DOCSLIB.ORG

Cardiac-Specific Transcription Factor Genes Smad4 and Gata4 Cooperatively Regulate Cardiac Valve Development

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cardiac-Specific Transcription Factor Genes Smad4 and Gata4 Cooperatively Regulate Cardiac Valve Development Corrections MEDICAL SCIENCES DEVELOPMENTAL BIOLOGY Correction for “Irradiation induces bone injury by damaging Correction for “Cardiac-specific transcription factor genes Smad4 bone marrow microenvironment for stem cells,” by Xu Cao, and Gata4 cooperatively regulate cardiac valve development,” by Xiangwei Wu, Deborah Frassica, Bing Yu, Lijuan Pang, Lingling Ivan P. Moskowitz, Jun Wang, Michael A. Peterson, William Xian, Mei Wan, Weiqi Lei, Michael Armour, Erik Tryggestad, T. Pu, Alexander C. Mackinnon, Leif Oxburgh, Gerald John Wong, Chun Yi Wen, William Weijia Lu, and Frank C. Chu, Molly Sarkar, Charles Berul, Leslie Smoot, Elizabeth J. Frassica, which appeared in issue 4, January 25, 2011, of Proc J. Robertson, Robert Schwartz, Jonathan G. Seidman, and Natl Acad Sci USA (108:1609–1614; first published January 10, Christine E. Seidman, which appeared in issue 10, March 8, 2011; 10.1073/pnas.1015350108). 2011, of Proc Natl Acad Sci USA (108:4006–4011; first published The authors note that their conflict of interest statement was February 17, 2011; 10.1073/pnas.1019025108). omitted during publication. The authors declare that John Wong The authors note that the title appeared incorrectly. The title has a research service contract with Gulmay Medical, Inc. in the should instead appear as “Transcription factor genes Smad4 and transfer of the SARRP technology from Johns Hopkins to the Gata4 cooperatively regulate cardiac valve development.” The company. The SARRP was used by Dr. Xu Cao to irradiate his online version has been corrected. study animals, and was only peripherally related to the subject matter of the manuscript. Additionally, the specific unit was www.pnas.org/cgi/doi/10.1073/pnas.1103973108 constructed at Johns Hopkins with grant support from the National Cancer Institute (US), and not by Gulmay. CORRECTIONS www.pnas.org/cgi/doi/10.1073/pnas.1104040108 www.pnas.org PNAS | April 5, 2011 | vol. 108 | no. 14 | 5921 Downloaded by guest on September 27, 2021 Cardiac-specific transcription factor genes Smad4 and Gata4 cooperatively regulate cardiac valve development Ivan P. Moskowitza,1,2, Jun Wangb, Michael A. Petersona, William T. Puc, Alexander C. Mackinnona, Leif Oxburghd, Gerald C. Chue, Molly Sarkarf, Charles Berulc, Leslie Smootc, Elizabeth J. Robertsong, Robert Schwartzb, Jonathan G. Seidmanh,1, and Christine E. Seidmanh,i,1,2 aDepartments of Pediatrics and Pathology, University of Chicago, Chicago, IL 60637; bInstitute of Biosciences and Technology, Texas A&M University System Health Science Center, Houston, TX 77030; cDepartment of Cardiology, Children’s Hospital Boston, Boston, MA 02115; dMaine Medical Center Research Institute, Scarborough, ME 04074; eDepartment of Pathology, Harvard Medical School, Boston, MA 02115; fCardiology Department, Cordis Corporation, Miami Lakes, FL 33014; gWellcome Trust Centre for Human Genetics, Oxford OX3 7BN, United Kingdom; hDepartment of Genetics, Harvard Medical School, Boston, MA 02115; and iHoward Hughes Medical Institute, Brigham and Women’s Hospital, Boston, MA, 02115 Contributed by Christine E. Seidman, January 4, 2011 (sent for review July 1, 2010) We report that the dominant human missense mutations G303E tae (19). The abnormalities produce substantial hemodynamic and G296S in GATA4, a cardiac-specific transcription factor gene, consequences that contribute to poor prognosis in affected pa- cause atrioventricular septal defects and valve abnormalities by tients and a virtually uniform requirement for surgical correction. disrupting a signaling cascade involved in endocardial cushion de- Human genetic studies have demonstrated that mutations in velopment. These GATA4 missense mutations, but not a mutation the gene encoding cardiac transcription factor GATA4 cause causing secundum atrial septal defects (S52F), demonstrated im- familial atrial secundum defects and, less commonly, sporadic paired protein interactions with SMAD4, a transcription factor re- AVSDs (20–23). quired for canonical bone morphogenetic protein/transforming We evaluated two families with dominant inheritance of AVSDs and identified two GATA4 missense mutations, G303E growth factor-β (BMP/TGF-β) signaling. Gata4 and Smad4 geneti- BIOLOGY β cally interact in vivo: atrioventricular septal defects result from en- and G296S. We investigated the canonical TGF- /BMP pathway DEVELOPMENTAL dothelial-specific Gata4 and Smad4 compound haploinsufficiency. effector SMAD4 and showed that G303E and G296S altered the transcriptional response to TGF-β/BMP activation. Deletion of Endothelial-specific knockout of Smad4 caused an absence of valve- Smad4 forming activity: Smad4-deficient endocardium was associated from the endocardium of mice caused severe maldevel- with acellular endocardial cushions, absent epithelial-to-mesenchy- opment of endocardial cushions and diminished expression of the Id2 gene. Together these studies define a transcriptio- mal transformation, reduced endocardial proliferation, and loss of nal network directing endocardial cushion formation involving Id2 expression in valve-forming regions. We show that Gata4 and Gata4, Smad4, and Id2. Smad4 cooperatively activated the Id2 promoter, that human GATA4 mutations abrogated this activity, and that Id2 deficiency Results in mice could cause atrioventricular septal defects. We suggest that Human Mutations in GATA4 Cause Endocardial Cushion Defects. From one determinant of the phenotypic spectrum caused by human a cohort of 103 probands with congenital heart defects, we se- GATA4 mutations is differential effects on GATA4/SMAD4 interac- quenced all protein-encoding exons of candidate genes, in- tions required for endocardial cushion development. cluding GATA4. Two GATA4 mutations were identified in probands from unrelated families (Fig. 1) with dominantly in- he atrioventricular canal, the valve-forming region between herited AVSDs. Tthe atria and ventricles, adopts a unique molecular and mor- Family A had six members with a spectrum of AVSDs (Fig. phological program during cardiac development that requires 1A). Sequence analyses of the proband revealed a heterozygous coordinated activity of myocardial and endocardial lineages. The G-to-A substitution at nucleotide 4 in exon 4 of GATA4, which cardiac valve anlage is the endocardial cushion, a swelling com- was also present in all affected Family A members (Fig. 1A), but posed of myocardial-derived extracellular matrix that becomes absent from over 500 ethnically matched controls. This variant populated primarily by endocardial-derived mesenchymal cells encodes replacement of a conserved glycine with glutamate at (1). The development of a mature valve structure from the en- amino acid position 303 (denoted G303E), just distal to the docardial cushion requires multiple distinct steps (2), including carboxyl-terminal zinc finger of the transcription factor. We activation and proliferation of endocardial cells, endothelial-to- concluded that GATA4 G303E caused AVSDs in Family A. mesenchymal transformation (EMT) of activated endocardial Family B had five individuals with AVSDs and four individuals cells, and maturation of the cellularized cushions into functional with electrophysiologic abnormalities (Fig. 1B). Sequence analy- valve leaflets. ses of the proband revealed a heterozygous G-to-A transition at Development of the atrioventricular endocardial cushions into nucleotide 886 of GATA4, which was also present in all affected the atrioventricular valves (tricuspid and mitral) and adjacent members of Family B (Fig. 1B), but absent from over 500 eth- portions of the atrial and ventricular septae requires Tgf-β and nically matched controls. This variant is predicted to substitute Bmp signaling. At least eight Tgf-β or Bmp ligands are expressed a conserved glycine with serine at amino acid position 296 during valve formation (3, 4), and gene ablation of individual (denoted G296S), located directly adjacent to the nuclear local- ligands in model organisms produces phenotypes that range from pronounced valvuloseptal malformations to subtle valve matura- tion defects (5–18). Compound gene ablations of Bmp5/Bmp7 or Author contributions: I.P.M. and J.G.S. designed research; I.P.M., J.W., M.A.P., A.C.M., and Bmp6/Bmp7 produced more severe endocardial cushion defects M.S. performed research; I.P.M., W.T.P., L.O., G.C.C., C.B., L.S., E.J.R., and R.S. contributed than either single mutant did (16–18). These observations imply new reagents/analytic tools; I.P.M., J.G.S., and C.E.S. analyzed data; and I.P.M. and C.E.S. considerable redundancy of Tgf-β/Bmp signaling in the early wrote the paper. functions of this pathway in endocardial cushion development. The authors declare no conflict of interest. Human atrioventricular septal defects (AVSDs) are defined by 1I.P.M., J.G.S., and C.E.S. contributed equally to this study. variable abnormalities of the mitral and/or tricuspid valves in 2To whom correspondence may be addressed. E-mail: [email protected] conjunction with defects in the adjacent atrial or ventricular sep- or [email protected]. www.pnas.org/cgi/doi/10.1073/pnas.1019025108 PNAS Early Edition | 1of6 Fig. 1. GATA4 mutations cause endocardial cushion defects. (A) Family A pedigree with cosegregation of GATA4 G303E mutation (+) with congenital heart disease (Left). Note that five mutation carriers had endocardial cushion defects (Right). (B) Family B pedigree with cosegregation of GATA4 G296S muta- tion (+) with congenital heart disease (Left). Note that six mutation carriers had endocardial cushion
Load more

Recommended publications
  • Recombinant Human TGF-Beta 2 Protein
    ACROBiosystems Recombinant Human TGF-Beta 2 Protein Cat. # TG2-H4213 For Research and Further Cell Culture Manufacturing Use Source: Bioactivity: Recombinant Human TGF Beta 2 Protein (rhTGFB2) The bio-activity was determined by its ability to Ala 303 - Ser 414 (Accession # NP_003229.1) was inhibit IL-4 induced HT-2 cell proliferation. ED50<0.1 produced in human HEK293 cells at ACRObiosystems. ng/ml, corresponding to a specific activity of >1X107 Unit/mg Molecular Characterization: Formulation: rhTGFB2 contains no “tags” and has a calculated MW of 12.7 kDa (monomer). DTT-reduced protein migrates Lyophilized from 0.22 μm filtered solution in TFA, as a 13 kDa polypeptide and the non-reduced cystine- acetonitrile. Normally Mannitol or Trehalose are linked homodimer migrates as a 25 kDa protein. added as protectants before lyophilization. Contact us for customized product format or Endotoxin: formulation. Less than 1.0 EU per μg of the rhTGFB2 by the LAL Reconstitution : method. See Certificate of Analysis for details of Purity: reconstitution instruction and specific concentration. >98% as determined by SDS-PAGE of reduced (+) and Storage: non-reduced (-) rhTGFB2. Avoid repeated freeze-thaw cycles. No activity loss was observed after storage at: SDS-PAGE: • 4-8℃ for 1 year in lyophilized state The purity of rhTGFB2 • 4-8℃ for 1 month under sterile conditions after was determined by SDS- reconstitution PAGE of reduced (+) and • -20 ℃ to -70 ℃ for 3 months under sterile non-reduced (-) rhTGFB2 conditions after reconstitution and staining overnight with Coomassie Blue. Background: Transforming growth factor beta 2 ( TGFB2) is also known as TGF-β2, TGF-beta2, Glioblastoma-derived T-cell suppressor factor, G-TSF, BSC-1 cell growth inhibitor, Polyergin, Cetermin, and is a polypeptide member of the transforming growth factor beta superfamily of cytokines.
    [Show full text]
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
    [Show full text]
  • Role of TGF-Β3 in the Regulation of Immune Responses T
    Role of TGF-β3 in the regulation of immune responses T. Okamura1,2, K. Morita1, Y. Iwasaki1, M. Inoue1, T. Komai1, K. Fujio1, K. Yamamoto1 1Department of Allergy and ABSTRACT ences, indicating their non-redundancy Rheumatology, Graduate School of Transforming growth factor-betas (12-16). The TGF-βs have opposite ef- Medicine, The University of Tokyo, (TGF-βs) are multifunctional cytokines fects on tissue fibrosis. Wound-healing Tokyo, Japan; that have been implicated in the regu- experiments revealed that TGF-β1 2Max Planck-The University of Tokyo Center for Integrative Inflammology, lation of a broad range of biological and TGF-β2 cause fibrotic scarring The University of Tokyo, Tokyo, Japan. processes, including cell proliferation, responses and that TGF-β3 induces a Tomohisa Okamura, MD, PhD cell survival, and cell differentiation. scar-free response (17). Both TGF-β1 Kaoru Morita, MD The three isoforms identified in mam- and -β2 activate the collagen α2 (I) Yukiko Iwasaki, MD, PhD mals, TGF-β1, TGF-β2, and TGF-β3, gene promoter, resulting in increased Mariko Inoue, MD have high sequence homology, bind to collagen synthesis (18). It was also re- Toshihiko Komai, MD the same receptors, and show similar ported that TGF-β1, but not TGF-β3, is Keishi Fujio, MD, PhD biological functions in many in vitro a crucial factor in the development of Kazuhiko Yamamoto, MD, PhD studies. However, analysis of the in vivo pulmonary fibrosis (19). Most of the in- Please address correspondence to: functions of the three isoforms and mice formation on the immunological activ- Keishi Fujio, MD, PhD, deficient for each cytokine reveals strik- Department of Allergy and ity of TGF-βs derives from studies of Rheumatology, ing differences, illustrating their unique TGF-β1 and, in part, TGF-β2, whereas Graduate School of Medicine, biological importance and functional recent investigations have begun to il- The University of Tokyo, non-redundancy.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Transforming Growth Factor-Β Soluble Receptor III (TGF-Β Sriii)
    Transforming Growth Factor-b Soluble Receptor III (TGF-b sRIII) Human, Recombinant Expressed in mouse NSO cells Product Number T4567 Product Description Reagent Transforming Growth Factor-b soluble Receptor III Recombinant human TGF-b sRIII is supplied as (TGF-b sRIII) is produced from a DNA sequence approximately 100 mg of protein lyophilized from a encoding the amino terminal (781 amino acid residue) 0.2 mm filtered solution in phosphate buffered saline extracellular domain of human TGF-b receptor type III (PBS) containing 5 mg of bovine serum albumin. protein.1 Mature human TGF-b sRIII, a 760 amino acid residue protein generated after cleavage of a 21 amino Preparation Instructions acid residue signal peptide, has a predicted molecular Reconstitute the contents of the vial using sterile mass of approximately 84 kDa. As a result of glycosy- phosphate-buffered saline (PBS) containing at least lation, recombinant TGF-b sRIII migrates as a 100 kDa 0.1% human serum albumin or bovine serum albumin. protein in SDS-PAGE. Prepare a stock solution of no less than 20 mg/ml. The transforming growth factor-b (TGF-b) family of Storage/Stability cytokines are multifunctional peptides; capable of Store at -20 °C. Upon reconstitution, store at 2 °C to influencing cell proliferation, growth, differentiation, and 8 °C for one month. For extended storage, freeze in other functions in a wide range of cell types. Most working aliquots. Repeated freezing and thawing is not mammalian cells express three abundant high affinity recommended. Do not store in a frost-free freezer. TGF receptors, which can bind and be cross-linked to 2 TGF-b.
    [Show full text]
  • Gata4 Potentiates Second Heart Field Proliferation and Hedgehog Signaling for Cardiac Septation
    Gata4 potentiates second heart field proliferation and Hedgehog signaling for cardiac septation Lun Zhoua,b,1, Jielin Liuc,1, Menglan Xianga, Patrick Olsona, Alexander Guzzettad,e,f, Ke Zhangg,h, Ivan P. Moskowitzd,e,f,2,3, and Linglin Xiea,c,2,3 aDepartment of Basic Sciences, University of North Dakota, Grand Forks, ND 58202; bDepartment of Gerontology, Tongji Hospital, Huazhong University of Science and Technology, Wuhan, Hubei, 430030, China; cDepartment of Nutrition and Food Sciences, Texas A&M University, College Station, TX 77843; dDepartment of Pediatrics, The University of Chicago, Chicago, IL 60637; eDepartment of Pathology, The University of Chicago, Chicago, IL 60637; fDepartment of Human Genetics, The University of Chicago, Chicago, IL 60637; gDepartment of Pathology, University of North Dakota, Grand Forks, ND 58202; and hNorth Dakota Idea Network of Biomedical Research Excellence Bioinformatics Core; University of North Dakota, Grand Forks ND 58202 Edited by Eric N. Olson, University of Texas Southwestern Medical Center, Dallas, TX, and approved January 13, 2017 (received for review March 29, 2016) GATA4, an essential cardiogenic transcription factor, provides a model (32–38). These observations lay the groundwork for investigating for dominant transcription factor mutations in human disease. Dom- the molecular pathways required for atrial septum formation in inant GATA4 mutations cause congenital heart disease (CHD), specif- SHF cardiac progenitor cells. ically atrial and atrioventricular septal defects (ASDs and AVSDs). We We investigated the lineage-specific requirement for Gata4 in found that second heart field (SHF)-specific Gata4 heterozygote em- atrial septation and found that SHF-specific heterozygote Gata4 bryos recapitulated the AVSDs observed in germline Gata4 heterozy- knockout recapitulated the AVSDs observed in germline hetero- gote embryos.
    [Show full text]
  • Augmented and Accelerated Nephrogenesis in TGF-␤2 Heterozygous Mutant Mice
    0031-3998/08/6306-0607 Vol. 63, No. 6, 2008 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2008 International Pediatric Research Foundation, Inc. Augmented and Accelerated Nephrogenesis in TGF-␤2 Heterozygous Mutant Mice SUNDER SIMS-LUCAS, GEORGINA CARUANA, JOHN DOWLING, MICHELLE M. KETT, AND JOHN F. BERTRAM Department of Anatomy and Developmental Biology [S.S.-L., G.C., J.F.B.], Monash University, Melbourne 3800, Australia; Department of Anatomical Pathology [J.D.], Alfred Hospital, Prahran 3181, Australia; Department of Physiology [M.M.K.], Monash University, Melbourne 3800, Australia ABSTRACT: Several members of the transforming growth factor-␤ development than TGF-␤1 and TGF-␤3 (21). TGF-␤2 gene (TGF-␤) superfamily play key roles in kidney development, either expression has been detected in the kidney at embryonic day directly or indirectly regulating nephron number. Although low (E) 11.5 (22) and the protein localized in and around the nephron number is a risk factor for cardiovascular and renal disease, ureteric epithelium and nephron structures from E12.5 the implications of increased nephron number has not been examined (21,23). TGF-␤2 homozygous null mutant mice (TGF-␤2Ϫ/Ϫ) due to the absence of appropriate animal models. Here, using unbi- die within 24 h of birth due to defective lung development ased stereology we demonstrated that kidneys from TGF-␤2 het- erozygous (TGF-␤2ϩ/Ϫ) mice have approximately 60% more (24). The kidneys of these mice display progressive deterio- nephrons than wild-type mice at postnatal day 30. To determine ration of the ureteric tubules and an enlarged renal pelvis after whether augmented nephron number involved accelerated ureteric E15.
    [Show full text]
  • LHX3 Interacts with Inhibitor of Histone Acetyltransferase Complex Subunits LANP and TAF-1B to Modulate Pituitary Gene Regulation
    LHX3 Interacts with Inhibitor of Histone Acetyltransferase Complex Subunits LANP and TAF-1b to Modulate Pituitary Gene Regulation Chad S. Hunter1.¤, Raleigh E. Malik2., Frank A. Witzmann3, Simon J. Rhodes1,2,3* 1 Department of Biology, Indiana University-Purdue University Indianapolis, Indiana, United States of America, 2 Department of Biochemistry and Molecular Biology, Indiana School of Medicine, Indianapolis, Indiana, United States of America, 3 Department of Cellular and Integrative Physiology, Indiana University School of Medicine, Indianapolis, Indiana, United States of America Abstract LIM-homeodomain 3 (LHX3) is a transcription factor required for mammalian pituitary gland and nervous system development. Human patients and animal models with LHX3 gene mutations present with severe pediatric syndromes that feature hormone deficiencies and symptoms associated with nervous system dysfunction. The carboxyl terminus of the LHX3 protein is required for pituitary gene regulation, but the mechanism by which this domain operates is unknown. In order to better understand LHX3-dependent pituitary hormone gene transcription, we used biochemical and mass spectrometry approaches to identify and characterize proteins that interact with the LHX3 carboxyl terminus. This approach identified the LANP/pp32 and TAF-1b/SET proteins, which are components of the inhibitor of histone acetyltransferase (INHAT) multi-subunit complex that serves as a multifunctional repressor to inhibit histone acetylation and modulate chromatin structure. The protein domains of LANP and TAF-1b that interact with LHX3 were mapped using biochemical techniques. Chromatin immunoprecipitation experiments demonstrated that LANP and TAF-1b are associated with LHX3 target genes in pituitary cells, and experimental alterations of LANP and TAF-1b levels affected LHX3-mediated pituitary gene regulation.
    [Show full text]
  • Growth Factors and Signaling Proteins in Craniofacial Development Robert Spears and Kathy K.H
    Growth Factors and Signaling Proteins in Craniofacial Development Robert Spears and Kathy K.H. Svoboda Regulation of growth and development is controlled by the interactions of cells with each other and the extracellular environment through signal transduction pathways that control the differentiation process by stimulating proliferation or causing cell death. This review will define the common signaling molecules and provide an overview of the general principles of signal transduction events. We also review the signal transduction pathways controlling one specific mechanism found in craniofacial development termed epithelial- mesenchymal transformation (EMT) employed during gastrulation, cranial neural crest migration, and secondary palate formation. Semin Orthod 11:184–198 © 2005 Elsevier Inc. All rights reserved. Growth Factors and receptors (GPCR, Fig 1A), ion-channel receptors, tyrosine Signal Transduction kinase-linked receptors, and receptors with intrinsic enzy- matic activity.2 The GPCRs are characterized by multiple ntracellular signaling is usually triggered by a cell surface transmembrane domains (usually seven) that wind the pro- Ievent such as a specific protein (ligand) binding to a cell tein in and out of the membrane in a serpentine conformation surface receptor to form a receptor-ligand interaction. Cells (Fig 1A, GPCR). The ion-channel receptors are closely re- contacting neighboring cells or their surrounding noncellular lated and actually open a membrane channel when the tissue are termed cell-cell or cell-extracellular matrix (ECM) ligand binds. Many cytokine receptors are in the tyrosine contacts (Fig 1A).1 Interactions of cells with other cells or the kinase-linked class as they lack intrinsic activity; but when ECM can stimulate many reactions, including: increased cell the ligand binds, intracellular tyrosine kinases become division, cell movement, differentiation, and even pro- activated to generate cellular changes.
    [Show full text]
  • Genetic Determinants and Epigenetic Effects of Pioneer-Factor Occupancy
    ARTICLES https://doi.org/10.1038/s41588-017-0034-3 Genetic determinants and epigenetic effects of pioneer-factor occupancy Julie Donaghey1,2, Sudhir Thakurela 1,2, Jocelyn Charlton2,3, Jennifer S. Chen2, Zachary D. Smith1,2, Hongcang Gu1, Ramona Pop2, Kendell Clement1,2, Elena K. Stamenova1, Rahul Karnik1,2, David R. Kelley 2, Casey A. Gifford1,2,5, Davide Cacchiarelli1,2,6, John L. Rinn1,2,7, Andreas Gnirke1, Michael J. Ziller4 and Alexander Meissner 1,2,3* Transcription factors (TFs) direct developmental transitions by binding to target DNA sequences, influencing gene expres- sion and establishing complex gene-regultory networks. To systematically determine the molecular components that enable or constrain TF activity, we investigated the genomic occupancy of FOXA2, GATA4 and OCT4 in several cell types. Despite their classification as pioneer factors, all three TFs exhibit cell-type-specific binding, even when supraphysiologically and ectopically expressed. However, FOXA2 and GATA4 can be distinguished by low enrichment at loci that are highly occupied by these fac- tors in alternative cell types. We find that expression of additional cofactors increases enrichment at a subset of these sites. Finally, FOXA2 occupancy and changes to DNA accessibility can occur in G1-arrested cells, but subsequent loss of DNA meth- ylation requires DNA replication. rganismal development is orchestrated by the selective use the regulatory capabilities of the presumed pioneer TFs FOXA2, and distinctive interpretation of identical genetic material GATA4 and OCT4, which are frequently studied in development Oin each cell. During this process, TFs coordinate protein and used in cellular reprogramming. complexes at associated promoter and distal enhancer elements to modulate gene expression.
    [Show full text]
  • Transforming Growth Factor-Β Gene Silencing Using Adenovirus Expressing TGF-Β1 Or TGF-Β2 Shrna
    Cancer Gene Therapy (2013) 20, 94–100 & 2013 Nature America, Inc. All rights reserved 0929-1903/13 www.nature.com/cgt ORIGINAL ARTICLE Transforming growth factor-b gene silencing using adenovirus expressing TGF-b1 or TGF-b2 shRNA SOh1,2, E Kim1,2, D Kang1,3, M Kim1, J-H Kim4 and JJ Song1 Tumor cells secrete a variety of cytokines to outgrow and evade host immune surveillance. In this context, transforming growth factor-b1 (TGF-b1) is an extremely interesting cytokine because it has biphasic effects in cancer cells and normal cells. TGF-b1 acts as a growth inhibitor in normal cells, whereas it promotes tumor growth and progression in tumor cells. Overexpression of TGF-b1 in tumor cells also provides additional oncogenic activities by circumventing the host immune surveillance. Therefore, this study ultimately aimed to test the hypothesis that suppression of TGF-b1 in tumor cells by RNA interference can have antitumorigenic effects. However, we demonstrated here that the interrelation between TGF-b isotypes should be carefully considered for the antitumor effect in addition to the selection of target sequences with highest efficacy. The target sequences were proven to be highly specific and effective for suppressing both TGF-b1 mRNA and protein expression in cells after infection with an adenovirus expressing TGF-b1 short hairpin RNA (shRNA). A single base pair change in the shRNA sequence completely abrogated the suppressive effect on TGF-b1. Surprisingly, the suppression of TGF-b1 induced TGF-b3 upregulation, and the suppression of TGF-b2 induced another unexpected downregulation of both TGF-b1 and TGF-b3.
    [Show full text]
  • Tgf-Β Receptor Ii
    CONTEXT SPECIFIC SIGNALING OF TGF-β RECEPTOR II DISSERTATION ZUR ERLANGUNG DES AKADEMISCHEN GRADES DES DOKTORS DER NATURWISSENSCHAFTEN (DR. RER. NAT.) EINGEREICHT IM FACHBEREICH BIOLOGIE,CHEMIE,PHARMAZIE DER FREIEN UNIVERSITÄT BERLIN vorgelegt von DANIEL WALTER HORBELT AUS ERLENBACH AM MAIN 2010 Diese Arbeit wurde von Oktober 2004 bis August 2010 in der Arbeitsgruppe von Prof. Petra Knaus am Institut für Chemie-Biochemie der Freien Universität Berlin angefertigt. 1. GUTACHTER:PROF.DR.PETRA KNAUS 2. GUTACHTER: PD DR.PETER N. ROBINSON Disputation am 12.11.2010 . Contents List of Figures V List of Tables VII Summary IX Zusammenfassung XI 1 Introduction 1 1.1 The TGF-β superfamily . .1 1.2 Mechanisms of TGF-β signaling . .3 1.2.1 Secretion and activation of TGF-β ...................3 1.2.2 Ligand binding and receptor activation of TGF-β receptors . .3 1.2.3 TGF-β isoform specificity . .6 1.2.4 The TGF-β receptor II isoform TβRII-B and aim of the project: "Antibodies against TβRII-B" . .8 1.2.5 Activation of Smad signaling by TGF-β receptors . .9 1.2.6 TGF-β signaling through Smads . 12 1.2.7 Non-Smad signaling by TGF-β ..................... 13 1.2.8 Endocytic regulation of TGF-β signaling . 15 1.3 Marfan Syndrome and MFS-related diseases . 17 1.3.1 Classical Marfan Syndrome . 17 1.3.2 Marfan syndrome type II, Loeys-Dietz syndrome and Thoracic Aortic Aneurysms and Dissections syndrome . 19 1.4 Pathological remodeling in the aortic media and the development of aortic aneurysms . 21 1.5 Role of TGF-β in vascular remodeling .
    [Show full text]