DOCSLIB.ORG

A Common Variant of CDKN2A (P16) Predisposes to Breast Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Common Variant of CDKN2A (P16) Predisposes to Breast Cancer 763 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.2005.031476 on 6 May 2005. Downloaded from A common variant of CDKN2A (p16) predisposes to breast cancer TDe˛bniak, B Go´rski, T Huzarski, T Byrski, C Cybulski, A Mackiewicz, S Gozdecka-Grodecka, J Gronwald, E Kowalska, O Haus, E Grzybowska, M Stawicka, M Swiec, K Urban´ski, S Niepsuj, B Was´ko, S Go´z´dz´, P Wandzel, C Szczylik, D Surdyka, A Rozmiarek, O Zambrano, M Posmyk, S A Narod, J Lubinski ............................................................................................................................... See end of article for J Med Genet 2005;42:763–765. doi: 10.1136/jmg.2005.031476 authors’ affiliations ....................... Correspondence to: Dr Steven Narod, Centre Background: A common missense variant of the CDKN2A gene (A148T) predisposes to malignant for Research in Women’s melanoma in Poland. An association between malignant melanoma and breast cancer has been reported Health, 790 Bay Street, in several families with CDKN2A mutations, Toronto, Ontario M5G Objective: To determine whether this variant also predisposes to breast cancer. 1N8, Canada; steven. [email protected] Methods: Genotyping was undertaken in 4209 cases of breast cancer, unselected for family history, from 18 hospitals throughout Poland and in 3000 controls. Received 28 January 2005 Results: The odds ratio (OR) associated with the CDKN2A allele for women diagnosed with breast cancer Revised version received before the age of 50 was 1.5 (p = 0.002) and after age 50 it was 1.3 (p = 0.2). The effect was particularly 8 April 2005 Accepted for publication strong for patients diagnosed at or before the age of 30 (OR = 3.8; p = 0.0002). 8 April 2005 Conclusions: CDKN2A appears to be a low penetrance breast cancer susceptibility gene in Poland. The ....................... association should be confirmed in other populations. here is continuing interest in identifying low penetrance appears to be a relatively common way of inactivating this genes that are associated with increased susceptibility to tumour suppressor gene in the breast.16 Furthermore, deletion or common types of cancer. There are several approaches to loss of heterozygosity at the CDKN2A locus (9p21) is relatively T 17 this problem, including the use of chip based single commoninbreastcancers. To establish whether or not this nucleotide polymorphism (SNP) arrays to interrogate a large common missense variant of CDKN2A predisposes to breast number of genes simultaneously, and preselecting candidate cancer we undertook an association study on 4209 cases of breast genes of interest. Candidate genes for cancers at a particular cancer and 3000 ethnically matched controls from Poland. site may be selected because they are known to predispose to http://jmg.bmj.com/ malignancies in other organs, or because they are mutated somatically in the cells from the cancer of the interest. It is METHODS possible that missense variants of genes for which truncating Study subjects mutations are clearly pathogenic may also be deleterious, but This study population includes prospectively ascertained with reduced penetrance. In this situation the association cases of invasive breast cancer diagnosed at 18 treatment may be overlooked unless large numbers of cancers are centres throughout Poland from 1997 to 2003. The study was studied. The CDKN2A (OMIM 600160) gene is a tumour approved by the ethics committee of the Pomeranian University. We are conducting a national study of unselected suppressor gene that is involved in susceptibility to malignant on September 27, 2021 by guest. Protected copyright. melanoma1 and has also been implicated in familial breast cancer patients diagnosed at or before the age of 50. pancreatic cancer.2 The p16 protein is a cyclin dependent Patients diagnosed before 2003 at the affiliated hospitals and kinase inhibitor that suppresses cell proliferation3 and is who were aged 50 or less were eligible. Patients with pure expressed in a wide range of tissues, including the breast, and intraductal or intralobular cancer (DCIS or LCIS) were in breast cancers.4 Somatic mutations of CDKN2A are present excluded but those with DCIS with microinvasion were in tumours of various sites,5 including head and neck included. The patient was invited to participate in person tumours,6 squamous cell carcinoma of the larynx,7 colon during her hospital stay or through a mailed invitation. cancer,8 clear cell sarcoma,9 and respiratory tract tumours.10 During the interview the goals of the study were explained, In Poland, a single missense variant of CDKN2A (an alanine to informed consent was obtained, genetic counselling was threonine substitution at codon 148: A148T) is present in given, and a blood sample was taken for DNA analysis. A approximately3%ofthegeneralpopulation.11 12 We have recently detailed family history of cancer was taken (first and second shown that this variant predisposes to malignant melanoma degree relatives included) and a risk factor questionnaire was (odds ratio (OR) = 2.5; p = 0.0003).13 It has been suggested by completed. In all, 4778 incident cases of early onset invasive Borg and colleagues that protein truncating CDKN2A mutations breast cancer were identified at the 18 different centres predispose women to breast cancer in the context of a syndrome during the study period. Of these, 3627 women (76%) of melanoma, pancreatic cancer, and breast cancer.14 They accepted the invitation to participate in the genetic study. observed eight cases of breast cancer in the Swedish families, The medical record and pathology report were reviewed. In a compared with 2.1 expected (p = 0.002). There are few other data companion study, seven of these centres also provided data on this topic. Ghiorzo et al observed a non-significant excess of on unselected breast cancer cases diagnosed above the age of breast cancers in seven melanoma families with CDKN2A 50 between 2000 and 2002. In the present study we provide mutations (OR = 1.9; 95% confidence interval (CI), 0.4 to 5.6).15 data on patients diagnosed before the age of 50 and on a Somatic CDKN2A mutations have not been well studied in smaller number of patients diagnosed at 51 and above. The breast cancers, but silencing of CDKN2A through methylation results of the two study groups are presented separately. www.jmedgenet.com 764 De˛bniak, Go´rski, Huzarski, et al We excluded 309 patients from the analyses: 114 patients died No A418T homozygotes were seen in the either cases and before providing a blood sample and 16 refused to participate at controls. There were 0.9 homozygotes expected among controls J Med Genet: first published as 10.1136/jmg.2005.031476 on 6 May 2005. Downloaded from a later date. We were unable to carry out molecular tests in 164 (p = 0.3) and 2.4 expected among breast cancer cases (p = 0.1). cases because of poor DNA quality. In 15 cases we had no data Among the 3318 women diagnosed with breast cancer under on age of onset. This brought the total number of breast cancer age 50, 692 had a family history of a first or second degree cases studied to 4209, including 3318 cases diagnosed at 50 or relative with breast cancer. For the familial cases the odds ratio below and 891 diagnosed at age 51 and above. observed with the A148T allele was 1.4 (95% CI, 0.9 to 2.1) and among the non-familial cases the odds ratio was 1.5 (1.1 to Controls 1.9). For 732 cases data on family history were not available. Two control groups were combined. The first group consisted of Our control group was drawn both from the newborns of 10 2000 newborn male and female children from 10 hospitals Polish cities and from the adult population from the region of situated throughout Poland in 2003 and 2004. Samples of cord Szczecin. However, the frequency of the alleles was similar in blood from unselected infants were forwarded to the study the newborn population (3.5%) and the adult population centre in Szczecin. The second control group consisted of 1000 (3.6%). The allele was equally frequent among males (3.5%) adults from the region of Szczecin unselected for cancer family and females (3.6%) and among controls recruited from history, sex, or age. These were patients randomly selected Szczecin (3.5%) and from elsewhere in Poland (3.6%). from the patient roles of participating family physicians. They were unaffected by cancer and were not selected for family DISCUSSION history. To ensure comparability of the control groups, the We have shown that the A148T allele of the CDKN2A gene is frequency of the A148T allele was computed separately for the overrepresented in a population of unselected patients with adult and neonatal control groups, and by geographical origin, breast cancer in Poland, compared with controls. It will be of and the groups compared. Because the two controls groups interest to see if this mutation or other founder CDKN2A were comparable (see below) they were combined. alleles are found to be associated with breast cancer susceptibility in other ethnic groups. Our study was notable Laboratory methods because of the large sizes of the case and control groups. Our DNA samples were obtained from peripheral blood or from cases and controls were both drawn from the Polish umbilical chord blood in newborns. The A148T variant was population and the great majority of the residents are ethnic analysed by restriction fragment length polymorphism Poles. This level of genetic homogeneity has enabled us to polymerase chain reaction (PCR), using np16ex2f find founder alleles of several other breast cancer genes, 18 19 (AGGGGTAATTAGACACCTGG) and np16ex2r including BRCA1 and CHEK2. Our cases and control (TTTGGAAGCTCTCAGGGTAC) primers. PCR products were groups differed in terms of age, sex, and geographical digested with the SacII enzyme and separated in 2–3% distribution, but none of these factors was associated with agarose gels.
Load more

Recommended publications
  • The P16 (Cdkn2a/Ink4a) Tumor-Suppressor Gene in Head
    The p16 (CDKN2a/INK4a) Tumor-Suppressor Gene in Head and Neck Squamous Cell Carcinoma: A Promoter Methylation and Protein Expression Study in 100 Cases Lingbao Ai, M.D., Krystal K. Stephenson, Wenhua Ling, M.D., Chunlai Zuo, M.D., Perkins Mukunyadzi, M.D., James Y. Suen, M.D., Ehab Hanna, M.D., Chun-Yang Fan, M.D., Ph.D. Departments of Pathology (LA, KKS, CZ, PM, CYF) and Otolaryngology-Head and Neck Surgery (CYF, JYS, EH), University of Arkansas for Medical Sciences; and School of Public Health (LA, WL), Sun-Yat Sen University, Guangzhou, China apparent loss of p16 protein expression appears to The p16 (CDKN2a/INK4a) gene is an important be an independent prognostic factor, although loss tumor-suppressor gene, involved in the p16/cyclin- of p16 protein may be used to predict overall pa- dependent kinase/retinoblastoma gene pathway of tient survival in early-stage head and neck squa- cell cycle control. The p16 protein is considered to mous cell carcinoma. be a negative regulator of the pathway. The gene encodes an inhibitor of cyclin-dependent kinases 4 KEY WORDS: Gene inactivation, Head and and 6, which regulate the phosphorylation of reti- neck squamous cell carcinoma, p16, Promoter noblastoma gene and the G1 to S phase transition of hypermethylation. the cell cycle. In the present study, p16 gene pro- Mod Pathol 2003;16(9):944–950 moter hypermethylation patterns and p16 protein expression were analyzed in 100 consecutive un- The development of head and neck squamous cell treated cases of primary head and neck squamous carcinoma is believed to be a multistep process, in cell carcinoma by methylation-specific PCR and im- which genetic and epigenetic events accumulate as munohistochemical staining.
    [Show full text]
  • Infrequent Methylation of CDKN2A(Mts1p16) and Rare Mutation of Both CDKN2A and CDKN2B(Mts2ip15) in Primary Astrocytic Tumours
    British Joumal of Cancer (1997) 75(1), 2-8 © 1997 Cancer Research Campaign Infrequent methylation of CDKN2A(MTS1p16) and rare mutation of both CDKN2A and CDKN2B(MTS2Ip15) in primary astrocytic tumours EE Schmidt, K Ichimura, KR Messerle, HM Goike and VP Collins Institute for Oncology and Pathology, Division of Tumour Pathology, and Ludwig Institute for Cancer Research, Stockholm Branch, Karolinska Hospital, S-171 76 Stockholm, Sweden Summary In a series of 46 glioblastomas, 16 anaplastic astrocytomas and eight astrocytomas, all tumours retaining one or both alleles of CDKN2A (48 tumours) and CDKN2B (49 tumours) were subjected to sequence analysis (entire coding region and splice acceptor and donor sites). One glioblastoma with hemizygous deletion of CDKN2A showed a missense mutation in exon 2 (codon 83) that would result in the substitution of tyrosine for histidine in the protein. None of the tumours retaining alleles of CDKN2B showed mutations of this gene. Glioblastomas with retention of both alleles of CDKN2A (14 tumours) and CDKN2B (16 tumours) expressed transcripts for these genes. In contrast, 7/13 glioblastomas with hemizygous deletions of CDKN2A and 8/11 glioblastomas with hemizygous deletions of CDKN2B showed no or weak expression. Anaplastic astrocytomas and astrocytomas showed a considerable variation in the expression of both genes, regardless of whether they retained one or two copies of the genes. The methylation status of the 5' CpG island of the CDKN2A gene was studied in all 15 tumours retaining only one allele of CDKN2A as well as in the six tumours showing no significant expression of transcript despite their retaining both CDKN2A alleles.
    [Show full text]
  • Increased Expression of Unmethylated CDKN2D by 5-Aza-2'-Deoxycytidine in Human Lung Cancer Cells
    Oncogene (2001) 20, 7787 ± 7796 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc Increased expression of unmethylated CDKN2D by 5-aza-2'-deoxycytidine in human lung cancer cells Wei-Guo Zhu1, Zunyan Dai2,3, Haiming Ding1, Kanur Srinivasan1, Julia Hall3, Wenrui Duan1, Miguel A Villalona-Calero1, Christoph Plass3 and Gregory A Otterson*,1 1Division of Hematology/Oncology, Department of Internal Medicine, The Ohio State University-Comprehensive Cancer Center, Columbus, Ohio, OH 43210, USA; 2Department of Pathology, The Ohio State University-Comprehensive Cancer Center, Columbus, Ohio, OH 43210, USA; 3Division of Human Cancer Genetics, Department of Molecular Virology, Immunology and Medical Genetics, The Ohio State University-Comprehensive Cancer Center, Columbus, Ohio, OH 43210, USA DNA hypermethylation of CpG islands in the promoter Introduction region of genes is associated with transcriptional silencing. Treatment with hypo-methylating agents can Methylation of cytosine residues in CpG sequences is a lead to expression of these silenced genes. However, DNA modi®cation that plays a role in normal whether inhibition of DNA methylation in¯uences the mammalian development (Costello and Plass, 2001; expression of unmethylated genes has not been exten- Li et al., 1992), imprinting (Li et al., 1993) and X sively studied. We analysed the methylation status of chromosome inactivation (Pfeifer et al., 1990). To date, CDKN2A and CDKN2D in human lung cancer cell lines four mammalian DNA methyltransferases (DNMT) and demonstrated that the CDKN2A CpG island is have been identi®ed (Bird and Wole, 1999). Disrup- methylated, whereas CDKN2D is unmethylated. Treat- tion of the balance in methylated DNA is a common ment of cells with 5-aza-2'-deoxycytidine (5-Aza-CdR), alteration in cancer (Costello et al., 2000; Costello and an inhibitor of DNA methyltransferase 1, induced a dose Plass, 2001; Issa et al., 1993; Robertson et al., 1999).
    [Show full text]
  • Efficacy of BRAF and MEK Inhibition in Patients with BRAF-Mutant
    cancers Communication Efficacy of BRAF and MEK Inhibition in Patients with BRAF-Mutant Advanced Melanoma and Germline CDKN2A Pathogenic Variants Francesco Spagnolo 1,†, Bruna Dalmasso 2,3,† , Enrica Tanda 1,3, Miriam Potrony 4,5 , Susana Puig 4,5 , Remco van Doorn 6, Ellen Kapiteijn 7 , Paola Queirolo 8, Hildur Helgadottir 9,‡ and Paola Ghiorzo 2,3,*,‡ 1 Medical Oncology 2, IRCCS Ospedale Policlinico San Martino, 16132 Genoa, Italy; [email protected] (F.S.); [email protected] (E.T.) 2 IRCCS Ospedale Policlinico San Martino, Genetics of Rare Cancers, 16132 Genoa, Italy; [email protected] 3 Genetics of Rare Cancers, Department of Internal Medicine and Medical Specialties, University of Genoa, 16132 Genoa, Italy 4 Melanoma Unit, Dermatology Department, Hospital Clinic de Barcelona, Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), Universitat de Barcelona, 08007 Barcelona, Spain; [email protected] (M.P.); [email protected] (S.P.) 5 Centro de Investigación Biomédica en Red (CIBER) de Enfermedades Raras, Instituto de Salud Carlos III, 08036 Barcelona, Spain 6 Department of Dermatology, Leiden University Medical Center, 2333 Leiden, The Netherlands; [email protected] 7 Department of Medical Oncology, Leiden University Medical Center, 2333 Leiden, The Netherlands; [email protected] Citation: Spagnolo, F.; Dalmasso, B.; 8 Melanoma, Sarcoma & Rare Tumors Division, European Institute of Oncology (IEO), 20141 Milan, Italy; Tanda, E.; Potrony, M.; Puig, S.; van [email protected] Doorn, R.; Kapiteijn, E.; Queirolo, P.; 9 Department of Oncology Pathology, Karolinska Institutet and Karolinska University Hospital Solna, Helgadottir, H.; Ghiorzo, P. Efficacy of 171 64 Stockholm, Sweden; [email protected] BRAF and MEK Inhibition in Patients * Correspondence: [email protected] with BRAF-Mutant Advanced † These authors contributed equally to this study.
    [Show full text]
  • Direct CDKN2 Modulation of CDK4 Alters Target Engagement of CDK4 Inhibitor Drugs Jennifer L
    Published OnlineFirst March 5, 2019; DOI: 10.1158/1535-7163.MCT-18-0755 Cancer Biology and Translational Studies Molecular Cancer Therapeutics Direct CDKN2 Modulation of CDK4 Alters Target Engagement of CDK4 Inhibitor Drugs Jennifer L. Green1, Eric S. Okerberg1, Josilyn Sejd1, Marta Palafox2, Laia Monserrat2, Senait Alemayehu1, Jiangyue Wu1, Maria Sykes1, Arwin Aban1, Violeta Serra2, and Tyzoon Nomanbhoy1 Abstract The interaction of a drug with its target is critical to achieve bition is not possible by traditional kinase assays. Here, we drug efficacy. In cases where cellular environment influences describe a chemo-proteomics approach that demonstrates target engagement, differences between individuals and cell high CDK4 target engagement by palbociclib in cells without types present a challenge for a priori prediction of drug efficacy. functional CDKN2A and attenuated target engagement when As such, characterization of environments conducive to CDKN2A (or related CDKN2/INK4 family proteins) is abun- achieving the desired pharmacologic outcome is warranted. dant. Analysis of biological sensitivity in engineered isogenic We recently reported that the clinical CDK4/6 inhibitor pal- cells with low or absent CDKN2A and of a panel of previously bociclib displays cell type–specific target engagement: Palbo- characterized cell lines indicates that high levels of CDKN2A ciclib engaged CDK4 in cells biologically sensitive to the drug, predict insensitivity to palbociclib, whereas low levels do not but not in biologically insensitive cells. Here, we report a correlate with sensitivity. Therefore, high CDKN2A may pro- molecular explanation for this phenomenon. Palbociclib tar- vide a useful biomarker to exclude patients from CDK4/6 get engagement is determined by the interaction of CDK4 with inhibitor therapy.
    [Show full text]
  • DNA Methylation and the Mechanisms of CDKN2A Inactivation in Transitional Cell Carcinoma of the Urinary Bladder Andrea R
    0023-6837/00/8010-1513$03.00/0 LABORATORY INVESTIGATION Vol. 80, No. 10, p. 1513, 2000 Copyright © 2000 by The United States and Canadian Academy of Pathology, Inc. Printed in U.S.A. DNA Methylation and the Mechanisms of CDKN2A Inactivation in Transitional Cell Carcinoma of the Urinary Bladder Andrea R. Florl, Knut H. Franke, Dieter Niederacher, Claus-Dieter Gerharz, Hans-Helge Seifert, and Wolfgang A. Schulz Urologische Klinik (ARF, KHF, H-HS, WAS), Frauenklinik (DN), and Institut für Pathologie (C-DG), Heinrich Heine Universität, Düsseldorf, Germany SUMMARY: Alterations of the CDKN2A locus on chromosome 9p21 encoding the p16INK4A cell cycle regulator and the p14ARF1 p53 activator proteins are frequently found in bladder cancer. Here, we present an analysis of 86 transitional cell carcinomas (TCC) to elucidate the mechanisms responsible for inactivation of this locus. Multiplex quantitative PCR analysis for five microsatellites around the locus showed that 34 tumors (39%) had loss of heterozygosity (LOH) generally encompassing the entire region. Of these, 17 tumors (20%) carried homozygous deletions of at least one CDKN2A exon and of flanking microsatellites, as detected by quantitative PCR. Analysis by restriction enzyme PCR and methylation-specific PCR showed that only three specimens, each with LOH across 9p21, had bona fide hypermethylation of the CDKN2A exon 1␣ CpG-island in the remaining allele. Like most other specimens, these three specimens displayed substantial genome-wide hypomethylation of DNA as reflected in the methylation status of LINE L1 sequences. The extent of DNA hypomethylation was significantly more pronounced in TCC with LOH and/or homozygous deletions at 9p21 than in those without (26% and 28%, respectively, on average, versus 11%, p Ͻ 0.0015).
    [Show full text]
  • Cdkn2a, the Cyclin-Dependent Kinase Inhibitor Encoding P16ink4a and P19arf, Is a Candidate for the Plasmacytoma Susceptibility Locus, Pctr1
    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 2429–2434, March 1998 Genetics Cdkn2a, the cyclin-dependent kinase inhibitor encoding p16INK4a and p19ARF, is a candidate for the plasmacytoma susceptibility locus, Pctr1 SHULING ZHANG,EDWARD S. RAMSAY, AND BEVERLY A. MOCK* Laboratory of Genetics, Division of Basic Sciences, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892-4255 Communicated by Michael Potter, National Institutes of Health, Bethesda, MD, December 24, 1997 (received for review November 17, 1997) ABSTRACT Plasma cell tumor induction in mice by cytoma susceptibilityyresistance locus resides. The protein pristane is under multigenic control. BALByc mice are sus- products of these genes bind to the CDKs CDK4 and CDK6 (6, ceptible to tumor development; whereas DBAy2 mice are 7), which, in turn, form complexes with the D-type G1 cyclins resistant. Restriction fragment length polymorphisms be- that phosphorylate pRb to control both cell cycle and tumor tween BALByc and DBAy2 for Cdkn2a(p16) and Cdkn2b(p15), suppression (8, 9). We compared the sequences of p16 and p18 and between BALByc and Mus spretus for Cdkn2c(p18INK4c) between susceptible (BALByc) and resistant (DBAy2N) were used to position these loci with respect to the Pctr1 locus. strains of mice, and found sequence variants in p16 located in These cyclin-dependent kinase (CDK) inhibitors mapped to a two different ankyrin repeat regions of the gene. DBAy2 (wild 6 cM interval of chromosome 4 between Ifna and Tal1. type) and BALByc A134C and G232A variants of the p16 C.D2-Chr 4 congenic strains harboring DBAy2 alleles asso- genes were fused to the glutathione S-transferase (GST) gene, ciated with the Pctr1 locus contained DBAy2 ‘‘resistant’’ and purified GST fusion proteins were tested for their ability alleles of the CDK4yCDK6 inhibitors p16 and p15.
    [Show full text]
  • CDKN2A Mutation and Deletion Status in Thin and Thick Primary Melanoma1
    Vol. 6, 3511–3515, September 2000 Clinical Cancer Research 3511 CDKN2A Mutation and Deletion Status in Thin and Thick Primary Melanoma1 Adrian R. Cachia,2,3 James O. Indsto,2 involved in the progression rather than initiation of sporadic Kathryn M. McLaren, Graham J. Mann, and malignant melanoma. Mark J. Arends INTRODUCTION Department of Tissue and Cell Pathology, Institute of Clinical Pathology and Medical Research, Westmead Hospital, Westmead, The incidence of malignant melanoma is rising in devel- New South Wales 2145, Australia [A. R. C.]; Westmead Institute for oped countries. Investigations of potential tumor suppressor Cancer Research, University of Sydney at Westmead Hospital, genes involved in melanoma formation have shown either hem- Westmead, New South Wales 2145, Australia [J. O. I., G. J. M.]; izygosity or LOH4 for DNA markers within chromosome 9p21 Department of Pathology, University Medical School, Teviot Place, in 34–86% of melanoma cell lines and tumors examined by Edinburgh EH8 9AG, Scotland [K. M. M.]; and Molecular several authors (1–7). Histopathology, University of Cambridge Department of Pathology, Addenbrooke’s Hospital, Cambridge CB2 2QQ, United Kingdom One gene within this deleted region is CDKN2A, which can [M. J. A.] produce two independent transcripts through the alternate splic- ing of a separate exon 1. One transcript encodes the cdk inhib- itor protein, p16INK4A (p16). The p16 protein binds to and ABSTRACT blocks the catalytic activity of two cyclin D-bound, cdks, cdk4 Human melanoma cell lines and tumor tissue from and cdk6. cdk4 is able to phosphorylate the retinoblastoma familial and sporadic melanomas have frequent, nonrandom (pRb) protein, leading to the release of associated proteins that chromosomal breaks and deletions on chromosome 9p21, a activate genes necessary for progression from the G1 to the region that includes the tumor suppressor gene CDKN2A/ S-phase of the cell cycle.
    [Show full text]
  • Aberrations of the P53 Pathway Components P53, MDM2 And
    Leukemia (1999) 13, 453–459 1999 Stockton Press All rights reserved 0887-6924/99 $12.00 http://www.stockton-press.co.uk/leu Aberrations of the p53 pathway components p53, MDM2 and CDKN2A appear independent in diffuse large B cell lymphoma MB Møller1, Y Ino2, A-M Gerdes3, K Skjødt4, DN Louis2 and NT Pedersen1 Departments of 1Pathology, 3Clinical Genetics, and 4Medical Microbiology, Odense University, Denmark; and 2Molecular Neuro-Oncology Laboratory, Department of Pathology (Neuropathology) and Neurosurgical Service, Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA The two gene products of the CDKN2A gene, p16 and p19ARF, ways together through the 9p21 locus.5,6 In this locus resides have recently been linked to each of two major tumour sup- two cyclin-dependent kinase inhibitor genes, CDKN2A and pressor pathways in human carcinogenesis, the RB1 pathway CDKN2B. The CDKN2A gene has the rare ability to encode and the p53 pathway. p16 inhibits the phosphorylation of the ARF retinoblastoma gene product by cyclin D-dependent kinases, two different proteins, p16 and p19 . This is due to the whereas p19ARF targets MDM2, a p53 inhibitory protein, for unusual organisation of the gene with two alternative first degradation. A deletion of CDKN2A would therefore disturb exons, exon 1␣ and exon 1␤, and common exons 2 and 3.7,8 both pathways. To explore the p53 pathway genes as a func- Because they are translated in different reading frames p16 tional unit in diffuse large B cell non-Hodgkin’s lymphomas and p19ARF are structurally unrelated. Despite this difference (DLCL), we wanted to see whether there exists mutually exclus- iveness of aberrations of CDKN2A, MDM2 and p53, since this both can arrest the cell cycle in G1, albeit through different has not been analysed previously.
    [Show full text]
  • The Role of Fos and Junb in the Reprogramming of Acute Myeloid Leukemia Cells
    Dickinson College Dickinson Scholar Student Honors Theses By Year Student Honors Theses 5-19-2019 The Role of Fos and JunB in the Reprogramming of Acute Myeloid Leukemia Cells Kayla Bendinelli Dickinson College Follow this and additional works at: https://scholar.dickinson.edu/student_honors Part of the Cell Biology Commons, and the Molecular Biology Commons Recommended Citation Bendinelli, Kayla, "The Role of Fos and JunB in the Reprogramming of Acute Myeloid Leukemia Cells" (2019). Dickinson College Honors Theses. Paper 321. This Honors Thesis is brought to you for free and open access by Dickinson Scholar. It has been accepted for inclusion by an authorized administrator. For more information, please contact [email protected]. 1 The role of Fos and JunB in the reprogramming of Acute Myeloid Leukemia Cells Kayla Bendinelli Submitted in partial fulfillment of the Biochemistry and Molecular Biology Honors Requirement Dr. Michael Roberts, Advisor, Committee Chair Dr. Rebecca Connor, Reader Dr. Dana Somers, Reader May 8, 2019 2 The role of Fos and JunB in the reprogramming of Acute Myeloid Leukemia cells Acute Myeloid Leukemia (AML) is the most common form of leukemia in adults and while it has a high remission rate, relapse with therapy resistance is common, indicating the need for more targeted and effective therapies. It is possible to reprogram AML cells in culture to undergo cell cycle arrest, differentiation into “normal” macrophage-like cells, and apoptosis using phorbol 12-myristate 13-acetate (PMA), a diacyl glycerol (DAG) mimic. While this is effective in “curing” leukemia in culture, PMA is too toxic to serve as a therapy in AML patients.
    [Show full text]
  • HKR3 Regulates Cell Cycle Through the Inhibition of Htert In
    Journal of Cancer 2020, Vol. 11 2442 Ivyspring International Publisher Journal of Cancer 2020; 11(9): 2442-2452. doi: 10.7150/jca.39380 Research Paper HKR3 regulates cell cycle through the inhibition of hTERT in hepatocellular carcinoma cell lines Sung Hoon Choi1, Kyung Joo Cho1,2, Sung Ho Yun3, Bora Jin1,2, Ha Young Lee3,4, Simon W Ro 1,5, Do Young Kim1,5, Sang Hoon Ahn1,2,5, Kwang-hyub Han1,3,5, Jun Yong Park1,2,5 1. Yonsei Liver Center, Yonsei University College of Medicine, Seoul, Republic of Korea 2. BK21 plus project for medical science, Yonsei University College of Medicine, Seoul, Republic of Korea 3. Division of Bioconvergence Analysis, Drug & Disease Target Team, Korea Basic Science Institute (KBSI), Cheongju, Republic of Korea 4. Bio-Analysis Science, University of Science & Technology (UST), 217 Gajeong-ro, Yuseong-gu, Daejeon, Republic of Korea 5. Department of Internal Medicine, Institute of Gastroenterology, Yonsei University College of Medicine, Seoul, Republic of Korea Corresponding author: Department of Internal Medicine, Institute of Gastroenterology, Yonsei University College of Medicine, 50-1 Yonsei-ro, Seodaemun-gu, Seoul 03722, Korea. Phone: 82-2-2228-1988; Fax: 82-2-393-6884; E-mail: [email protected] © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2019.08.16; Accepted: 2020.01.20; Published: 2020.02.10 Abstract Hepatocellular carcinoma is a malignant disease with improved hepatic regeneration and survival, and is activated by human telomere transferase (hTERT).
    [Show full text]
  • Analysis of the CDKN2A, CDKN2B and CDK4 Genes in 48 Australian Melanoma Kindreds
    Oncogene (1997) 15, 2999 ± 3005 1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00 SHORT REPORT Analysis of the CDKN2A, CDKN2B and CDK4 genes in 48 Australian melanoma kindreds Jose F Flores1, Pamela M Pollock2, Graeme J Walker1,2, J Michael Glendening1, Amy H-T Lin1, Jane M Palmer2, Marilyn K Walters2, Nicholas K Hayward2 and Jane W Fountain1 1University of Southern California, Institute for Genetic Medical, Department of Biochemistry and Molecular Biology, 2011 Zonal Ave (HMR601), Los Angeles, CA, 90033, USA; 2Queensland Cancer Fund Research Unit, Queensland Institute of Medical Research, Herston, 4029, Australia Germline mutations within the cyclin-dependent kinase 1994, 1996; Walker et al., 1994; Luca et al., 1995; inhibitor 2A (CDKN2A) gene and one of its targets, the Platz et al., 1996; Flores et al., 1996) and is genetically cyclin dependent kinase 4 (CDK4) gene, have been linked to familial melanoma (Cannon-Albright et al., identi®ed in a proportion of melanoma kindreds. In the 1992; Nancarrow et al., 1993; Gruis et al., 1993, case of CDK4, only one speci®c mutation, resulting in the 1995a; Goldstein et al., 1994; MacGeoch et al., 1994; substitution of a cysteine for an arginine at codon 24 Holland et al., 1995). p16 is a pivotal cell cycle (R24C), has been found to be associated with melanoma. regulator that binds to the cyclin-dependent kinases 4 We have previously reported the identi®cation of germline (CDK4) and 6 (CDK6) and inhibits their ability to CDKN2A mutations in 7/18 Australian melanoma phosphorylate the retinoblastoma protein (pRb) kindreds and the absence of the R24C CDK4 mutation (Serrano et al., 1993).
    [Show full text]