DOCSLIB.ORG

Cotranscription and Intergenic Splicing of the PPARG and TSEN2 Genes in Cattle Matthieu Roux, Hubert Levéziel, Valérie Amarger

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cotranscription and Intergenic Splicing of the PPARG and TSEN2 Genes in Cattle Matthieu Roux, Hubert Levéziel, Valérie Amarger Cotranscription and intergenic splicing of the PPARG and TSEN2 genes in cattle Matthieu Roux, Hubert Levéziel, Valérie Amarger To cite this version: Matthieu Roux, Hubert Levéziel, Valérie Amarger. Cotranscription and intergenic splicing of the PPARG and TSEN2 genes in cattle. BMC Genomics, BioMed Central, 2006, 7, pp.71. 10.1186/1471- 2164-7-71. hal-01211936 HAL Id: hal-01211936 https://hal.archives-ouvertes.fr/hal-01211936 Submitted on 30 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. BMC Genomics BioMed Central Research article Open Access Cotranscription and intergenic splicing of the PPARG and TSEN2 genes in cattle Matthieu Roux1, Hubert Levéziel1 and Valérie Amarger*1,2 Address: 1Unité de Génétique Moléculaire Animale, UMR1061 INRA/Université de Limoges, Faculté des Sciences et Techniques, 123 av Albert Thomas, 87060 Limoges Cedex, France and 2UMR 1280 Physiologie des Adaptations Nutritionnelles, Centre INRA de Nantes, BP71627, 44316 Nantes cedex 3, France Email: Matthieu Roux - [email protected]; Hubert Levéziel - [email protected]; Valérie Amarger* - [email protected] * Corresponding author Published: 04 April 2006 Received: 01 December 2005 Accepted: 04 April 2006 BMC Genomics2006, 7:71 doi:10.1186/1471-2164-7-71 This article is available from: http://www.biomedcentral.com/1471-2164/7/71 © 2006Roux et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Intergenic splicing resulting in the combination of mRNAs sequences from distinct genes is a newly identified mechanism likely to contribute to protein diversity. Few cases have been described, most of them involving neighboring genes and thus suggesting a cotranscription event presumably due to transcriptional termination bypass. Results: We identified bovine chimeric transcripts resulting from cotranscription and intergenic splicing of two neighboring genes, PPARG and TSEN2. These two genes encode the Peroxisome Proliferator Activated Receptors γ1 and γ2 and the tRNA Splicing Endonuclease 2 homolog and are situated in the same orientation about 50 kb apart on bovine chromosome 22q24. Their relative position is conserved in human and mouse. We identified two types of chimeric transcripts containing all but the last exon of the PPARG gene followed by all but the first exon of the TSEN2 gene. The two chimers differ by the presence/absence of an intermediate exon resulting from transcription of a LINE L2 sequence situated between the two genes. Both transcripts use canonical splice sites for all exons coming from both genes, as well as for the LINE L2 sequence. One of these transcripts harbors a premature STOP codon and the other encodes a putative chimeric protein combining most of the PPARγ protein and the entire TSEN2 protein, but we could not establish the existence of this protein. Conclusion: By showing that both individual and chimeric transcripts are transcribed from PPARG and TSEN2, we demonstrated regulation of transcription termination. Further, the existence and functionality of a chimeric protein harboring active motifs that are a priori unrelated is hypothesized. Background information from different genes, also known as inter- It is now well known that diversity at the protein level can genic mRNAs. Various mechanisms appear to be involved result from different positions of transcriptional start and in this process and can be classified in two categories (1) termination of a single gene, alternative splicing and post- trans-splicing events between pre-mRNAs of distinct translational modifications. However, there is now evi- genes and (2) long transcription events across neighbor- dence that an additional level of diversity may also exist ing genes that normally act as independent transcription by the production of mRNAs that combine sequence units. The latter case has been described for a number of Page 1 of 11 (page number not for citation purposes) BMC Genomics 2006, 7:71 http://www.biomedcentral.com/1471-2164/7/71 A PPARG gene 50 kb TSEN2 gene 5 6 // 1 2 Human chr3p25 LINE L2 88 262 Bovine EST BF041169 5 6 1 2 Bovine mRNAs PPARG TSEN2 B LINE L2 794 bp 5 2 620 bp 5 2 RT-PCR on bovine cDNA IdentificationFigure 1 of chimeric transcripts between the bovine PPARG and TSEN2 genes Identification of chimeric transcripts between the bovine PPARG and TSEN2 genes. A-Correspondance between the bovine EST BF041169 and human chr3p25 genomic sequence and bovine mRNAs. B- RT-PCR experiment performed on bovine cDNA using primers designed on PPARG exon 5 and TSEN2 exon 2: structure of the two amplified fragments. genes including HAI-2 and H2RSP [1], the CYP2C locus encodes two nuclear receptors (PPARγ1 and PPARγ2) [2], GALT and IL-11Rα [3], P2Y11 and SSF1 [4], UEV1 and implicated in the regulation of a variety of cellular proc- Kua [5], 4E-BP3 and MASK [6]. In all these cases, chimeric esses, such as cell cycle control, carcinogenesis, inflamma- mRNAs that are produced might encode proteins harbor- tion, atherosclerosis and mostly adipogenesis [9-11]. The ing functional domains that are usually not encountered reason why we decided to study this gene in cattle is on a single protein. However, although the chimeric tran- because of its presumed implication in the amount of adi- scripts appear to be present at a comparable level as single pose tissue associated to the meat. The TSEN2 gene gene transcripts, the in vivo existence of chimeric proteins encodes a protein involved in the formation of a human has not been confirmed so far, suggesting that the transla- endonuclease complex whose function is the removal of tion of chimeric transcripts might be subjected to a nar- introns from pre-tRNAs,. The complex is a heterotretramer row regulation. formed by four distinct proteins that are well character- ized in yeast [12] but only very recently identified in We describe here the existence of bovine chimeric tran- human [7]. We identified two types of chimeric transcripts scripts involving the Peroxisome Proliferator Activated containing all but the last exon of the PPARG gene fol- Receptor Gamma (PPARG) gene and the neighboring lowed by all the coding exons of the TSEN2 gene (exons 2 gene, recently identified in human as the TSEN2 gene to 12). One chimeric transcript harbors a continuous (tRNA Splicing Endonuclease 2 homolog) [7]. These two open reading frame resulting from a perfect connection of genes are situated 50 kb from each other on human chro- the two coding regions, but lacks the region encoded by mosome 3p25 and their respective position is conserved the last exon of PPARG. The other chimeric transcript has on bovine chromosome 22q24 (this paper, [8]). The an additional exon between the two regions, resulting PPARG gene has been intensively studied because it from the transcription of a repetitive sequence situated in Page 2 of 11 (page number not for citation purposes) BMC Genomics 2006, 7:71 http://www.biomedcentral.com/1471-2164/7/71 A PPARG TSEN2 A1 A2 B 1 2 3 4 5 6 1 2 3 4 5 6 7 8 9 10 11 12 // B PPARG1 TSEN2 ATG STOP PPARG2 ATG STOP ATG STOP C Short chimeric transcript ATG ATG STOP …atatttatagctgtcattattctcagtggagtcctgaaggaacagtcacttgggaagATGgctgaggcggtg… I F I A V I I L S G V L K E Q S L G K M A E A V Long chimeric transcript TSEN2 5’UTR ATG STOP …atatttatagctgtcattattctcagtggagggggcaccagactatcctagaacacagaggaatgt… I F I A V I I L S G G G T R L S * LINE L2 StructureFigure 2 of the bovine PPARG and TSEN2 genes and transcripts Structure of the bovine PPARG and TSEN2 genes and transcripts. A- Genomic structure of the two genes. B- Structure of the normal transcripts from both genes. C- Structure of the short and long chimeric transcripts and partial coding sequence at the junction between the two genes (untranslated exons are in red, translation start and stop are indicated). the 5' region of the TSEN2 gene and introducing a stop of this protein. Chimeric transcripts between these two codon in the coding sequence. genes cannot be detected in human or mouse. We show here that, in cattle, both genes can be expressed Results as independent transcriptional units or as a hybrid The PPARG and TSEN2 genes form chimeric transcripts PPARG-TSEN2 transcript devoid of the last exon of PPARG in cattle and the first exon of TSEN2. This chimeric transcript har- When searching in the bovine EST database for ESTs cor- bors an open reading frame encoding a putative chimeric responding to the PPARG gene, we found one EST protein combining domains from the two distinct pro- sequence [Genbank:BF041169] containing the end of teins but we could not show any evidence of the existence PPARG exon 5 followed by a sequence completely unre- Page 3 of 11 (page number not for citation purposes) BMC Genomics 2006, 7:71 http://www.biomedcentral.com/1471-2164/7/71 lated to the PPARG gene. A BLAST search with this exon 2 (referred to as long and short chimeric transcripts, sequence revealed a high level of identity with two regions Genbank:DQ256760 and Genbank:DQ256759) (Figure on the human genome : (1) the 174 bp situated down- 2).
Load more

Recommended publications
  • Kb Candidate Region on Chicken Chromosome 12
    GENETICS AND GENOMICS Narrowing the wingless-2 mutation to a 227 kb candidate region on chicken chromosome 12 A. E. Webb,∗,2,6 I. A. Youngworth,∗,6 M. Kaya,†,3 C. L. Gitter,∗,4 E. A. O’Hare,∗,5 B. May,∗ H. H. Cheng,† and M. E. Delany∗,1 ∗Department of Animal Science, University of California, Davis 95616; and †USDA-ARS, Avian Disease and Oncology Laboratory, East Lansing, MI 48823 ABSTRACT Wingless-2 (wg-2) is an autosomal re- element. Specifically, the wg-2 mutation was initially cessive mutation in chicken that results in an embry- mapped to a 7 Mb region of chromosome 12 using an onic lethal condition. Affected individuals exhibit a Illumina 3 K SNP array. Subsequent SNP genotyping multisystem syndrome characterized by absent wings, and exon sequencing combined with analysis from im- truncated legs, and craniofacial, kidney, and feather proved genome assemblies narrowed the region of in- malformations. Previously, work focused on phenotype terest to a maximum size of 227 kb. Within this re- description, establishing the autosomal recessive pat- gion, 3 validated and 3 predicted candidate genes are tern of Mendelian inheritance and placing the muta- found, and these are described. The wg-2 mutation is tion on an inbred genetic background to create the a valuable resource to contribute to an improved un- congenic line UCD Wingless-2.331. The research de- derstanding of the developmental pathways involved in scribed in this paper employed the complementary tools chicken and avian limb development as well as serving of breeding, genetics, and genomics to map the chromo- as a model for human development, as the resulting somal location of the mutation and successively nar- syndrome shares features with human congenital disor- row the size of the region for analysis of the causative ders.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information Flow
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Reconstitution of the Human Trna Splicing Endonuclease Complex: Insight Into the Regulation of Pre-Trna Cleavage
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.16.878546; this version posted December 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. Reconstitution of the Human tRNA Splicing Endonuclease Complex: insight into the regulation of pre-tRNA cleavage. Cassandra K. Hayne1, Casey A. Schmidt2, A. Gregory Matera2,3,4, and Robin E. Stanley1* 1Signal Transduction Laboratory, National Institute of Environmental Health Sciences, National Institutes of Health, Department of Health and Human Services, 111 T. W. Alexander Drive, Research Triangle Park, NC 27709, USA 2Curriculum in Genetics & Molecular Biology and Integrative Program for Biological and Genome Sciences, University of North Carolina, Chapel Hill, NC 27599, USA. 3Departments of Biology and Genetics, University of North Carolina, Chapel Hill, NC 27599, USA. 4Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA. *To whom correspondence should be addressed. Tel: 01 984 287 3568; Email: [email protected] ABSTRACT The splicing of tRNA introns is a critical step in pre-tRNA maturation. In archaea and eukaryotes, tRNA intron removal is catalyzed by the tRNA splicing endonuclease (TSEN) complex. Eukaryotic TSEN is comprised of four core subunits (TSEN54, TSEN2, TSEN34, and TSEN15). The human TSEN complex additionally co-purifies with the polynucleotide kinase CLP1; however, CLP1’s role in tRNA splicing remains unclear. Mutations in genes encoding all four TSEN subunits, as well as CLP1, are known to cause neurodegenerative disorders, yet the mechanisms underlying the pathogenesis of these disorders are unknown.
    [Show full text]
  • Spatial Sorting Enables Comprehensive Characterization of Liver Zonation
    ARTICLES https://doi.org/10.1038/s42255-019-0109-9 Spatial sorting enables comprehensive characterization of liver zonation Shani Ben-Moshe1,3, Yonatan Shapira1,3, Andreas E. Moor 1,2, Rita Manco1, Tamar Veg1, Keren Bahar Halpern1 and Shalev Itzkovitz 1* The mammalian liver is composed of repeating hexagonal units termed lobules. Spatially resolved single-cell transcriptomics has revealed that about half of hepatocyte genes are differentially expressed across the lobule, yet technical limitations have impeded reconstructing similar global spatial maps of other hepatocyte features. Here, we show how zonated surface markers can be used to sort hepatocytes from defined lobule zones with high spatial resolution. We apply transcriptomics, microRNA (miRNA) array measurements and mass spectrometry proteomics to reconstruct spatial atlases of multiple zon- ated features. We demonstrate that protein zonation largely overlaps with messenger RNA zonation, with the periportal HNF4α as an exception. We identify zonation of miRNAs, such as miR-122, and inverse zonation of miRNAs and their hepa- tocyte target genes, highlighting potential regulation of gene expression levels through zonated mRNA degradation. Among the targets, we find the pericentral Wingless-related integration site (Wnt) receptors Fzd7 and Fzd8 and the periportal Wnt inhibitors Tcf7l1 and Ctnnbip1. Our approach facilitates reconstructing spatial atlases of multiple cellular features in the liver and other structured tissues. he mammalian liver is a structured organ, consisting of measurements would broaden our understanding of the regulation repeating hexagonally shaped units termed ‘lobules’ (Fig. 1a). of liver zonation and could be used to model liver metabolic func- In mice, each lobule consists of around 9–12 concentric lay- tion more precisely.
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • VU Research Portal
    VU Research Portal (Epi) genetics and twins van Dongen, J. 2015 document version Publisher's PDF, also known as Version of record Link to publication in VU Research Portal citation for published version (APA) van Dongen, J. (2015). (Epi) genetics and twins. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. E-mail address: [email protected] Download date: 29. Sep. 2021 Appendix 3 Supplement to chapter 5* * Based on: van Dongen J, Willemsen G., Heijmans B.T., Neuteboom J., Kluft C, Jansen R, Penninx BWJ, Slagboom PE, Geus EJ, Boomsma DI. Longitudinal weight differences, gene expression, and blood biomarkers in BMI discordant identical twins (accepted for publication by the International Journal of Obesity). Supplemental Methods 1. Subjects MZ twins were registered with the Netherlands Twin Register (NTR). The majority of twins was recruited through City Councils between 1990 and 1993 when they were adolescents or young adults.
    [Show full text]
  • SETD1A Protects from Senescence Through Regulation of the Mitotic Gene Expression Program
    ARTICLE https://doi.org/10.1038/s41467-019-10786-w OPEN SETD1A protects from senescence through regulation of the mitotic gene expression program Ken Tajima1,2,5,7, Satoru Matsuda1,2,6,7, Toshifumi Yae1,2,7, Benjamin J. Drapkin1,3, Robert Morris1, Myriam Boukhali1, Kira Niederhoffer1, Valentine Comaills 1, Taronish Dubash1, Linda Nieman1, Hongshan Guo1, Neelima K.C. Magnus1, Nick Dyson1, Toshihiro Shioda1, Wilhelm Haas1, Daniel A. Haber1,3,4 & Shyamala Maheswaran1,2 1234567890():,; SETD1A,aSet1/COMPASS family member maintaining histone-H3-lysine-4 (H3K4) methy- lation on transcriptionally active promoters, is overexpressed in breast cancer. Here, we show that SETD1A supports mitotic processes and consequentially, its knockdown induces senes- cence. SETD1A, through promoter H3K4 methylation, regulates several genes orchestrating mitosis and DNA-damage responses, and its depletion causes chromosome misalignment and segregation defects. Cell cycle arrest in SETD1A knockdown senescent cells is inde- pendent of mutations in p53, RB and p16, known senescence mediators; instead, it is sustained through transcriptional suppression of SKP2, which degrades p27 and p21. Rare cells escaping senescence by restoring SKP2 expression display genomic instability. In > 200 cancer cell lines and in primary circulating tumor cells, SETD1A expression correlates with genes pro- moting mitosis and cell cycle suggesting a broad role in suppressing senescence induced by aberrant mitosis. Thus, SETD1A is essential to maintain mitosis and proliferation and its suppression unleashes the tumor suppressive effects of senescence. 1 Massachusetts General Hospital Cancer Center, Harvard Medical School, Charlestown, MA 02129, USA. 2 Department of Surgery, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114, USA.
    [Show full text]
  • Gnomad Lof Supplement
    1 gnomAD supplement gnomAD supplement 1 Data processing 4 Alignment and read processing 4 Variant Calling 4 Coverage information 5 Data processing 5 Sample QC 7 Hard filters 7 Supplementary Table 1 | Sample counts before and after hard and release filters 8 Supplementary Table 2 | Counts by data type and hard filter 9 Platform imputation for exomes 9 Supplementary Table 3 | Exome platform assignments 10 Supplementary Table 4 | Confusion matrix for exome samples with Known platform labels 11 Relatedness filters 11 Supplementary Table 5 | Pair counts by degree of relatedness 12 Supplementary Table 6 | Sample counts by relatedness status 13 Population and subpopulation inference 13 Supplementary Figure 1 | Continental ancestry principal components. 14 Supplementary Table 7 | Population and subpopulation counts 16 Population- and platform-specific filters 16 Supplementary Table 8 | Summary of outliers per population and platform grouping 17 Finalizing samples in the gnomAD v2.1 release 18 Supplementary Table 9 | Sample counts by filtering stage 18 Supplementary Table 10 | Sample counts for genomes and exomes in gnomAD subsets 19 Variant QC 20 Hard filters 20 Random Forest model 20 Features 21 Supplementary Table 11 | Features used in final random forest model 21 Training 22 Supplementary Table 12 | Random forest training examples 22 Evaluation and threshold selection 22 Final variant counts 24 Supplementary Table 13 | Variant counts by filtering status 25 Comparison of whole-exome and whole-genome coverage in coding regions 25 Variant annotation 30 Frequency and context annotation 30 2 Functional annotation 31 Supplementary Table 14 | Variants observed by category in 125,748 exomes 32 Supplementary Figure 5 | Percent observed by methylation.
    [Show full text]
  • TSEN2 Gene Trna Splicing Endonuclease Subunit 2
    TSEN2 gene tRNA splicing endonuclease subunit 2 Normal Function The TSEN2 gene provides instructions for making one part (subunit) of an enzyme called the tRNA splicing endonuclease complex. This complex helps process several types of RNA molecules, which are chemical cousins of DNA. The tRNA splicing endonuclease complex is particularly important for the normal processing of a form of RNA known as transfer RNA (tRNA). tRNA molecules help assemble protein building blocks called amino acids into full-length proteins. However, before they can assemble proteins, tRNAs must be processed into mature molecules. In particular, regions called introns need to be removed from some tRNAs for the molecules to be functional. The tRNA splicing endonuclease complex recognizes and then removes introns to help produce mature tRNA molecules. Studies suggest that the tRNA splicing endonuclease complex may also be involved in processing another form of RNA known as messenger RNA (mRNA). mRNA serves as a genetic blueprint for making proteins. Researchers suspect that the tRNA splicing endonuclease complex cuts (cleaves) one end of mRNA molecules so a string of adenines (one of the building blocks of RNA) can be added. This process is known as polyadenylation, and the string of adenines is known as a poly(A) tail. The poly(A) tail signals the stopping point for protein production and protects mRNA from being broken down before protein production occurs. Health Conditions Related to Genetic Changes Pontocerebellar hypoplasia At least four mutations in the TSEN2 gene have been identified in people with a disorder of brain development called pontocerebellar hypoplasia. The major features of this condition include delayed development, problems with movement, and intellectual disability.
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]
  • The University of Chicago Genetic Services Laboratories Next
    The University of Chicago Genetic Services Laboratories 5841 S. Maryland Ave., Rm. G701, MC 0077, Chicago, Illinois 60637 773) 702 9130 [email protected] dnatesting.uchicago.edu CLIA #: 14D0917593 CAP #: 18827-49 Next Generation Sequencing Panel for Cerebellar Hypoplasia Pontocerebellar Hypoplasia Pontocerebellar hypoplasia (PCH) is a group of rare autosomal recessive neurodegenerative disorders with a prenatal onset, characterized by cerebellar hypoplasia in addition to varying degrees of atrophy of the cerebellum and pons [1]. MRI findings include a small cerebellum and brainstem, variable neocortical atrophy, severe and progressive microcephaly and variable ventriculomegaly [1]. Clinically, most patients have severe intellectual disability, swallowing problems, and seizures. Cerebellar Vermis Hypoplasia Cerebellar Vermis Hypoplasia (CVH) consists of isolated vermis hypoplasia and may also be called “Dandy-Walker variant” due to the phenotypic overlap with Dandy-Walker malformation (DWM). DWM includes vermis hypoplasia in addition to several other features such as enlarged posterior fossa. Our Cerebellar Hypoplasia Panel includes all seven genes listed below. Cerebellar Hypoplasia VRK1 TSEN54 RARS2 OPHN1 TSEN2 TSEN34 CASK Disorder and Clinical Features / Molecular Pathology Associated Genes PCH type 1 PCH type 1 is characterized by loss of motor neurons in the spinal cord, which is morphologically [OMIM#607596] similar to the hereditary spinal muscular atrophies, in addition to the typical findings of PCH [1]. Renbaum et al. (2009) identified a homozygous nonsense mutation in VRK1 in a VRK1 [OMIM#602168] consanguineous family with PCH type 1. VRK1 encodes a serine-threonine kinase which is thought to play a role in nervous system development and neuronal maintenance [2]. PCH type 2 PCH type 2 is characterized by dyskinesia and dystonia and is the most common subtype of [OMIM#277470] PCH [3].
    [Show full text]
  • 1 Imipramine Treatment and Resiliency Exhibit Similar
    Imipramine Treatment and Resiliency Exhibit Similar Chromatin Regulation in the Mouse Nucleus Accumbens in Depression Models Wilkinson et al. Supplemental Material 1. Supplemental Methods 2. Supplemental References for Tables 3. Supplemental Tables S1 – S24 SUPPLEMENTAL TABLE S1: Genes Demonstrating Increased Repressive DimethylK9/K27-H3 Methylation in the Social Defeat Model (p<0.001) SUPPLEMENTAL TABLE S2: Genes Demonstrating Decreased Repressive DimethylK9/K27-H3 Methylation in the Social Defeat Model (p<0.001) SUPPLEMENTAL TABLE S3: Genes Demonstrating Increased Repressive DimethylK9/K27-H3 Methylation in the Social Isolation Model (p<0.001) SUPPLEMENTAL TABLE S4: Genes Demonstrating Decreased Repressive DimethylK9/K27-H3 Methylation in the Social Isolation Model (p<0.001) SUPPLEMENTAL TABLE S5: Genes Demonstrating Common Altered Repressive DimethylK9/K27-H3 Methylation in the Social Defeat and Social Isolation Models (p<0.001) SUPPLEMENTAL TABLE S6: Genes Demonstrating Increased Repressive DimethylK9/K27-H3 Methylation in the Social Defeat and Social Isolation Models (p<0.001) SUPPLEMENTAL TABLE S7: Genes Demonstrating Decreased Repressive DimethylK9/K27-H3 Methylation in the Social Defeat and Social Isolation Models (p<0.001) SUPPLEMENTAL TABLE S8: Genes Demonstrating Increased Phospho-CREB Binding in the Social Defeat Model (p<0.001) SUPPLEMENTAL TABLE S9: Genes Demonstrating Decreased Phospho-CREB Binding in the Social Defeat Model (p<0.001) SUPPLEMENTAL TABLE S10: Genes Demonstrating Increased Phospho-CREB Binding in the Social
    [Show full text]