Cotranscription and intergenic splicing of the PPARG and TSEN2 genes in cattle Matthieu Roux, Hubert Levéziel, Valérie Amarger To cite this version: Matthieu Roux, Hubert Levéziel, Valérie Amarger. Cotranscription and intergenic splicing of the PPARG and TSEN2 genes in cattle. BMC Genomics, BioMed Central, 2006, 7, pp.71. 10.1186/1471- 2164-7-71. hal-01211936 HAL Id: hal-01211936 https://hal.archives-ouvertes.fr/hal-01211936 Submitted on 30 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. BMC Genomics BioMed Central Research article Open Access Cotranscription and intergenic splicing of the PPARG and TSEN2 genes in cattle Matthieu Roux1, Hubert Levéziel1 and Valérie Amarger*1,2 Address: 1Unité de Génétique Moléculaire Animale, UMR1061 INRA/Université de Limoges, Faculté des Sciences et Techniques, 123 av Albert Thomas, 87060 Limoges Cedex, France and 2UMR 1280 Physiologie des Adaptations Nutritionnelles, Centre INRA de Nantes, BP71627, 44316 Nantes cedex 3, France Email: Matthieu Roux - [email protected]; Hubert Levéziel - [email protected]; Valérie Amarger* - [email protected] * Corresponding author Published: 04 April 2006 Received: 01 December 2005 Accepted: 04 April 2006 BMC Genomics2006, 7:71 doi:10.1186/1471-2164-7-71 This article is available from: http://www.biomedcentral.com/1471-2164/7/71 © 2006Roux et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Intergenic splicing resulting in the combination of mRNAs sequences from distinct genes is a newly identified mechanism likely to contribute to protein diversity. Few cases have been described, most of them involving neighboring genes and thus suggesting a cotranscription event presumably due to transcriptional termination bypass. Results: We identified bovine chimeric transcripts resulting from cotranscription and intergenic splicing of two neighboring genes, PPARG and TSEN2. These two genes encode the Peroxisome Proliferator Activated Receptors γ1 and γ2 and the tRNA Splicing Endonuclease 2 homolog and are situated in the same orientation about 50 kb apart on bovine chromosome 22q24. Their relative position is conserved in human and mouse. We identified two types of chimeric transcripts containing all but the last exon of the PPARG gene followed by all but the first exon of the TSEN2 gene. The two chimers differ by the presence/absence of an intermediate exon resulting from transcription of a LINE L2 sequence situated between the two genes. Both transcripts use canonical splice sites for all exons coming from both genes, as well as for the LINE L2 sequence. One of these transcripts harbors a premature STOP codon and the other encodes a putative chimeric protein combining most of the PPARγ protein and the entire TSEN2 protein, but we could not establish the existence of this protein. Conclusion: By showing that both individual and chimeric transcripts are transcribed from PPARG and TSEN2, we demonstrated regulation of transcription termination. Further, the existence and functionality of a chimeric protein harboring active motifs that are a priori unrelated is hypothesized. Background information from different genes, also known as inter- It is now well known that diversity at the protein level can genic mRNAs. Various mechanisms appear to be involved result from different positions of transcriptional start and in this process and can be classified in two categories (1) termination of a single gene, alternative splicing and post- trans-splicing events between pre-mRNAs of distinct translational modifications. However, there is now evi- genes and (2) long transcription events across neighbor- dence that an additional level of diversity may also exist ing genes that normally act as independent transcription by the production of mRNAs that combine sequence units. The latter case has been described for a number of Page 1 of 11 (page number not for citation purposes) BMC Genomics 2006, 7:71 http://www.biomedcentral.com/1471-2164/7/71 A PPARG gene 50 kb TSEN2 gene 5 6 // 1 2 Human chr3p25 LINE L2 88 262 Bovine EST BF041169 5 6 1 2 Bovine mRNAs PPARG TSEN2 B LINE L2 794 bp 5 2 620 bp 5 2 RT-PCR on bovine cDNA IdentificationFigure 1 of chimeric transcripts between the bovine PPARG and TSEN2 genes Identification of chimeric transcripts between the bovine PPARG and TSEN2 genes. A-Correspondance between the bovine EST BF041169 and human chr3p25 genomic sequence and bovine mRNAs. B- RT-PCR experiment performed on bovine cDNA using primers designed on PPARG exon 5 and TSEN2 exon 2: structure of the two amplified fragments. genes including HAI-2 and H2RSP [1], the CYP2C locus encodes two nuclear receptors (PPARγ1 and PPARγ2) [2], GALT and IL-11Rα [3], P2Y11 and SSF1 [4], UEV1 and implicated in the regulation of a variety of cellular proc- Kua [5], 4E-BP3 and MASK [6]. In all these cases, chimeric esses, such as cell cycle control, carcinogenesis, inflamma- mRNAs that are produced might encode proteins harbor- tion, atherosclerosis and mostly adipogenesis [9-11]. The ing functional domains that are usually not encountered reason why we decided to study this gene in cattle is on a single protein. However, although the chimeric tran- because of its presumed implication in the amount of adi- scripts appear to be present at a comparable level as single pose tissue associated to the meat. The TSEN2 gene gene transcripts, the in vivo existence of chimeric proteins encodes a protein involved in the formation of a human has not been confirmed so far, suggesting that the transla- endonuclease complex whose function is the removal of tion of chimeric transcripts might be subjected to a nar- introns from pre-tRNAs,. The complex is a heterotretramer row regulation. formed by four distinct proteins that are well character- ized in yeast [12] but only very recently identified in We describe here the existence of bovine chimeric tran- human [7]. We identified two types of chimeric transcripts scripts involving the Peroxisome Proliferator Activated containing all but the last exon of the PPARG gene fol- Receptor Gamma (PPARG) gene and the neighboring lowed by all the coding exons of the TSEN2 gene (exons 2 gene, recently identified in human as the TSEN2 gene to 12). One chimeric transcript harbors a continuous (tRNA Splicing Endonuclease 2 homolog) [7]. These two open reading frame resulting from a perfect connection of genes are situated 50 kb from each other on human chro- the two coding regions, but lacks the region encoded by mosome 3p25 and their respective position is conserved the last exon of PPARG. The other chimeric transcript has on bovine chromosome 22q24 (this paper, [8]). The an additional exon between the two regions, resulting PPARG gene has been intensively studied because it from the transcription of a repetitive sequence situated in Page 2 of 11 (page number not for citation purposes) BMC Genomics 2006, 7:71 http://www.biomedcentral.com/1471-2164/7/71 A PPARG TSEN2 A1 A2 B 1 2 3 4 5 6 1 2 3 4 5 6 7 8 9 10 11 12 // B PPARG1 TSEN2 ATG STOP PPARG2 ATG STOP ATG STOP C Short chimeric transcript ATG ATG STOP …atatttatagctgtcattattctcagtggagtcctgaaggaacagtcacttgggaagATGgctgaggcggtg… I F I A V I I L S G V L K E Q S L G K M A E A V Long chimeric transcript TSEN2 5’UTR ATG STOP …atatttatagctgtcattattctcagtggagggggcaccagactatcctagaacacagaggaatgt… I F I A V I I L S G G G T R L S * LINE L2 StructureFigure 2 of the bovine PPARG and TSEN2 genes and transcripts Structure of the bovine PPARG and TSEN2 genes and transcripts. A- Genomic structure of the two genes. B- Structure of the normal transcripts from both genes. C- Structure of the short and long chimeric transcripts and partial coding sequence at the junction between the two genes (untranslated exons are in red, translation start and stop are indicated). the 5' region of the TSEN2 gene and introducing a stop of this protein. Chimeric transcripts between these two codon in the coding sequence. genes cannot be detected in human or mouse. We show here that, in cattle, both genes can be expressed Results as independent transcriptional units or as a hybrid The PPARG and TSEN2 genes form chimeric transcripts PPARG-TSEN2 transcript devoid of the last exon of PPARG in cattle and the first exon of TSEN2. This chimeric transcript har- When searching in the bovine EST database for ESTs cor- bors an open reading frame encoding a putative chimeric responding to the PPARG gene, we found one EST protein combining domains from the two distinct pro- sequence [Genbank:BF041169] containing the end of teins but we could not show any evidence of the existence PPARG exon 5 followed by a sequence completely unre- Page 3 of 11 (page number not for citation purposes) BMC Genomics 2006, 7:71 http://www.biomedcentral.com/1471-2164/7/71 lated to the PPARG gene. A BLAST search with this exon 2 (referred to as long and short chimeric transcripts, sequence revealed a high level of identity with two regions Genbank:DQ256760 and Genbank:DQ256759) (Figure on the human genome : (1) the 174 bp situated down- 2).