 7796 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc Increased expression of unmethylated CDKN2D by 5-aza-2'-deoxycytidine in human lung cancer cells Wei-Guo Zhu1, Zunyan Dai2,3, Haiming Ding1, Kanur Srinivasan1, Julia Hall3, Wenrui Duan1, Miguel A Villalona-Calero1, Christoph Plass3 and Gregory A Otterson*,1 1Division of Hematology/Oncology, Department of Internal Medicine, The Ohio State University-Comprehensive Cancer Center, Columbus, Ohio, OH 43210, USA; 2Department of Pathology, The Ohio State University-Comprehensive Cancer Center, Columbus, Ohio, OH 43210, USA; 3Division of Human Cancer Genetics, Department of Molecular Virology, Immunology and Medical Genetics, The Ohio State University-Comprehensive Cancer Center, Columbus, Ohio, OH 43210, USA DNA hypermethylation of CpG islands in the promoter Introduction region of genes is associated with transcriptional silencing. Treatment with hypo-methylating agents can Methylation of cytosine residues in CpG sequences is a lead to expression of these silenced genes. However, DNA modi®cation that plays a role in normal whether inhibition of DNA methylation in¯uences the mammalian development (Costello and Plass, 2001; expression of unmethylated genes has not been exten- Li et al., 1992), imprinting (Li et al., 1993) and X sively studied. We analysed the methylation status of chromosome inactivation (Pfeifer et al., 1990). To date, CDKN2A and CDKN2D in human lung cancer cell lines four mammalian DNA methyltransferases (DNMT) and demonstrated that the CDKN2A CpG island is have been identi®ed (Bird and Wole, 1999). Disrup- methylated, whereas CDKN2D is unmethylated. Treat- tion of the balance in methylated DNA is a common ment of cells with 5-aza-2'-deoxycytidine (5-Aza-CdR), alteration in cancer (Costello et al., 2000; Costello and an inhibitor of DNA methyltransferase 1, induced a dose Plass, 2001; Issa et al., 1993; Robertson et al., 1999).
    [Show full text]
  • Efficacy of BRAF and MEK Inhibition in Patients with BRAF-Mutant
    cancers Communication Efficacy of BRAF and MEK Inhibition in Patients with BRAF-Mutant Advanced Melanoma and Germline CDKN2A Pathogenic Variants Francesco Spagnolo 1,†, Bruna Dalmasso 2,3,† , Enrica Tanda 1,3, Miriam Potrony 4,5 , Susana Puig 4,5 , Remco van Doorn 6, Ellen Kapiteijn 7 , Paola Queirolo 8, Hildur Helgadottir 9,‡ and Paola Ghiorzo 2,3,*,‡ 1 Medical Oncology 2, IRCCS Ospedale Policlinico San Martino, 16132 Genoa, Italy; [email protected] (F.S.); [email protected] (E.T.) 2 IRCCS Ospedale Policlinico San Martino, Genetics of Rare Cancers, 16132 Genoa, Italy; [email protected] 3 Genetics of Rare Cancers, Department of Internal Medicine and Medical Specialties, University of Genoa, 16132 Genoa, Italy 4 Melanoma Unit, Dermatology Department, Hospital Clinic de Barcelona, Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), Universitat de Barcelona, 08007 Barcelona, Spain; [email protected] (M.P.); [email protected] (S.P.) 5 Centro de Investigación Biomédica en Red (CIBER) de Enfermedades Raras, Instituto de Salud Carlos III, 08036 Barcelona, Spain 6 Department of Dermatology, Leiden University Medical Center, 2333 Leiden, The Netherlands; [email protected] 7 Department of Medical Oncology, Leiden University Medical Center, 2333 Leiden, The Netherlands; [email protected] Citation: Spagnolo, F.; Dalmasso, B.; 8 Melanoma, Sarcoma & Rare Tumors Division, European Institute of Oncology (IEO), 20141 Milan, Italy; Tanda, E.; Potrony, M.; Puig, S.; van [email protected] Doorn, R.; Kapiteijn, E.; Queirolo, P.; 9 Department of Oncology Pathology, Karolinska Institutet and Karolinska University Hospital Solna, Helgadottir, H.; Ghiorzo, P. Efficacy of 171 64 Stockholm, Sweden; [email protected] BRAF and MEK Inhibition in Patients * Correspondence: [email protected] with BRAF-Mutant Advanced † These authors contributed equally to this study.
    [Show full text]
  • Direct CDKN2 Modulation of CDK4 Alters Target Engagement of CDK4 Inhibitor Drugs Jennifer L
    Published OnlineFirst March 5, 2019; DOI: 10.1158/1535-7163.MCT-18-0755 Cancer Biology and Translational Studies Molecular Cancer Therapeutics Direct CDKN2 Modulation of CDK4 Alters Target Engagement of CDK4 Inhibitor Drugs Jennifer L. Green1, Eric S. Okerberg1, Josilyn Sejd1, Marta Palafox2, Laia Monserrat2, Senait Alemayehu1, Jiangyue Wu1, Maria Sykes1, Arwin Aban1, Violeta Serra2, and Tyzoon Nomanbhoy1 Abstract The interaction of a drug with its target is critical to achieve bition is not possible by traditional kinase assays. Here, we drug efficacy. In cases where cellular environment influences describe a chemo-proteomics approach that demonstrates target engagement, differences between individuals and cell high CDK4 target engagement by palbociclib in cells without types present a challenge for a priori prediction of drug efficacy. functional CDKN2A and attenuated target engagement when As such, characterization of environments conducive to CDKN2A (or related CDKN2/INK4 family proteins) is abun- achieving the desired pharmacologic outcome is warranted. dant. Analysis of biological sensitivity in engineered isogenic We recently reported that the clinical CDK4/6 inhibitor pal- cells with low or absent CDKN2A and of a panel of previously bociclib displays cell type–specific target engagement: Palbo- characterized cell lines indicates that high levels of CDKN2A ciclib engaged CDK4 in cells biologically sensitive to the drug, predict insensitivity to palbociclib, whereas low levels do not but not in biologically insensitive cells. Here, we report a correlate with sensitivity. Therefore, high CDKN2A may pro- molecular explanation for this phenomenon. Palbociclib tar- vide a useful biomarker to exclude patients from CDK4/6 get engagement is determined by the interaction of CDK4 with inhibitor therapy.
    [Show full text]
  • DNA Methylation and the Mechanisms of CDKN2A Inactivation in Transitional Cell Carcinoma of the Urinary Bladder Andrea R
    0023-6837/00/8010-1513$03.00/0 LABORATORY INVESTIGATION Vol. 80, No. 10, p. 1513, 2000 Copyright © 2000 by The United States and Canadian Academy of Pathology, Inc. Printed in U.S.A. DNA Methylation and the Mechanisms of CDKN2A Inactivation in Transitional Cell Carcinoma of the Urinary Bladder Andrea R. Florl, Knut H. Franke, Dieter Niederacher, Claus-Dieter Gerharz, Hans-Helge Seifert, and Wolfgang A. Schulz Urologische Klinik (ARF, KHF, H-HS, WAS), Frauenklinik (DN), and Institut für Pathologie (C-DG), Heinrich Heine Universität, Düsseldorf, Germany SUMMARY: Alterations of the CDKN2A locus on chromosome 9p21 encoding the p16INK4A cell cycle regulator and the p14ARF1 p53 activator proteins are frequently found in bladder cancer. Here, we present an analysis of 86 transitional cell carcinomas (TCC) to elucidate the mechanisms responsible for inactivation of this locus. Multiplex quantitative PCR analysis for five microsatellites around the locus showed that 34 tumors (39%) had loss of heterozygosity (LOH) generally encompassing the entire region. Of these, 17 tumors (20%) carried homozygous deletions of at least one CDKN2A exon and of flanking microsatellites, as detected by quantitative PCR. Analysis by restriction enzyme PCR and methylation-specific PCR showed that only three specimens, each with LOH across 9p21, had bona fide hypermethylation of the CDKN2A exon 1␣ CpG-island in the remaining allele. Like most other specimens, these three specimens displayed substantial genome-wide hypomethylation of DNA as reflected in the methylation status of LINE L1 sequences. The extent of DNA hypomethylation was significantly more pronounced in TCC with LOH and/or homozygous deletions at 9p21 than in those without (26% and 28%, respectively, on average, versus 11%, p Ͻ 0.0015).
    [Show full text]
  • Cdkn2a, the Cyclin-Dependent Kinase Inhibitor Encoding P16ink4a and P19arf, Is a Candidate for the Plasmacytoma Susceptibility Locus, Pctr1
    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 2429–2434, March 1998 Genetics Cdkn2a, the cyclin-dependent kinase inhibitor encoding p16INK4a and p19ARF, is a candidate for the plasmacytoma susceptibility locus, Pctr1 SHULING ZHANG,EDWARD S. RAMSAY, AND BEVERLY A. MOCK* Laboratory of Genetics, Division of Basic Sciences, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892-4255 Communicated by Michael Potter, National Institutes of Health, Bethesda, MD, December 24, 1997 (received for review November 17, 1997) ABSTRACT Plasma cell tumor induction in mice by cytoma susceptibilityyresistance locus resides. The protein pristane is under multigenic control. BALByc mice are sus- products of these genes bind to the CDKs CDK4 and CDK6 (6, ceptible to tumor development; whereas DBAy2 mice are 7), which, in turn, form complexes with the D-type G1 cyclins resistant. Restriction fragment length polymorphisms be- that phosphorylate pRb to control both cell cycle and tumor tween BALByc and DBAy2 for Cdkn2a(p16) and Cdkn2b(p15), suppression (8, 9). We compared the sequences of p16 and p18 and between BALByc and Mus spretus for Cdkn2c(p18INK4c) between susceptible (BALByc) and resistant (DBAy2N) were used to position these loci with respect to the Pctr1 locus. strains of mice, and found sequence variants in p16 located in These cyclin-dependent kinase (CDK) inhibitors mapped to a two different ankyrin repeat regions of the gene. DBAy2 (wild 6 cM interval of chromosome 4 between Ifna and Tal1. type) and BALByc A134C and G232A variants of the p16 C.D2-Chr 4 congenic strains harboring DBAy2 alleles asso- genes were fused to the glutathione S-transferase (GST) gene, ciated with the Pctr1 locus contained DBAy2 ‘‘resistant’’ and purified GST fusion proteins were tested for their ability alleles of the CDK4yCDK6 inhibitors p16 and p15.
    [Show full text]
  • CDKN2A Mutation and Deletion Status in Thin and Thick Primary Melanoma1
    Vol. 6, 3511–3515, September 2000 Clinical Cancer Research 3511 CDKN2A Mutation and Deletion Status in Thin and Thick Primary Melanoma1 Adrian R. Cachia,2,3 James O. Indsto,2 involved in the progression rather than initiation of sporadic Kathryn M. McLaren, Graham J. Mann, and malignant melanoma. Mark J. Arends INTRODUCTION Department of Tissue and Cell Pathology, Institute of Clinical Pathology and Medical Research, Westmead Hospital, Westmead, The incidence of malignant melanoma is rising in devel- New South Wales 2145, Australia [A. R. C.]; Westmead Institute for oped countries. Investigations of potential tumor suppressor Cancer Research, University of Sydney at Westmead Hospital, genes involved in melanoma formation have shown either hem- Westmead, New South Wales 2145, Australia [J. O. I., G. J. M.]; izygosity or LOH4 for DNA markers within chromosome 9p21 Department of Pathology, University Medical School, Teviot Place, in 34–86% of melanoma cell lines and tumors examined by Edinburgh EH8 9AG, Scotland [K. M. M.]; and Molecular several authors (1–7). Histopathology, University of Cambridge Department of Pathology, Addenbrooke’s Hospital, Cambridge CB2 2QQ, United Kingdom One gene within this deleted region is CDKN2A, which can [M. J. A.] produce two independent transcripts through the alternate splic- ing of a separate exon 1. One transcript encodes the cdk inhib- itor protein, p16INK4A (p16). The p16 protein binds to and ABSTRACT blocks the catalytic activity of two cyclin D-bound, cdks, cdk4 Human melanoma cell lines and tumor tissue from and cdk6. cdk4 is able to phosphorylate the retinoblastoma familial and sporadic melanomas have frequent, nonrandom (pRb) protein, leading to the release of associated proteins that chromosomal breaks and deletions on chromosome 9p21, a activate genes necessary for progression from the G1 to the region that includes the tumor suppressor gene CDKN2A/ S-phase of the cell cycle.
    [Show full text]
  • Aberrations of the P53 Pathway Components P53, MDM2 And
    Leukemia (1999) 13, 453–459 1999 Stockton Press All rights reserved 0887-6924/99 $12.00 http://www.stockton-press.co.uk/leu Aberrations of the p53 pathway components p53, MDM2 and CDKN2A appear independent in diffuse large B cell lymphoma MB Møller1, Y Ino2, A-M Gerdes3, K Skjødt4, DN Louis2 and NT Pedersen1 Departments of 1Pathology, 3Clinical Genetics, and 4Medical Microbiology, Odense University, Denmark; and 2Molecular Neuro-Oncology Laboratory, Department of Pathology (Neuropathology) and Neurosurgical Service, Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA The two gene products of the CDKN2A gene, p16 and p19ARF, ways together through the 9p21 locus.5,6 In this locus resides have recently been linked to each of two major tumour sup- two cyclin-dependent kinase inhibitor genes, CDKN2A and pressor pathways in human carcinogenesis, the RB1 pathway CDKN2B. The CDKN2A gene has the rare ability to encode and the p53 pathway. p16 inhibits the phosphorylation of the ARF retinoblastoma gene product by cyclin D-dependent kinases, two different proteins, p16 and p19 . This is due to the whereas p19ARF targets MDM2, a p53 inhibitory protein, for unusual organisation of the gene with two alternative first degradation. A deletion of CDKN2A would therefore disturb exons, exon 1␣ and exon 1␤, and common exons 2 and 3.7,8 both pathways. To explore the p53 pathway genes as a func- Because they are translated in different reading frames p16 tional unit in diffuse large B cell non-Hodgkin’s lymphomas and p19ARF are structurally unrelated. Despite this difference (DLCL), we wanted to see whether there exists mutually exclus- iveness of aberrations of CDKN2A, MDM2 and p53, since this both can arrest the cell cycle in G1, albeit through different has not been analysed previously.
    [Show full text]
  • The Role of Fos and Junb in the Reprogramming of Acute Myeloid Leukemia Cells
    Dickinson College Dickinson Scholar Student Honors Theses By Year Student Honors Theses 5-19-2019 The Role of Fos and JunB in the Reprogramming of Acute Myeloid Leukemia Cells Kayla Bendinelli Dickinson College Follow this and additional works at: https://scholar.dickinson.edu/student_honors Part of the Cell Biology Commons, and the Molecular Biology Commons Recommended Citation Bendinelli, Kayla, "The Role of Fos and JunB in the Reprogramming of Acute Myeloid Leukemia Cells" (2019). Dickinson College Honors Theses. Paper 321. This Honors Thesis is brought to you for free and open access by Dickinson Scholar. It has been accepted for inclusion by an authorized administrator. For more information, please contact [email protected]. 1 The role of Fos and JunB in the reprogramming of Acute Myeloid Leukemia Cells Kayla Bendinelli Submitted in partial fulfillment of the Biochemistry and Molecular Biology Honors Requirement Dr. Michael Roberts, Advisor, Committee Chair Dr. Rebecca Connor, Reader Dr. Dana Somers, Reader May 8, 2019 2 The role of Fos and JunB in the reprogramming of Acute Myeloid Leukemia cells Acute Myeloid Leukemia (AML) is the most common form of leukemia in adults and while it has a high remission rate, relapse with therapy resistance is common, indicating the need for more targeted and effective therapies. It is possible to reprogram AML cells in culture to undergo cell cycle arrest, differentiation into “normal” macrophage-like cells, and apoptosis using phorbol 12-myristate 13-acetate (PMA), a diacyl glycerol (DAG) mimic. While this is effective in “curing” leukemia in culture, PMA is too toxic to serve as a therapy in AML patients.
    [Show full text]
  • HKR3 Regulates Cell Cycle Through the Inhibition of Htert In
    Journal of Cancer 2020, Vol. 11 2442 Ivyspring International Publisher Journal of Cancer 2020; 11(9): 2442-2452. doi: 10.7150/jca.39380 Research Paper HKR3 regulates cell cycle through the inhibition of hTERT in hepatocellular carcinoma cell lines Sung Hoon Choi1, Kyung Joo Cho1,2, Sung Ho Yun3, Bora Jin1,2, Ha Young Lee3,4, Simon W Ro 1,5, Do Young Kim1,5, Sang Hoon Ahn1,2,5, Kwang-hyub Han1,3,5, Jun Yong Park1,2,5 1. Yonsei Liver Center, Yonsei University College of Medicine, Seoul, Republic of Korea 2. BK21 plus project for medical science, Yonsei University College of Medicine, Seoul, Republic of Korea 3. Division of Bioconvergence Analysis, Drug & Disease Target Team, Korea Basic Science Institute (KBSI), Cheongju, Republic of Korea 4. Bio-Analysis Science, University of Science & Technology (UST), 217 Gajeong-ro, Yuseong-gu, Daejeon, Republic of Korea 5. Department of Internal Medicine, Institute of Gastroenterology, Yonsei University College of Medicine, Seoul, Republic of Korea Corresponding author: Department of Internal Medicine, Institute of Gastroenterology, Yonsei University College of Medicine, 50-1 Yonsei-ro, Seodaemun-gu, Seoul 03722, Korea. Phone: 82-2-2228-1988; Fax: 82-2-393-6884; E-mail: [email protected] © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2019.08.16; Accepted: 2020.01.20; Published: 2020.02.10 Abstract Hepatocellular carcinoma is a malignant disease with improved hepatic regeneration and survival, and is activated by human telomere transferase (hTERT).
    [Show full text]
  • A Common Variant of CDKN2A (P16) Predisposes to Breast Cancer
    763 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.2005.031476 on 6 May 2005. Downloaded from A common variant of CDKN2A (p16) predisposes to breast cancer TDe˛bniak, B Go´rski, T Huzarski, T Byrski, C Cybulski, A Mackiewicz, S Gozdecka-Grodecka, J Gronwald, E Kowalska, O Haus, E Grzybowska, M Stawicka, M Swiec, K Urban´ski, S Niepsuj, B Was´ko, S Go´z´dz´, P Wandzel, C Szczylik, D Surdyka, A Rozmiarek, O Zambrano, M Posmyk, S A Narod, J Lubinski ............................................................................................................................... See end of article for J Med Genet 2005;42:763–765. doi: 10.1136/jmg.2005.031476 authors’ affiliations ....................... Correspondence to: Dr Steven Narod, Centre Background: A common missense variant of the CDKN2A gene (A148T) predisposes to malignant for Research in Women’s melanoma in Poland. An association between malignant melanoma and breast cancer has been reported Health, 790 Bay Street, in several families with CDKN2A mutations, Toronto, Ontario M5G Objective: To determine whether this variant also predisposes to breast cancer. 1N8, Canada; steven. [email protected] Methods: Genotyping was undertaken in 4209 cases of breast cancer, unselected for family history, from 18 hospitals throughout Poland and in 3000 controls. Received 28 January 2005 Results: The odds ratio (OR) associated with the CDKN2A allele for women diagnosed with breast cancer Revised version received before the age of 50 was 1.5 (p = 0.002) and after age 50 it was 1.3 (p = 0.2). The effect was particularly 8 April 2005 Accepted for publication strong for patients diagnosed at or before the age of 30 (OR = 3.8; p = 0.0002).
    [Show full text]