Molecular Biology, Vol. 36, No. 5, 2002, pp. 625–630. Translated from Molekulyarnaya Biologiya, Vol. 36, No. 5, 2002, pp. 777–783. Original Russian Text Copyright © 2002 by Babenko, Zemlyakova, Saakyan, Brovkina, Strelnikov, Zaletaev, Nemtsova. GENOMICS. TRANSCRIPTOMICS. PROTEOMICS UDC 577.218 RB1 and CDKN2A Functional Defects Resulting in Retinoblastoma O. V. Babenko1, V. V. Zemlyakova1, S. V. Saakyan2, A. F. Brovkina2, V. V. Strelnikov1, D. V. Zaletaev1, and M. V. Nemtsova1 1 Medical Genetic Research Center, Russian Academy of Medical Sciences, Moscow, 115478 Russia: E-mail: [email protected] 2 Moscow Institute of Eye Diseases, Ministry of Health of the Russian Federation, Moscow, 103064 Russia Received October 25, 2001 Abstract—Multiplex methylation-sensitive PCR was employed in studying the methylation of the RB1 and CDKN2A/p16 promoter regions in 52 retinoblastomas. Aberrant methylation inactivating RB1 was detected in 14 (27%) tumors. Methylation of p16 was for the first time observed in retinoblastoma (9 tumors, 17%). Both promoters proved to be methylated in two tumors. In four tumors, aberrant methylation was combined with structural defects of both RB1 alleles. Aberrant methylation of the p16 promoter was the second mutation event in two tumors and was not accompanied by RB1 defects in one tumor. Complex testing for RB1 mutations, loss of heterozygosity, and functional inactivation of the two genes revealed molecular defects in at least one allele in 51 (98%) tumors. Key words: retinoblastoma, RB1, CDKN2A/p16, promoter region, CpG methylation, methylation-sensitive PCR INTRODUCTION tural organization of chromatin and in regulation of the gene functional activity [4]. The role of genetic factors in carcinogenesis in now beyond doubt. As shown by numerous studies, By now, ample data have been accumulated on the malignant cells arise upon structural alterations of role of epigenetic events, including disturbed DNA certain genes. Increasing importance is also attached methylation, in carcinogenesis [1, 5]. Methylation dis- to epigenetic gene regulation, whereby the expression balance has been observed in virtually all types of of a gene is altered without changes in its nucleotide neoplastic cells. The average genome methylation is sequence [1]. An example is DNA methylation, i.e., low (hypomethylated are single CpG dinucleotides enzymatic addition of the methyl group to C5 of the scattered through the genome), while hypermethyla- pyrimidine ring in cytosine. Only cytosines in CpG tion occurs in CpG islands located in the promoter dinucleotides are thus methylated. The modification is regions of several genes involved in controlling the stable and heritable, although demethylating agents or cell cycle, differentiation, and apoptosis [4, 6]. In car- enzymes may cause reversion. cinogenesis, substantial changes in DNA methylation are maintained through tumor cell generations and, DNA methylation plays an important role in regu- what is more, progressively extend to other genes. lating the mammalian genome and underlies such bio- This problem has received increasing attention in logical phenomena as inactivation of the X chromo- recent years. Methylation of CpG islands in the pro- some, monoallelic expression in imprinting, and sup- moter region and subsequent gene inactivation have pression of foreign DNA (e.g., methylation of been demonstrated for numerous tumor suppressor, transposons suppresses their transcriptional activity metastasis-associated, and DNA repair genes [7]. In and protects the host cell) [1, 3]. Methylation and certain tumors, aberrant methylation involves several demethylation alternate in a regular fashion during genes to produce a certain methylation profile, which may serve as a marker of malignancy and may corre- embryo development, resulting in a strictly specified late with disease severity, rapid metastatic spread, or methylation profile of individual genes and the whole with resistance to chemo- and radiotherapy [1, 8]. genome. Normally, the profile is maintained stable through generations of a given somatic cell lineage. In The contribution of DNA methylation to carcino- the mature organism, methylation substantially affects genesis is not restricted to the epigenetic effect. Being DNA–protein interactions without changing the unstable, 5-methylcytosine may be spontaneously genetic information, and thereby participates in struc- deaminated to yield thymine (about 30% point muta- 0026-8933/02/3605-0625 $27.00 © 2002 MAIK “Nauka /Interperiodica” 626 BABENKO et al. tions), which is unrecognizable for repair systems. RESULTS AND DISCUSSION The resulting ë í transition may change the struc- Detection of Aberrant Methylation ture and function of the corresponding protein [9]. in the RB1 Promoter Region As a process inactivating tumor suppressor genes, Along with structural mutations and loss of het- methylation has first been described for RB1 [10]. erozygosity, methylation of the promoter region and Methylation of the RB1 promoter is involved in subsequent gene inactivation initiate carcinogenesis. Epigenetic alterations have been found to inactivate retinoblastoma development [10–12]. The normal various genes in tumor cells. For example, aberrant function of RB1 is essential for the cell-cycle control. methylation is the major inactivation mechanism of However, rather than acting alone, RB1 is functionally p16 in lung carcinoma and in various leukemias. The associated with other suppressor genes and protoon- gene for E-cadherin, which is involved in cell-to-cell cogenes, which code for modifiers of the RB1 activity. contacts, is methylated in mammary and bladder car- cinomas. MLH1, which participates in repair of Nuclear protein p16/CDKN2A inhibits cyclin- unpaired DNA, is methylated in almost all colorectal dependent kinases (CDK4/6) and prevents their com- carcinomas associated with microsatellite instability. plexation with cyclins D, which phosphorylate and The estrogen receptor gene (ER) is aberrantly methy- thereby inactivate RB1 to release transcription factor lated in 20–30% mammary carcinomas and in 60– E2F from its complex with RB1. As a result, E2F is 70% acute leukemias. The promoter region of the activated, transcription of various cell genes transcription factor WT1 gene is methylated in 90% enhanced, and the cell proceeds to the S phase. Inhibi- mammary carcinomas, 50% colorectal carcinomas, tion of cyclin-dependent kinases by p16 is the best- and in 10% Wilms tumors [17]. studied mechanism controlling the RB1 activity in the Methylation of the RB1 promoter leads to retino- cell [13]. blastoma [12, 18, 19]. We tested 52 tumors for this alteration by means of MS-PCR. The gist of the tech- In this work, we studied the methylation of the RB1 nique is selective hydrolysis of DNA sites containing and p16/CDKN2A promoter regions in 52 retinoblas- 5-methylcytosine with methylation-sensitive restric- toma specimens, and determined the spectrum of tion enzymes. DNA regions devoid of modified molecular defects leading to tumorigenesis. cytosines are cleaved, and subsequent PCR yields no product. When 5-methylcytosine is in the recognition site of a restriction enzyme, the region is not cleaved, EXPERIMENTAL and a PCR product of a certain size can be detected in the gel. The method is highly sensitive and allows Tumor specimens were obtained from patients detection of rare methylated alleles in the presence of with various forms of retinoblastoma, who were sub- excess wild-type alleles. The GC-rich RB1 promoter jected to surgery in the Oncoophthalmological fragment under study contains four HpaII (CCGG) Department, Moscow Institute of Eye Diseases. and four HhaI (CGCG) sites. MS-PCR revealed RB1 Genomic DNA was isolated from the surgery material promoter methylation in 14 (27%) tumors. Methyla- and from peripheral blood lymphocytes according to tion was combined with loss of heterozygosity in ten the standard protocol [14]. tumors and with RB1 mutations in three tumors. No RB1 defects other than methylation were found in one Methylation of CG-rich promoter regions of RB1 tumor. and p16 was probed by methylation-sensitive PCR The RB1 promoter region has 27 CpG dinucle- (MS-PCR). Genomic DNA (1 µg) was digested with otides, which can be methylated throughout the CpG 10 units of HpaII in 10 µl of the reaction mixture overnight. island to produce a specimen-specific pattern [19]. The product (150 ng) was amplified in multiplex PCR [15] The number of methylated cytosines is not associated with primers prRBF (CTGGACCCACGCCAGGTTTC), with the extent of gene inactivation [20]. Methylation prRBR (ATTGGTACCCGACTCCCGTTACAAAAT), mostly occurs in sporadic retinoblastoma (10–15% pr16F (AGCCAGCCCCTCCTCTTTCTTC), and pr16R tumors) [21] and is less frequent (6–9%) in congenital retinoblastoma [18, 22]. In addition to aberrant meth- (GAACGCACTCAAACACGC). For a positive internal ylation of the promoter, methylated cytosines have control of amplification, multiplex PCR was run been found in CGA codons of exons 8 and 14. The with primers Ext2-8F (TCTAGTTTTCCCACTCT- resulting ë í transition yields the TGA stop GTCTC) and Ext2-8R (TTCCTTCCACCCACCCT- codon and leads to premature termination of RB1 syn- GAC), which are directed to EXT2 exon 8 lacking the thesis [20]. This mechanism has not been observed for HpaII site. The amplification product was resolved in other RB1 regions containing CGA codons, suggest- 8% PAG and silver stained [16] or in 2% agarose gel ing that methylation of individual CpG in exons and stained with