DOCSLIB.ORG

Two Human Homeobox Genes, Cl and C8

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Proc. Natl. Acad. Sci. USA Vol. 84, pp. 4914-4918, July 1987 Developmental Biology Two human homeobox genes, cl and c8: Structure analysis and expression in embryonic development ANTONIO SIMEONE*, FULVIO MAVILIOt, DARIO ACAMPORA*, ADELE GIAMPAOLOt, ANTONIO FAIELLA*, VINCENZO ZAPPAVIGNAt, MAURIZIo D'EsPosITO*, MARIA PANNESE*, GIOVANNI Russot, EDOARDO BONCINELLI*, AND CESARE PESCHLEt§ *International Institute of Genetics and Biophysics, Via Marconi 10, 80125 Naples, Italy; tDepartment of Hematology, Istituto Superiore di Saniti, Viale Regina Elena 299, 00161 Rome, Italy; and tDivision of Obstetrics and Gynecology, Ospedale di Avellino, 83100 Avellino, Italy Communicated by Frank H. Ruddle, April 14, 1987 (received for review February 18, 1987) ABSTRACT Two human cDNA clones (HHO.cl.95 and scripts, respectively, which are differentially expressed in a HHO.c8.5111) containing a homeobox region have been charac- variety of organs or body parts at 5 to 9 weeks of embryon- terized, and the respective genomic regions have been partially ic/fetal development. analyzed. Expression of the corresponding genes, termed cl and c8, was evaluated in different organs and body parts during METHODS human embryonic/fetal development. HHO.cl.95 apparently Human Embryos and Fetuses. Human embryos and early encodes a 217-amino acid protein containing a class I fetuses were obtained virtually intact from legal curettage homeodomain that shares 60 out of 61 amino acid residues with abortions and were maintained in sterile culture medium at the Antennapedia homeodomain of Drosophila melanogaster. +40C until processing (26). The age of embryos (5-8 weeks) HHO.c8.5111 encodes a 153-amino acid protein containing a was carefully established by morphologic staging according homeodomain identical to that of the frog ACI gene. Clones to multiple criteria (dating error was ± 2 days) (27, 28). Early HHO.cl and HHO.c8 detect by blot-hybridization one and two fetuses (9 weeks) were staged on the basis of standard specific polyadenylylated transcripts, respectively. These are age/crown-rump length plots. Different organs or body parts differentially expressed in spinal cord, backbone rudiments, limb were dissected under an inverted microscope and were stored buds (or limbs), heart, and skin of human embros and early in liquid nitrogen until analyzed. fetuses in the 5- to 9-week postfertilization period, thus suggesting cDNA Clones. Recombinant clones (8 x 105) of a cDNA that the cl and c8 genes play a key role in a variety of library prepared from poly(A)+ RNA of SV40-transformed developmental processes. Together, the results of the human fibroblasts (29) were originally screened with a 600-bp embryonic/fetal expression of cl and c8 and those of two BamHI-Pvu II fragment of clone 903 (4, 30) containing the previously analyzed genes (cdO and c13) indicate a coherent entire Antp homeobox region or a 1050-bp Pvu II fragment pattern of expression of these genes in early human ontogeny. containing the homeobox and the 3' region of theftz gene (4), both labeled to a high specific activity by nick-translation In the fruitfly Drosophila melanogaster, studies on develop- (31). Clones (2.5 x 105) of the same cDNA library were mental mutants have allowed the identification of a number subsequently screened with the insert of clone HHO.cl or of genes controlling morphogenesis, which are classified in HHO.c8 under stringent conditions. Recombinant positive three general groups: (i) maternal-effect genes, which specify clones were isolated, and the longest inserts (HHO.cl.95, the structure and spatial coordinates of the egg, (it) segmen- HHO.c8.5111) were characterized by restriction endonucle- tation genes, which determine the number and polarity of ase mapping and were sequenced (32). body segments, and (iii) homeotic genes, which specify the RNA and DNA Analysis. Total RNA was extracted from identity of each segment (reviewed in ref. 1). Most homeotic fresh or frozen samples by the guanidinium isothiocyanate genes identified so far are clustered in the Antennapedia technique and was selected for poly(A)+ RNA by one passage (Antp-C) and the bithorax (bx-C) complex (2, 3). Cloning of on an oligo(dT)-ceilulose column (33, 34). Ten micrograms of some of these genes has led to the identification of a total RNA or 2-3 pug of poly(A)+ RNA was electrophoresed 183-base-pair (bp) sequence, termed the homeobox, which is on a 1.0% agarose/formaldehyde gel, blotted on nitrocellu- contained in most segmentation and homeotic genes and lose or nylon membranes, and hybridized to 107 cpm ofDNA encodes a highly conserved protein domain (4, 5). Homeo- probe labeled by nick-translation to a specific activity of 3 X box-containing genes have also been cloned from sea urchin 108 to 8 x 108 dpm per Ag (31). The blots were washed under (6), frog (7-9), mouse (10-20), and human (21, 22); however, stringent conditions (cf. ref. 25). Probes were then removed direct evidence for their regulatory role in development is still by boiling in a 0.1% NaDodSO4 buffered solution, and the unavailable (cf. ref. 23). filters were rehybridized to a chicken .8-actin probe for We have reported the isolation of human cDNA clones, normalization (see refs. 24 and 25). Southern analysis was termed HHO.cl, HHO.c8, HHO.c1O, and HHO.c13, con- performed according to standard techniques (31). taining homeobox sequences that appear to represent tran- scripts from four different genes (22). HHO.c1O (24) and RESULTS AND DISCUSSION HHO.c13 (25) contain a conserved class I homeobox and The nucleotide sequence of HHO.cl.95 is shown in Fig. lA. detect by blot hybridization specific transcripts during human Conceptual translation of its longest open reading frame, embryogenesis. We report here the characterization ofclones starting from the ATG codon at position 100, produces a HHO.cl.95 and HHO.c8.5111 and part of the corresponding peptide sequence of 217-amino acid residues that contains a genomic regions. HHO.cl and HHO.c8 detect by blot hy- class I homeodomain. The carboxyl-terminus of this protein bridization one and two specific polyadenylylated tran- lies 20-amino acid residues downstream from the homeodo- main and ends in a row of six glutamic acid residues. A 609-bp The publication costs of this article were defrayed in part by page charge 3'-untranslated region contains a polyadenylylation signal payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. §To whom reprint requests should be addressed. 4914 Developmental Biology: Simeone et al. Proc. Natl. Acad. Sci. USA 84 (1987) 4915 (AATAAA) 20 nucleotides upstream from the poly(A) tail. A HHO.c1.95 contains a second open reading frame, which putative glycosylation site (Asn-Xaa-Thr) is present at the might ehcode a 156-amino acid protein, starting from the 60th amino acid residue of the homeodomain (Fig. LA), as is methionine codon at position 116 through a TGA codon at found in the Antp homeodomain (23). The original clone position 584 (halfway through the homeobox). Further anal- HHO.cl is identical to HHO.c1.95 at positions 450-1359. A TTAMCCCCCAGCACGATGCACGACCAGGGCTTGACCTTGCCAGCTGCACATGCCTCCGCCCGTCCTCTCTCCCA 75 A CGTTTTCGTCTAAATCTGC.ACTCTAATTCTGTAATATATCAAGCAATCTCCTAAA 55 GCCTCTTCCTCCTGCCCCCTTCTTCCAMCTCTCCTTAATTTTCTTTCCCTTTTCCATCATTATMTTATTTTTATTTTT 156 Met Ser Ser Leu Tyr Tyr Ala Aan Ala ACCGACACTMAACGTCCCTGCCTACAAATCATCCGCCCAAATTATG ACT TCA TTC TAT TAT (CG AAT GCT 126 A GMTTTATATAMACTATATCTGTCGTCGTCTCCASCTCAGACAGCTCCCCAGCCGCACAGMTCACSCAACGACCACM 233 10 20 Leu Phe Ser Lys Tyr Pro Ala Ser Ser Ser Val Phe Ala Thr Cly Ala Phe Pro Glu GIn -7- TTA TTT TCT MA TAT CCA CCC TCA ACT TCG CTT TTC GCT ACC CGA GCC TTC CCA GAA CAA 186 30 40 Thr Ser Cys Ala Phe Ala Ser Asn Pro Gln Arg Pro Gly Tyr Gly Ala Gly Ser Gly Ala TCMTTCCACCCCCTATCATCCACTCAGGCATTTCTCCACCTATGCACCGCCCGTCCCCCAaAACCC(CATCTACTCCAC 391 ACT TCT TGT GCC TTT GCT TCC MC CCC CAG CCC CCG GCC TAT CGA GCG CGT TCG GGC GCT 246 A 50 60 TCCCTTTTATTCCCCACACCACMTGTCCTGTTCAGTTCCACCCGCGCCCCCTATCACTATGCATCTAATTCCTTTTAC 470 Ser Phe Ala Ala Ser cet Gln Gly Leo Tyr Pro Gly Gly Gly Gly Met Ala Cly Gln Ser A TCC TTC GCC GCC TCG ATG CAG GGC TTC TAC CCC CGC GCC CGG GGC ATG GCG CAG ACC 10 GCC 306 Cys Arg Thr His Thr Thr A Met Leu Ser Asn Gln Acn Leu Cly Asn Gln Ser 70 80 CAGCACGAAGACATG CTC TCA MC TCC ACA CAA AAC ACC TTA SCA CAT MC ACA CAC ACC TCA 533 Ala Ala Gly Val Tyr Ala Ala Gly Tyr Gly Leu Glu Pro Ser Ser Phe Asn Met His Cys GCG GCC GGC GTC TAC GCC CCC CCC TAT GGG CTC GAG CCC ACT TCC TIC MC ATG CAC TCC 366 20 30 Ile Ala Gln Asp Phe Ser Ser Glu GSn Gly Arg Thr Ala Pro Gln Asp Gln Lys Ala Ser 90 100 ATC GCT CAG GAT TTT ACT TCT GAG CAG GGC AGG ACT GCG CCC CAG GAC CAG AM GCC AGT 593 Ala Pro Phe clu Gln Asn Leu Ser Sly Val Cys Pro Sly Ser Ala Lys Ala Ala Sly Acp 7 GCG CCC TmT GAG CAG MC CTC TCC GGG GTG TGT CCC GCC SAC TCC GCC MG GCG GCG GCC 426 40 S0 Ile Gln Ile Tyr Pro Trp Met Gln Arg Met Asn Ser His Ser Gly Val Gly Tyr Gly Ala 110 120 ATC CAG ATT TAC CCC TCC ATG CAC CGA ATG MT TCG CAC AGT GGG CTC GGC TAC GSA GCC 653 Ala Lys Glu Sln Arg Asp Ser Asp Leoi Ala Ala Clu Ser Acn Ile Tyr Pro Trp Phe Arg 60 70 GCC MS GAG CAG AGG GAC TCG SAC TTC GCG CCC GAG ACT MC TTC CGC ATC TAC CCC TCG 486 Asp Fr Arg Arg Gly Arg Cln Ile Tyr Ser Arg Tyr Gln Thr Leu Glu Leu Glu Lys Glu CAC CGC ASS CCC CGC CCC CAC ATC TAC TCC CCG TAC CAG ACC CTG GM CTG GAG MG GM 713 130 7 'A Met Arg Ser Ser Gly Thr Asp SrgLys Arg Gly Arg Gln Thr Tyr Thr Arg Tyr Gln Thr 80 90 ATG CGA ASC TCA GGA ACT GAC
Recommended publications
  • Functional Analysis of the Homeobox Gene Tur-2 During Mouse Embryogenesis

    Functional Analysis of the Homeobox Gene Tur-2 During Mouse Embryogenesis

    Functional Analysis of The Homeobox Gene Tur-2 During Mouse Embryogenesis Shao Jun Tang A thesis submitted in conformity with the requirements for the Degree of Doctor of Philosophy Graduate Department of Molecular and Medical Genetics University of Toronto March, 1998 Copyright by Shao Jun Tang (1998) National Library Bibriothèque nationale du Canada Acquisitions and Acquisitions et Bibiiographic Services seMces bibliographiques 395 Wellington Street 395, rue Weifington OtbawaON K1AW OttawaON KYAON4 Canada Canada The author has granted a non- L'auteur a accordé une licence non exclusive licence alIowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distri%uteor sell reproduire, prêter' distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique. The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. Functional Analysis of The Homeobox Gene TLr-2 During Mouse Embryogenesis Doctor of Philosophy (1998) Shao Jun Tang Graduate Department of Moiecular and Medicd Genetics University of Toronto Abstract This thesis describes the clonhg of the TLx-2 homeobox gene, the determination of its developmental expression, the characterization of its fiuiction in mouse mesodem and penpheral nervous system (PNS) developrnent, the regulation of nx-2 expression in the early mouse embryo by BMP signalling, and the modulation of the function of nX-2 protein by the 14-3-3 signalling protein during neural development.
  • Visualizing Morphogenesis with the Processing Programming Language 15

    Visualizing Morphogenesis with the Processing Programming Language 15

    Visualizing Morphogenesis with the Processing Programming Language 15 Visualizing Morphogenesis with the Processing Programming Language Avik Patel, Amar Bains, Richard Millet, and Tamira Elul changing tissue shapes. A powerful technique for elucidating the We used Processing, a visual artists’ programming dynamic cellular mechanisms of morphogenesis is time-lapse video- language developed at MIT Media Lab, to simulate microscopic imaging of cells in embryonic tissues undergoing cellular mechanisms of morphogenesis – the generation morphogenesis (Elul and Keller 2000; Elul et al., 1997; Harris et al., of form and shape in embryonic tissues. Based on 1987). The mechanisms underlying morphogenetic processes can be clarified by observation of cell dynamics from these time-lapse video observations of in vivo time-lapse image sequences, we sequences. Morphometric measurement further defines the created animations of neural cell motility responsible for quantitative and statistical relationships between the cell dynamics that elongating the spinal cord, and of optic axon branching underlie morphogenesis (Kim and Davidson 2011; Marshak et al., dynamics that establish primary visual connectivity. 2007; Elul et al., 1997; Witte et al., 1996). Mathematical These visual models underscore the significance of the decomposition of cell dynamics additionally facilitates the computational decomposition of cellular dynamics computational modeling of cellular mechanisms that drive underlying morphogenesis. morphogenesis (Satulovsky et al., 2008). Methods In this paper, we use the Processing programming language to visualize dynamic cell behaviors driving morphogenesis in the Introduction developing nervous system. Based on in vivo time-lapse image sequences, we created models of cell dynamics underlying two Processing is a Java based software language and environment morphogenetic processes in the developing nervous system.
  • Transformations of Lamarckism Vienna Series in Theoretical Biology Gerd B

    Transformations of Lamarckism Vienna Series in Theoretical Biology Gerd B

    Transformations of Lamarckism Vienna Series in Theoretical Biology Gerd B. M ü ller, G ü nter P. Wagner, and Werner Callebaut, editors The Evolution of Cognition , edited by Cecilia Heyes and Ludwig Huber, 2000 Origination of Organismal Form: Beyond the Gene in Development and Evolutionary Biology , edited by Gerd B. M ü ller and Stuart A. Newman, 2003 Environment, Development, and Evolution: Toward a Synthesis , edited by Brian K. Hall, Roy D. Pearson, and Gerd B. M ü ller, 2004 Evolution of Communication Systems: A Comparative Approach , edited by D. Kimbrough Oller and Ulrike Griebel, 2004 Modularity: Understanding the Development and Evolution of Natural Complex Systems , edited by Werner Callebaut and Diego Rasskin-Gutman, 2005 Compositional Evolution: The Impact of Sex, Symbiosis, and Modularity on the Gradualist Framework of Evolution , by Richard A. Watson, 2006 Biological Emergences: Evolution by Natural Experiment , by Robert G. B. Reid, 2007 Modeling Biology: Structure, Behaviors, Evolution , edited by Manfred D. Laubichler and Gerd B. M ü ller, 2007 Evolution of Communicative Flexibility: Complexity, Creativity, and Adaptability in Human and Animal Communication , edited by Kimbrough D. Oller and Ulrike Griebel, 2008 Functions in Biological and Artifi cial Worlds: Comparative Philosophical Perspectives , edited by Ulrich Krohs and Peter Kroes, 2009 Cognitive Biology: Evolutionary and Developmental Perspectives on Mind, Brain, and Behavior , edited by Luca Tommasi, Mary A. Peterson, and Lynn Nadel, 2009 Innovation in Cultural Systems: Contributions from Evolutionary Anthropology , edited by Michael J. O ’ Brien and Stephen J. Shennan, 2010 The Major Transitions in Evolution Revisited , edited by Brett Calcott and Kim Sterelny, 2011 Transformations of Lamarckism: From Subtle Fluids to Molecular Biology , edited by Snait B.
  • An Ontogenetic Switch Drives the Positive and Negative Selection of B Cells

    An Ontogenetic Switch Drives the Positive and Negative Selection of B Cells

    An ontogenetic switch drives the positive and negative selection of B cells Xijin Xua, Mukta Deobagkar-Lelea, Katherine R. Bulla, Tanya L. Crockforda, Adam J. Meadb, Adam P. Cribbsc, David Simsc, Consuelo Anzilottia, and Richard J. Cornalla,1 aMedical Research Council Human Immunology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, OX3 9DS Oxford, United Kingdom; bMedical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, OX3 9DS Oxford, United Kingdom; and cMedical Research Council, Weatherall Institute of Molecular Medicine, Centre for Computational Biology, Weatherall Institute of Molecular Medicine, University of Oxford, OX3 9DS Oxford, United Kingdom Edited by Michael Reth, University of Freiburg, Freiburg, Germany, and approved January 6, 2020 (received for review September 3, 2019) + Developing B cells can be positively or negatively selected by self- BM HSCs increased CD5 B-1a B cell development (15), while antigens, but the mechanisms that determine these outcomes are expression of let-7b in FL pro-B cells blocked the development of incompletely understood. Here, we show that a B cell intrinsic B-1 B cells (17). These findings support the notion of hard-wired switch between positive and negative selection during ontogeny differences during ontogeny, but possibly downstream of the HSC is determined by a change from Lin28b to let-7 gene expression. commitment stage. Ectopic expression of a Lin28b transgene in murine B cells restored Several lines of evidence also suggest that B-1 B cells can un- the positive selection of autoreactive B-1 B cells by self-antigen in dergo positive selection, which is linked to their B cell receptor adult bone marrow.
  • Nicotinic Receptor Alpha7 Expression During Tooth Morphogenesis Reveals Functional Pleiotropy

    Nicotinic Receptor Alpha7 Expression During Tooth Morphogenesis Reveals Functional Pleiotropy

    Nicotinic Receptor Alpha7 Expression during Tooth Morphogenesis Reveals Functional Pleiotropy Scott W. Rogers1,2*, Lorise C. Gahring1,3 1 Geriatric Research, Education and Clinical Center, Veteran’s Administration, Salt Lake City, Utah, United States of America, 2 Department of Neurobiology and Anatomy, University of Utah School of Medicine, Salt Lake City, Utah, United States of America, 3 Division of Geriatrics, Department of Internal Medicine, University of Utah School of Medicine, Salt Lake City, Utah, United States of America Abstract The expression of nicotinic acetylcholine receptor (nAChR) subtype, alpha7, was investigated in the developing teeth of mice that were modified through homologous recombination to express a bi-cistronic IRES-driven tau-enhanced green fluorescent protein (GFP); alpha7GFP) or IRES-Cre (alpha7Cre). The expression of alpha7GFP was detected first in cells of the condensing mesenchyme at embryonic (E) day E13.5 where it intensifies through E14.5. This expression ends abruptly at E15.5, but was again observed in ameloblasts of incisors at E16.5 or molar ameloblasts by E17.5–E18.5. This expression remains detectable until molar enamel deposition is completed or throughout life as in the constantly erupting mouse incisors. The expression of alpha7GFP also identifies all stages of innervation of the tooth organ. Ablation of the alpha7-cell lineage using a conditional alpha7Cre6ROSA26-LoxP(diphtheria toxin A) strategy substantially reduced the mesenchyme and this corresponded with excessive epithelium overgrowth consistent with an instructive role by these cells during ectoderm patterning. However, alpha7knock-out (KO) mice exhibited normal tooth size and shape indicating that under normal conditions alpha7 expression is dispensable to this process.
  • Phenotypic and Molecular Analysis of Mes-3, a Maternal-Effect Gene Required for Proliferation and Viability of the Germ Line in C

    Phenotypic and Molecular Analysis of Mes-3, a Maternal-Effect Gene Required for Proliferation and Viability of the Germ Line in C

    Copyright 0 1995 by the Genetics Society of America Phenotypic and Molecular Analysis of mes-3, a Maternal-Effect Gene Required for Proliferation and Viability of the Germ Line in C. eleguns Janet E. Paulsen,' Elizabeth E. Capowski2 and Susan Strome Department of Biology, Indiana University, Bloomington, Indiana 47405 Manuscript received July 24, 1995 Accepted for publication September 14, 1995 ABSTRACT mes-3 is one of four maternaleffect sterile genes that encode maternal components required for normal postembryonic development of the germ line in Caenorhabditis elegans. mes-3 mutant mothers produce sterile progeny, which contain few germ cells andno gametes. This terminal phenotype reflects two problems: reduced proliferation of the germ line and germ cell death. Both the appearanceof the dying germ cells and the results of genetic tests indicate that germ cells in mes-3 animals undergo a necrotic-like death, not programmedcell death. The few germ cells that appear healthyin mes-3 worms do not differentiateinto gametes, even after eliminationof the signaling pathway that normally maintains the undifferentiated population of germ cells. Thus, mes-3 encodes a maternally supplied product that is required both for proliferation of the germ line and for maintenance of viable germ cells that are competent to differentiate into gametes. Cloning and molecular characterizationof mes-3 revealed that it is the upstream gene in an operon. The genes in the operon display parallel expression patterns; transcripts are present throughout development and are not restricted to germ-line tissue. Both mes-3 and the downstream gene in the operon encode novel proteins. HE germ line enables metazoan organisms to pro- germ cell, P4, at the 16-24cell stage.
  • Delta-Notch Signaling: the Long and the Short of a Neuron’S Influence on Progenitor Fates

    Delta-Notch Signaling: the Long and the Short of a Neuron’S Influence on Progenitor Fates

    Journal of Developmental Biology Review Delta-Notch Signaling: The Long and the Short of a Neuron’s Influence on Progenitor Fates Rachel Moore 1,* and Paula Alexandre 2,* 1 Centre for Developmental Neurobiology, King’s College London, London SE1 1UL, UK 2 Developmental Biology and Cancer, University College London Great Ormond Street Institute of Child Health, London WC1N 1EH, UK * Correspondence: [email protected] (R.M.); [email protected] (P.A.) Received: 18 February 2020; Accepted: 24 March 2020; Published: 26 March 2020 Abstract: Maintenance of the neural progenitor pool during embryonic development is essential to promote growth of the central nervous system (CNS). The CNS is initially formed by tightly compacted proliferative neuroepithelial cells that later acquire radial glial characteristics and continue to divide at the ventricular (apical) and pial (basal) surface of the neuroepithelium to generate neurons. While neural progenitors such as neuroepithelial cells and apical radial glia form strong connections with their neighbours at the apical and basal surfaces of the neuroepithelium, neurons usually form the mantle layer at the basal surface. This review will discuss the existing evidence that supports a role for neurons, from early stages of differentiation, in promoting progenitor cell fates in the vertebrates CNS, maintaining tissue homeostasis and regulating spatiotemporal patterning of neuronal differentiation through Delta-Notch signalling. Keywords: neuron; neurogenesis; neuronal apical detachment; asymmetric division; notch; delta; long and short range lateral inhibition 1. Introduction During the development of the central nervous system (CNS), neurons derive from neural progenitors and the Delta-Notch signaling pathway plays a major role in these cell fate decisions [1–4].
  • Genetic and Maternal Effect Influences on Viability of Common Frog

    Genetic and Maternal Effect Influences on Viability of Common Frog

    Heredity (2003) 91, 117–124 & 2003 Nature Publishing Group All rights reserved 0018-067X/03 $25.00 www.nature.com/hdy Genetic and maternal effect influences on viability of common frog tadpoles under different environmental conditions S Pakkasmaa1, J Merila¨2 and RB O’Hara2,3 1Department of Population Biology, Evolutionary Biology Centre, Uppsala University, Norbyva¨gen 18D, SE-75236 Uppsala, Sweden; 2Ecological Genetics Research Unit, Department of Ecology and Systematics, PO Box 65, FIN-00014 University of Helsinki, Finland; 3Rolf Nevanlinna Institute, PO Box 4, FIN-00014 University of Helsinki, Finland The influence of environmental stress on the expression of all traits were significant, independent of pH treatments and genetic and maternal effects on the viability traits has seldom typically of magnitude similar to the additive genetic effects. been assessed in wild vertebrates. We have estimated Maternal effects were large for all traits, especially for genetic and maternal effects on the viability (viz probability of viability itself, and their expression was partly dependent survival, probability of being deformed, and body size and on the environment. In the case of body size, the maternal shape) of common frog, Rana temporaria, tadpoles under effects were mediated largely through egg size. In general, stressful (low pH) and nonstressful (neutral pH) environ- the results give little evidence for the conjecture that mental conditions. A Bayesian analysis using generalized environmental stress created by low pH would impact linear mixed models was applied to data from a factorial strongly on the genetic architecture of fitness-related traits laboratory experiment. The expression of additive genetic in frogs, and hamper adaptation to stress caused by variance was independent of pH treatments, and all traits acidification.
  • Avian Tail Ontogeny, Pygostyle Formation, and Interpretation of Juvenile Mesozoic Specimens Received: 27 March 2018 Dana J

    Avian Tail Ontogeny, Pygostyle Formation, and Interpretation of Juvenile Mesozoic Specimens Received: 27 March 2018 Dana J

    www.nature.com/scientificreports OPEN Avian tail ontogeny, pygostyle formation, and interpretation of juvenile Mesozoic specimens Received: 27 March 2018 Dana J. Rashid1, Kevin Surya2, Luis M. Chiappe3, Nathan Carroll3, Kimball L. Garrett4, Bino Accepted: 23 May 2018 Varghese5, Alida Bailleul6,7, Jingmai K. O’Connor 7, Susan C. Chapman 8 & John R. Horner1,9 Published: xx xx xxxx The avian tail played a critical role in the evolutionary transition from long- to short-tailed birds, yet its ontogeny in extant birds has largely been ignored. This defcit has hampered eforts to efectively identify intermediate species during the Mesozoic transition to short tails. Here we show that fusion of distal vertebrae into the pygostyle structure does not occur in extant birds until near skeletal maturity, and mineralization of vertebral processes also occurs long after hatching. Evidence for post-hatching pygostyle formation is also demonstrated in two Cretaceous specimens, a juvenile enantiornithine and a subadult basal ornithuromorph. These fndings call for reinterpretations of Zhongornis haoae, a Cretaceous bird hypothesized to be an intermediate in the long- to short-tailed bird transition, and of the recently discovered coelurosaur tail embedded in amber. Zhongornis, as a juvenile, may not yet have formed a pygostyle, and the amber-embedded tail specimen is reinterpreted as possibly avian. Analyses of relative pygostyle lengths in extant and Cretaceous birds suggests the number of vertebrae incorporated into the pygostyle has varied considerably, further complicating the interpretation of potential transitional species. In addition, this analysis of avian tail development reveals the generation and loss of intervertebral discs in the pygostyle, vertebral bodies derived from diferent kinds of cartilage, and alternative modes of caudal vertebral process morphogenesis in birds.
  • Maternal Variants in NLRP and Other Maternal Effect Proteins Are

    Maternal Variants in NLRP and Other Maternal Effect Proteins Are

    Epigenetics J Med Genet: first published as 10.1136/jmedgenet-2017-105190 on 24 March 2018. Downloaded from ORIGINAL ARTICLE Maternal variants in NLRP and other maternal effect proteins are associated with multilocus imprinting disturbance in offspring Matthias Begemann,1 Faisal I Rezwan,2 Jasmin Beygo,3 Louise E Docherty,4 Julia Kolarova,5 Christopher Schroeder,3 Karin Buiting,3 Kamal Chokkalingam,6 Franziska Degenhardt,7 Emma L Wakeling,8 Stephanie Kleinle,9 Daniela González Fassrainer,9 Barbara Oehl-Jaschkowitz,10 Claire L S Turner,11 Michal Patalan,12 Maria Gizewska,12 Gerhard Binder,13 Can Thi Bich Ngoc,14 Vu Chi Dung,14 Sarju G Mehta,15 Gareth Baynam,16,17 Julian P Hamilton-Shield,18 Sara Aljareh,2 Oluwakemi Lokulo-Sodipe,2,19 Rachel Horton,2,19 Reiner Siebert,5 Miriam Elbracht,1 Isabel Karen Temple,2,19 Thomas Eggermann,1 Deborah J G Mackay2 ► Additional material is ABSTRact overgrowth, macroglossia, exomphalos, hemihy- published online only. To view Background Genomic imprinting results from pertrophy and predisposition to Wilms tumour), please visit the journal online (http:// dx. doi. org/ 10. 1136/ the resistance of germline epigenetic marks to the growth restriction disorders Silver-Russell jmedgenet- 2017- 105190). reprogramming in the early embryo for a small syndrome (SRS; restricted growth, asymmetry and number of mammalian genes. Genetic, epigenetic or poor feeding) and Temple syndrome (TS; growth For numbered affiliations see environmental insults that prevent imprints from evading restriction, poor feeding, early puberty and obesity) end of article. reprogramming may result in imprinting disorders, which and transient neonatal diabetes mellitus (TNDM; impact growth, development, behaviour and metabolism.
  • Development and Evolution

    Development and Evolution

    AccessScience from McGraw-Hill Education Page 1 of 4 www.accessscience.com Development and evolution Contributed by: Brian K. Hall Publication year: 2010 The disciplines of developmental biology (or embryology) and evolutionary biology have come together twice—once as evolutionary embryology in the late nineteenth century and again as evolutionary developmental biology (evo-devo, as it is typically known) in the late twentieth century. The current intersections of development and evolution are proving to be of paramount importance for creating a fully integrated theory of biology. History Prior to and into the nineteenth century, the word “evolution” had a completely different meaning from its usage today. Then, it was used to describe a particular type of embryonic or larval development—the preformation and unfolding of a more or less fully formed organism from an embryonic or larval stage (for example, a butterfly from a caterpillar, or aphids from the body of an adult female). In fact, Charles Darwin did not use the word “evolution” per se in On the Origin of Species , which was published in 1859, although “evolved” was the final word of his book. To reach its present-day definition, the term “evolution” had to undergo a slow transformation from development within a single generation to transformation (transmutation) between generations. As for the field of developmental biology, in the nineteenth century, embryology (referring to the study of embryonic development) was a progressive field in biology, with researchers describing normal development and then manipulating animal embryos [ experimental or physiological embryology (also known as developmental mechanics)] in search of altered outcomes that would help explain how development occurred.
  • Synthetic Morphogenesis

    Synthetic Morphogenesis

    Downloaded from http://cshperspectives.cshlp.org/ on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Synthetic Morphogenesis Brian P. Teague, Patrick Guye, and Ron Weiss Synthetic Biology Center, Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 Correspondence: [email protected] Throughout biology, function is intimately linked with form. Across scales ranging from subcellular to multiorganismal, the identity and organization of a biological structure’s subunits dictate its properties. The field of molecular morphogenesis has traditionally been concerned with describing these links, decoding the molecular mechanisms that give rise to the shape and structure of cells, tissues, organs, and organisms. Recent advances in synthetic biology promise unprecedented control over these molecular mechanisms; this opens the path to not just probing morphogenesis but directing it. This review explores several frontiers in the nascent field of synthetic morphogenesis, including programmable tissues and organs, synthetic biomaterials and programmable matter, and engineering complex morphogenic systems de novo. We will discuss each frontier’s objectives, current approaches, constraints and challenges, and future potential. hat is the underlying basis of biological 2014). As the mechanistic underpinnings of Wstructure? Speculations were based on these processes are elucidated, opportunities macroscopic observation until the 17th century, arise to use this knowledge to direct mor- when Antonie van Leeuwenhoek and Robert phogenesis toward novel, useful ends. We call Hooke discovered that organisms were com- this emerging field of endeavor “synthetic mor- posed of microscopic cells (Harris 1999), and phogenesis.” Inspired by and based on natural that the size and shape of the cells affected the morphogenic systems, synthetic morphogenesis properties of the structures they formed.