DOCSLIB.ORG

GATA4 Is Highly Expressed in Childhood Acute Lymphoblastic Leukemia, Promotes Cell Proliferation and Inhibits Apoptosis by Activating BCL2 and MDM2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
GATA4 Is Highly Expressed in Childhood Acute Lymphoblastic Leukemia, Promotes Cell Proliferation and Inhibits Apoptosis by Activating BCL2 and MDM2 6290 MOLECULAR MEDICINE REPORTS 16: 6290-6298, 2017 GATA4 is highly expressed in childhood acute lymphoblastic leukemia, promotes cell proliferation and inhibits apoptosis by activating BCL2 and MDM2 QIUGUO HAN1, XIN XU1, JING LI1, JINGGANG WANG1, LI BAI1, AIHONG WANG1, WEI WANG1 and BO ZHANG2 1Department of Pediatrics, Daqing Oilfield General Hospital, Daqing, Heilongjiang 163000; 2Department of Pediatric Neurology, The First Hospital of Jilin University, Changchun, Jilin 130000, P.R. China Received October 30, 2016; Accepted June 16, 2017 DOI: 10.3892/mmr.2017.7369 Abstract. Members of the GATA-binding factor protein lysine methyltransferase 2A, IKARS family zinc-finger 1, family, including GATA1, GATA2 and GATA3, serve an inhib- AT-rich interaction domain 5B, CCAAT/enhancer-binding iting role in leukemia. The present study demonstrated that protein and cyclin dependent kinase inhibitor 2A, may lead to GATA4 was upregulated in children with acute lymphoblastic the development of ALL (7,8). leukemia (ALL). Results from a number of functional experi- The GATA-binding protein family of zinc-finger tran- ments, including cell proliferation analysis, cell cycle analysis, scription factors comprises six members, including GATA1, cell apoptosis assay and Transwell migration and invasion GATA2, GATA3, GATA4, GATA5 and GATA6 (9), which analyses, have suggested that high expression of GATA4 may bind to GATA sequences in the DNA with the consensus facilitate proliferation and metastasis, and suppress apoptosis 5'-WGATAR-3', where W is either T or A nucleotides and R is in ALL cells. Chromatin immunoprecipitation assay and lucif- either G or A (10,11). GATA4 was originally revealed to serve erase reporter assay revealed that GATA4 was a transcription an important role in cardiac development (12,13); subsequent factor that activated mouse double minute 2 homolog (MDM2) studies have reported that GATA4 mediated apoptosis (14,15) and B cell lymphoma 2 (BCL2) expression in ALL cells. and regulated the mRNA expression of B cell lymphoma 2 BCL2 is a key anti-apoptosis protein that was demonstrated (BCL2) (16) and BCL‑XL (17), and serves as a survival factor to suppress cell apoptosis. In addition, GATA4 was revealed to in carcinoma. A number of GATA family proteins have been regulate p53 through the transcriptional activation of MDM2, revealed to serve inhibitory roles in leukemia, including subsequently influencing cell cycle and apoptosis. Results GATA1, GATA2 and GATA3 (18-21). However, the expression from the present study suggested that GATA4 may be a key and function of GATA4 in ALL remains unknown. marker in ALL diagnosis and a potential target of molecular The present study demonstrated that GATA4 expression therapy. was upregulated in ALL and binds to the promoter region of BCL2 and mouse double minute 2 homolog (Mdm2), activating Introduction their transcription. MDM2 protein expression was revealed to negatively regulate the expression of p53, thereby inhibiting Acute lymphoblastic leukemia (ALL) predominantly occurs in apoptosis and promoting cell cycle. In conclusion, the present children between the ages of 2 and 5 years, but may also occur results suggested that GATA4 may be a marker for ALL diag- in adults (1-4). Over the past decade, under different treatments, nosis and a target of molecular therapy. the survival rate of childhood ALL has approached ~90% (1,5); however, the treatment of adult ALL still needs improve- Materials and methods ment (2,6). The activation or inhibition of various genes, including Cell culture and transfection. MOLT-4 adult ALL, Jurkat childhood ALL cell lines and H9 normal human T lympho- cyte cell lines were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured in RPMI-1640 Correspondence to: Dr Bo Zhang, Department of Pediatric Neurology, The First Hospital of Jilin University, 71 Xinmin Street, medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, Changchun, Jilin 130000, P.R. China USA) that contained 1% penicillin-streptomycin and 10% E-mail: [email protected] fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, 5 Inc.) at 37˚C with 5% CO2. Then ~4x10 cells were trans- Key words: GATA-binding factor 4, acute lymphoblastic leukemia, fected with pCMV-Tag 2B empty vector (Youbio, Hunan, apoptosis, B cell lymphoma 2, mouse double minute 2 homolog China) FLAG-GATA4 (pCMV-Tag 2B-GATA4) or small interfering RNA (siRNA) against scrambled (SCR), GATA4 siRNA (siGATA4) or siGATA4 and sip21 simultaneously HAN et al: GATA4 PROMOTES CELL PROLIFERATION AND INHIBITS APOPTOSIS IN CHILDHOOD ALL 6291 using Lipofectamine 2000 reagent (Invitrogen; Thermo 5'-TCA AAC TCC TGA CCT CAA GTG-3' and 5'-TTA CCA TCA Fisher Scientific, Inc.) according the manufacturer's protocol. TAA GCC TAC AGA CC-3'; p53, 5'-GAC CTA TGG AAA CTA Following 48 h transfection, cells were collected by 800 x g CTT CCT G-3' and 5'-CAT TCT GGG AGC TTC ATC TG-3'; p21, centrifugation at 4˚C for 5 min and used for the further experi- GCA TGA CAG ATT TCT ACC AC-3' and 5'-GAC TAA GGC ments. siRNA sequences were as follows: siGATA4#1, AAC AGA AGA TGT AGA G; GAD D45, 5'-CGA GAA CGA CAT CAA CGG CCG CTC ATC AAG CCT; siGATA4#2, AAT CTC GTA CAT CC-3' and 5'-ATG AAT GTG GAT TCG TCA CC-3'; 14-3-3σ, GAT ATG TTT GAC; sip21, AAC TTC GAC TTT GTC ACC 5'-AGA CAA CCT AAC ACT TTG GAC-3' and 5'-AGG AAA GAG. GAA GGA TGA CAC CC-3'; GAP DH, 5'-CAT TTC CTG GTA TGA CAA CGA-3' and 5'-TAC ATG GCA ACT GTG AGG AG-3'. Blood samples. A total of 42 blood samples from patients with Relative mRNA expression levels of indicated genes were ALL and 42 samples from healthy controls were collected from calculated by the 2-ΔΔCq method (22). GAPDH was used as patients at the First Hospital of Jilin University (Changchun, internal control and for normalization. Each experiment was China) between 2010 and 2016. All patients had been informed performed at least 3 times. about the nature of the experiments and provided written informed consent. The study was approved by the Ethics Cell Counting Kit‑8 (CCK‑8) proliferation assay. Following Committee of the First Hospital of Jilin University. 48 h transfection, cells (4x103 cells/well in 100 µl RPMI-1640 medium) were cultured in 96‑well plates at 37˚C. CCK‑8 solu- Western blot analysis. Cells (~4x106) were lysed with radio- tion (10 µl; Beyotime Institute of Biotechnology) was added to immunoprecipitation assay buffer (Beyotime Institute of each well and incubated at 37˚C for 3 h. A microplate reader Biotechnology, Haimen, China) containing a protease inhibitor was used to measure the absorbance at 450 nm; the absorbance cocktail (Beijing Transgen Biotech Co., Ltd., Beijing, China) indicated cells proliferation. Each experiment was performed at 4˚C for 30 min. Protein concentrations were measured using at least 3 times. the Bradford Reagent (Beyotime Institute of Biotechnology). A total of 40 µg protein was loaded in each well and resolved by Apoptosis assay. Adriamycin was purchased from Selleck 8% SDS-PAGE. Proteins were transferred to polyvinylidene Chemicals (Houston, TX, USA) and dissolved in phos- fluoride membranes, which were subsequently blocked with phate-buffered saline (PBS). Following 48 h transfection, 5% non‑fat milk at 37˚C for 1 h. The membranes were incu- Adriamycin (5 µg/ml) was added to the culture medium and bated with the following primary antibodies at 4˚C overnight: incubated for 24 h at 37˚C to induce apoptosis. Subsequently, anti-GATA4 (ab124265; 1:600) anti GADD45 (ab105060; apoptotic rates were examined with the Annexin V/fluorescein 1:3,000), anti-p21 (ab109520; 1:2,000), anti-14-3-3σ (ab14123; isothiocyanate (FITC) Apoptosis Detection kit (Abcam), 1:2,000) and anti-β-actin (1:1,000) from Abcam (Cambridge, according to the manufacturer's protocol. Briefly, approxi- MA, USA); and anti-FLAG (F1804 1:5,000), anti-MDM2 mately 4x105 cells were collected by 800 x g centrifugation at (SAB4300601; 1:2,000), anti-BCL2 (SAB4300340; 1:500) and 4˚C for 5 min, washed with PBS and stained with Annexin V anti-p53 (P9249; 1:1,000) from Sigma-Aldrich (Merck KGaA, and propidium iodide. Attune™ NxT Software (version 1.0; Darmstadt, Germany). Membranes were washed three times Thermo Fisher Scientific, Inc.) was used to analyze apoptotic with TBS + 1% Tween-20 and incubated with horseradish cells using a flow cytometer. Each experiment was performed peroxidase‑conjugated secondary goat anti‑mouse immuno- at least 3 times. globulin (Ig)G (ab6728; 1:5,000; Abcam) or goat anti-rabbit IgG (ab6721; 1:5,000; Abcam) at room temperature for 1 h. Transwell migration and invasion assay. Costar Transwell Immunoreactive protein bands were visualized using the chambers (Corning Inc., Corning, NY, USA) were used to Enhanced Chemiluminescence kit (Beyotime Institute of detect the cell migration and invasion ability. Uncoated Biotechnology). Each experiment was performed at least Transwell inserts were used to assess cell migration ability, 3 times. whereas Transwell inserts precoated with Matrigel (BD Biosciences, San Jose, CA, USA) were used to determine cell Reverse transcription‑quantitative polymerase chain reaction invasion ability. Jurkat cells were transfected for 48 h, resus- (RT‑qPCR). Total RNA was extracted from 3x106 cells using pended in RPMI-1640 without FBS, and plated (2x104 cells) the RNAprep Pure kit (Tiangen Biotech Co., Ltd., Beijing, into the upper chamber; the lower chamber was filled with China), following the manufacturer's protocol. Total RNA 500 µl RPMI-1640 supplemented with 10% FBS. Cells were (2 µg) was reverse transcribed into cDNA using the FastKing incubated at 37˚C with 5% CO2 in a humidified air atmosphere RT kit (Tiangen Biotech Co., Ltd.), according to the manufac- for 24 h.
Load more

Recommended publications
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Gata4 Potentiates Second Heart Field Proliferation and Hedgehog Signaling for Cardiac Septation
    Gata4 potentiates second heart field proliferation and Hedgehog signaling for cardiac septation Lun Zhoua,b,1, Jielin Liuc,1, Menglan Xianga, Patrick Olsona, Alexander Guzzettad,e,f, Ke Zhangg,h, Ivan P. Moskowitzd,e,f,2,3, and Linglin Xiea,c,2,3 aDepartment of Basic Sciences, University of North Dakota, Grand Forks, ND 58202; bDepartment of Gerontology, Tongji Hospital, Huazhong University of Science and Technology, Wuhan, Hubei, 430030, China; cDepartment of Nutrition and Food Sciences, Texas A&M University, College Station, TX 77843; dDepartment of Pediatrics, The University of Chicago, Chicago, IL 60637; eDepartment of Pathology, The University of Chicago, Chicago, IL 60637; fDepartment of Human Genetics, The University of Chicago, Chicago, IL 60637; gDepartment of Pathology, University of North Dakota, Grand Forks, ND 58202; and hNorth Dakota Idea Network of Biomedical Research Excellence Bioinformatics Core; University of North Dakota, Grand Forks ND 58202 Edited by Eric N. Olson, University of Texas Southwestern Medical Center, Dallas, TX, and approved January 13, 2017 (received for review March 29, 2016) GATA4, an essential cardiogenic transcription factor, provides a model (32–38). These observations lay the groundwork for investigating for dominant transcription factor mutations in human disease. Dom- the molecular pathways required for atrial septum formation in inant GATA4 mutations cause congenital heart disease (CHD), specif- SHF cardiac progenitor cells. ically atrial and atrioventricular septal defects (ASDs and AVSDs). We We investigated the lineage-specific requirement for Gata4 in found that second heart field (SHF)-specific Gata4 heterozygote em- atrial septation and found that SHF-specific heterozygote Gata4 bryos recapitulated the AVSDs observed in germline Gata4 heterozy- knockout recapitulated the AVSDs observed in germline hetero- gote embryos.
    [Show full text]
  • LHX3 Interacts with Inhibitor of Histone Acetyltransferase Complex Subunits LANP and TAF-1B to Modulate Pituitary Gene Regulation
    LHX3 Interacts with Inhibitor of Histone Acetyltransferase Complex Subunits LANP and TAF-1b to Modulate Pituitary Gene Regulation Chad S. Hunter1.¤, Raleigh E. Malik2., Frank A. Witzmann3, Simon J. Rhodes1,2,3* 1 Department of Biology, Indiana University-Purdue University Indianapolis, Indiana, United States of America, 2 Department of Biochemistry and Molecular Biology, Indiana School of Medicine, Indianapolis, Indiana, United States of America, 3 Department of Cellular and Integrative Physiology, Indiana University School of Medicine, Indianapolis, Indiana, United States of America Abstract LIM-homeodomain 3 (LHX3) is a transcription factor required for mammalian pituitary gland and nervous system development. Human patients and animal models with LHX3 gene mutations present with severe pediatric syndromes that feature hormone deficiencies and symptoms associated with nervous system dysfunction. The carboxyl terminus of the LHX3 protein is required for pituitary gene regulation, but the mechanism by which this domain operates is unknown. In order to better understand LHX3-dependent pituitary hormone gene transcription, we used biochemical and mass spectrometry approaches to identify and characterize proteins that interact with the LHX3 carboxyl terminus. This approach identified the LANP/pp32 and TAF-1b/SET proteins, which are components of the inhibitor of histone acetyltransferase (INHAT) multi-subunit complex that serves as a multifunctional repressor to inhibit histone acetylation and modulate chromatin structure. The protein domains of LANP and TAF-1b that interact with LHX3 were mapped using biochemical techniques. Chromatin immunoprecipitation experiments demonstrated that LANP and TAF-1b are associated with LHX3 target genes in pituitary cells, and experimental alterations of LANP and TAF-1b levels affected LHX3-mediated pituitary gene regulation.
    [Show full text]
  • Genetic Determinants and Epigenetic Effects of Pioneer-Factor Occupancy
    ARTICLES https://doi.org/10.1038/s41588-017-0034-3 Genetic determinants and epigenetic effects of pioneer-factor occupancy Julie Donaghey1,2, Sudhir Thakurela 1,2, Jocelyn Charlton2,3, Jennifer S. Chen2, Zachary D. Smith1,2, Hongcang Gu1, Ramona Pop2, Kendell Clement1,2, Elena K. Stamenova1, Rahul Karnik1,2, David R. Kelley 2, Casey A. Gifford1,2,5, Davide Cacchiarelli1,2,6, John L. Rinn1,2,7, Andreas Gnirke1, Michael J. Ziller4 and Alexander Meissner 1,2,3* Transcription factors (TFs) direct developmental transitions by binding to target DNA sequences, influencing gene expres- sion and establishing complex gene-regultory networks. To systematically determine the molecular components that enable or constrain TF activity, we investigated the genomic occupancy of FOXA2, GATA4 and OCT4 in several cell types. Despite their classification as pioneer factors, all three TFs exhibit cell-type-specific binding, even when supraphysiologically and ectopically expressed. However, FOXA2 and GATA4 can be distinguished by low enrichment at loci that are highly occupied by these fac- tors in alternative cell types. We find that expression of additional cofactors increases enrichment at a subset of these sites. Finally, FOXA2 occupancy and changes to DNA accessibility can occur in G1-arrested cells, but subsequent loss of DNA meth- ylation requires DNA replication. rganismal development is orchestrated by the selective use the regulatory capabilities of the presumed pioneer TFs FOXA2, and distinctive interpretation of identical genetic material GATA4 and OCT4, which are frequently studied in development Oin each cell. During this process, TFs coordinate protein and used in cellular reprogramming. complexes at associated promoter and distal enhancer elements to modulate gene expression.
    [Show full text]
  • Nuclear Receptor Gene Polymorphisms and Warfarin Dose Requirements in the Quebec Warfarin Cohort
    The Pharmacogenomics Journal (2019) 19:147–156 https://doi.org/10.1038/s41397-017-0005-1 ARTICLE Nuclear receptor gene polymorphisms and warfarin dose requirements in the Quebec Warfarin Cohort 1,2,3 1,2,3 1,2,4 1,2,3 Payman Shahabi ● Félix Lamothe ● Stéphanie Dumas ● Étienne Rouleau-Mailloux ● 1,2 1,2 1,2 1,2 1,2 Yassamin Feroz Zada ● Sylvie Provost ● Geraldine Asselin ● Ian Mongrain ● Diane Valois ● 1,2 1,2 4 1,2,3 Marie-Josée Gaulin Marion ● Louis-Philippe Lemieux Perreault ● Sylvie Perreault ● Marie-Pierre Dubé Received: 7 January 2017 / Revised: 24 August 2017 / Accepted: 18 September 2017 / Published online: 3 January 2018 © The Author(s) 2017. This article is published with open access Abstract Warfarin is primarily metabolized by cytochrome 2C9, encoded by gene CYP2C9. Here, we investigated whether variants in nuclear receptor genes which regulate the expression of CYP2C9 are associated with warfarin response. We used data from 906 warfarin users from the Quebec Warfarin Cohort (QWC) and tested the association of warfarin dose requirement at 3 months following the initiation of therapy in nine nuclear receptor genes: NR1I3, NR1I2, NR3C1, ESR1, GATA4, RXRA, VDR, CEBPA, and HNF4A. Three correlated SNPs in the VDR gene (rs4760658, rs11168292, and rs11168293) were = × −5 = × −4 = × −4 1234567890 associated with dose requirements of warfarin (P 2.68 10 , P 5.81 10 , and P 5.94 10 , respectively). Required doses of warfarin were the highest for homozygotes of the minor allele at the VDR variants (P < 0.0026). Variants in the VDR gene were associated with the variability in response to warfarin, emphasizing the possible clinical relevance of nuclear receptor gene variants on the inter-individual variability in drug metabolism.
    [Show full text]
  • Notch Controls Multiple Pancreatic Cell Fate Regulators Through Direct Hes1-Mediated Repression
    bioRxiv preprint doi: https://doi.org/10.1101/336305; this version posted June 1, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Notch Controls Multiple Pancreatic Cell Fate Regulators Through Direct Hes1-mediated Repression by Kristian H. de Lichtenberg1, Philip A. Seymour1, Mette C. Jørgensen1, Yung-Hae Kim1, Anne Grapin-Botton1, Mark A. Magnuson2, Nikolina Nakic3,4, Jorge Ferrer3, Palle Serup1* 1 Novo Nordisk Foundation Center for Stem Cell Biology (Danstem), University of Copenhagen, Denmark. 2 Center for Stem Cell Biology, Vanderbilt University, Tennessee, USA. 3 Section on Epigenetics and Disease, Imperial College London, UK. 4 Current Address: GSK, Stevenage, UK. *Corresponding Author: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/336305; this version posted June 1, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Notch signaling and its effector Hes1 regulate multiple cell fate choices in the developing pancreas, but few direct target genes are known. Here we use transcriptome analyses combined with chromatin immunoprecipitation with next-generation sequencing (ChIP-seq) to identify direct target genes of Hes1. ChIP-seq analysis of endogenous Hes1 in 266-6 cells, a model of multipotent pancreatic progenitor cells, revealed high-confidence peaks associated with 354 genes. Among these were genes important for tip/trunk segregation such as Ptf1a and Nkx6-1, genes involved in endocrine differentiation such as Insm1 and Dll4, and genes encoding non-pancreatic basic-Helic-Loop-Helix (bHLH) factors such as Neurog2 and Ascl1.
    [Show full text]
  • GATA4-Dependent Organ-Specific Endothelial Differentiation Controls Liver Development and Embryonic Hematopoiesis
    GATA4-dependent organ-specific endothelial differentiation controls liver development and embryonic hematopoiesis Cyrill Géraud, … , Kai Schledzewski, Sergij Goerdt J Clin Invest. 2017;127(3):1099-1114. https://doi.org/10.1172/JCI90086. Research Article Hepatology Vascular biology Microvascular endothelial cells (ECs) are increasingly recognized as organ-specific gatekeepers of their microenvironment. Microvascular ECs instruct neighboring cells in their organ-specific vascular niches through angiocrine factors, which include secreted growth factors (angiokines), extracellular matrix molecules, and transmembrane proteins. However, the molecular regulators that drive organ-specific microvascular transcriptional programs and thereby regulate angiodiversity are largely elusive. In contrast to other ECs, which form a continuous cell layer, liver sinusoidal ECs (LSECs) constitute discontinuous, permeable microvessels. Here, we have shown that the transcription factor GATA4 controls murine LSEC specification and function. LSEC-restricted deletion of Gata4 caused transformation of discontinuous liver sinusoids into continuous capillaries. Capillarization was characterized by ectopic basement membrane deposition, formation of a continuous EC layer, and increased expression of VE-cadherin. Correspondingly, ectopic expression of GATA4 in cultured continuous ECs mediated the downregulation of continuous EC-associated transcripts and upregulation of LSEC-associated genes. The switch from discontinuous LSECs to continuous ECs during embryogenesis caused
    [Show full text]
  • Inconsistency in Using Early Differentiation Markers of Human Pluripotent Stem Cells
    International Research Journal of Medicine and Biomedical Sciences Vol.6 (2),pp. 11-18, May 2021 Available online at http://www.journalissues.org/IRJMBS/ https://doi.org/10.15739/irjmbs.21.003 Copyright © 2021 Author(s) retain the copyright of this article ISSN 2488-9032 Review Inconsistency in using early differentiation markers of human pluripotent stem cells Received 15 February, 2021 Revised 4 April, 2021 Accepted 15 April, 2021 Published 8 April, 2021 Hassan H Kaabi1* Advances in the field of human pluripotent stem cells (hPSC) have prompted researchers to advocate for the increased development of dependable 1Department of Oral Medicine therapies to cure degenerative diseases and replace damaged tissues. hPSCs and Diagnostic Sciences,College have a one-of-a-kind ability to differentiate into all cell types in the body. The of Dentistry, King Saud ability to characterise homogeneous primary cell populations, such as University, P.O. Box 60169, pluripotent stem cells and germ layer cells, is required for the efficient Riyadh 11545, Saudi Arabia. generation of adult cells. Several in vitro differentiation protocols for germ layer lineages have been extensively researched. There is, however, no Author’s Email: standard set of markers that can be used to separate endoderm, ectoderm, [email protected] and mesoderm populations from hPSC differentiation cultures. This review discusses the inconsistency among studies in identifying endodermal, mesodermal, and ectodermal cells using markers. The search was restricted to markers used in the last 5 years to identify differentiated cells of the three germ layers from hPSCs. The focus of this review, however, is on the most commonly used early differentiation markers.
    [Show full text]
  • Cardiac-Specific Transcription Factor Genes Smad4 and Gata4 Cooperatively Regulate Cardiac Valve Development
    Corrections MEDICAL SCIENCES DEVELOPMENTAL BIOLOGY Correction for “Irradiation induces bone injury by damaging Correction for “Cardiac-specific transcription factor genes Smad4 bone marrow microenvironment for stem cells,” by Xu Cao, and Gata4 cooperatively regulate cardiac valve development,” by Xiangwei Wu, Deborah Frassica, Bing Yu, Lijuan Pang, Lingling Ivan P. Moskowitz, Jun Wang, Michael A. Peterson, William Xian, Mei Wan, Weiqi Lei, Michael Armour, Erik Tryggestad, T. Pu, Alexander C. Mackinnon, Leif Oxburgh, Gerald John Wong, Chun Yi Wen, William Weijia Lu, and Frank C. Chu, Molly Sarkar, Charles Berul, Leslie Smoot, Elizabeth J. Frassica, which appeared in issue 4, January 25, 2011, of Proc J. Robertson, Robert Schwartz, Jonathan G. Seidman, and Natl Acad Sci USA (108:1609–1614; first published January 10, Christine E. Seidman, which appeared in issue 10, March 8, 2011; 10.1073/pnas.1015350108). 2011, of Proc Natl Acad Sci USA (108:4006–4011; first published The authors note that their conflict of interest statement was February 17, 2011; 10.1073/pnas.1019025108). omitted during publication. The authors declare that John Wong The authors note that the title appeared incorrectly. The title has a research service contract with Gulmay Medical, Inc. in the should instead appear as “Transcription factor genes Smad4 and transfer of the SARRP technology from Johns Hopkins to the Gata4 cooperatively regulate cardiac valve development.” The company. The SARRP was used by Dr. Xu Cao to irradiate his online version has been corrected. study animals, and was only peripherally related to the subject matter of the manuscript. Additionally, the specific unit was www.pnas.org/cgi/doi/10.1073/pnas.1103973108 constructed at Johns Hopkins with grant support from the National Cancer Institute (US), and not by Gulmay.
    [Show full text]
  • The Hormone-Bound Vitamin D Receptor Regulates Turnover of Target
    The hormone-bound vitamin D receptor regulates turnover of target proteins of the SCFFBW7 E3 ligase By Reyhaneh Salehi Tabar Department of Experimental Medicine McGill University Montreal, QC, Canada April 2016 A thesis submitted to McGill University in partial fulfillment of the requirements of the degree of Doctor of Philosophy © Reyhaneh Salehi Tabar 1 Table of Contents Abbreviations ................................................................................................................................................ 7 Abstract ....................................................................................................................................................... 10 Rèsumè ....................................................................................................................................................... 13 Acknowledgements ..................................................................................................................................... 16 Preface ........................................................................................................................................................ 17 Contribution of authors .............................................................................................................................. 18 Chapter 1-Literature review........................................................................................................................ 20 1.1. General introduction and overview of thesis ............................................................................
    [Show full text]
  • PDF-Document
    Supplementary Material Investigating the role of microRNA and Transcription Factor co-regulatory networks in Multiple Sclerosis pathogenesis Nicoletta Nuzziello1, Laura Vilardo2, Paride Pelucchi2, Arianna Consiglio1, Sabino Liuni1, Maria Trojano3 and Maria Liguori1* 1National Research Council, Institute of Biomedical Technologies, Bari Unit, Bari, Italy 2National Research Council, Institute of Biomedical Technologies, Segrate Unit, Milan, Italy 3Department of Basic Sciences, Neurosciences and Sense Organs, University of Bari, Bari, Italy Supplementary Figure S1 Frequencies of GO terms and canonical pathways. (a) Histogram illustrates the GO terms associated to assembled sub-networks. (b) Histogram illustrates the canonical pathways associated to assembled sub-network. a b Legends for Supplementary Tables Supplementary Table S1 List of feedback (FBL) and feed-forward (FFL) loops in miRNA-TF co-regulatory network. Supplementary Table S2 List of significantly (adj p-value < 0.05) GO-term involved in MS. The first column (from the left) listed the GO-term (biological processes) involved in MS. For each functional class, the main attributes (gene count, p-value, adjusted p-value of the enriched terms for multiple testing using the Benjamini correction) have been detailed. In the last column (on the right), we summarized the target genes involved in each enriched GO-term. Supplementary Table S3 List of significantly (adj p-value < 0.05) enriched pathway involved in MS. The first column (from the left) listed the enriched pathway involved in MS. For each pathway, the main attributes (gene count, p-value, adjusted p-value of the enriched terms for multiple testing using the Benjamini correction) have been detailed. In the last column (on the right), we summarized the target genes involved in each enriched pathway.
    [Show full text]