Cardiac-Specific Transcription Factor Genes Smad4 and Gata4 Cooperatively Regulate Cardiac Valve Development
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Recombinant Human TGF-Beta 2 Protein
ACROBiosystems Recombinant Human TGF-Beta 2 Protein Cat. # TG2-H4213 For Research and Further Cell Culture Manufacturing Use Source: Bioactivity: Recombinant Human TGF Beta 2 Protein (rhTGFB2) The bio-activity was determined by its ability to Ala 303 - Ser 414 (Accession # NP_003229.1) was inhibit IL-4 induced HT-2 cell proliferation. ED50<0.1 produced in human HEK293 cells at ACRObiosystems. ng/ml, corresponding to a specific activity of >1X107 Unit/mg Molecular Characterization: Formulation: rhTGFB2 contains no “tags” and has a calculated MW of 12.7 kDa (monomer). DTT-reduced protein migrates Lyophilized from 0.22 μm filtered solution in TFA, as a 13 kDa polypeptide and the non-reduced cystine- acetonitrile. Normally Mannitol or Trehalose are linked homodimer migrates as a 25 kDa protein. added as protectants before lyophilization. Contact us for customized product format or Endotoxin: formulation. Less than 1.0 EU per μg of the rhTGFB2 by the LAL Reconstitution : method. See Certificate of Analysis for details of Purity: reconstitution instruction and specific concentration. >98% as determined by SDS-PAGE of reduced (+) and Storage: non-reduced (-) rhTGFB2. Avoid repeated freeze-thaw cycles. No activity loss was observed after storage at: SDS-PAGE: • 4-8℃ for 1 year in lyophilized state The purity of rhTGFB2 • 4-8℃ for 1 month under sterile conditions after was determined by SDS- reconstitution PAGE of reduced (+) and • -20 ℃ to -70 ℃ for 3 months under sterile non-reduced (-) rhTGFB2 conditions after reconstitution and staining overnight with Coomassie Blue. Background: Transforming growth factor beta 2 ( TGFB2) is also known as TGF-β2, TGF-beta2, Glioblastoma-derived T-cell suppressor factor, G-TSF, BSC-1 cell growth inhibitor, Polyergin, Cetermin, and is a polypeptide member of the transforming growth factor beta superfamily of cytokines. -
UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii -
Role of TGF-Β3 in the Regulation of Immune Responses T
Role of TGF-β3 in the regulation of immune responses T. Okamura1,2, K. Morita1, Y. Iwasaki1, M. Inoue1, T. Komai1, K. Fujio1, K. Yamamoto1 1Department of Allergy and ABSTRACT ences, indicating their non-redundancy Rheumatology, Graduate School of Transforming growth factor-betas (12-16). The TGF-βs have opposite ef- Medicine, The University of Tokyo, (TGF-βs) are multifunctional cytokines fects on tissue fibrosis. Wound-healing Tokyo, Japan; that have been implicated in the regu- experiments revealed that TGF-β1 2Max Planck-The University of Tokyo Center for Integrative Inflammology, lation of a broad range of biological and TGF-β2 cause fibrotic scarring The University of Tokyo, Tokyo, Japan. processes, including cell proliferation, responses and that TGF-β3 induces a Tomohisa Okamura, MD, PhD cell survival, and cell differentiation. scar-free response (17). Both TGF-β1 Kaoru Morita, MD The three isoforms identified in mam- and -β2 activate the collagen α2 (I) Yukiko Iwasaki, MD, PhD mals, TGF-β1, TGF-β2, and TGF-β3, gene promoter, resulting in increased Mariko Inoue, MD have high sequence homology, bind to collagen synthesis (18). It was also re- Toshihiko Komai, MD the same receptors, and show similar ported that TGF-β1, but not TGF-β3, is Keishi Fujio, MD, PhD biological functions in many in vitro a crucial factor in the development of Kazuhiko Yamamoto, MD, PhD studies. However, analysis of the in vivo pulmonary fibrosis (19). Most of the in- Please address correspondence to: functions of the three isoforms and mice formation on the immunological activ- Keishi Fujio, MD, PhD, deficient for each cytokine reveals strik- Department of Allergy and ity of TGF-βs derives from studies of Rheumatology, ing differences, illustrating their unique TGF-β1 and, in part, TGF-β2, whereas Graduate School of Medicine, biological importance and functional recent investigations have begun to il- The University of Tokyo, non-redundancy. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Transforming Growth Factor-Β Soluble Receptor III (TGF-Β Sriii)
Transforming Growth Factor-b Soluble Receptor III (TGF-b sRIII) Human, Recombinant Expressed in mouse NSO cells Product Number T4567 Product Description Reagent Transforming Growth Factor-b soluble Receptor III Recombinant human TGF-b sRIII is supplied as (TGF-b sRIII) is produced from a DNA sequence approximately 100 mg of protein lyophilized from a encoding the amino terminal (781 amino acid residue) 0.2 mm filtered solution in phosphate buffered saline extracellular domain of human TGF-b receptor type III (PBS) containing 5 mg of bovine serum albumin. protein.1 Mature human TGF-b sRIII, a 760 amino acid residue protein generated after cleavage of a 21 amino Preparation Instructions acid residue signal peptide, has a predicted molecular Reconstitute the contents of the vial using sterile mass of approximately 84 kDa. As a result of glycosy- phosphate-buffered saline (PBS) containing at least lation, recombinant TGF-b sRIII migrates as a 100 kDa 0.1% human serum albumin or bovine serum albumin. protein in SDS-PAGE. Prepare a stock solution of no less than 20 mg/ml. The transforming growth factor-b (TGF-b) family of Storage/Stability cytokines are multifunctional peptides; capable of Store at -20 °C. Upon reconstitution, store at 2 °C to influencing cell proliferation, growth, differentiation, and 8 °C for one month. For extended storage, freeze in other functions in a wide range of cell types. Most working aliquots. Repeated freezing and thawing is not mammalian cells express three abundant high affinity recommended. Do not store in a frost-free freezer. TGF receptors, which can bind and be cross-linked to 2 TGF-b. -
Gata4 Potentiates Second Heart Field Proliferation and Hedgehog Signaling for Cardiac Septation
Gata4 potentiates second heart field proliferation and Hedgehog signaling for cardiac septation Lun Zhoua,b,1, Jielin Liuc,1, Menglan Xianga, Patrick Olsona, Alexander Guzzettad,e,f, Ke Zhangg,h, Ivan P. Moskowitzd,e,f,2,3, and Linglin Xiea,c,2,3 aDepartment of Basic Sciences, University of North Dakota, Grand Forks, ND 58202; bDepartment of Gerontology, Tongji Hospital, Huazhong University of Science and Technology, Wuhan, Hubei, 430030, China; cDepartment of Nutrition and Food Sciences, Texas A&M University, College Station, TX 77843; dDepartment of Pediatrics, The University of Chicago, Chicago, IL 60637; eDepartment of Pathology, The University of Chicago, Chicago, IL 60637; fDepartment of Human Genetics, The University of Chicago, Chicago, IL 60637; gDepartment of Pathology, University of North Dakota, Grand Forks, ND 58202; and hNorth Dakota Idea Network of Biomedical Research Excellence Bioinformatics Core; University of North Dakota, Grand Forks ND 58202 Edited by Eric N. Olson, University of Texas Southwestern Medical Center, Dallas, TX, and approved January 13, 2017 (received for review March 29, 2016) GATA4, an essential cardiogenic transcription factor, provides a model (32–38). These observations lay the groundwork for investigating for dominant transcription factor mutations in human disease. Dom- the molecular pathways required for atrial septum formation in inant GATA4 mutations cause congenital heart disease (CHD), specif- SHF cardiac progenitor cells. ically atrial and atrioventricular septal defects (ASDs and AVSDs). We We investigated the lineage-specific requirement for Gata4 in found that second heart field (SHF)-specific Gata4 heterozygote em- atrial septation and found that SHF-specific heterozygote Gata4 bryos recapitulated the AVSDs observed in germline Gata4 heterozy- knockout recapitulated the AVSDs observed in germline hetero- gote embryos. -
Augmented and Accelerated Nephrogenesis in TGF-2 Heterozygous Mutant Mice
0031-3998/08/6306-0607 Vol. 63, No. 6, 2008 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2008 International Pediatric Research Foundation, Inc. Augmented and Accelerated Nephrogenesis in TGF-2 Heterozygous Mutant Mice SUNDER SIMS-LUCAS, GEORGINA CARUANA, JOHN DOWLING, MICHELLE M. KETT, AND JOHN F. BERTRAM Department of Anatomy and Developmental Biology [S.S.-L., G.C., J.F.B.], Monash University, Melbourne 3800, Australia; Department of Anatomical Pathology [J.D.], Alfred Hospital, Prahran 3181, Australia; Department of Physiology [M.M.K.], Monash University, Melbourne 3800, Australia ABSTRACT: Several members of the transforming growth factor- development than TGF-1 and TGF-3 (21). TGF-2 gene (TGF-) superfamily play key roles in kidney development, either expression has been detected in the kidney at embryonic day directly or indirectly regulating nephron number. Although low (E) 11.5 (22) and the protein localized in and around the nephron number is a risk factor for cardiovascular and renal disease, ureteric epithelium and nephron structures from E12.5 the implications of increased nephron number has not been examined (21,23). TGF-2 homozygous null mutant mice (TGF-2Ϫ/Ϫ) due to the absence of appropriate animal models. Here, using unbi- die within 24 h of birth due to defective lung development ased stereology we demonstrated that kidneys from TGF-2 het- erozygous (TGF-2ϩ/Ϫ) mice have approximately 60% more (24). The kidneys of these mice display progressive deterio- nephrons than wild-type mice at postnatal day 30. To determine ration of the ureteric tubules and an enlarged renal pelvis after whether augmented nephron number involved accelerated ureteric E15. -
LHX3 Interacts with Inhibitor of Histone Acetyltransferase Complex Subunits LANP and TAF-1B to Modulate Pituitary Gene Regulation
LHX3 Interacts with Inhibitor of Histone Acetyltransferase Complex Subunits LANP and TAF-1b to Modulate Pituitary Gene Regulation Chad S. Hunter1.¤, Raleigh E. Malik2., Frank A. Witzmann3, Simon J. Rhodes1,2,3* 1 Department of Biology, Indiana University-Purdue University Indianapolis, Indiana, United States of America, 2 Department of Biochemistry and Molecular Biology, Indiana School of Medicine, Indianapolis, Indiana, United States of America, 3 Department of Cellular and Integrative Physiology, Indiana University School of Medicine, Indianapolis, Indiana, United States of America Abstract LIM-homeodomain 3 (LHX3) is a transcription factor required for mammalian pituitary gland and nervous system development. Human patients and animal models with LHX3 gene mutations present with severe pediatric syndromes that feature hormone deficiencies and symptoms associated with nervous system dysfunction. The carboxyl terminus of the LHX3 protein is required for pituitary gene regulation, but the mechanism by which this domain operates is unknown. In order to better understand LHX3-dependent pituitary hormone gene transcription, we used biochemical and mass spectrometry approaches to identify and characterize proteins that interact with the LHX3 carboxyl terminus. This approach identified the LANP/pp32 and TAF-1b/SET proteins, which are components of the inhibitor of histone acetyltransferase (INHAT) multi-subunit complex that serves as a multifunctional repressor to inhibit histone acetylation and modulate chromatin structure. The protein domains of LANP and TAF-1b that interact with LHX3 were mapped using biochemical techniques. Chromatin immunoprecipitation experiments demonstrated that LANP and TAF-1b are associated with LHX3 target genes in pituitary cells, and experimental alterations of LANP and TAF-1b levels affected LHX3-mediated pituitary gene regulation. -
Growth Factors and Signaling Proteins in Craniofacial Development Robert Spears and Kathy K.H
Growth Factors and Signaling Proteins in Craniofacial Development Robert Spears and Kathy K.H. Svoboda Regulation of growth and development is controlled by the interactions of cells with each other and the extracellular environment through signal transduction pathways that control the differentiation process by stimulating proliferation or causing cell death. This review will define the common signaling molecules and provide an overview of the general principles of signal transduction events. We also review the signal transduction pathways controlling one specific mechanism found in craniofacial development termed epithelial- mesenchymal transformation (EMT) employed during gastrulation, cranial neural crest migration, and secondary palate formation. Semin Orthod 11:184–198 © 2005 Elsevier Inc. All rights reserved. Growth Factors and receptors (GPCR, Fig 1A), ion-channel receptors, tyrosine Signal Transduction kinase-linked receptors, and receptors with intrinsic enzy- matic activity.2 The GPCRs are characterized by multiple ntracellular signaling is usually triggered by a cell surface transmembrane domains (usually seven) that wind the pro- Ievent such as a specific protein (ligand) binding to a cell tein in and out of the membrane in a serpentine conformation surface receptor to form a receptor-ligand interaction. Cells (Fig 1A, GPCR). The ion-channel receptors are closely re- contacting neighboring cells or their surrounding noncellular lated and actually open a membrane channel when the tissue are termed cell-cell or cell-extracellular matrix (ECM) ligand binds. Many cytokine receptors are in the tyrosine contacts (Fig 1A).1 Interactions of cells with other cells or the kinase-linked class as they lack intrinsic activity; but when ECM can stimulate many reactions, including: increased cell the ligand binds, intracellular tyrosine kinases become division, cell movement, differentiation, and even pro- activated to generate cellular changes. -
Genetic Determinants and Epigenetic Effects of Pioneer-Factor Occupancy
ARTICLES https://doi.org/10.1038/s41588-017-0034-3 Genetic determinants and epigenetic effects of pioneer-factor occupancy Julie Donaghey1,2, Sudhir Thakurela 1,2, Jocelyn Charlton2,3, Jennifer S. Chen2, Zachary D. Smith1,2, Hongcang Gu1, Ramona Pop2, Kendell Clement1,2, Elena K. Stamenova1, Rahul Karnik1,2, David R. Kelley 2, Casey A. Gifford1,2,5, Davide Cacchiarelli1,2,6, John L. Rinn1,2,7, Andreas Gnirke1, Michael J. Ziller4 and Alexander Meissner 1,2,3* Transcription factors (TFs) direct developmental transitions by binding to target DNA sequences, influencing gene expres- sion and establishing complex gene-regultory networks. To systematically determine the molecular components that enable or constrain TF activity, we investigated the genomic occupancy of FOXA2, GATA4 and OCT4 in several cell types. Despite their classification as pioneer factors, all three TFs exhibit cell-type-specific binding, even when supraphysiologically and ectopically expressed. However, FOXA2 and GATA4 can be distinguished by low enrichment at loci that are highly occupied by these fac- tors in alternative cell types. We find that expression of additional cofactors increases enrichment at a subset of these sites. Finally, FOXA2 occupancy and changes to DNA accessibility can occur in G1-arrested cells, but subsequent loss of DNA meth- ylation requires DNA replication. rganismal development is orchestrated by the selective use the regulatory capabilities of the presumed pioneer TFs FOXA2, and distinctive interpretation of identical genetic material GATA4 and OCT4, which are frequently studied in development Oin each cell. During this process, TFs coordinate protein and used in cellular reprogramming. complexes at associated promoter and distal enhancer elements to modulate gene expression. -
Transforming Growth Factor-Β Gene Silencing Using Adenovirus Expressing TGF-Β1 Or TGF-Β2 Shrna
Cancer Gene Therapy (2013) 20, 94–100 & 2013 Nature America, Inc. All rights reserved 0929-1903/13 www.nature.com/cgt ORIGINAL ARTICLE Transforming growth factor-b gene silencing using adenovirus expressing TGF-b1 or TGF-b2 shRNA SOh1,2, E Kim1,2, D Kang1,3, M Kim1, J-H Kim4 and JJ Song1 Tumor cells secrete a variety of cytokines to outgrow and evade host immune surveillance. In this context, transforming growth factor-b1 (TGF-b1) is an extremely interesting cytokine because it has biphasic effects in cancer cells and normal cells. TGF-b1 acts as a growth inhibitor in normal cells, whereas it promotes tumor growth and progression in tumor cells. Overexpression of TGF-b1 in tumor cells also provides additional oncogenic activities by circumventing the host immune surveillance. Therefore, this study ultimately aimed to test the hypothesis that suppression of TGF-b1 in tumor cells by RNA interference can have antitumorigenic effects. However, we demonstrated here that the interrelation between TGF-b isotypes should be carefully considered for the antitumor effect in addition to the selection of target sequences with highest efficacy. The target sequences were proven to be highly specific and effective for suppressing both TGF-b1 mRNA and protein expression in cells after infection with an adenovirus expressing TGF-b1 short hairpin RNA (shRNA). A single base pair change in the shRNA sequence completely abrogated the suppressive effect on TGF-b1. Surprisingly, the suppression of TGF-b1 induced TGF-b3 upregulation, and the suppression of TGF-b2 induced another unexpected downregulation of both TGF-b1 and TGF-b3. -
Tgf-Β Receptor Ii
CONTEXT SPECIFIC SIGNALING OF TGF-β RECEPTOR II DISSERTATION ZUR ERLANGUNG DES AKADEMISCHEN GRADES DES DOKTORS DER NATURWISSENSCHAFTEN (DR. RER. NAT.) EINGEREICHT IM FACHBEREICH BIOLOGIE,CHEMIE,PHARMAZIE DER FREIEN UNIVERSITÄT BERLIN vorgelegt von DANIEL WALTER HORBELT AUS ERLENBACH AM MAIN 2010 Diese Arbeit wurde von Oktober 2004 bis August 2010 in der Arbeitsgruppe von Prof. Petra Knaus am Institut für Chemie-Biochemie der Freien Universität Berlin angefertigt. 1. GUTACHTER:PROF.DR.PETRA KNAUS 2. GUTACHTER: PD DR.PETER N. ROBINSON Disputation am 12.11.2010 . Contents List of Figures V List of Tables VII Summary IX Zusammenfassung XI 1 Introduction 1 1.1 The TGF-β superfamily . .1 1.2 Mechanisms of TGF-β signaling . .3 1.2.1 Secretion and activation of TGF-β ...................3 1.2.2 Ligand binding and receptor activation of TGF-β receptors . .3 1.2.3 TGF-β isoform specificity . .6 1.2.4 The TGF-β receptor II isoform TβRII-B and aim of the project: "Antibodies against TβRII-B" . .8 1.2.5 Activation of Smad signaling by TGF-β receptors . .9 1.2.6 TGF-β signaling through Smads . 12 1.2.7 Non-Smad signaling by TGF-β ..................... 13 1.2.8 Endocytic regulation of TGF-β signaling . 15 1.3 Marfan Syndrome and MFS-related diseases . 17 1.3.1 Classical Marfan Syndrome . 17 1.3.2 Marfan syndrome type II, Loeys-Dietz syndrome and Thoracic Aortic Aneurysms and Dissections syndrome . 19 1.4 Pathological remodeling in the aortic media and the development of aortic aneurysms . 21 1.5 Role of TGF-β in vascular remodeling .