The Rickettsia Late Motility Factor Sca2 Exhibits Species Differences in Its Actin Assembly Mechanism by Julie Eunkyoung Choe

Home , Rickettsia conorii, Rickettsia felis, Rickettsia parkeri, Rickettsia prowazekii, Rickettsia raoultii, Rickettsia rickettsii

The Rickettsia Late Motility Factor Sca2 Exhibits Species Differences in its Actin Assembly Mechanism by Julie Eunkyoung Choe

A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Molecular and Cell Biology in the Graduate Division of the University of California, Berkeley

Committee in charge: Professor Matthew D. Welch, Chair Professor Eva Nogales Professor David Drubin Professor Kathleen Ryan

Fall 2015

Julie Eunkyoung Choe Abstract

The Rickettsia Late Motility Factor Sca2 Exhibits Species Differences in its Actin Assembly Mechanism by Julie Eunkyoung Choe Doctor of Philosophy in Molecular and Cell Biology University of California, Berkeley Professor Matthew D. Welch, Chair

Intracellular pathogens commonly subvert the host cell actin cytoskeleton during various points of their infection cycles. My work has focused on the exploitation of actin by pathogens that grow within the cytosol. Many such pathogens assemble actin filaments at their surface to power motility within the cytoplasm, facilitating cell-cell spread during infection. Diverse bacterial species have independently evolved this strategy, and each uses a distinct mechanisms to intercept or mimic different host proteins involved in actin polymerization. Rickettsia are one genus of bacterial pathogens that exploit actin for intracellular motility. These are Gram-negative, obligate intracellular pathogens that include the causative agents of various types of spotted fever disease and typhus. Species within the genus Rickettsia can express up to two bacterial factors that power motility at either early or late times during infection. My work has focused on orthologs of the Rickettsia late motility factor Sca2 (surface cell antigen 2). Interestingly, I have found that these exhibit significant sequence differences between species. I participated in the discovery that Sca2 from the spotted fever group (SFG) Rickettsia species R. parkeri mimics eukaryotic formins in its ability to nucleate and processively elongate actin filaments, resulting in the assembly of an actin comet tail consisting of long and bundled filaments. Furthermore, for R. parkeri Sca2, I identified a minimal truncation that retains nucleation function, and showed that it can bind to three molecules of profilin, also similar to the behavior of formins. In contrast, Sca2 from typhus group (TG) and ancestral group (AG) Rickettsia species lack the formin-mimicking domain, and the organization of the actin filaments in their comet tails is poorly defined. I found that Sca2 from the TG species R. typhi nucleates actin, though its specific actin assembly mechanism remains undetermined. I further found that Sca2 from the AG species R. bellii nucleates actin efficiently when dimerized, and binds to a single actin monomer through a WASP-homology 2 (WH2) motif. These results suggest that R. bellii Sca2 may assemble actin via a mechanism that mimics eukaryotic tandem- WH2 nucleators, and its activity may be enhanced by dimerization or oligomerization of Sca2 on the bacterial surface. Additionally, I found that during infection, R. bellii move more slowly, in more curved paths, and more frequently than R. parkeri, and generate narrower actin tails consisting of bundled actin filaments. Nevertheless, R. bellii and R. parkeri use a similar set of host actin cytoskeletal proteins for efficient motility. Together, these data support the conclusion that R. bellii Sca2 utilizes a distinct mechanism to assemble actin filaments, and yet harness a similar set of host proteins to promote a motility that occurs with distinct parameters when compared with other Rickettsia species. This work reveals that even related bacterial species exhibit a surprising diversity of actin assembly mechanisms to subvert host actin for intracellular movement.

Table of Contents

Abstract ...... 1 Table of Contents ...... i List of Figures ...... ii List of Abbreviations ...... iii Acknowledgments...... iv

Chapter 1 – Introduction: An evolutionary perspective on the role of actin-based motility in virulence of intracellular bacterial pathogens ...... 1 Roles of actin-based motility in survival and virulence ...... 4 Bacterial motility factors mimic eukaryotic host actin nucleators ...... 6 Actin motility proteins – orthologs comparison and evolution ...... 7 Conclusion and future directions ...... 11 References ...... 13

Chapter 2 – Actin assembly by the late actin-based motility factor Sca2 in spotted fever group and typhus group Rickettsia species ...... 18 Introduction ...... 19 Results ...... 21 Discussion...... 27 Materials & Methods ...... 31 References ...... 34

Chapter 3 – The Sca2 protein from the ancestral group Rickettsia species Rickettsia bellii employs a distinctive mechanism of actin assembly ...... 37 Introduction ...... 38 Results ...... 40 Discussion...... 50 Materials & Methods ...... 55 References ...... 59

Chapter 4 – Future Directions & Remaining Questions ...... 63 Sca2 Ortholog Mechanisms ...... 64 Host Factor Requirements ...... 65 Expression Patterns and Regulation of Sca2 Orthologs...... 66 Genetic Manipulation of Rickettsia ...... 67 References ...... 69

List of Figures

Figure 1.1 – Bacteria intercept actin pathways for several purposes during infection ...... 3

Figure 1.2 – Eukaryotic actin nucleators and their bacterial mimics...... 5

Figure 1.3 – Mechanisms of ABM of select bacterial species ...... 8

Figure 2.1 – R. parkeri Sca2 domain organization and biochemical characterization of a minimal active fragment ...... 20

Figure 2.2 – The proline-rich region of RpSca2 binds profilin ...... 23

Figure 2.3 – RtSca2 passenger is largely insoluble and prone to aggregation. RtSca2-785 conditionally enhances actin assembly ...... 25

Figure 3.1 – Rickettsia phylogeny and domain organization of Sca2 orthologs ...... 39

Figure 3.2 – R. bellii actin-based motility parameters differ from those of R. parkeri ...... 41

Figure 3.3 – A similar set of host cytoskeleton proteins is important for R. bellii and R. parkeri motility ...... 43

Figure 3.4 – Sca2 has a polar localization more often in R. bellii than in R. parkeri ...... 45

Figure 3.5 – The R. bellii Sca2 passenger domain nucleates actin when dimerized ...... 46

Figure 3.6 – R. bellii Sca2 binds tightly to one actin monomer via a single WH2 motif ...... 48

Figure 3.7 – Addition of chemical crosslinkers to R. bellii shifts RbSca2 bands into a larger MW smear ...... 49

Figure 3.8 – Proposed model of actin assembly by Sca2 orthologs ...... 53

List of Abbreviations

ABM Actin-based motility ActA Actin assembly-inducing protein (Listeria motility factor) AG Ancestral Group Rickettsia AG Sca2 Ancestral Group Rickettsia Sca2 BimA Burkholderia intracellular motility A factor BmBimA Burkholderia mallei BimA BpBimA Burkholderia pseudomallei BimA BtBimA Burkholderia thailandensis BimA FH1 Formin Homology 1 domain FH2 Formin Homology 2 domain F-actin Filamentous actin G-actin Monomeric (globular) actin GST Glutathione S-transferase LiActA Listeria ivanovii ActA LmActA Listeria monoctyogenes ActA LsActA Listeria seeligeri ActA NPF Nucleation Promoting Factor (for Arp2/3 complex) NTD N-terminal domain (conserved across SFG species Sca2) RbSca2 Rickettsia bellii Sca2 RfSca2 Rickettsia felis Sca2 RpSca2 Rickettsia parkeri Sca2 RtSca2 Rickettsia typhi Sca2 SFG Spotted Fever Group Rickettsia SFG Sca2 Spotted Fever Group Sca2 TG Typhus Group Rickettsia TG Sca2 Typhus Group Sca2 TRG Transitional Group Rickettsia WCA WH2, Central/Connecting, and Acidic motifs (for Arp2/3 complex) WH2 WASP Homology 2 domain

iii

Acknowledgments This dissertation has reached completion with the help of many, many supporters, both professional and personal.

Thank you to Matt for giving me the space to grow (and grow up) during my time in graduate school. Despite numerous obstacles, you have been ever supportive and helpful, providing so much guidance and instruction along this entire path.

So much support has been generously provided by Welch lab members, past and present. The most thanks go to Cat Haglund for mentorship, support and guidance during my early years in the lab. Additional thanks to the rest of Team Rickettsia over the years: Alisa Serio, Shawna Reed, Becky Lamason, and Patrik Engstrom. Becky Lamason in particular has been incredibly helpful over the last few years: providing Rickettsia strains, scientific support, help with experimental design, and many laughs in the Bay of Excellence. Erin Benanti was invaluable in providing advice on the protein and biochemistry side of experiments; I almost miss fighting her for time on the AKTA and platereader. Thanks also to Taro Ohkawa for many years of birthday cards, quote board maintenance, microscope troubleshooting, and without whom I’m sure the Welch lab would fully and abruptly cease to function. The remaining Welch lab members and alumni who have provided endless entertainment and moral support: Bisco Hill, Catherine Nguyen, Natasha Kafai, James Depeltau, Domi Laukos, Susan Hepp, Lee Douglas, Peter Hsiue, Ken Campellone, Haiming Wu, & Elif Firat-Kiralar. And of course, Steve Duleh.

I am additionally grateful to the members of The TriLab, past and present. Thanks also to David King in the HHMI Mass Spectrometry Laboratory; Jeff Iwig, formerly of the Kuriyan lab, for such kind support with protein crystallization experiments; Ross Wilson in the Doudna Lab for assistance with Isothermal Titration Calorimetry; Justin Bosch in the Hariharan Lab for help starting up insect cell culture in our lab again; Steve Ruzin and Denise Schichnes at the Berkeley Biological Imaging Facility (BIF) for assistance with super-Resolution Structured Illumination Microcroscopy. Beyond Berkeley, thanks to the Hackstadt Lab (Rocky Mountain Laboratories, NIAID, NIH) and the Munderloh Lab (University of Minnesota) for Rickettsia strains and reagents over the years. Appreciation also goes out to the rotation students and undergraduates who worked on this project: Michelle Bloom, Michelle Lane, Angelica Castaneda and Ross Pedersen.

Family members: Mom, Dad, Janice, Justin, Jen, Steve, Ava & Young Lee (Steve’s mom). You have given such endless love and support, even when you (mostly) don’t understand what it is that I do. Dad, I’m sorry I am still not going to ever become a “real” doctor, but I hope a PhD is acceptable as a close second. I love you all so much.

Friends from this journey: Graduate school is a uniquely challenging experience in so many different ways. The many friendships that arose, and persisted, during this time are equally unique and so, so special to me. I am so grateful that we built a beautiful community of close support as we have grown and moved further into adulthood together.

And lastly, a special thanks to Steve Duleh, the person who probably most closely understands my graduate school experience, and for his endless amounts of support in so many ways, especially here at the end.

Chapter 1

Introduction: An evolutionary perspective on the role of actin-based motility in virulence of intracellular bacterial pathogens

Intracellular bacterial pathogens remodel and exploit the host cell environment to support their survival and growth. A common target of these bacteria is the host cell actin cytoskeleton, a dynamic system of intracellular filaments that is central to host cell processes and functions including cell shape determination and movement, as well as endocytosis, phagocytosis and intracellular trafficking. Because of its role in these processes, the actin cytoskeleton is also manipulated by many bacterial pathogens at multiple stages of their infection cycle (Fig. 1.1) (1). Most intracellular bacterial target actin during invasion (2). Following invasion, some remain within membrane bound compartments and can target actin to aid in the subversion of membrane trafficking or remodeling (1). However, perhaps the most striking mobilization of host actin is by bacteria that escape into the cytosol and polymerize actin on their surface, using actin assembly to power intracellular actin-based motility (ABM) and generating actin comet tails that trail the moving bacteria (1, 3). Since the discovery of actin-based motility (4), this phenomenon has captured the attention of both microbiologists and cell biologists, and studying this process has led to important advances in both fields.

The role of actin-based motility in infection is to support bacterial survival by enabling efficient spread to neighboring cells (5), and perhaps also by helping to avoid targeting by the host autophagy machinery (6). For these reasons, motility is important for infection and virulence. The ability to undergo actin-based motility has evolved independently in several unrelated bacterial genera. Interestingly, different bacterial species have also evolved very distinct molecular strategies to assemble host actin to power motility, either by mimicking and/or recruiting host actin assembly factors (3, 7) (Fig. 1.2). Numerous reviews have focused on summarizing the various mechanisms that bacteria have deployed to mobilize actin during infection. In this chapter, I will instead present a different framework, focusing on comparing motility mechanisms between closely related species. This will open a window into the evolution of actin-based motility mechanisms and their roles in adapting bacteria to the intracellular environment of their hosts. This may also suggest models for how differences in motility may influence pathogenicity and virulence in humans and other animals.

Given this framework, my focus will be on bacterial genera with two or more species that are known to undergo actin-based motility. These include the genera Listeria, Rickettsia, and Burkholderia (8, 9) (10) (11). The Listeriae include seven species of Gram-positive soil-dwelling facultative anaerobes, two of which – L. monocytogenes and L. ivanovii – are capable of undergoing actin-based motility and causing the foodborne infection listeriosis in humans and animals (12). The Burkholderiae within the pseudomallei group consist of three species of Gram- negative betaproteobacteria that are typically saprophytic, although B. pseudomallei causes the human disease melioidosis, and B. mallei causes glanders in animals (the third species B. thailandensis is not pathogenic) (13). The Rickettsiae are a much larger genus of Gram-negative alphaproteobacteria and are unique among bacterial pathogens that undergo actin-based motility with regard to their obligate intracellular lifestyle. The genus is relatively ancient at over 150 million years old, and they are considered the closest extant relatives to the bacterial precursor of mitochondria (14). Many species within the Rickettsia genus cause disease, including species that cause spotted fever and various types of typhus. Because of the presence of both pathogenic and non-pathogenic species within each genus, a comparison of motility mechanisms

Figure 1.1 - Bacteria intercept actin pathways for several purposes during infection. Actin (red) is mobilized during multiple stages of infection by intracellular pathogens (green). Actin facilitates bacterial adhesion to and invasion of the host cell. Some pathogens remodel the internalization vacuole with the assistance of the actin cytoskeleton. Other pathogens that escape from the vacuole into the cytosol often assemble actin on their surface and use the force to power motility through the cytosol and generate actin comet tails. This association with actin also inhibits bacterial clearance by host autophagy pathways. Actin-based motility additionally propels the bacteria to the plasma membrane, enabling protrusion formation and engulfment by neighboring cells to facilitate cell- cell spread.

3 may also suggest models for how differences in motility may influence pathogenicity and virulence in humans and other animals.

Here, I will first discuss the roles of actin mobilization in survival and virulence. Then I will outline the diverse strategies of actin assembly that underlie the process of actin-based motility, with a focus on the evolution of actin-based motility factors in related species. Last, I will synthesize these points and relate how differences in motility mechanism may contribute to differences in survival and pathogenicity.

Roles of actin-based motility in survival and virulence

The roles of actin-based motility in bacterial infection have been revealed by the identification of the genes and corresponding proteins that mediate motility, and by studies of the phenotypes caused by mutating these genes. Genes that are critical for motility have often been identified by identifying transposon insertions that interfere with virulence, plaque formation in cell monolayers as a measure of cell-cell spread, or in actin assembly and motility itself. This method identified the L. monocytogenes actA gene, as well as the Rickettsia sca2 and rickA genes as required for bacterial motility (15-17). In addition to being unable to form actin tails, these mutants were also less pathogenic in animal models, supporting their role as an important virulence factor (17, 18). bima was identified as the Burkholderia motility factor through computational methods, but mutation or loss of this gene in B. pseudomallei and other species also leads to loss of actin tails and reduced cell-cell spread (19, 20). The identification of these mutants has also revealed important roles for actin-based motility in bacterial infection.

The best-studied role of motility is to promote cell-cell spread (Fig 1.1). Motility facilitates bacterial movement and localization to the host plasma membrane, ideally at a cell-cell junction. Once there, Listeria or Rickettsia can use force of actin assembly, or an ability to reduce cortical tension, to initiate formation of bacterial protrusions into the neighboring cells (1, 5). In contrast, Burkholderia spp. implement a unique method of spread by inducing fusion of the host cells when they reach cell junctions, although the mechanisms of cell-cell fusion are poorly understood (13). Mutants that fail to polymerize actin cannot move to the cell periphery and are severely defective in cell-cell spread or fusion (5). The ability of the bacteria to move directly between host cells in turn provides another mechanism of protection – remaining continuously in the intracellular environment allows them to evade adaptive immune pathways that are active in extracellular space.

A second a more speculative role for actin assembly is to enable the evasion of host immune pathways, particularly those involved in ubiquitinating bacteria and targeting them for destruction via the autophagy pathway (6). For L. monocytogenes, actin assembly appears to antagonize bacterial clearance through the autophagy pathway (21), as L. monocytogenes Δacta mutants also show higher levels of ubiquitination and clearance by autophagy pathways (22). How actin modulates ubiquitination and autophagy is unclear. Actin networks may form a physical barrier blocking ubiquitination machinery, and the motility factors themselves appear to inhibit bacterial ubiquitination as well (6, 22).

Figure 1.2 - Eukaryotic actin nucleators and their bacterial mimics. (A) Spontaneous actin nucleation involves the formation of a trimer, which is kinetically unfavorable. Once a trimer forms, the filament can elongate/shrink at both the (+) end and (–) end, depending on the concentration of available actin. (B) Types of host proteins that promote actin nucleation and, in some cases, elongation. These include the Arp2/3 complex and NPFs, tandem-WH2 nucleators, formins and Eva/VASP proteins. (C) Bacterial proteins that mimic different classes of host actin nucleating proteins or their activators.

Bacterial motility factors mimic eukaryotic host actin nucleators

Many of the bacterial actin assembly proteins encoded by the genes mentioned above have also been studied extensively at the biochemical level. They have been found to recruit and/or mimic distinct families of eukaryotic actin nucleators (7). Understanding species differences in the mechanism of action of bacterial actin assembly proteins, and hence their evolution and role in virulence, requires an introduction to the biochemical properties of host actin and actin nucleating proteins.

Actin filaments (F-actin or filamentous actin) are composed of actin monomers (G-actin or globular actin) that are assembled into two helical protofilaments with biochemically distinct ends. The plus (or barbed) end elongates and shrinks more quickly, whereas the minus (or pointed) end elongates and shrinks more slowly. Actin filaments can be further organized into branched, cross-linked or bundled arrays. Most filaments undergo constant assembly and disassembly, with the location and timing of actin dynamics regulated by a slew of regulatory pathways and dozens of different actin modulating proteins (23)(24). The rate-limiting step of F- actin assembly is the spontaneous nucleation of actin into trimers (Fig. 1.2A). Thus, an important class of actin regulatory proteins are the filament nucleating factors. These initiate the formation of new actin filaments by accelerating nucleation, and many also promote the elongation of newly formed filaments. Host actin nucleating factors are divided into several types, which are outlined below.

The Arp2/3 complex (Fig. 1.2B) is a seven-subunit complex that can be activated by many different nucleation promoting factors (NPFs) to assemble branched actin networks (25). NPFs contain an Arp2/3 WCA domain consisting of a G-actin-binding WASP-homology 2 (WH2 or W), an Arp2/3-binding central (C) and acidic (A) sequences. Differences in the remaining domains determine the mode of regulation, activation and localization of each individual NPF within host cells. After activation by NPFs, the Arp2/3 complex links the pointed end of a new growing filament to the side of a pre-existing filament, generating a Y-branch, while the NPF dissociates (23, 25). Many bacterial motility factors mimic some component of the Arp2/3 activating pathway (26) (Fig. 1.2C). Many bacteria produce proteins that directly mimic host NPFs. These include ActA from L. monocytogenes ActA (27, 28), BimA from B. thailandensis BimA (13, 29) and RickA from Rickettsia species (30). Shigella flexneri, a Gram-negative foodborne pathogen, instead produces the IcsA motility factor, which mimics the GTPase Cdc42 to recruit and activate the host NPF N-WASP, which subsequently recruits and activates the Arp2/3 complex (31).

A second type of nucleating protein is the tandem WH2 nucleator family (Fig. 1.2C). These proteins have multiple G-actin-binding WH2 motifs that bind to 2 or more actin monomers to facilitate nucleation; many of these proteins dimerize, effectively doubling the number of actin binding sites. They typically dissociate from the newly formed filament, which can then elongate spontaneously or in association with elongation factors such as formin proteins (32, 33). Members of this class differ in the number and spacing of WH2 sequences (23, 34, 35). Bacterial mimics of tandem WH2 nucleators include Vibrio species effectors VopF from V. cholerae and VopL from V. parahaemolyticus (Fig. 1.2C). While VopF and VopL do not power bacterial motility,

6 they remodel host actin networks, compromising the structure of enteric epithelia during infection (7). Some species of Rickettsia, including Ancestral Group (AG) species R. bellii, express orthologs of late motility factor Sca2 that are predicted to assemble actin in a similar fashion (36) (Fig. 1.2C and Chapter 3).

A third type of nucleating protein is the formin family, which promote both nucleation and processive elongation of actin filaments (Fig. 1.2B). They have a conserved formin homology 2 (FH2) domain that forms a homodimeric ring that can nucleate a new filament (37). The FH2 domain ring also remains attached and “walks” along the growing filament as additional actin monomers are incorporated, The neighboring formin homology 1 (FH1) sequences contain a series of proline-rich repeats that bind to profilin-actin complexes, bringing in ATP-bound actin to facilitate elongation (38). The Sca2 protein from spotted fever group Rickettsia species has been shown to mimic a formin-like mechanism of actin assembly (36, 39) (Fig. 1.2C). Though it does not dimerize around the end of an actin filament, it enhances actin nucleation and mediates profilin-dependent elongation. Central to this function is an N-terminal domain that is highly conserved in Rickettsia Sca2 orthologs from closely-related spotted fever group species, but is absent in orthologs from more distantly related Rickettsia species.

Finally, a fourth class of host nucleators is the Ena/VASP family. These multifunctional proteins are capable of nucleation, bundling, severing and elongation (23) (Fig. 1.2B). VASP is a tetramer with both a polyproline region and two sequences that can bind either F- or G-actin in various permutations, accounting for its multiple observed activities (40). The first bacterial mimics of Ena/VASP have recently been identified in BimA orthologs of Burkholderia species B. mallei and B. pseudomallei (13) (Fig. 1.2C). BimA is a trimeric autotransporter, and the passenger domain of BimA from each of these species contains one or more WH2 motifs. Both orthologs show similar activity to VASP: they nucleate, processively elongate, and bundle F-actin to power their motility (13).

As we can see through the examples presented above, even related bacterial species can express orthologs of motility factors that exhibit different interactions with actin and divergent mechanisms of actin assembly. Next, we begin to consider the mechanistic differences in actin assembly orthologs from select bacterial genera and how these differences relate to different aspects and roles for ABM, including virulence.

Actin motility proteins – orthologs comparison and evolution

Listeria species

Listeria species are found largely in the soil and environment as saprotrophes. L. monocytogenes is an opportunistic pathogen of humans, with current cases of human infection occurring in immunocompromised persons through contaminated meat and produce. The genus Listeria also includes the animal pathogen L. ivanovii and 5 other species that are not pathogenic (41). Actin- based motility has only been observed for L. monocytogenes and L. ivanovii (42). Interestingly, the two pathogenic species are more closely related to other non-pathogenic species than to

select bacterial species. bacterial select

Motility factors of factors Motility

Schematic representation of bacterial actin motility factors, grouped to to grouped factors, motility actin bacterial of representation Schematic

–

Select species of Listera, Burkholderia, and Rickettsia. * denotes pathogenic pathogenic * denotes Rickettsia. and Burkholderia, ofListera, species Select

A) species. orthologs. between comparisons show Figure

8 each other - L. monocytogenes is more closely related to L. innocua, and L. ivanovii is most similar to L. seeligeri (41) (Fig. 1.3A). Genomic data supports multiple instances of loss of virulence genes as Listeria species made multiple transitions from a pathogenic to saprotrophic lifestyle (41).

The Listeria motility factor ActA is anchored in the bacterial membrane with a polar distribution pattern on the bacterial surface (43). L. monocytogenes ActA recruits and activates the host Arp2/3 complex (26) (Fig. 1.3B). This produces actin tails that are dense, short, and curved, which is typical for an Arp2/3 mediated actin assembly mechanism (26). Interactions of ActA with profilin and Ena/VASP enhance speed and directionality of bacterial movement (44). Only L. monocytogenes, L. ivanovii, and L. seeligeri carry an intact acta gene (8). Sequence similarity between the orthologs LiActA and LmActA is 52%, the lowest level of similarity for all their shared virulence genes(45). However, much of that difference is attributed to a greater number of proline rich sequences in LiActA. These sequences are important for binding host VASP, which, as mentioned above, is important for effective motility. LiActA is expressed in L. ivanovii and does interact with host VASP (46). The ActA ortholog from L. seeligeri shares only 46-47% sequence similarity to LmActA (47), and although there are sequences in LsActA that resemble the actin interacting sequences in LmActA (27) (Fig. 1.3B), there is no biochemical data addressing whether it assembles actin filaments.

Actin tails have only been observed for L. monocytogenes and L. ivanovii; additionally, L. ivanovii actA is sufficient to restore actin tail phenotypes in an L. monocytogenes ΔactA mutant strain (42). Non-pathogenic L. seeligeri does not generate actin tails, which may be attributed to the fact that L. seeligeri exhibits low expression of some virulence genes, suggesting the possibility that actA may also be poorly expressed. Thus, although Listeria have are other known virulence factors, there is evidence supporting a connection between ActA function and expression efficient actin-based motility and bacterial virulence.

Burkholderia species

Burkholderia species include soil-dwelling saprophytes, some of which are opportunistic pathogens to humans, other animals, or plants. B. pseudomallei causes meliodosis in humans, and its clonal descendant B. mallei causes glanders in equines (Fig. 1.3A). B. thaliandensis is closely related to both species but is not pathogenic to humans. Its typical host range remains unknown but it has recently been shown to be pathogenic to Drosophila (48).

The motility factor BimA is a trimeric autotransporter and orthologs are found in all three of these species. BtBimA is a bacterial NPF that activates the host Arp2/3 complex (13, 29) (Fig. 1.3B). BmBimA and BpBimA are both mimics of the Ena/VASP family of nucleators, facilitating actin filament nucleation, processive elongation, and bundling to assemble long bundled actin tails (13). However, the BmBimA passenger domain contains a single WH2 motif, compared to three in BpBimA. The purified proteins functioned to a similar degree in a number of in vitro experiments measuring actin assembly (13).

Actin-based motility is observed in the pathogenic species B. mallei and B. pseudomallei, as well as in the non-pathogenic species B. thailandensis (13). B. thailandensis tails are longer than seen with other bacterial Arp2/3 mediated actin tails but they consistently follow a circular or curved path of movement (13, 26). Despite similarities between BmBimA and BpBimA in actin assembly experiments, during infections it was observed that B. mallei are less often associated with actin tails than B. pseudomallei, and have slower motility rates (13), suggesting that it is less effective at forming actin filaments in the cellular environment. Additionally, B. mallei appears to be less efficient at inducing cell fusion for bacterial spread compared to both B. pseudomallei and B. thailandensis (13). Other than the differences in motility trajectories due to their different BimA actin nucleation mechanisms, B. thailandensis and B. pseudomallei show more similarity in regard to frequency of tail formation, bacterial motility rates and promotion of host cell fusion (13). In this genus, it appears that the molecular mechanism of actin assembly and its associated dynamics do influence aspects of infection, but there is a less clear connection between specific differences in BimA mechanisms to virulence.

Notably, the work by Benanti et al. was conducted in human or primate cell lines, which may explain the greater level of activity and motility by the human pathogen species B. pseudomallei as compared to B. mallei. Studying the motility of each species in their native host environment may lead to changes in their motility that may help support a connection between actin nucleation mechanisms to virulence and pathogenesis.

Rickettsia species

Rickettsiae encompass a diverse range of species, all of which are obligate intracellular parasites. As a relatively ancient genus, it is sorted into 4 groups, all but one of which contain pathogenic species. The genus is fairly ancient, and species members exhibit significant differences in the types and severity of disease caused (if any) as well as notable differences in host range (49). In mammalian hosts, they typically first infect endothelial cells but can spread quite effectively into many other cell types and tissues. Pathogenic species are typically found in arthropod vectors, and are transmitted through insect bites to mammalian hosts, where they can then cause disease. Members of the spotted fever group (SFG) can cause spotted fever disease of varying severity in humans and other mammals (Fig. 1.3A). Typhus group (TG) species can cause human or murine typhus, while transitional group (TRG) species infect mammals and is considered an emergent human pathogen (50). Ancestral group (AG) members are arthropod endosymbionts, typically found in the digestive tract of ticks but also found in ovaries for maternal transmission (14, 51).

Rickettsiae can express up to two different actin assembly factors. The Arp2/3 activator RickA facilitates infrequent motility resulting in short, curved actin tails early in infection (15-60 minutes post infection) (15, 52). RickA is fairly well conserved across all Rickettsia species, with the exception of TG species, which lack it entirely (36). Some species also have a late actin assembly factor, Sca2, which assembles Arp2/3-independent actin tails at later times (48hpi) during infection (15). In SFG Rickettisa, the Sca2 actin assembly mechanism mimics eukaryotic formins to generate long, linear filaments (36, 39). SFG Sca2 is fairly well conserved in most

10 members of the group (Fig. 1.3B). However, Sca2 orthologs are extremely divergent in TG, TRG and AG species (36, 53). Transitional group member R. felis contains a Sca2 ortholog that somewhat resembles the domain organization of SFG Sca2 but the N-terminal domain is shorter and not similar in sequence (Fig. 1.3B). For TG and AG Sca2, sequence predictions identify a number of putative WH2-motifs in TG and AG Sca2 (Fig. 1.3B), suggesting that they may mimic tandem WH2 nucleators. While little is known about TRG Sca2 and motility, work presented in later chapters of this thesis indicate that Sca2 from TG species R. typhi and AG species R. bellii are capable of nucleating actin filaments but the precise mechanism is still under investigation.

Actin-based motility has been studied most extensively for SFG species. Sca2 is highly conserved within the SFG, and many species are pathogenic and generate actin tails that composed of long linear helical bundles (54), corresponding to the linear actin filaments generated by Sca2 in vitro. R. felis has been shown to make actin tails (55) but further details about the tail structures and assembly remain unknown. R. typhi very infrequently forms actin tails that are short and curved (56, 57), reminiscent of Arp2/3 mediated tails, despite the fact that it lacks RickA and has no predicted Arp2/3 activating domains in Sca2. TG species R. prowazekii is also pathogenic to humans yet lacks both RickA and Sca2 and has not been observed to make actin tails. In contrast, AG species R. bellii can assemble long, mostly linear actin tails, though they lack the helical bundles seen in actin tails from SFG species (58).

Actin-based motility is considered central to the virulence of SFG Rickettsia. Therefore, we hypothesize that the observed differences in actin motility characteristics between Rickettsia species may be correlated to the known or predicted actin assembly mechanisms of their respective RickA or Sca2 orthologs. However, the role of motility in virulence is likely to be more complicated, as TG Rickettsia are pathogenic despite showing very little or no ability to undergo ABM, while the non-pathogenic AG species generate actin tails but are not pathogenic. Similarly, when Sca2 is knocked out in SFG species, ABM is lost, and their ability to form plaques and cause disease are both dramatically reduced (15, 17). Yet, TG species typically form smaller plaques than SFG species (59), and non-pathogenic AG plaques are larger than SFG species (58). There are likely other virulence factors at play here, though we still lack a clear picture of what genes underlie Rickettsia pathogenesis (60).

Further study of Sca2 in distant species may continue to illuminate the evolution of actin motility pathways and mechanisms, and understanding the contribution of ABM for virulence. In the transition from symbiotic to pathogenic species, Sca2 and its associated functions clearly gained virulence functions, yet this protein has been lost by members of the Typhus Group. The ability to survive inside the host is an important for the success of intracellular pathogens. The obligate intracellular requirement for Rickettsia species may make it more difficult to parse out differences in survival versus virulence specifically. Additionally, as mentioned previously, identification of other Rickettsial virulence factors may also illuminate the role of ABM in virulence or how it relates to other aspect of pathogenesis.

Conclusion and future directions

Actin-based motility of intracellular bacterial pathogens is a theme that recurs, even among evolutionarily unrelated species. This shows that remodeling host actin for motility is a powerful strategy for virulence. The actin assembly factors developed by diverse pathogens show that multiple mechanisms are sufficient to generate tails for motility. While actin-based motility is a central component of virulence for many pathogens, there is not often a clear connection between ability to undergo motility or mechanisms of motility and pathogenesis. Further understanding of motility factors in related pathogenic and non-pathogenic species can further illuminate our understanding of the role it plays in pathogenesis.

References

1. Haglund CM, Welch MD. 2011. Host-pathogen interactions: Pathogens and polymers: Microbe-host interactions illuminate the cytoskeleton. The Journal of Cell Biology 195:7. 2. Carabeo R. 2011. Bacterial subversion of host actin dynamics at the plasma membrane. Cellular Microbiology 13:1460. 3. Goldberg MB. 2001. Actin-based motility of intracellular microbial pathogens. Microbiol Mol Biol Rev 65. 4. LG T, Portnoy DA. 1989. Actin Filaments and the Growth, Movement, and Spread of the Intracellular Bacterial Parasite, Listeria monocytogenes 109:1597–1608. 5. Ireton K. 2013. Molecular mechanisms of cell-cell spread of intracellular bacterial pathogens. Open Biology 3:130079. 6. Jo E-K, Yuk J-M, Shin D-M, Sasakawa C. 2013. Roles of autophagy in elimination of intracellular bacterial pathogens. Front Immunol 4:97. 7. Mota LJ. 2015. Bacterial nucleators: actin' on actin. Pathogens and Disease 73. 8. Gouin E, Mengaud J, Cossart P. 1994. The virulence gene cluster of Listeria monocytogenes is also present in Listeria ivanovii, an animal pathogen, and Listeria seeligeri, a nonpathogenic species. Infection and Immunity 62:3550–3. 9. Vannini C, Boscaro V, Ferrantini F, Benken KA, Mironov TI, Schweikert M, Görtz H-D, Fokin SI, Sabaneyeva EV, Petroni G. 2014. Flagellar Movement in Two Bacteria of the Family Rickettsiaceae: A Re-Evaluation of Motility in an Evolutionary Perspective. PLoS ONE 9:e87718. 10. Uchiyama T. 2012. Tropism and pathogenicity of rickettsiae. Frontiers in Microbiology 3:230. 11. Stoyanova M, Pavlina I, Moncheva P, Bogatzevska N. 2007. Biodiversity and Incidence of Burkholderia Species. Biotechnology & Biotechnological Equipment 21:306. 12. Schmid MW, Ng EYW, Lampidis R, Emmerth M, Walcher M, Kreft J, Goebel W, Wagner M, Schleifer K-H. 2005. Evolutionary history of the genus Listeria and its virulence genes. Syst Appl Microbiol 28:1–18. 13. Benanti EL, Nguyen CM, Welch MD. 2015. Virulent Burkholderia Species Mimic Host Actin Polymerases to Drive Actin-Based Motility. Cell 161:348. 14. Weinert LA, Werren JH, Aebi A, Stone GN, Jiggins FM. 2009. Evolution and diversity of Rickettsia bacteria. BMC Biol 7:6. 15. Lamason RL, Risca VI, Abernathy E, Welch MD. 2014. Rickettsia Actin-Based Motility Occurs in Distinct Phases Mediated by Different Actin Nucleators. Current Biology 24:98. 16. Kocks C, Gouin E, Tabouret M, Berche P, Ohayon H, Cossart P. 1992. L. monocytogenes- induced actin assembly requires the actA gene product, a surface protein. Cell 68:521–531.

17. Kleba B, Clark TR, Lutter EI, Ellison DW, Hackstadt T. 2010. Disruption of the Rickettsia rickettsii Sca2 Autotransporter Inhibits Actin-Based Motility. Infection and Immunity 78:2240. 18. Domann E, Wehland J, Rohde M, Pistor S, Hartl M, Goebel W, Leimeister-Wächter M, Wuenscher M, Chakraborty T. 1992. A novel bacterial virulence gene in Listeria monocytogenes required for host cell microfilament interaction with homology to the proline-rich region of vinculin. EMBO J 11:1981–1990. 19. Stevens MP, Stevens JM, Jeng RL, Taylor LA, Wood MW, Hawes P, Monaghan P, Welch MD, Galyov EE. 2005. Identification of a bacterial factor required for actin-based motility of Burkholderia pseudomallei. Molecular Microbiology 56:40–53. 20. Stevens JM, Ulrich RL, Taylor LA, Wood MW, DeShazer D, Stevens MP, Galyov EE. 2005. Actin-binding proteins from Burkholderia mallei and Burkholderia thailandensis can functionally compensate for the actin-based motility defect of a Burkholderia pseudomallei bimA mutant. Journal of Bacteriology 187:7857–7862. 21. Mostowy S, Cossart P. 2011. Autophagy and the cytoskeleton: new links revealed by intracellular pathogens. Autophagy 7:780–2. 22. Cemma M, Lam GY, Stöckli M, Higgins DE, Brumell JH. 2015. Strain-Specific Interactions of Listeria monocytogenes with the Autophagy System in Host Cells. PLoS ONE 10:e0125856. 23. Campellone KG, Welch MD. 2010. A nucleator arms race: cellular control of actin assembly. Nature Reviews Microbiology 11:237. 24. Lee SH, Dominguez R. 2010. Regulation of actin cytoskeleton dynamics in cells. Mol Cells 29:311–25. 25. Goley ED, Welch MD. 2006. The ARP2/3 complex: an actin nucleator comes of age. Nature Reviews Molecular Cell Biology 7:713. 26. Way M, Welch MD, Way M. 2013. Arp2/3-Mediated Actin-Based Motility: A Tail of Pathogen Abuse. Cell Host & Microbe 14:242. 27. Skoble J, Portnoy DA, Welch MD. 2000. Three regions within ActA promote Arp2/3 complex-mediated actin nucleation and Listeria monocytogenes motility. The Journal of Cell Biology 150:527–538. 28. Welch MD. 1998. Interaction of Human Arp2/3 Complex and the Listeria monocytogenes ActA Protein in Actin Filament Nucleation. Science 281:105. 29. Sitthidet C, Stevens JM, Field TR, Layton AN, Korbsrisate S, Stevens MP. 2010. Actin-based motility of Burkholderia thailandensis requires a central acidic domain of BimA that recruits and activates the cellular Arp2/3 complex. Journal of Bacteriology 192:5249–52. 30. Jeng RL, Goley ED, D'Alessio JA, Chaga OY, Svitkina TM, Borisy GG, Heinzen RA, Welch MD. 2004. A Rickettsia WASP-like protein activates the Arp2/3 complex and mediates actin-based motility. Cellular Microbiology 6:761–9.

31. Egile C, Loisel TP, Laurent V, Li R, Pantaloni D, Sansonetti PJ, Carlier MF. 1999. Activation of the CDC42 effector N-WASP by the Shigella flexneri IcsA protein promotes actin nucleation by Arp2/3 complex and bacterial actin-based motility. The Journal of Cell Biology 146:1319–1332. 32. Quinlan ME, Hilgert S, Bedrossian A, Mullins RD, Kerkhoff E. 2007. Regulatory interactions between two actin nucleators, Spire and Cappuccino. The Journal of Cell Biology 179:117. 33. Thompson ME, Heimsath EG, Gauvin TJ, Higgs HN, Kull FJ. 2012. FMNL3 FH2–actin structure gives insight into formin-mediated actin nucleation and elongation. Nature Structural & Molecular Biology 20:111. 34. Qualmann B, Kessels MM. 2009. New players in actin polymerization – WH2-domain- containing actin nucleators. Trends in Cell Biology 19:276. 35. Chen X, Ni F, Tian X, Kondrashkina E, Wang Q, Ma J. 2013. Structural Basis of Actin Filament Nucleation by Tandem W Domains. Cell Reports 3:1910. 36. Haglund CM, Choe JE, Skau CT, Kovar DR, Welch MD. 2010. Rickettsia Sca2 is a bacterial formin-like mediator of actin-based motility. Nature Cell Biology 12:1057. 37. Goode BL, Eck MJ. 2007. Mechanism and Function of Formins in the Control of Actin Assembly. Annual Review of Biochemistry 76:593. 38. Paul AS, Pollard TD. 2009. Review of the Mechanism of Processive Actin Filament Elongation by Formins. Cell Motility and the Cytoskeleton 66:606. 39. Madasu Y, Suarez C, Kast DJ, Kovar DR, Dominguez R. 2013. Rickettsia Sca2 has evolved formin-like activity through a different molecular mechanism. Proceedings of the National Academy of Sciences 110:E2677. 40. Hansen SD, Mullins RD. 2010. VASP is a processive actin polymerase that requires monomeric actin for barbed end association. The Journal of Cell Biology 191:571. 41. Bakker den HC, Cummings CA, Ferreira V, Vatta P, Orsi RH, Degoricija L, Barker M, Petrauskene O, Furtado MR, Wiedmann M. 2010. Comparative genomics of the bacterial genus Listeria: Genome evolution is characterized by limited gene acquisition and limited gene loss. BMC Genomics 11:688. 42. Gouin E, Dehoux P, Mengaud J, Kocks C, Cossart P. 1995. iactA of Listeria ivanovii, although distantly related to Listeria monocytogenes actA, restores actin tail formation in an L. monocytogenes actA mutant. Infection and Immunity 63:2729–2737. 43. Rafelski SM, Theriot JA. 2006. Mechanism of polarization of Listeria monocytogenes surface protein ActA. Molecular Microbiology 59:1262–79. 44. Auerbuch V, Loureiro JJ, Gertler FB, Theriot JA, Portnoy DA. 2003. Ena/VASP proteins contribute to Listeria monocytogenes pathogenesis by controlling temporal and spatial persistence of bacterial actin-based motility. Molecular Microbiology 49:1361.

45. Gouin E, Mengaud J, Cossart P. 1994. The virulence gene cluster of Listeria monocytogenes is also present in Listeria ivanovii, an animal pathogen, and Listeria seeligeri, a nonpathogenic species. Infection and Immunity 62:3550–3553. 46. Gerstel B, Gröbe L, Pistor S, Chakraborty T, Wehland J. 1996. The ActA polypeptides of Listeria ivanovii and Listeria monocytogenes harbor related binding sites for host microfilament proteins. Infection and Immunity 64:1929–36. 47. Muller AA, Schmid MW, Meyer O, Meussdoerffer FG. 2010. Listeria seeligeri Isolates from Food Processing Environments Form Two Phylogenetic Lineages. Applied and Environmental Microbiology 76:3044. 48. Pilátová M, Dionne MS. 2012. Burkholderia thailandensis is virulent in Drosophila melanogaster. PLoS ONE 7:e49745. 49. Gillespie JJ, Beier MS, Rahman MS, Ammerman NC, Shallom JM, Purkayastha A, Sobral BS, Azad AF. 2007. Plasmids and Rickettsial Evolution: Insight from Rickettsia felis. PLoS ONE 2:e266. 50. Pérez-Osorio CE, Zavala-Velázquez JE, León JJA, Zavala-Castro JE. 2008. Rickettsia felis as emergent global threat for humans. Emerging Infect Dis 14:1019–1023. 51. Stothard DR, Clark JB, Fuerst PA. 1994. Ancestral divergence of Rickettsia bellii from the spotted fever and typhus groups of Rickettsia and antiquity of the genus Rickettsia. Int J Syst Bacteriol 44:798–804. 52. Serio AW, Welch MD. 2012. Rickettsia parkeri invasion of diverse host cells involves an Arp2/3 complex, WAVE complex and Rho-family GTPase-dependent pathway. Cellular Microbiology 14:529. 53. Sears KT, Ceraul SM, Gillespie JJ, Allen ED, Popov VL, Ammerman NC, Rahman MS, Azad AF. 2012. Surface Proteome Analysis and Characterization of Surface Cell Antigen (Sca) or Autotransporter Family of Rickettsia typhi. PLoS Pathogens 8:e1002856. 54. Gouin E, Welch MD, Cossart P. 2005. Actin-based motility of intracellular pathogens. Current Opinion in Microbiology 8:35–45. 55. Ogata H, Renesto P, Audic S, Robert C, Blanc G, Fournier P-E, Parinello H, Claverie J-M, Raoult D. 2005. The genome sequence of Rickettsia felis identifies the first putative conjugative plasmid in an obligate intracellular parasite. PLoS Biology 3:e248. 56. Teysseire N, Chiche-Portiche C, Raoult D. 1992. Intracellular movements of Rickettsia conorii and R. typhi based on actin polymerization. Research in Microbiology 143:821–829. 57. Van Kirk LS, Hayes SF, Heinzen RA. 2000. Ultrastructure of Rickettsia rickettsii actin tails and localization of cytoskeletal proteins. Infection and Immunity 68:4706–13. 58. Oliver JD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG. 2013. Motility Characteristics Are Altered for Rickettsia bellii Transformed To Overexpress a Heterologous rickA Gene. Applied and Environmental Microbiology 80:1170.

59. Wike DA, Ormsbee RA, Tallent G, Peacock MG. 1972. Effects of Various Suspending Media on Plauqe Formation by Rickettsiae in Tissure Culture. Infection and Immunity 6:550–556. 60. Clark TR, Noriea NF, Bublitz DC, Ellison DW, Martens C, Lutter EI, Hackstadt T. 2015. Comparative genome sequencing of Rickettsia rickettsii strains that differ in virulence. Infection and Immunity 83:1568–1576.

Chapter 2

Actin assembly by the late actin-based motility factor Sca2 in spotted fever group and typhus group Rickettsia species

Note – A portion of this chapter was included in the publication: Haglund, C.M., J.E. Choe, C.T. Skau, D.R. Kovar, and M.D. Welch. 2010. Rickettsia Sca2 is a bacterial formin-like mediator of actin-based motility. Nat Cell Biol. 12:1057-63.

Introduction

Rickettsia are Gram-negative alphaproteobacteria that have an obligate intracellular growth requirement. Several species cause disease in humans, including a cluster of species that causes spotted fever illness (spotted fever group or SFG) and a cluster that causes typhus (typhus group or TG). Both are transmitted to mammals by arthropod vectors (ticks for SFG species, fleas and lice for TG species (1)) and infect vascular endothelial cells. Due to their obligate intracellular nature, Rickettsia species are a useful model for understanding how intracellular pathogens modulate the eukaryotic host environment to facilitate their survival.

After invasion of host cells and escape from a membrane-bound phagosome, many Rickettsia species employ actin-based motility (ABM) in the host cytosol (2, 3). This is a central feature of pathogenicity, and plays a key role in facilitating bacterial localization to the host cell plasma membrane for efficient spread into neighboring cells (2, 4, 5). Host actin is polymerized at one pole of the bacterial surface and the force derived from polymerization propels the bacteria through the cytoplasm. Many intracellular bacterial pathogens have independently evolved ABM, including Listeria monocytogenes, Shigella flexneri, and multiple Burkholderia species (2, 6, 7). Rickettsia species are unique, however, in that they may utilize up to two unique modes of motility at different stages of infection (8).

Most pathogens that undergo ABM use a single actin nucleating protein that activates the host Arp2/3 complex to assemble branched actin networks (6). Exceptions include the Burkholderia species B. mallei and B. pseudomallei, which each express motility factors that mimic the Ena/VASP family (7). Members of the Rickettsia genus are unique, however, in that some species have two distinct motility factors (8). One is RickA, which mediates early motility by binding to and activating the host Arp2/3 complex to form branched actin filament networks (8, 9). RickA orthologs are well conserved across Rickettsia species, with the exception of typhus group (TG) members, which lack any identifiable orthologs (9, 10). The second actin nucleating factor is Sca2 (surface cell antigen 2), which mediates late motility by directly assembling host actin filaments via an Arp2/3-independent mechanism (9, 11-13). Interestingly, Sca2 orthologs vary considerably between species, with significant differences in their predicted actin-interacting domains (11). There are also observed differences in late stage actin-based motility parameters between the different Rickettsia species. Notably, the TG species R. typhi infrequently forms short and curved actin tails, despite the absence of the Arp2/3 activator RickA (11, 14). Thus, variability between Sca2 orthologs may underlie differences in actin-based motility behaviors in different Rickettsia species.

Sca2 is a member of the autotransporter (T5SS) family of secreted proteins. The C-terminal autotransporter domain forms a beta-barrel in the outer membrane, which both anchors the protein into the membrane and serves as the pore through which the remainder of the protein, the passenger domain, is secreted through to become exposed on the bacterial surface (15). Sca2 orthologs across Rickettsia species exhibit a high degree of sequence identity in their autotransporter domain but show significant variability in the composition of their passenger domains (11). In most SFG species, the Sca2 passenger contains a conserved N-terminal domain

Figure 2.1 – R. parkeri Sca2 domain organization and biochemical characterization of a minimal active fragment.

(A) Domain organization of the RpSca2 passenger domain, and list of truncation derivatives used in this study. NTD: N-terminal domain (conserved in SFG species); P: proline-rich domains; W: predicted WH2 motifs. (B) SDS-PAGE and Coomassie stained gel of the purified RpSca2-670 fragment (~72 kDa) in the absence and presence of chymotrypsin for 15 min. Note the prominent degradation products in the absence of protease, and that following proteolysis, the larger N-terminal fragment disappears, and smaller protein products appear, most notably a band at around 45 kDa. (C) Graphs of pyrene-actin assembly reactions (5% pyrene-actin) with the indicated RpSca2-670 and RpSca2-408 fragments. Note that both promote a modest and dose-dependent enhancement of actin assembly. (D) Photos of representative RpSca2-NTD408 protein crystals. Crystals form elongated needle shapes, often with clustering.

(NTD), followed by a domain composed of proline-rich sequences and WASP-homology 2 (WH2) motifs, which bind to profilin-actin and actin monomers, respectively. We reported that Sca2 from the SFG species R. parkeri (RpSca2) mimics eukaryotic formin family proteins in several activities: it facilitates both filament actin nucleation and elongation, with elongation requiring the actin-binding protein profilin, and remains processively attached to actin filament barbed ends during elongation (16, 17). In contrast, Sca2 from the TG species R. typhi (RtSca2) lacks the N-terminal domain present in RpSca2 and instead has a single N-terminal proline-rich repeat followed by a number of predicted WH2 motifs. However, no further details are known regarding whether or how RtSca2 acts to assemble actin.

Based on the divergent sequences of RpSca2 and RtSca2, and differences in motility characteristics of R. parkeri and R. typhi, we hypothesized that the Sca2 orthologs from these species use different mechanisms to interact with and assemble host actin. To gain an understanding at the mechanistic and structural level of how each of these Sca2 orthologs interact with host actin, I purified truncated variants of RpSca2 and RtSca2 to identify the minimal active fragments. I identified a fragment of RpSca2 that was highly stable, soluble, and sufficient to confer weak but consistent actin filament nucleation activity. I obtained crystals of the purified RpSca2 fragment, but they did not diffract. For RtSca2, I found that a truncation of the passenger domain is sufficient to assemble actin by an Arp2/3-indpendent mechanism. The data collected support our hypothesis that divergent Sca2 orthologs are capable of assembling actin filaments, but utilize different biochemical mechanisms.

Results

Mapping the minimal functional fragment of SFG Sca2, including preliminary structural characterization

We previously reported that the entire passenger domain of RpSca2 exhibits activity that is characteristic of formin FH2 domains, including filament barbed end binding and inhibition of depolymerization (11). We wanted to identify if these capabilities were localized within the RpSca2 NTD, and to define the minimal fragment capable of these activities. To this end, we expressed and purified RpSca2-670 (Fig. 2.1A) (amino acids 34-670) as a GST fusion protein, then removed the GST tag by protease cleavage. This domain alone was sufficient for associating with actin filament barbed ends, as it inhibited filament depolymerization, though to a lesser degree than the full RpSca2 passenger domain, consistent with previous results (11).

However, the RpSca2-670 fragment did not show strong expression in E. coli, and purification resulted in low final protein yields with a number degradation product impurities (Fig. 2.1B), making it a poor candidate for further functional studies and structure determination. To identify a minimal functional region and identify domain boundaries for smaller truncations that might be suitable for structure determination, we performed a limited proteolysis experiment. The protease chymotrypsin was added to RpSca2-670 at a high concentration for a short period of time, leading to preferential cleavage of the protein at regions outside of stably folded domains, typically in linkers or unstructured sequences. Following limited proteolysis of RpSca2-670, we

21 saw a pronounced band appear at an approximate molecular weight of 45 kDa (Fig. 2.1B). The cleaved fragments were identified by mass spectrometry to identify the precise cut sites. This data was combined with a secondary structure prediction output from the Porter structure prediction website (http://distillf.ucd.ie/porter/) to identify potential unstructured regions of the protein, which became candidates for C-terminal boundaries to generate additional truncation constructs (11, 18). These shorter NTD truncations were expressed in E. coli with the goal of identifying a stable domain that retained the activity of RpSca2-670, while also providing better stability and protein yield for structural analyses.

The shortest tested truncation construct RpSca2-408 (amino acids 34-408; Fig. 2.1A) fulfilled both sets of criteria listed above. In pyrene actin assembly assays, this fragment was able to moderately enhance actin filament nucleation, comparable to the effects of RpSca2-670 (Fig. 2.1C). This truncation was also more stable and soluble at high protein concentrations, making it a strong candidate for structural analysis. Yields were further enhanced by about 3-fold by using a gene sequence that was codon optimized for more efficient expression in E. coli. Thus, we identified a minimal functional truncation of the Rp-Sca2 NTD (RpSca2-408) that proved to be stably folded and could be purified at sufficiently high concentrations for preliminary structural analysis.

We screened conditions for crystal formation at protein concentrations ranging from 1-10 mg/ml using commercially available screening matrices. Protein crystals were observed in conditions with 0.2 M lithium sulfate monohydrate, HEPES pH 7.5 and 25% PEG-3350. However, crystals were long and needle shaped, and not ideal for structural analysis (Fig. 2.1D). Further screening using this buffer condition with additional additives did not yield any different crystal shapes. The crystals were frozen in buffer containing 20% glycerol and analyzed by X-ray diffraction. As expected, due to their elongated needle shape, these crystals did not generate a diffraction pattern. These structural studies were stopped when another group published a paper describing the structure of a similar fragment of Sca2 (19).

The proline-rich region of SFG Sca2 binds to profilin

Beyond the NTD of RpSca2, we wanted to understand the roles of other sequence motifs, including two proline-rich sequences that are present in the center of the passenger domain (Figs. 2.1A, 2.2A). Due to the importance of this remainder of the passenger domain for robust actin assembly kinetics, we hypothesized that it may function analogously to the FH1 domain of formin proteins. FH1 domains contain a series of proline-rich sequences that bind to profilin, a protein that binds to G-actin and helps feed G-actin to the growing end of an actin filament (17). As the length and precise sequence of the proline-rich sequences in RpSca2 differ slightly from those found in formin FH1 domains, we wanted to identify the number of profilin proteins to which RpSca2 is capable of binding.

To examine the binding characteristics of the proline-rich domain of Sca2 to profilin, including stoichiometry of binding as well as binding affinity, we purified a truncated variant RpSca2-646- 1106 (amino acids 646-1106) (Fig. 2.1A). Binding stoichiometry of the RpSca2-646-1106 to profilin

Figure 2.2 – The proline-rich region of RpSca2 binds profilin.

(A) Amino acid sequence of both proline-rich repeat sequences in RpSca2, with proline residues highlighted in red. P1: aa 671-700, P2: aa 1077-1086. (B) Measurement of intrinsic fluorescence of tryptophan in profilin as the ratio of profilin:RpSca2-646-1106 is changed. Inflection point (red arrow) of signal occurs at a ratio of 3 profilins per molecule of RpSca2.

23 was determined by measuring the intrinsic fluorescence of tryptophan in profilin, which increases upon binding to proline-rich sequences. By maintaining a constant total protein concentration while varying the ratio of profilin to RpSca2-646-1106, the inflection point of the fluorescence curve indicates the binding stoichiometry of the proteins (20, 21). Our results indicate a binding stoichiometry of 3 profilins to 1 RpSca2-646-1106 (Fig. 2.2B). Attempts to measure the affinity of RpSca2 to profilin by isothermal titration calorimetry were unsuccessful as the interaction did not generate a measurable amount of enthalpy change beyond the background signal from dilution (data not shown).

Determining the stoichiometry and affinity of binding of RpSca2-646-1106 to G-actin proved to be more challenging. An attempt to use isothermal titration calorimetry failed due to an inability to find suitable buffer conditions that allowed the actin to remain as monomers while also allowing RpSca2-646-1106 to remain soluble (this challenge was subsequently overcome as described in Chapter 3). Fluorescence-based binding assays were also unsuccessful due to an inability to achieve sufficient signal-to-noise ratios, despite testing several different fluorescent labels on actin. Thus, although we were able to determine that RpSca2-646-1106 binds to three molecules of profilin, we were unfortunately not able to determine the stoichiometry of binding of RpSca2 and G-actin.

TG Sca2 protein is a weak actin nucleator, but the protein is poorly behaved in biochemical assays

The passenger domain of RtSca2 from the TG species R. typhi is divergent from that of RpSca2, raising the question of whether RtSca2 nucleates actin assembly, and if so, by what mechanisms. To examine the activity of RtSca2, we first attempted to express the full passenger domain (RtSca2-1253) (Fig. 2.3A) as a GST fusion protein, then removed the GST tag by protease cleavage. However, protein expression was poor even under a wide range of expression conditions, and final purification yields were very low. A truncated variant excluding the C-terminal repeats (RtSca2-785) (Fig. 2.3A) was more highly expressed, much more soluble, and was able to be purified to homogeneity in higher yields (Fig. 2.3B).

RtSca2 has up to 7 sequences predicted WH2 sequences that may bind actin monomers, and these span across most of the passenger domain. Therefore, we predicted that RtSca2 might be able to nucleate actin filaments by mimicking tandem-WH2 nucleators. We first tested a fragment RtSca2-785 (amino acids 2-785) cleaved of its N-terminal GST tags. The monomeric construct alone does not appear to influence actin assembly in pyrene-actin assays, though we start to see some inhibition of polymerization when it is present in equimolar amounts to G-actin (Fig. 2.3C). Purified RtSca2-785 does not appear to enhance actin assembly in vitro.

RtSca2 has a short polyproline sequence, with 9 consecutive prolines at the N-terminus, following the secretion signal sequence (Fig. 2.3A). We hypothesized that this might interact with profilin- actin, similar to the polyproline sequences found in RpSca2 and formin FH1 domains. When profilin was added to RtSca2-785 at a final concentration of 2 µM (2x the molar concentration of actin), RtSca2-785 accelerated actin assembly in comparison with control reactions (Fig. 2.3D). However, there was little concentration-dependent enhancement of actin assembly, suggesting

Figure 2.3 – RtSca2 passenger is largely insoluble and prone to aggregation. RtSca2-785 conditionally enhances actin assembly.

(A) Domain organization of the RtSca2 passenger domain, and list of truncation derivatives used in this study. (B) SDS-PAGE and Coomassie stained gel of purified RtSca2-1253 (expected MW 140 kDa) and RtSca2-785 (expected MW 86 kDa). (C-F) Graphs of pyrene-actin assembly reactions (5% pyrene-actin) for the indicated concentrations of RtSca2-785, with GST tag cleaved during purification. (C) final reaction concentration of 75 mM KCl, without profilin, (D) 75 mM KCl, with 2 µM profilin, (E) 25mM KCl, without profilin, and (F) 25mM KCl, with 2 µM profilin. (G-I) Graphs of pyrene-actin assembly reactions for the indicated concentrations of GST-RtSca2-785, with dimerization induced through an N-terminal GST affinity tag. (G) final reaction concentration of 75 mM KCl, without profilin. (H) 75 mM KCl, with 2 µM profilin, (I) 25 mM KCl, without profilin. (J) Graphs of pyrene-actin assembly reactions for the indicated concentrations of RtSca2-785 at 75mM KCl, with 40 nM of the Arp2/3 complex, and without profilin.

26 that the profilin may simply suppress assembly of actin in the control reaction. Lowering the salt concentration in the reaction buffer can help boost activity of a weak nucleator, so we also tested RtSca2-785 in pyrene reactions with buffer that contained no additional KCl. When tested under these conditions, in both the absence and presence of profilin, RtSca2-785 caused a concentration-dependent enhancement of actin assembly, most notably leading to a dramatic increase in F-actin at steady state (Fig. 2.3E, F). However, there was little different between the reactions with or without profilin, and in both cases, there was little effect on the lag phase at the very early time points of the reactions.

Many actin nucleators function as dimers, or show enhanced activity when dimerized or oligomerized (22-24). We also tested an artificially dimerized construct of RtSca2-785 by keeping it attached to its N-terminal GST-affinity tag, which forms a homodimer. When introduced in pyrene-actin assembly reactions in the absence of profilin, we saw a moderate positive effect on actin assembly and nucleation (Fig. 2.3G). However, when GST-RtSca2-875 is added with 2 µM profilin, a strong concentration-dependent increase in actin assembly was observed (Fig. 2.3H). Interestingly, the only conditions where we see a strong enhancement specifically at the early nucleation timepoints is when the dimer is added to the low KCl concentration buffer reaction conditions (Fig. 2.4I). Here we have demonstrated for the first time that a truncation of the RtSca2 passenger domain interacts with actin, and can enhance actin assembly or activity, particularly as a dimerized construct with either low salt conditions, or with the addition of profilin.

Finally, we wanted to test if it RtSca2-785 was able to activate the Arp2/3 complex, although it does not have canonical Arp2/3 activating sequences. When RtSca2-785 was added at increasing concentrations with 40 nM Arp2/3 complex, we saw no enhancement of actin assembly in pyrene-actin assays, though with higher concentrations, we observe moderate acceleration of actin assembly (Fig. 2.3J). Thus, as expected, RtSca2-785 does not appear to behave as an Arp2/3 activator.

While these studies yielded positive results, the purified RtSca2-785 protein was still prone to aggregation. Additionally, we had to exclude the C-terminal repeats for successful purification of the protein, and they serve a currently unknown function. Protein yields were not sufficient for additional experiments aimed at biochemical characterization of RtSca2 and investigating its interactions with actin and profilin. Thus, this work remained unfinished, though further investigations of Sca2 function and activity from Ancestral Group species R. bellii were pursued, as described in Chapter 3.

Discussion

Bacterial actin-based motility is central to the virulence of many intracellular pathogens and provides a model for illuminating actin function and regulation in uninfected cells. The data presented here suggest that the Rickettsia late motility factor Sca2 from different species exhibit differences in their actin nucleation mechanisms.

RpSca2 domains function analogously to formin FH1 and FH2 domains

Previously published work indicated that RpSca2 exhibits many characteristics and activities similar to the formin family of actin nucleation and elongation factors (11). We wanted to determine in greater detail whether particular domains of RpSca2 conferred specific roles and how analogous they were to the domains found in formins. We hypothesized that the RpSca2 N- terminal domain mimics the formin FH2 domain, whereas the downstream proline-rich repeats and WH2 motifs mimic the formin FH1 domain by bind to profilin and actin to facilitate elongation.

The FH2 domain of formins facilitate both actin nucleation and elongation. It forms a homodimeric ring, which first nucleates a new actin filament and then remains at the barbed end of the filament and “walks” along the end as monomers are added and the filament grows (16, 23, 25). The RpSca2 NTD is sufficient to nucleate actin, supporting an FH2-mimicking role for this domain. We were able to identify a minimal functional truncation of this domain, RpSca2-408. This truncation retained the function of the larger NTD, though was a slightly less potent nucleator. RpSca2-408 differs from FH2 domains primarily in that it is functional as a monomer, unlike the dimerizing formin FH2 domains. Despite this key difference, this construct still bound actin filament barbed ends and inhibited filament depolymerization. Thus, the RpSca2 NTD mimics the functions of a formin FH2 domain though a distinct mechanism and interaction with actin filaments.

During the time that above-mentioned experiments were in progress, a paper was published that corroborated our preliminary work (19). A crystal structure was solved of a truncated Sca2 protein nearly identical to the truncation we had identified, confirming that the RpSca2-408 truncation is a stably folded minimal functional domain. Though it remains a monomer instead of mimicking the formin FH2 dimer, the RpSca2 NTD still adopts a crescent shape composed of a number of packed short alpha helices that is predicted to fit around the barbed end of an actin filament (19).

In contrast with the FH2 domain, the FH1 domain of formins is composed of a number of proline- rich repeats that bind profilin-actin and feed ATP-bound actin monomers into the growing end of a filament. Profilin-gated filament elongation is a key feature of formins (26, 27). FH1 domains contain multiple short proline-rich repeats with linker sequences in between (28). The proline- rich domain of RpSca2 contains two polyproline sequences, the first one with 14 prolines in 30 consecutive residues, and the other with 9 prolines in 10 consecutive residues. Though the first polyproline repeat contains many non-proline residues, many of them are aliphatic residues (including leucine and isoleucine), which may not strongly inhibit folding into a type-II polyproline helix that binds profilin (29). As our results showed that RpSca2 binds to 3 profilin molecules, we predict that the first polyproline repeat may be long enough to bind to 2 molecules of profilin, while the second shorter polyproline sequence likely binds to a single profilin protein.

Some formins also contain additional WH2 motifs located C-terminally to the FH2 domain. When two of these WH2 motifs are brought into proximity due to the dimerization by the FH2 domains,

28 they can initiate filament nucleation, similar to tandem WH2 nucleators (24). However, an RpSca2 truncation comprised of just the proline-rich and WH2 motifs did not enhance nucleation. It is possible that the spacing, orientation, and affinities of these sequences may not be sufficient to initiate nucleation (30, 31). Therefore, we hypothesized that they may instead feed actin monomers to enhance elongation similar to the role of formin FH1 domains. Other published work shows that mutagenesis of the WH2 motifs indeed does inhibit both nucleation and elongation activity of RpSca2 (19). The requirement of profilin in the actin assembly reaction in conjunction with mutagenesis experiments that abolish G-actin binding in this domain confirm that the SFG Sca2 proline-rich and WH2 sequences contribute to elongation of the growing actin filament (11, 19).

Thus, we conclude that RpSca2 is a unique formin-mimicking bacterial actin nucleator. Its NTD functions in an analogous manner to formin FH2 domains, and the proline-rich sequences and WH2 motifs play a similar role to the formin FH1 domain. There is little primary sequence homology between formin FH1 and FH2 domains and RpSca2, yet RpSca2 achieves similar functions through distinct motifs. Of particular interest, RpSca2 may function as a monomer, in contrast with the classical formin dimer.

RtSca2 is an actin nucleator that may mimic host tandem-WH2 nucleators

In contrast with the above-mentioned information on the function of Sca2 from R. parkeri, the mechanism of action of Sca2 from the TG species R. typhi continues to be poorly understood. Sequence and secondary structure predictions of RtSca2 point towards an actin assembly mechanism that may be similar to tandem-WH2 nucleators. They typically initiate nucleation of a new actin filament, then dissociate, leaving the new filament free to elongate (23). Tandem- WH2 nucleators vary considerably in the number and spacing of WH2 motifs, which in turn determine the precise manner of actin filament assembly (16, 23, 32). Although RtSca2 has seven predicted WH2 motifs, these sequences are poorly conserved and we do not know the number of predicted WH2 motifs that actually bind to actin monomers. The enhancement in RtSca2 actin assembly activity with the addition of profilin may mean that it can use a combination of G-actin and profilin-actin to assemble actin, though we don’t yet know the number of profilin-actin complexes that RtSca2 can bind. It is also unclear if RtSca2 is a monomer or forms larger oligomers or complexes. Our experiments also utilized a truncation excluding a C-terminal repeat region, which may influence its actin assembly mechanism, or facilitate interactions with itself or other proteins as well. Thus, many additional questions remain unanswered regarding the RtSca2 actin assembly mechanism, and future investigation will provide a more detailed understanding of its mechanism of action, as described in Chapter 4.

How do differences between Sca2 orthologs affect actin-based motility?

Interestingly, Rickettsia species in the SFG and TG exhibit significant differences in actin-based motility characteristics. SFG species assemble actin tails composed of long, linear, bundled actin filaments. The formin-mimicking mechanism of RpSca2 explains the linear actin organization seen with these species. In contrast, the TG species R. typhi assembles shorter, dense curved

29 actin tails. Moreover, actin tails are seen extremely infrequently, in association with fewer than 1% of bacteria (14, 33). This actin tail appearance is unexpected because it has been reported that the assembly of short and curved actin tails by R. parkeri occurs through the activity of the Rickettsial RickA protein, which is not encoded in the R. typhi genome (14, 33). Moreover, the purified passenger domain of RtSca2 does not activate the Arp2/3 complex. Because actin tails are an infrequent occurrence with TG Rickettsia, this leaves us with additional questions regarding the role of Sca2 in infection beyond actin tail formation in these species. A more detailed understanding of how Sca2 orthologs differentially interact with and assemble actin filaments may allow us to understand the connection between the bacterial actin nucleators and the motility phenotypes we see in the cellular environment. This could influence aspects such as the actin structures found in the tails, the percentage of bacteria that undergo motility, and motility rates and trajectories of movement.

Summary

The study of bacterial actin-based motility continues to provide us with information about host- pathogen interactions and expands our understanding of native host actin dynamics. Rickettsia have emerged as particularly interesting pathogens to study due to the diversity of actin assembly mechanisms they have evolved. Further study of related bacterial species will also provide us with insight on the evolution of bacterial actin assembly factors and how differences in their mechanisms of action may influence motility and virulence.

Materials and Methods

Molecular Biology

Passenger domains and all mutant constructs of Sca2 were cloned into the expression vectors pGEX4T-2 or pGEX6P-3. All Sca2 expression constructs were comprised of sequences encoding the passenger domain, excluding the N-terminal signal sequence and the C-terminal autotransporter domain. The gene fragment encoding the RpSca2 passenger domain and RpSca2- 646-1106 were amplified from heat-killed R. parkeri strain Portsmouth (gift from Chris Paddock at the Centers for Disease Control and Prevention) as described previously (11). N-terminal truncation constructs were amplified using the forward primer 5’- GCGTGTGGATCCGCAAGCTTTAAAGATTTAGTTAGTAAAACC-3’ and reverse primer 5’- CGGCTCGAGCTATTTCTTGTCTCTACCCGTGG-3’, and inserted into pGEX4T-2 using BamHI and XhoI restriction sites. For crystallography experiments, RpSca2-408 was additionally codon optimized for expression in E. coli (DNA 2.0, Inc.) and inserted into pGEX6P-3 with BamHI and XhoI restriction sites using the forward primer 5’-GGAGGATCCGCGTCGTTC-3’ and reverse primer 5’- CATCTCGAGTTACTTCTTGTCACG-3’. The gene fragment encoding the RtSca2 passenger domain and truncation were amplified from heat-killed R. typhi strain Wilmington (gift from the Hackstadt Lab, Rocky Mountain Labs). RtSca2- 1253 was amplified using the forward primer 5’-GCTGGATCCGAATCCTTAGCCTCATC-3’ and reverse primer 5’-GAGGGTCTGCGGCCGCTTCATCACCGGCTCCTATTAC-3’ and inserted into pGEX4T-2 using BamHI and NotI, while RtSca2-785 used the forward primer 5’- GCTGGATCCGAATCCTTAGCCTCATC-3’ and the reverse primer 5’- CATGCGGCCGCTCATGCTGCATATTTTGC-3’, and was inserted into pGEX6P-3 using the restriction sites BamHI and XhoI. Both expression vectors added an N-terminal GST tag and short linker, cleavable by either thrombin (pGEX4T-2) or Prescission protease (pGEX6P-3).

Protein Purification

RpSca2 passenger domain, RpSca2-670 and RpSca2-646-1106 were purified as described previously (11). The RtSca2 passenger domain and truncations were expressed in either BL21- CodonPlus (DE3) RIL or RIPL E. coli (Agilent Technologies). Cultures were grown in 2xYT and protein expression was induced with 0.3-1 mM IPTG at 16°C for 16-18 h. Bacterial pellets were resuspended in 10 ml of lysis buffer per liter of culture (50 mM Tris pH 7.5, 200 mM KCl, 1 mM EDTA). Pellets were frozen slowly to -80°C for a minimum of 12 hours to begin cell lysis. Pellets were thawed in room temperature water and further lysed with the addition of 1 mg/ml lysozyme (Sigma) and incubated on ice for 20 minutes with occasional inversion. Protease inhibitors (PMSF or AEBSF [EMD Millipore], leupeptin/pepstatin/chymostatin [EMD Millipore], aprotinin [MP Biomedicals]) were added, and cell lysis was then completed by sonication. Lysates were centrifuged at 12,000 x g for 25 min at 4°C to pellet insoluble material. Supernatants were then supplemented again with the above-mentioned protease inhibitors and incubated over buffer-equilibrated-Glutathione Sepharose 4B (GE Healthcare) for up to 60 min at 4°C. Resin was batch washed with at least 150 ml of wash buffer (lysis buffer + 0.5 mM DTT). For GST-tagged proteins, proteins were eluted with wash buffer supplemented with 10 mM glutathione. To

31 remove GST tags, Prescission Protease was added to the washed resin for 16-18 h at 4°C. Cleaved protein was eluted with one resin volume of wash buffer. Protein eluates in both cases were concentrated to <500 µl, filtered and further purified using an AKTA Explorer (GE Healthcare). Size exclusion was performed using either a Superdex 75 10/300 GL (RpSca2 N-terminal truncation constructs) or a Superdex 200 10/300 GL (all other constructs, including GST-tagged proteins) column (GE Healthcare) into final storage buffer (20 mM HEPES pH 7.5, 100 mM KCl, 1 mM EGTA, 2 mM EDTA, 0.5 mM DTT, 10% v/v glycerol). Final protein fractions were concentrated to > 40 µM, aliquoted and flash frozen in liquid nitrogen before storage at -80°C. Proteins used in crystallization trials contained 0.5 mM TCEP instead of DTT as a reducing agent.

Protein Crystallization Trials

RpSca2-408 was purified and crystallization was attempted with the help of Jeff Iwig in the lab of John Kuriyan at UC Berkeley. The Mosquito liquid handler (TTP Labtech) was used to set screening trays. RpSca2-408 ranging in concentration from 10-40 mg/ml were screened using the following commercially available screening plates: PEG Ion, Index HT, Salt Rx 1 (all Hampton Research Corp), Wizard Classic (Rigaku Reagents, Inc), and PACT (Qiagen). After identifying initial crystallization conditions (Index, well G4: 0.2 M Li2SO4, 0.1 M HEPES pH 7.5, 25% PEG3350), custom screens were made. With a constant concentration of Li2SO4, we made a matrix varying both buffer pH (6.8-8.2) and concentrations of PEG3350 (18-29.5%) to identify more ideal crystallization conditions. Another custom screen was conducted, keeping pH constant (7.5), altering PEG3350 concentrations as before, but also adding different salts as the other variable. An additive screen (Silver Bullets, Hampton Research Corp) was also tested at concentrations ranging from 5-20% in a buffer containing 0.1 M HEPES pH 8.0, 0.2 M Li2SO4 and 19% PEG3350 using 10 mg/ml of protein. No conditions were able to yield protein crystals in shapes other than needles. The largest needles from the Silver Bullets additive screening plates were harvested and flash frozen in liquid nitrogen with addition of 20% v/v glycerol as a cryoprotectant. Crystals were measured for X-ray diffraction at the Lawrence Berkeley National Laboratory Advanced Light Source, Beamline 8.2.2.

Pyrene-Actin Assembly Assays

Pyrene-actin assembly assays used 99% pure rabbit muscle G-actin supplemented with 5-10% pyrene-actin (both Cytoskeleton, Inc.). Lyophilized proteins were resuspended and dialyzed in G- buffer (5 mM Tris pH 7.5, 0.2 mM CaCl2, 0.2 mM ATP, and 0.5 mM DTT) for at least 48 hours. Polymerization reactions were initiated by adding 10% volume of 10x initiation buffer (10 mM MgCl2, 10 mM EGTA, 5 mM ATP, 500 mM KCl) and 23.3% volume of Sca2, or protein storage buffer as a control (see protein purification details). Low salt pyrene reaction conditions utilized initiation buffer without KCl, with salt contributions coming solely from the protein buffer. Final reaction conditions were 1 µM actin and pyrene-actin, and 2 µM human platelet profilin (34) if applicable. Reactions with Arp2/3 complex contained a final concentration of 40 nM recombinant Arp2/3 complex purified from insect cells.

Fluorescence measurements began within 30 seconds of mixing actin with the remainder of the reaction mixture in black bottom 96- or 384-well plates (Corning) on a Tecan InfinitePro2000 plate reader, using a 365 nm excitation filter (10 nm bandpass), a 405 nm emission filter (20 nm bandpass), recorded using Magellan software. Kinetic reactions were measured every 20 s for 40-60 min. Curves were averaged and normalized to both a minimum and maximum baseline for each reaction, averaging 2-4 replicates for each reaction condition. Normalized plots were generated using Prism v6.07 (GraphPad Software, Inc.). Elongation reactions were seeded with an additional 100 nM of F-actin seeds, pre-polymerized for at least 2 h at room temperature. F- actin was added to reaction wells using wide bore pipet tips. Elongation reactions were mixed by pipetting up and down exactly 3 times to uniformly shear the F-actin in all experiments.

Protein Interaction Assays

Measuring the interaction of RpSca2-646-1106 with profilin was accomplished by following the increase in intrinsic fluorescence of a tryptophan in profilin upon binding of a polyproline sequence (21). While maintaining a total protein concentration of 10nM, the ratios of RpSca2- 646-1106 and profilin (diluted into 20mM Tris pH 7.5, 150mM KCl, 0.2mM DTT) were varied (20), and reactions were left to incubate at room temperature for one hour. Tryptophan fluorescence was measured (ex: 295nm, em: 323nm) using a Fluorolog-3 model FL3-11 spectrofluorometer (Horiba Jobin Yvon) and SpectrAcq v5.20 and DataMax v2.2.12B software. Experiment was repeated in duplicate, with measurements of profilin only solutions subtracted from the interaction measurements. Data analysis and plots were generated in Microsoft Excel.

References

1. Azad AF, Beard CB. 1998. Rickettsial pathogens and their arthropod vectors. Emerging Infect Dis 4:179–86. 2. Goldberg MB. 2001. Actin-based motility of intracellular microbial pathogens. Microbiology and Molecular Biology Reviews 65:595. 3. Van Kirk LS, Hayes SF, Heinzen RA. 2000. Ultrastructure of Rickettsia rickettsii actin tails and localization of cytoskeletal proteins. Infection and Immunity 68:4706–13. 4. Gouin E, Welch MD, Cossart P. 2005. Actin-based motility of intracellular pathogens. Current Opinion in Microbiology 8:35. 5. Kleba B, Clark TR, Lutter EI, Ellison DW, Hackstadt T. 2010. Disruption of the Rickettsia rickettsii Sca2 Autotransporter Inhibits Actin-Based Motility. Infection and Immunity 78:2240. 6. Way M, Welch MD, Way M. 2013. Arp2/3-Mediated Actin-Based Motility: A Tail of Pathogen Abuse. Cell Host & Microbe 14:242. 7. Benanti EL, Nguyen CM, Welch MD. 2015. Virulent Burkholderia Species Mimic Host Actin Polymerases to Drive Actin-Based Motility. Cell 161:348. 8. Lamason RL, Risca VI, Abernathy E, Welch MD. 2014. Rickettsia Actin-Based Motility Occurs in Distinct Phases Mediated by Different Actin Nucleators. Current Biology 24:98. 9. Jeng RL, Goley ED, D'Alessio JA, Chaga OY, Svitkina TM, Borisy GG, Heinzen RA, Welch MD. 2004. A Rickettsia WASP-like protein activates the Arp2/3 complex and mediates actin-based motility. Cellular Microbiology 6:761–9. 10. McLeod MP, Qin X, Karpathy SE, Gioia J, Highlander SK, Fox GE, McNeill TZ, Jiang H, Muzny D, Jacob LS, Hawes AC, Sodergren E, Gill R, Hume J, Morgan M, Fan G, Amin AG, Gibbs RA, Hong C, Yu X-J, Walker DH, Weinstock GM. 2004. Complete genome sequence of Rickettsia typhi and comparison with sequences of other rickettsiae. Journal of Bacteriology 186:5842–55. 11. Haglund CM, Choe JE, Skau CT, Kovar DR, Welch MD. 2010. Rickettsia Sca2 is a bacterial formin-like mediator of actin-based motility. Nature Cell Biology 12:1057. 12. Cardwell MM, Martinez JJ. 2012. Identification and characterization of the mammalian association and actin-nucleating domains in the Rickettsia conorii autotransporter protein, Sca2. Cellular Microbiology 14:1485. 13. Goley ED, Welch MD. 2006. The ARP2/3 complex: an actin nucleator comes of age. Nature Reviews Molecular Cell Biology 7:713. 14. Teysseire N, Chiche-Portiche C, Raoult D. 1992. Intracellular movements of Rickettsia conorii and R. typhi based on actin polymerization. Research in Microbiology 143:821–829.

15. Grijpstra J, Arenas J, Rutten L, Tommassen J. 2013. Autotransporter secretion: varying on a theme. Research in Microbiology 164:562. 16. Campellone KG, Welch MD. 2010. A nucleator arms race: cellular control of actin assembly. Nature Reviews Microbiology 11:237. 17. Goode BL, Eck MJ. 2007. Mechanism and Function of Formins in the Control of Actin Assembly. Annual Review of Biochemistry 76:593. 18. Pollastri G, McLysaght A. 2004. Porter: a new, accurate server for protein secondary structure prediction. Bioinformatics 21:1719–20. 19. Madasu Y, Suarez C, Kast DJ, Kovar DR, Dominguez R. 2013. Rickettsia Sca2 has evolved formin-like activity through a different molecular mechanism. Proceedings of the National Academy of Sciences 110:E2677. 20. Weeds AG, Harris H, Gratzer W, Gooch J. 1986. Interactions of pig plasma gelsolin with G- actin. Eur J Biochem 161:77–84. 21. Perelroizen I, Marchand JB, Blanchoin L, Didry D, Carlier MF. 1994. Interaction of profilin with G-actin and poly(L-proline). Biochemistry 33:8472–8478. 22. Namgoong S, Boczkowska M, Glista MJ, Winkelman JD, Rebowski G, Kovar DR, Dominguez R. 2011. Mechanism of actin filament nucleation by Vibrio VopL and implications for tandem W domain nucleation. Nature Structural & Molecular Biology 18:1060–7. 23. Dominguez R. 2009. Actin filament nucleation and elongation factors – structure–function relationships. Critical Reviews in Biochemistry and Molecular Biology 44:351. 24. Gould CJ, Maiti S, Michelot A, Graziano BR, Goode BL, Blanchoin L, Goode BL. 2011. Report The Formin DAD Domain Plays Dual Roles in Autoinhibition and Actin Nucleation. Current Biology 21:384. 25. Chesarone MA, DuPage AG, Goode BL. 2009. Unleashing formins to remodel the actin and microtubule cytoskeletons. Nature Reviews Molecular Cell Biology 11:62. 26. Paul AS, Paul AS, Pollard TD, Pollard TD. 2007. The role of the FH1 domain and profilin in formin-mediated actin-filament elongation and nucleation. Curr Biol 18:9–19. 27. Sagot I, Rodal AA, Moseley J, Goode BL, Pellman D. 2002. An actin nucleation mechanism mediated by Bni1 and Profilin. Nature Cell Biology. 28. Courtemanche N, Pollard TD. 2012. Determinants of Formin Homology 1 (FH1) Domain Function in Actin Filament Elongation by Formins. Journal of Biological Chemistry 287:7812. 29. Brown AM, Zondlo NJ. 2012. A propensity scale for type II polyproline helices (PPII): aromatic amino acids in proline-rich sequences strongly disfavor PPII due to proline-aromatic interactions. Biochemistry 51:5041–51. 30. Rasson AS, Bois JS, Pham DSL, Yoo H, Quinlan ME. 2015. Filament Assembly by Spire: Key Residues and Concerted Actin Binding. Journal of Molecular Biology 427:824.

31. Chereau D, Kerff F, Graceffa P, Grabarek Z, Langsetmo K, Dominguez R. 2005. Actin-bound structures of Wiskott-Aldrich syndrome protein (WASP)-homology domain 2 and the implications for filament assembly. Proc Natl Acad Sci USA 102:16644–16649. 32. Carlier M-F, Husson C, Renault L, Didry D. 2011. Control of Actin Assembly by the WH2 Domains and Their Multifunctional Tandem Repeats in Spire and Cordon-—Bleu. International Review of Cell and Molecular Biology 55. 33. Van Kirk LS, Hayes SF, Heinzen RA. 2000. Ultrastructure of RIckettsia rickettsii Actin Tails and Localization of Cytoskeletal Proteins. Infection and Immunity 68:4706–4713. 34. Haarer BK, Lillie SH, Adams AE, Magdolen V, Bandlow W, Brown SS. 1990. Purification of profilin from Saccharomyces cerevisiae and analysis of profilin-deficient cells. The Journal of Cell Biology 110:105–114.

Chapter 3

The Sca2 protein from the ancestral group Rickettsia species Rickettsia bellii employs a distinctive mechanism of actin assembly

Introduction

The genus Rickettsia comprises a group of Gram-negative alphaproteobacteria that are obligate intracellular parasites of arthropods and mammals. It includes subgroups of species that cause human illness, including spotted fever group (SFG) species that cause various spotted fever rickettsioses, as well as typhus group (TG) species that cause endemic and epidemic typhus (Fig. 3.1A). The genus is relatively ancient, and in addition to the SFG and TG, it also includes transitional group (TRG) species that are closely related to the SFG, as well as ancestral group (AG) species that diverged earlier during rickettsial evolution (1, 2).

R. bellii is an AG species that is the most common Rickettsia found in ticks in the Americas (3). It is passed on from female ticks to their offspring via transovarial transmission. It is also the only Rickettsia species that is found in both hard and soft ticks, and thus exhibits a greater host range than other Rickettsiae (3). Although R. bellii is generally considered to be non-pathogenic to vertebrates, with no known cases of human infection, it can induce formation of eschars in a guinea pig model (4). Despite the inability of R. bellii to cause disease in mammals, it is capable of infecting and replicating in cell lines from many arthropod and mammalian species (5). R. bellii also differs from most other Rickettsia species in that they have a larger genome, and retain genes not found in other Rickettsiae, including those that encode the machinery involved in conjugative DNA transfer (6-8).

One striking feature of infection with R. bellii, as well as many other Rickettsia species, is their ability to escape from the phagosome into the cytosol, where they undergo actin-based motility (9, 10). Actin-based motility has been observed for R. bellii in infected Vero cells (11). Although basic motility parameters were studied, it is still not know how quantitative motility parameters and the underlying mechanisms of motility compare with those of pathogenic SFG species. Understanding how R. bellii actin-based motility differs from that of SFG species may help to illuminate the role of actin-based motility in pathogenesis, as well as provide insight into the evolution of motility mechanisms within the genus.

Rickettsia are unique among bacteria that undergo actin-based motility in that many species, including R. bellii, encode two different motility factors – RickA and Sca2 – that nucleate filamentous actin (F-actin) from monomeric actin (G-actin). These two proteins act by different mechanisms and are active at different times during infection. The RickA ortholog from SFG species activates the host Arp2/3 complex to form branched actin networks at the bacterial surface (12, 13). In SFG Rickettsia, RickA mediates actin-based motility at short times (<1 hour) post infection, resulting in the assembly of short, curved actin tails (14). In contrast with RickA, the Sca2 ortholog from SFG species directly nucleates actin without requiring other host proteins. Sca2 mediates actin assembly at later times (>24h) post infection, resulting in the assembly of actin tails consisting of long, parallel bundled filaments (14-16)(17).

RickA and Sca2 also differ in the extent to which their sequence is conserved in the Rickettsia genus. RickA orthologs, when present, are well conserved across Rickettsia species, particularly in their Arp2/3-activating domain (18), suggesting their function in actin-based motility is also

Figure 3.1 – Rickettsia phylogeny and domain organization of Sca2 orthologs.

(A) Phylogenetic tree depicting Ancestral Group (AG), Transitional Group (TRG), Typhus Group (TG) and Spotted Fever Group (SFG) Rickettsia species. (B) Sca2 domain organization for SFG species R. parkeri and AG species R. bellii. NTD: N-terminal domain, conserved in SFG species; W: WH2 motifs; W?: predicted WH2 motifs; P: proline-rich repeat regions; SS: signal sequence; AT: autotransporter domain. (C) Names and descriptions of all RbSca2 fragments and mutants used in this study.

39 likely to be conserved between species. In contrast, Sca2 orthologs across Rickettsia species show considerable variability (17). As a member of the autotransporter (T5SS) protein family, Sca2 contains a C-terminal autotransporter domain that is highly conserved between species and forms a beta-barrel in the outer membrane that anchors the protein to the bacterial surface. The remaining passenger domain of the protein threads through the pore formed by the autotransporter domain and is exposed on the bacterial surface (19); this domain exhibits a great deal of variability between Sca2 orthologs. In SFG species, the N-terminus of passenger domain is conserved and is key to its activity in mimicking eukaryotic formin proteins in their ability to nucleate actin filaments and associate with growing filament barbed ends as they elongate (17). However, Sca2 from R. bellii lacks this N-terminal domain and is significantly shorter (Fig. 3.1B). Yet, their observed actin tails are also long and linear, suggesting that they are not formed by RickA and host Arp2/3 complex.

Here, we sought to determine whether the parameters of R. bellii actin-based motility are dictated by the mechanism by which AG Sca2 assembled actin tails, if it indeed is the actin assembly factor. We determined that AG and SFG Rickettsia differ in significant ways in various aspects of motility. Notably, AG motility exhibits more variability dependent on the cell type. AG Sca2 is sufficient to nucleate actin, likely mimicking a tandem WH2 nucleating mechanism, likely through dimerization or oligomerization.

Results

R. bellii actin-based motility parameters differ from those of R. parkeri

Although AG species R. bellii and representative SFG species R. parkeri are known to undergo actin-based motility (3, 9), it is not known whether the parameters of motility are similar or different for these species when infecting a single host cell type. To assess motility parameters, we infected human lung epithelial A549 cells with either species (these cells were chosen because of their amenability for microscopy and gene silencing experiments). For live imaging experiments, we used an A549 cell line that stably expressed LifeAct-mCherry to visualize actin. These cells were infected by either GFP-expressing R. parkeri or R. bellii at an MOI of 1 for both species and motility rates were measured at 48 hours post infection (hpi). The mean rates for R. parkeri motility was 18.09 µm/min (similar to previous observations in other mammalian cell types (14, 20)). In contrast, R. bellii motility occurred at an average rate of ~11.43 µm/min (Fig. 3.2A). Thus, R. bellii moves at a slightly slower rate than R. parkeri.

Next, we examined the trajectories of bacterial movement. We followed the movement of individual bacteria for 1 min and calculated a motility efficiency coefficient by dividing the total distance travelled by the straight-line displacement from the initial to the final position. Values closer to 1 indicate a more linear trajectory, and values closer to 0 indicate a more curved trajectory. Although the mean motility coefficients for R. parkeri (0.842) and R. bellii (0.757) were close, the difference was statistically significant (p-value of 0.0115 by the Mann-Whitney test) (Fig. 3.2C). We see that motile R. bellii do show a higher number of bacteria with considerably lower efficiency coefficients.

Figure 3.2 – R. bellii actin-based motility parameters differ from those of R. parkeri.

(A) Confocal micrograph stills from movies taken of A549 epithelial cells expressing F-tractin-tagRFPT (red) and infected with GFP expressing R. bellii or R. parkeri (both shown in green) and imaged at 48 hpi. Scale bar = 5um. (B) Motility rates (µm/min) for R. bellii (n=142) or R. parkeri (n=106) in A549 cells. Differences are statistically significant (p < 0.0001 as calculated by Mann-Whitney U test). (C) Representative movement tracks for R. bellii and R. parkeri in A549 cells (20 randomly selected bacteria per species over the course of 60 s). (D) Motility efficiency coefficients for R. bellii (n=142) or R. parkeri (n=106). Differences are statistically significant (p < 0.05 as calculated by Mann-Whitney U test). (E) Fraction of bacteria associated with actin tails for R. bellii (n=2301) or R. parkeri (n=1121).

Finally, we measured percentage of bacteria associated with actin tails in A549 cells at 48 hpi as an indicator of the efficiency with which each species initiates actin-based motility. For R. parkeri, 16.9% were associated with actin tails, consistent with results from other mammalian cell lines (14, 20). In contrast, 42.4% R. bellii were associated with actin tails (Fig. 3.2D), also similar to the percentages seen with in other mammalian cell lines (11). Thus, the parameters of motility differ significantly between R. bellii and R. parkeri, with R. bellii more often associated with actin tails, though their motility is slower and contains a sub-population that more often follows curved trajectories.

A similar set of host cytoskeleton proteins is important for R. bellii and R. parkeri motility

The observed differences in the parameters of R. bellii and R. parkeri actin-based motility suggested that the host proteins involved in motility may differ between the two species. To test this, we used RNAi to individually silence host factors that were previously determined play a role in the motility of R. parkeri (20). These include the host proteins profilin, capping protein, cofilin, and fimbrin/T-plastin. For R. parkeri, depletion of profilin, capping protein, and plastin caused a decrease in actin-tail length, whereas depletion of cofilin did not impact tail length (Fig. 3.3B). For R. bellii, the effects were similar, except that depletion of cofilin caused an increase in actin tail length. We additionally measured the percentage of bacteria associated with actin tails for each siRNA treatment (Fig. 3.3C), but repeated only a single replicate of this experiment, so statistical analysis has not been completed. The data here show that R. bellii utilizes similar host factors as R. parkeri, with a notable difference in the role of cofilin in regulating actin tail length.

Sca2 has a polar localization more often in R. bellii than in R. parkeri

Polar localization of actin assembly factors is critical for efficient motility in many bacterial species (21-24). To determine if there are differences in expression frequency or localization patterns of Sca2 between Rickettsia species (Fig. 3.4A), we measured both the percentage of bacteria with surface-expressed Sca2 and the percentage with polar localization of Sca2 by immunofluorescence microscopy. R. bellii more often shows unambiguously polar localization on the bacteria compared to R. parkeri (Fig. 3.4B).

The R. bellii Sca2 passenger domain nucleates actin when dimerized

We next wanted to determine R. bellii Sca2 protein (hereafter referred to as RbSca2) is sufficient to promote actin assembly. To this end, we expressed the passenger domain of RbSca2 in E. coli, purified the protein, and assessed its ability to promote actin assembly using pyrene-actin assembly assays. When Sca2 was added at approximately 50% the molar ratio of actin, we saw moderate increases in the total amount of actin polymer but no significant acceleration of actin nucleation at the early time points (Fig. 3.5A). When RbSca2 was added at concentrations close to the molar ratio of actin, it inhibited polymerization, suggesting that it binds and sequesters actin monomers (Fig. 3.5A).

Figure 3.3 – A similar set of host cytoskeleton proteins is important for R. bellii and R. parkeri motility.

(A) Confocal micrographs of actin tails in untreated A549 cells infected with R. parkeri or R. bellii (green), fixed at 48 hpi, and stained for actin with Alexa-568 phalloidin (red). Scale bar = 5um. (B) Measurements

43 of actin tail lengths for both bacterial species following transfection with a nonspecific siRNA (NS) or siRNAs that target the genes encoding the indicated proteins. At least 40 bacteria were counted for each species per siRNA treatment. *** = p < 0.001 compared with NS, **** = p < 0.0001 compared with NS, using a 1-way ANOVA analysis. (C) Percentage of bacteria associated with actin tails for both bacterial species with each siRNA treatment, with counts of over 200 bacteria for each species per siRNA treatment.

Figure 3.4 – Sca2 has a polar localization more often in R. bellii than in R. parkeri.

(A) Confocal micrographs showing representative examples of different Sca2 localization patterns in A549 cells were infected with R. bellii or GFP-R. parkeri. Cells were fixed and stained at 48 hpi, with Sca2 visualized using rabbit anti-Sca2 antibodies (red) for each bacterial species. Scale bar = 1um. (B) Percentages of R. bellii (n=2301) and R. parkeri (n=1121) with a polar Sca2 distribution pattern. Measurements are from a single replicate so no statistical analysis was performed.

Figure 3.5 – The R. bellii Sca2 passenger domain nucleates actin when dimerized.

(A) Graphs of pyrene-actin assembly reactions (5% pyrene-actin) with the indicated concentration of RbSca2 (monomeric) and GST-RbSca2 (an induced dimer). Plots represent an average of at least 2 reactions, which were followed for 2400 s. (B) Pyrene-actin assembly reactions with RbSca2 and GST- RbSca2 in the presence of 2 µM profilin.

For other actin assembly factors, inducing dimerization or oligomerization enhances actin assembly activity (25-27). First, to confirm that RbSca2 is indeed monomeric, we carried out small angle X-ray scattering analysis, which confirmed that the passenger was a dimer with an elongated structure (data not shown). Next, to test whether dimerization enhances the activity of RbSca2, we purified the RbSca2 passenger domain tagged at its N-terminus with GST (GST- RbSca2), which induced dimerization (27, 28). When the actin assembly activity of GST-RbSca2 activity was assessed using the pyrene-actin assembly assay, we saw that it significantly accelerated actin polymerization, even when GST-RbSca2 was added at low nanomolar concentrations, (Fig. 3.5B). Thus, RbSca2 passenger domain nucleates actin effectively when artificially dimerized through a GST tag.

Because profilin is required for actin nucleation by purified R. parkeri Sca2 (hereafter referred to as RpSca2) (17), we also tested whether addition of either profilin-1 or profilin-2 isoforms enhanced actin assembly by either monomeric RbSca2 or GST-dimerized GST-RbSca2. However, in both cases, there was no enhancement of actin assembly rates in the presence compared with the absence of profilin (Fig. 3.5C and data not shown). Therefore, it appears that profilin does not accelerate or enhance actin assembly activity by RbSca2.

R. bellii Sca2 binds tightly to one actin monomer via a single WH2 motif

The sequence of RbSca2 contains three predicted WH2 motifs that are candidate binding sites of G-actin (Fig. 3.1B). Whether proposed WH2 motifs will actually interact with actin can be difficult to predict as these motifs are variable in sequence and length. To better understand the mechanism of actin nucleation by RbSca2, we sought to identify the number of G-actin binding sites and their location(s) in the protein. To determine the number of G-actin molecules bound by a single RpSca2 molecule, we subjected a mixture of monomeric RbSca2 and a 5-fold molar excess of G-actin to gel filtration chromatography – Latrunculin A was also added at a concentration equimolar to that of actin to the mix to prevent actin assembly. The mixture eluted in 2 peaks, for which the protein composition was resolved by SDS-PAGE (Fig. 3.6A). The larger molecular mass peak separated into two bands, corresponding to RbSca2 and actin. Measurements of relative intensity of these two bands suggest a RbSca2:actin stoichiometry of approximately 1:1. The later peak contained only actin. This data suggests that one molecule of RbSca2 binds tightly to a single actin monomer.

To confirm the stoichiometry of binding between RbSca2 and G-actin as well as measure the affinity of binding, we carried out isothermal titration calorimetry (ITC) while injecting RbSca2 into a solution containing G-actin. The ITC results confirmed a 1:1 binding ratio of RbSca2:actin. The averaged results from two trials also revealed an average Kd of ~352.5nM (SD = 91.22nM), which is in line with previously measured affinities of WH2 motifs and G-actin (Fig. 3.6B) (29).

Next, to map the G-actin binding site in RbSca2, we generated point mutations in the first predicted WH2 motif (WH2-1) that are predicted to interfere with actin binding (RbSca2- L88A/K89A) (Fig. 3.1C). When ITC was performed on the RbSca2-L88A/K89A point mutant, we saw loss of binding to G-actin and no measurable Kd (Fig. 3.6C). This confirms that the RbSca2

Figure 3.6 – R. bellii Sca2 binds tightly to one actin monomer via a single WH2 motif.

(A) RbSca2 was mixed with a 5-fold molar excess of G-actin and latrunculin A (equimolar to actin) and separated using a Superdex 200 size exclusion column. The chromatogram of absorbance 280 nm shows two peaks. Fractions corresponding to each peak were separated by SDS-PAGE and visualized by Coomassie staining. Isothermal titration calorimetry thermograms of (B) RbSca2 or (C) RbSca2- L88A/K89A mutant proteins titrated into G-actin. Thermograms shown are representative plots from duplicate experiments. (D) Graphs of pyrene-actin assembly reactions with the indicated concentrations of the GST-RbSca2-L88A/K89A point mutant.

Figure 3.7 – Addition of chemical crosslinkers to R. bellii shifts RbSca2 bands into a larger MW smear.

R. bellii freshly isolated from A549 cells were treated with either DMSO or increasing concentrations of disuccinimidyl suberate (DSS) at 40uM, 200uM and 1mM. Cells were boiled in SDS-PAGE sample buffer, subjected to SDS-PAGE, and then Sca2 was revealed by Western blotting for RbSca2 from lysates of R. bellii infected A549 cells yields multiple bands, corresponding to full length (~100kDa) and proteolyzed products of Sca2 (~72kDa and ~40kDa bands). Addition of increasing concentrations of DSS leads to loss of discreet RbSca2 bands and the appearance of a larger molecular weight smear.

49 passenger binds to a single actin monomer with high affinity, and that high affinity actin binding is dependent on a single WH2-motif. We generated a similar mutation GST-RbSca2, and tested this GST-RbSca2- L88A/K89A mutant for actin assembly activity. At low concentrations, there was a loss of the actin assembly enhancement (Fig. 3.6D). Interestingly, the sequestering effect was still seen at very high concentrations (equimolar to or exceeding the concentration of actin), though slightly higher concentrations of the mutant RbSca2 were required compared to WT to achieve similar levels of polymerization inhibition (Figs. 3.5B, 3.6B). This point mutant may have reduced binding capability at its WH2 motif site, or assuming total loss of binding by the point mutant, this suggests the existence of additional low affinity actin-binding sites.

Sca2 may oligomerize or interact with other proteins on the R. bellii cell surface

Our observation that RbSca2 is more active in actin assembly when dimerized through an N- terminal GST tag suggests RbSca2 activity in bacteria may depend on oligomerization or clustering of RbSca2 on the bacterial surface. To determine if RbSca2 forms oligomers or complexes with other proteins on the bacterial surface, similar to the ActA protein from L. monocytogenes (28). We added the chemical crosslinker disuccinimidyl suberate (DSS) and assayed by Western blot for bands that might correspond to an appropriate molecular weight for dimers or higher order oligomers of RbSca2. The addition of DSS led to loss of the discrete bands and the appearance of protein smears of higher molecular weight (Fig. 3.7). The appearance of larger molecular weight complexes upon the addition of crosslinkers show that Sca2 is in close proximity with either itself or other potential interacting proteins, but additional experiments will be needed to confirm if it truly oligomerizes with itself on the bacterial surface in its native state.

Discussion

Despite over two decades of research, our knowledge of the diversity of actin-based motility mechanisms in different intracellular pathogens continues to expand. Through convergent evolution, this successful strategy for intracellular motility has evolved numerous times in unrelated bacterial species, and each species employs a unique mechanism of intercepting host actin pathways (30, 31). Even within a single genus, related species can employ distinct mechanisms of actin assembly, as seen with various Burkholderia species (32). Our studies here provide our first detailed understanding of actin-based motility characteristics in the non- pathogenic AG Rickettsia species R. bellii, and how these compare with those of the related pathogenic SFG species R. parkeri.

There are clear differences in motility parameters between species

We measured a number of motility parameters and found several key differences in motility of R. bellii compared with R. parkeri. R. bellii exhibited slower motility rates. However, they were more frequently associated with actin tails, indicating they may be more efficient at initiating or less efficient at terminating motility. The distribution of motility trajectories was also different, with a greater proportion of R. bellii moved in more curved or meandering paths. At an

50 ultrastructural level, preliminary results indicate that that R. bellii actin tails are thinner and lack the helical bundles than tails produced by R. parkeri (data not show). These differences in motility parameters suggest that that there are key differences in the underlying molecular mechanisms of R. bellii and R. parkeri motility.

Species difference may be due in part to differences in the utilization of key host actin cytoskeleton factors

We sought to distinguish whether motility differences might result from the use of a different core set up host actin cytoskeleton proteins. Previous studies showed that silencing critical host factors – which include profilin, capping protein, cofilin, and fimbrin – caused alterations in the length of R. parkeri actin tails as well as the frequency of actin-tail formation (20). We reproduced these results for R. parkeri, and furthermore demonstrated that silencing these factors had similar impacts on R. bellii actin tail length and frequency. However, there were interesting differences, including that silencing cofilin caused an increase in the length of actin tails made by R. bellii, but not R. parkeri. This suggests that R. bellii-assembled actin tails may be more sensitive to disassembly by cofilin compared with R. parkeri tails.

Interestingly, we also observed differences between R. bellii and R. parkeri actin tail formation upon infection of other cell types. Whereas both R. bellii and R. parkeri form robust actin tails in A549 cells, only R. parkeri forms actin tails in Drosophila S2R+ cells and R. bellii very rarely forms tails in this cell type. We speculate that either the host environment may affect the expression or activation of different Rickettsial proteins, or that R. bellii requires an as yet undetermined set of host proteins that are lacking or otherwise altered insect cells. In the future it will be interesting to compare actin-based motility parameters in tick cells, which are the natural host for Rickettsia. This is discussed further in Chapter 4.

Species differences in motility and actin-tail organization may be caused by differences in Sca2 localization

The Rickettsial late actin-based motility factor Sca2 is a member of the autotransporter protein family. Sca2, like many other autotransporter proteins (21), exhibits a polar localization on the bacterial surface in both R. bellii and R. parkeri. However, percentage of bacteria exhibiting polar Sca2 was higher for R. bellii than R. parkeri. RbSca2 also shows a more punctate polar localization pattern, and typically covers a smaller area of the bacterial pole, whereas RpSca2 is more often seen extending up the lateral sides of the bacterial cell. The more polarized distribution of RbSca2 may result in the formation of a narrower tail, perhaps consisting of fewer filaments, or filament bundled in a different manner. This may result in the bacteria being more susceptible external influence on their motility path, leading to the higher frequency of curved or meandering movement trajectories. Higher resolution visualization of the actin organization in R. bellii tails by methods such as electron microscopy may provide additional insight on the overall filament architecture, as well as the area of the interface between the actin tail and bacterial pole.

R. bellii Sca2 nucleates actin from by different mechanism than R. parkeri Sca2

The actin nucleation mechanism of RbSca2 is remarkably different from that of RpSca2. It exhibits none of the formin-like functions of RpSca2, and does not contain the formin-like N-terminal domain found in Sca2 in SFG species. Instead, as with RtSca2 (see Chapter 2), we propose that RbSca2 likely mimics the eukaryotic tandem-WH2 family of nucleators. Tandem-WH2 nucleators are most often characterized by the presence of two or more WH2 domains, although they vary considerably in the number and spacing of WH2 motifs, which in turn determines the precise manner of actin filament assembly (33-35). These proteins typically initiate nucleation of a new actin filament, then dissociate, leaving the new filament free to elongate (36).

RbSca2 has several characteristics in common with tandem-WH2 nucleators. It enhances actin assembly but does not affect actin elongation and does not appear to bind filament ends. However, it is also distinct from most tandem-WH2 nucleators in that only its first predicted WH2 sequence is competent to bind to G-actin with high affinity, although we hypothesize that other sequences within RbSca2 may bind actin with lower affinity. Moreover, the passenger domain itself behaves as a monomer in solution and is only minimally active in enhancing actin polymerization. However, a dimeric version of RbSca2 tagged at its N-terminus with GST is much more active in actin assembly. Based on this, we hypothesized that on the bacterial surface, RbSca2 may form oligomers or otherwise self-associate, as is seen with other autotransporter proteins including S. flexneri motility factor IcsA (37). Such complexes might form directly, or indirectly through interactions with other bacterial surface proteins or even with host factors. Alternatively, the density of RbSca2 at the bacterial pole may be sufficient to provide the close packing necessary for oligomer-like function, similar to L. monocytogenes ActA (28). Indeed, oligomerization is common across diverse actin assembly factors, including tandem WH2 nucleators (25, 38), the formin FH2 homodimer (34, 39) and the enhanced activation of the Arp2/3 complex by dimerized NPFs (26, 40, 41). Future studies determining the RbSca2 oligomerization state will further our understanding of its actin assembly mechanism in the biological context of the bacterial pole.

In addition to the WH2 domain, the proline-rich repeat region of RbSca2 may also participate in actin assembly. These sequences in other actin modulating proteins bind to profilin and Ena/VASP (42-44), so we suspect that it may influence actin-based motility of R. bellii in infected cells. Proline-rich domains have also been shown to interact directly with G-actin (45). This might also explain the actin-sequestering activity seen with the WH2-1 point mutant. Additional experiments directly investigating this potential interaction may enlighten us to further functions of polyproline repeat motifs in regulating actin dynamics.

Based on this, we propose a model for actin nucleation by RbSca2 that contrasts with the formin- mimicking actin assembly mechanism of Sca2 from SFG species. We propose that RbSca2 binds actin with high affinity using a single WH2 motif, and perhaps also with one or more low affinity sites. Further, RbSca2 may be oligomerized or tightly packed on the bacterial pole. To mediate actin nucleation similar to tandem WH2 nucleators (Fig. 3.8). The N-terminal polyproline sequence may play a role in G-actin binding or recruitment, or may be involved with interactions with other bacterial or host proteins.

Figure 3.8 – Proposed model of actin assembly by Sca2 orthologs.

In contrast to the formin mimicking mechanism of SFG Sca2, we propose that RbSca2 may associate or oligomerize on the bacterial surface, allowing the single WH2 motifs on each protein to come within sufficient distance to mimic a tandem WH2 nucleating mechanism to polymerize new actin filaments. The polyproline sequences may facilitate by binding either profilin-actin or G-actin directly to assemble actin filaments.

It is unclear why Sca2 exhibits such differences between species. We speculate that differences in Sca2 sequence may result from selection for motility properties exclusively in an arthropod host for R. bellii, versus both mammalian hosts and arthropod vector for R. parkeri. Moreover, apart from its role in actin-based motility, Sca2 may participate in other roles during infection. For example, Sca2 from the SFG species R. conorii also functions in host cell adherence and invasion (15, 46). Thus, there may be multiple selective pressures that influence Sca2 sequence and function during evolution.

Summary

Actin-based motility is accomplished in creative and diverse ways by many different bacterial pathogens. Our understanding of the diversity of actin assembly mechanisms of motility factor orthologs in closely related bacterial species provides us with the opportunity to gain an evolutionary perspective on the rise of this phenomenon and the diverse pathways intercepted or mimicked by the bacteria. By comparing the differences in actin assembly strategies by pathogenic and non-pathogenic Rickettsia, we may also be able to understand how this strategy for intracellular survival gained importance as a virulence factor.

Materials & Methods

Molecular Biology

Passenger domains and all mutant constructs of RbSca2 were cloned into the expression vector pGEX6P-3 using the restriction sites BamHI and XhoI. DNA was amplified by PCR from R. bellii strain RML-369-C. The gene encoding the wild-type passenger domain was amplified using the forward primer 5’-GCTGGATCCGCACCACCTCCAC-3’ and reverse primer 5’- GAGGGTCTGCGGCCGCTTCATCACCACCAGTAATCGC-3’, which excludes the N-terminal secretion signal sequence and the C-terminal autotransporter domain. Point mutations in the sequence encoding WH2 domain 1 (L88A/K89A) were made using a standard Phusion site-directed mutagenesis protocol using phosphorylated non-overlapping primers (ThermoFisher Scientific), the sequences of the forward primer is 5’- /Phos/GCAAAAAATAGGAAAAATATAAAAAATAAAAAAGATAATTCTGATTTAGAAGCC-3’ and the reverse primer is 5’-/Phos/TGCTGTATCATAAGGATTAAATGTTGGACCTAATTCAGC-3’. The expression vectors encoded an N-terminal GST tag and short linker, which could be cleaved off using Prescission protease (GE Healthcare).

Protein Purification

All proteins were expressed in either E. coli BL21-CodonPlus(DE3)-RIL (or -RIPL for constructs with intact proline-rich sequences) (Agilent Technologies). Cultures were grown in 2xYT and protein expression was induced with 0.3-1 mM IPTG at 16°C for 16-18 h. Bacterial pellets were resuspended in 10 ml of lysis buffer per liter of culture (50 mM Tris pH 7.5, 200 mM KCl, 1 mM EDTA). Pellets were frozen slowly to -80°C for a minimum of 12 h to begin cell lysis. Pellets were frozen slowly to -80°C for a minimum of 12 hours to begin cell lysis. Pellets were thawed in room temperature water and further lysed with the addition of 1 mg/ml lysozyme (Sigma) and incubated on ice for 20 minutes with occasional inversion. Protease inhibitors (PMSF or AEBSF [EMD Millipore], leupeptin/pepstatin/chymostatin [EMD Millipore], aprotinin [MP Biomedicals]) were added, and cells were further lysed by sonication. Lysates were centrifuged at 12,000 x g for 25 min at 4°C to pellet insoluble material. Supernatants were then supplemented with an additional round of protease inhibitors and incubated over buffer-equilibrated-Glutathione Sepharose 4B (GE Healthcare) for up to 60 min at 4°C. Resin was batch washed with at least 150ml of wash buffer (lysis buffer + 0.5mM DTT). GST-tagged proteins were eluted with wash buffer supplemented with 10 mM glutathione. To remove GST tags, Prescission Protease was added to the washed resin for 16-18 h at 4°C. Cleaved protein was eluted with one resin volume of wash buffer. Protein eluates were concentrated to <500 µl, filtered, and further purified using size exclusion chromatography on either a Superdex 75 10/300 GL (GST-cleaved constructs, all truncated constructs) or a Superdex 200 10/300 GL (GST-tagged passenger and point mutants) column (GE Healthcare) into final storage buffer (20 mM Tris pH 7.5, 100 mM KCl, 1 mM EGTA, 2 mM EDTA, 0.5 mM DTT, 10% glycerol). Final protein fractions were concentrated to >40µM, aliquoted and flash frozen in liquid nitrogen before storage at -80°C.

Antibody Production

Polyclonal anti-RbSca2 antibodies were generated in rabbits. Two truncations of the RbSca2 passenger domain (aa 44-175 and aa 357-464) were expressed in E. coli and purified as described above for proteins cleaved from their N-terminal GST tag. Protein truncations were mixed in equimolar amounts in protein storage buffer (see above) and used to raise antisera in rabbits (Pocono Rabbit Farm & Laboratory, Inc.). Antibodies were purified from sera from 2 rabbits with standard antibody purification protocols, using the same Sca2 truncations conjugated to NHS- activated Sepharose 4 Fast Flow (GE Healthcare). Antibodies were eluted using 100mM glycine pH 2.5 and fractions were pooled and dialyzed against TBS overnight. Antibodies were concentrated before flash freezing and storage at -80°C, or mixed with 50% glycerol and stored at -20°C. Antibodies from rabbit #30928 (“Rabbit 2”) were used for all experiments.

Mammalian Cell and Bacterial Culture

All mammalian cell lines were received from the UC Berkeley tissue culture facility. They were grown at 37°C with 5% CO2 and 5% humidity. Vero cells were grown in DMEM (Gibco) supplemented with 5% fetal bovine serum (FBS) (BenchMark). A549 cell lines were maintained in DMEM supplemented with 10% FBS (Atlas). A549 cells stably expressing F-tractin-tagRFPT were generated as described previously (32). Drosophila melanogaster S2 and S2R+ cells were cultured at 27°C in Schneider’s Drosophila media supplemented with 10% FBS (HyClone). siRNA silencing was accomplished using siRNAs obtained from Ambion (Silencer or Silencer Select RNA). siRNAs were transfected into A549 cells using Lipofectamine RNAiMax (Life Technologies) following the manufacturer’s recommended protocols for A549 cells. siRNA treatment was allowed to proceed for 48 hours before infection with Rickettsia.

R. bellii and R. parkeri were propagated in confluent monolayers of Vero cells growing in DMEM with 2% FBS at 33°C, 5% CO2 and 5% humidity. Bacterial stocks were prepared and isolated by Renografin-density centrifugation as previously described (47). For small scale isolation of bacteria for crosslinking experiments, infected Vero cells were scraped from the surface of the flask, spun at 3000 x g for 5 minutes, and resuspended in K-36 buffer. Resuspended cells were added to a 15 ml conical tube containing 50% volume of 3mm glass beads. Cells and beads were vortexed in two 30 second pulses, resting on ice for 30 seconds after each pulse. Host cell debris was removed by centrifugation at 200 x g. GFP-expressing bacterial strains were generated (by R. Lamason) by electroporating bacteria using a Bio-Rad Gene Pulser at 2.5kV, 200 Ω, and 25uF, with the shuttle plasmid pRAMdRGA (a gift from U. Munderloh, University of Minnesota), engineered to express GFP. These strains were propagated as described above, but in the presence of 200 ng/ml rifampicin in the growth media to support maintenance of the plasmid. For imaging experiments, GFP expressing bacteria were added to mammalian cells and infection proceeded at 33°C, 5% CO2 and 5% humidity for 48 hours prior to imaging.

Imaging and Analysis

For immunofluorescence microscopy, A549 cells at a density of 1x105 cells/ml were infected with GFP-expressing R. bellii or R. parkeri at an MOI of 1. Infections proceeded at 33°C, 5% CO2 and 5% humidity for 48 h. Rickettsia-infected mammalian cells were fixed with 4% paraformaldehyde in phosphate buffered saline (PBS) for 10 minutes, rinsed with PBS and quenched with 100 mM glycine in PBS for 10 min. Cells were permeabilized with 0.5% Triton-X 100 in PBS for 5 minutes at room temperature, then blocked with 2-4% BSA for 1 hour. Actin was stained using either Alexa-568 phalloidin (Life Technologies) or CytoPainter Phalloidin-iFluor 405 (AbCam) diluted at 1:400 or 1:100, respectively (approximately 16 nM). To visualize R. bellii Sca2, permeabilized cells were first treated with ImageIt FX Signal Enhancer (Molecular Probes) for 30 minutes, then blocked with 2% BSA + 10% normal goat serum for 1 hour. Sca2 antibody was added at approximately 2 µg/ml in blocking solution and incubated for 1 hour at room temperature. Goat- anti-rabbit rhodamine secondary (1:400 dilution) and CytoPainter Phalloidin-iFluor 405 (1:100 dilution) were diluted into blocking solution composed of only 10% normal goat serum in PBS and incubated for 1 hour. Coverslips were washed in PBS and mounted onto slides using ProLong Diamond Anti-Fade reagent (Molecular Probes). Coverslips were cured for at least 24 hours before sealing with nail polish and imaging. Images were acquired on a Nikon Ti Eclipse microscope equipped with a Yokogawa CSU-XI spinning confocal disc with either a 100x (1.4 NA) Plan Apo or a 100x (1.4 NA) Plan Apo VC objective and a Clara Interline CCD camera. Images were collected as z-stacks using Metamorph software and later compiled as maximum intensity projections using ImageJ.

For live cell imaging, A549 cells stably expressing LifeAct-mCherry were seeded onto glass bottom dishes (MatTek Corporation) at 1x105 cells/ml. After 24 hours, they were infected with GFP- expressing R. parkeri or R. bellii at an MOI of 1 and imaged at 48 hpi. Imaging media was FluoroBrite DMEM (Gibco) supplemented with GlutaMax (Gibco), and cells were maintained at 33°C and 5% CO2. Images were acquired on a Nikon Ti Eclipse microscope equipped with a Yokogawa CSU-XI spinning confocal disc with a 60x (1.4 NA) Plan Apo objective and a Clara Interline CCD camera. Images were collected using MetaMorph software and analyzed using ImageJ and the Manual Tracking plugin. Movies were collected by imaging every 10 seconds over a course of 5 minutes. Motility rates were measured by following a single bacterium over the course of 1 minutes, tracked using ImageJ.

Pyrene-Actin Assembly Assays

Pyrene-actin assembly assays used 99% pure rabbit muscle G-actin supplemented with 5-10% pyrene-actin (both Cytoskeleton, Inc.). Lyophylized proteins were resuspended and dialyzed in G-buffer (5 mM Tris pH 7.5, 0.2 mM CaCl2, 0.2 mM ATP, 0.5 mM DTT) for at least 48 h. Polymerization reactions were initiated by adding 10% volume of 10x initiation buffer (10 mM MgCl2, 10 mM EGTA, 5 mM ATP, 500 mM KCl) and 23.3% volume of Sca2, or protein storage buffer as a control (see protein purification details). Final reaction conditions were 1 µM actin and pyrene-actin, and 2-3 µM human platelet profilin (48) if applicable. Reactions with Arp2/3 complex contained a final concentration of 40 nM recombinant Arp2/3 complex purified from insect cells.

Fluorescence measurements began within 30 s of mixing the reaction in black bottom 96- or 384- well plates (Corning) on a Tecan InfinitePro2000 platereader, using a 365 nm excitation filter (10 nm bandpass), a 405 nm emission filter (20 nm bandpass) and Magellan software. Kinetic reactions were measured every 20 seconds for 60 minutes. Curves were averaged and normalized (minimum = first value in the individual data set, maximum = largest value of the entire data set) with 2-3 replicates measured for each reaction condition. Analysis was completed and plots were generated using Prism v6.07 (GraphPad Software, Inc.).

Protein Molecular Mass Determination and Binding Interaction Characterization

Protein molecular mass estimates were determined by size exclusion chromatography using either Superdex 200 10/300 GL or Superdex 75 10/300 GL columns (GE Healthcare). Columns were calibrated the week of measurements using standard calibration kits. Isothermal titration calorimetry (ITC) was completed using an ITC-200 Auto (GE Healthcare). Proteins were dialyzed into G-buffer (substituting TCEP for DTT). RbSca2 was loaded into the syringe at 60-100 µM, and injected into the cuvette containing G-actin at a concentration 10% that of RbSca2, starting with a 0.5 µl injection followed by 12 x 3.1 µl injections at 25°C. Experiments were performed in duplicate with different concentrations of protein for each replicate but always maintaining a 1:10 molar ratio of G-actin to RbSca2. Data were analyzed via modified Origin software (GE Healthcare), fitting to a one-site binding model following baseline correction. A control reaction of RbSca2 injected into buffer was used to account for background signal due to dilution, which was minimal.

Small Angle X-ray Scattering (SAXS) was completed through the SIBYLS Beamline at the Advanced Light Source at LBNL with the assistance of Greg Hura. RbSca2 was dialyzed into protein storage buffer with a reduced amount of glycerol (2% instead of 10%). Data collection was completed using two separate preparations of protein prepared at concentrations ranging from 1-10mg/ml. All samples were measured with exposure times of 0.5, 1, and 6 seconds, with corresponding buffer blank measurements subtracted from these values. Data were analyzed using SCATTER software (LBNL). Measurements from both protein preparation samples gave estimated protein molecular weights of 75-90 kDa, with indications of small amounts of protein aggregation at the higher protein concentrations.

References

1. Merhej V, Raoult D. 2010. Rickettsial evolution in the light of comparative genomics. Biological Reviews 86:379. 2. Sears KT, Ceraul SM, Gillespie JJ, Allen ED, Popov VL, Ammerman NC, Rahman MS, Azad AF. 2012. Surface Proteome Analysis and Characterization of Surface Cell Antigen (Sca) or Autotransporter Family of Rickettsia typhi. PLoS Pathogens 8:e1002856. 3. Ogata H, La Scola B, Audic S, Renesto P, Blanc G, Robert C, Fournier P-E, Claverie J-M, Raoult D. 2006. Genome Sequence of Rickettsia bellii Illuminates the Role of Amoebae in Gene Exchanges between Intracellular Pathogens. PLoS Genetics 2:e76. 4. La Scola B, Bechah Y, Lepidi H, Raoult D. 2009. Prediction of rickettsial skin eschars in humans using an experimental guinea pig model. Microb Pathog 47:128–33. 5. Pinter A, Labruna MB. 2006. Isolation of Rickettsia rickettsii and Rickettsia bellii in cell culture from the tick Amblyomma aureolatum in Brazil. Annals of the New York Academy of Sciences 1078:523–529. 6. Blanc G, Ogata H, Robert C, Audic S, Suhre K, Vestris G, Claverie J-M, Raoult D. 2007. Reductive genome evolution from the mother of Rickettsia. PLoS Genetics 3:e14. 7. Stothard DR, Clark JB, Fuerst PA. 1994. Ancestral divergence of Rickettsia bellii from the spotted fever and typhus groups of Rickettsia and antiquity of the genus Rickettsia. Int J Syst Bacteriol 44:798–804. 8. Heu CC, Kurtti TJ, Nelson CM, Munderloh UG. 2015. Transcriptional Analysis of the Conjugal Transfer Genes of Rickettsia bellii RML 369-C. PLoS ONE 10:e0137214. 9. Heinzen RA. 2003. Rickettsial actin-based motility: behavior and involvement of cytoskeletal regulators. Annals of the New York Academy of Sciences 990:535–47. 10. Heinzen RA, Hayes SF, Peacock MG, Hackstadt T. 1993. Directional actin polymerization associated with spotted fever group Rickettsia infection of Vero cells. Infection and Immunity 61:1926–1935. 11. Oliver JD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG. 2013. Motility Characteristics Are Altered for Rickettsia bellii Transformed To Overexpress a Heterologous rickA Gene. Applied and Environmental Microbiology 80:1170. 12. Gouin E, Egile C, Dehoux P, Villiers V, Adams J, Gertler F, Li R, Cossart P. 2004. The RickA protein of Rickettsia conorii activates the Arp2/3 complex. Nature 427:457–61. 13. Jeng RL, Goley ED, D'Alessio JA, Chaga OY, Svitkina TM, Borisy GG, Heinzen RA, Welch MD. 2004. A Rickettsia WASP-like protein activates the Arp2/3 complex and mediates actin-based motility. Cellular Microbiology 6:761–9. 14. Lamason RL, Risca VI, Abernathy E, Welch MD. 2014. Rickettsia Actin-Based Motility Occurs in Distinct Phases Mediated by Different Actin Nucleators. Current Biology 24:98.

15. Cardwell MM, Martinez JJ. 2012. Identification and characterization of the mammalian association and actin-nucleating domains in the Rickettsia conorii autotransporter protein, Sca2. Cellular Microbiology 14:1485. 16. Kleba B, Clark TR, Lutter EI, Ellison DW, Hackstadt T. 2010. Disruption of the Rickettsia rickettsii Sca2 Autotransporter Inhibits Actin-Based Motility. Infection and Immunity 78:2240. 17. Haglund CM, Choe JE, Skau CT, Kovar DR, Welch MD. 2010. Rickettsia Sca2 is a bacterial formin-like mediator of actin-based motility. Nature Cell Biology 12:1057. 18. Balraj P, Karkouri El K, Vestris G, Espinosa L, Raoult D, Renesto P. 2008. RickA expression is not sufficient to promote actin-based motility of Rickettsia raoultii. PLoS ONE 3:e2582. 19. Grijpstra J, Arenas J, Rutten L, Tommassen J. 2013. Autotransporter secretion: varying on a theme. Research in Microbiology 164:562. 20. Serio AW, Jeng RL, Haglund CM, Reed SC, Welch MD. 2010. Defining a Core Set of Actin Cytoskeletal Proteins Critical for Actin-Based Motility of Rickettsia. Cell Host & Microbe 7:388. 21. Doyle MT, Grabowicz M, Morona R. 2015. A small conserved motif supports polarity augmentation of Shigella flexneri IcsA. Microbiology (Reading, Engl) 161:2087–2097. 22. Smith GA, Portnoy DA, Theriot JA. 1995. Asymmetric distribution of the Listeria monocytogenes ActA protein is required and sufficient to direct actin-based motility. Molecular Microbiology 17:945–951. 23. Doyle MT, Grabowicz M, Morona R. 2015. A small conserved motif supports polarity augmentation of Shigella flexneri IcsA. Microbiology (Reading, Engl) 161:2087–2097. 24. Rafelski SM, Theriot JA. 2006. Mechanism of polarization of Listeria monocytogenes surface protein ActA. Molecular Microbiology 59:1262–79. 25. Quinlan ME, Hilgert S, Bedrossian A, Mullins RD, Kerkhoff E. 2007. Regulatory interactions between two actin nucleators, Spire and Cappuccino. The Journal of Cell Biology 179:117. 26. Padrick SB, Doolittle LK, Brautigam CA, King DS, Rosen MK. 2011. Arp2/3 complex is bound and activated by two WASP proteins. Proceedings of the National Academy of Sciences 108:E472–9. 27. Gould CJ, Maiti S, Michelot A, Graziano BR, Goode BL, Blanchoin L, Goode BL. 2011. Report The Formin DAD Domain Plays Dual Roles in Autoinhibition and Actin Nucleation. Current Biology 21:384. 28. Footer MJ, Lyo JK, Theriot JA. 2008. Close Packing of Listeria monocytogenes ActA, a Natively Unfolded Protein, Enhances F-actin Assembly without Dimerization. Journal of Biological Chemistry 283:23852. 29. Bosch M, Le KHD, Bugyi B, Correia JJ, Renault L, Carlier M-F. 2007. Analysis of the Function of Spire in Actin Assembly and Its Synergy with Formin and Profilin. Molecular Cell 28:555.

30. Goldberg MB. 2001. Actin-based motility of intracellular microbial pathogens. Microbiol Mol Biol Rev 65. 31. Goldberg MB. 2001. Actin-based motility of intracellular microbial pathogens. Microbiol Mol Biol Rev 65. 32. Benanti EL, Nguyen CM, Welch MD. 2015. Virulent Burkholderia Species Mimic Host Actin Polymerases to Drive Actin-Based Motility. Cell 161:348. 33. Carlier M-F, Husson C, Renault L, Didry D. 2011. Control of Actin Assembly by the WH2 Domains and Their Multifunctional Tandem Repeats in Spire and Cordon-—Bleu. International Review of Cell and Molecular Biology 55. 34. Dominguez R. 2009. Actin filament nucleation and elongation factors – structure–function relationships. Critical Reviews in Biochemistry and Molecular Biology 44:351. 35. Campellone KG, Welch MD. 2010. A nucleator arms race: cellular control of actin assembly. Nature Reviews Microbiology 11:237. 36. Chen X, Ni F, Tian X, Kondrashkina E, Wang Q, Ma J. 2013. Structural Basis of Actin Filament Nucleation by Tandem W Domains. Cell Reports 3:1910. 37. May KL, Grabowicz M, Polyak SW, Morona R. 2012. Self-association of the Shigella flexneri IcsA autotransporter protein. Microbiology 158:1874. 38. Namgoong S, Boczkowska M, Glista MJ, Winkelman JD, Rebowski G, Kovar DR, Dominguez R. 2011. Mechanism of actin filament nucleation by Vibrio VopL and implications for tandem W domain nucleation. Nature Structural & Molecular Biology 18:1060–7. 39. Chesarone MA, DuPage AG, Goode BL. 2009. Unleashing formins to remodel the actin and microtubule cytoskeletons. Nature Reviews Molecular Cell Biology 11:62. 40. Vasilescu D. 2008. The pathogen protein EspFU hijacks actin polymerization using mimicry and multivalency. Nature 454:1005. 41. Padrick SB, Cheng H-C, Ismail AM, Panchal SC, Doolittle LK, Kim S, Skehan BM, Umetani J, Brautigam CA, Leong JM, Rosen MK. 2008. Hierarchical regulation of WASP/WAVE proteins. Molecular Cell 32:426–38. 42. Prehoda KE, Lee DJ, Lim WA. 1999. Structure of the enabled/VASP homology 1 domain- peptide complex: a key component in the spatial control of actin assembly. Cell 97:471–480. 43. Paul AS, Pollard TD. 2009. Review of the Mechanism of Processive Actin Filament Elongation by Formins. Cell Motility and the Cytoskeleton 66:606. 44. Auerbuch V, Loureiro JJ, Gertler FB, Theriot JA, Portnoy DA. 2003. Ena/VASP proteins contribute to Listeria monocytogenes pathogenesis by controlling temporal and spatial persistence of bacterial actin-based motility. Molecular Microbiology 49:1361.

45. Urbanek AN, Smith AP, Allwood EG, Booth WI, Ayscough KR. 2013. Article A Novel Actin- Binding Motif in Las17/WASP Nucleates Actin Filaments Independently of Arp2/3. Current Biology 23:196. 46. Cardwell MM, Martinez JJ. 2009. The Sca2 Autotransporter Protein from Rickettsia conorii Is Sufficient To Mediate Adherence to and Invasion of Cultured Mammalian Cells. Infection and Immunity 77:5272. 47. Hackstadt T, Messer R, Cieplak W, Peacock MG. 1992. Evidence for proteolytic cleavage of the 120-kilodalton outer membrane protein of rickettsiae: identification of an avirulent mutant deficient in processing. Infection and Immunity 60:159–65. 48. Haarer BK, Lillie SH, Adams AE, Magdolen V, Bandlow W, Brown SS. 1990. Purification of profilin from Saccharomyces cerevisiae and analysis of profilin-deficient cells. The Journal of Cell Biology 110:105–114.

Chapter 4

Future Directions & Remaining Questions

Introduction

The work presented in this thesis highlights the diversity of actin assembly mechanisms employed by different Rickettsia species to drive actin-based motility. In Chapters 2-3, I outline how orthologs of the late motility factor Sca2 are highly variable in their domain organization and predicted actin-interacting motifs. I demonstrate that Sca2 from the SFG species R. parkeri mimics eukaryotic formins, whereas Sca2 from the AG species R. bellii may mimic tandem WH2 nucleators. However, many questions remain unanswered. For example, what is the mechanism of action of TG Sca2? Moreover, what is the relationship between actin assembly mechanisms of Sca2 orthologs and parameters of motility in the host cell environment? Additionally, because Rickettsia are difficulty to manipulate genetically, can emerging genetic tools be employed to mutate genes involved in actin assembly to better define the role of actin- based motility in infection? Here in Chapter 4, I will explore potential future directions aimed at answering these questions.

What is the mechanism of actin polymerization by divergent Sca2 orthologs?

Sca2 Ortholog Mechanisms

We showed that Sca2 orthologs from the TG species R. typhi and the AG species R. bellii are both divergent from Sca2 of SFG species, most notably in that they lack the N-terminal domain with formin-like activity. For both TG and AG Sca2, actin nucleating activity is more pronounced when the proteins are artificially dimerized using a GST-tag. This suggests that Sca2 may require oligomerization or close-packing on the bacterial surface for optimal activity, a behavior that has been seen before for other actin polymerizing proteins from unrelated bacteria that undergo actin-based motility (1, 2). However, the mechanism of Sca2 oligomerization or packing remains unclear and is an important next question to answer. Potentially useful methods for revealing oligomerization or close packing including chemical crosslinking. However, in preliminary studies, Sca2 from both R. parkeri and R. bellii are present in multiple bands on a Western blot, indicating cleavage or processing of the passenger domains. This obscures the ability to see clear oligomerization in crosslinking experiments. Differential tagging of Sca2, as was done with Shigella IcsA (2) is not possible due to our current inability ectopically express Sca2 variants in Rickettsia. We are currently working on a protocol using a combination of chemical crosslinking, immunoprecipitation, and mass spectrometry to identify oligomerization or close packing of Sca2 in Rickettsia.

The mechanism of actin nucleation by Sca2 from the TG species R. typhi also remains unclear. This is of particular interest as R. typhi actin tails are short and curved, which is characteristic of actin tails produced by factors that activate the Arp2/3 complex (3). However, R. typhi lacks the gene encoding the Arp2/3 activator RickA, suggesting that its motility is mediated solely by Sca2 (4). R. typhi are also very infrequently associated with actin tails (5), suggesting that Sca2 from R. typhi may employ an inefficient actin assembly mechanism, or that other aspects of the host environment may suppress actin tail formation for R. typhi. Sca2 from R. typhi was difficult to purify, and the only truncated protein we were able to express and purify in any appreciable

64 amount lacks the C-terminal repeats that comprise approximately 1/3 of the total passenger domain. Further experiments to test if its nucleation mechanism mimics tandem-WH2 nucleators will require optimization of R. typhi Sca2 expression and purification. This will allow us to identify the stoichiometry of binding to actin and profilin, and if it forms oligomers as mentioned above.

Host Factor Requirements

Sca2 orthologs may also differ in their interactions with host actin-modulating proteins in the cytoplasm of host cells. Though moderately different in sequence and length, each Sca2 ortholog contains one or more proline-rich repeats, which differ with regard to their relative location(s) in the passenger domain, as well as in their functional roles in actin assembly. The presence of proline-rich sequences in Sca2 orthologs is interesting, because in other actin nucleating proteins these are sites of interaction with the host proteins profilin and Ena/VASP (6, 7). Proline residues are encoded by codons rich in G and C, which are less frequently found in the genomes of Rickettsia species because their genomes are AT rich (30% GC content) (8, 9). This suggests that there is some selective pressure to maintain these proline-rich sequences and that they may play important functional roles for Sca2-mediated actin assembly.

In actin assembly reactions in vitro, profilin has differing effects on actin nucleating activity of Sca2 orthologs. Profilin has no discernible effect on actin assembly by Sca2 from R. bellii, but enhances actin nucleation by Sca2 from R. typhi. Profilin is also necessary for actin assembly by Sca2 from the SFG species R. parkeri (10, 11). The inability of profilin to enhance actin assembly by R. bellii Sca2 suggests that the proline-rich sequence of Sca2 from this species may interact with other host factors, such as Ena/VASP proteins. However, in preliminary experiments in which host Ena/VASP were silenced by siRNA, I observed no effect on the length of actin tails formed by R. bellii, suggesting that interaction of the proline rich region with Ena/VASP proteins is not important for motility. It is also possible that proline-rich sequence in R. bellii Sca2 interacts with DNA or RNA, as has been found for certain human proteins containing proline- rich sequences (12). A more likely hypothesis is that the proline-rich sequences are directly binding to G-actin (13). While all Sca2 orthologs contain proline-rich repeats, they differ considerably in their positions within the passenger domain, their length, and the spacing of consecutive prolines. Experiments uncovering the function and potential interacting partners of these proline-rich sequences may lead to additional insight into the role of these sequences in Sca2 activity.

There are also likely to be additional differences in host factor utilization during actin-based motility driven by Sca2 orthologs from different Rickettsia species. Critical host factors (including profilin) have been identified for efficient motility of the SFG species R. parkeri (11). However, we did not identify any host components that were essential for R. bellii motility. We did observe that actin tail formation by R. bellii varies greatly depending on the type of host cell that is infected, supporting the hypothesis that there are significant host factor contributions to R. bellii actin-based motility. Eukaryotic cells contain a multitude of actin modulating proteins, which provide precise regulation of host actin, defining the types of actin structures formed as

65 well as when and where they are assembled. Differences in host protein utilization by Rickettsia species may be based on the available host factors in different cell types, differences in orthologs or isoforms of these host proteins, or may be influenced by the different signaling pathways that are central to regulating host actin dynamics. These differences may be reflective of the native host ranges of the Rickettsia species, as they each inhabit a different combination of arthropod vectors and mammalian hosts.

Future work will be required to provide a substantive answer to the question of whether and how different host proteins participate in actin-based motility driven by different Sca2 orthologs. We investigated the role of just a handful of host factors in R. bellii motility in mammalian epithelial cells. Repeating the experiments in an endothelial cell line, the typical mammalian cell type infected by Rickettsiae, may provide additional insights, as may expanding the range of host cells tested. Interestingly, preliminary experiments showed that R. bellii very rarely formed actin tails in the D. melanogaster S2R+ cell line. Additional preliminary experiments in a human endothelial cell line also appeared to show a reduction in the number of bacteria associated with actin tails. Future experiments looking at more detailed differences in actin motility and tail formation in additional cell types may help us understand the different host factor requirements important to for R. bellii motility. In particular, it may be helpful to use tick cell lines, as R. bellii are typically tick endosymbionts, and this may give us a better understanding of how differences between relevant host cell types influences actin-based motility. Rickettsia species do not typically cause disease in their arthropod vectors, so studying differences in actin-based motility upon infection of both arthropod and mammalian cells may enhance our understanding of how actin based motility selectively influences virulence upon infection of different species.

Expression Patterns and Regulation of Sca2 Orthologs

Differences in actin based motility of R. bellii in difference host species and cell types may also be caused by differences in Sca2 expression in different contexts. In the experiments presented in Chapters 2 and 3, I gained a limited understanding of how R. bellii Sca2 is expressed and localized on the bacterial surface and how that correlates with actin tail formation and the parameters of motility. As we only recently acquired an antibody against R. bellii Sca2, we were unable to visualize its expression and localization of Sca2 in many different cell types. Evaluating Sca2 localization in multiple cell types by immunofluorescence microscopy will help us understand if the differences in actin-based motility may be due to changes in Sca2 expression levels and/or localization. Such differences in motility may also be due to differences in stimulatory or inhibitory factors or pathways in the host environment. Experiments knocking down key components of signaling or immune pathways would allow us to see how they may influence Sca2 expression. Additionally, methods such as rtPCR can allow us to measure differences in transcription of sca2 genes, which may also be regulated or altered throughout the bacterial infection cycle.

The focus of the studies presented in this thesis was to understand late stage of actin-based motility of R. bellii. Consequently, most experiments were conducted at 48 hpi, in the middle of

66 the late motility phase. In the SFG species R. parkeri, we know that early motility is mediated by the Rickettsial NPF RickA, and late motility is Sca2-dependent, and that expression of each differs over the course of infection (14). R. bellii contains an intact though somewhat divergent ricka gene, so it would be interesting to determine if it also undergoes an early phase of motility. A combination of live and fixed fluorescence microscopy of both early- and mid-stages of infection would allow us to observe if this happens, and measure any differences in motility parameters when compared with R. parkeri early motility.

Genetic Manipulation of Rickettsia

It is now important to understand how differences in the biochemical mechanisms of Sca2 actin assembly in vitro influence the parameters of actin-based motility in vivo. However, investigating the function of Sca2 orthologs in vivo has been hindered by limitations in the genetic tools available for Rickettsia. Ideally, we would like to knock out genes important for motility, including sca2, and complement with both wild-type and mutant sca2 variants to assess the effects on motility during an infection. However, directed knockouts are difficult, and there is only a single report of targeted gene replacement in the TG species R. prowazekii (15).

Therefore, we took advantage of the limited tools that are currently available to us, which include a plasmid-based system for transposon mutagenesis, and a separate set of shuttle plasmids for transforming Rickettsia (16-18). Our lab previously generated a transposon mutant library in R. parkeri, which included a mutant that disrupts sca2 and shows a loss late actin tail formation and motility (14). Our attempts to generate a similar sca2 transposon mutant in R. bellii were unsuccessful, despite screening over 200 mutant strains, suggesting that sca2 may be essential for in this Rickettsia species, or that not enough mutants were screened. As an alternative strategy, we attempted to complement the R. parkeri sca2::tn mutant by expression of both wild-type and mutant variants of R. bellii Sca2. Our strategy for complementation employed both transposon insertion (19) and plasmid transformation (16). I PCR amplified sca2 from R. bellii, including the flanking sequences containing predicted promoter and terminator sequences. R. bellii sca2 was inserted into both plasmids pMW1650 (containing the transposon) and pRAM18dSGA (the shuttle plasmid) and transformed by electroporation into the R. parkeri sca2::tn mutant. As the original transposon mutant strain encoded resistance to rifampicin, the complementation plasmids both contained a spectinomycin resistance gene. For bacteria transformed with pRAM18dSGA-[RbSca2], I was unable to isolate any Rickettsia that contained the plasmid. However, transformants of pMW1650-[RbSca2] were successfully generated as indicated by the presence of PCR-amplified fragment of R. bellii sca2. However, I was unable to isolate a clonal population of this strain despite screening dozens of isolated plaques. Therefore, I concluded that a high background of spontaneously antibiotic-resistant mutants overwhelmed the population, inhibiting successful isolation of a complemented transformant. Indeed, recent literature supports the notion that resistance of Rickettsia to spectinomycin or streptomycin can emerge spontaneously, with successful selection achieved only with higher doses of spectinomycin, and when used in combination with streptomycin (20). Future experiments that incorporate these changes in the selection protocol may enable the isolation of clonal transformants. Overcoming incomplete selection by spectinomycin may also be

67 accomplished by modifying the resistance gene in our complementation plasmids. Moreover, the spectinomycin resistance gene I used (aadA) has a GC content of 53%, so codon optimization for expression in Rickettsia may allow for better expression and more robust resistance, allowing us to use higher concentrations of antibiotic for effective selection of transformants. Finally, spectinomycin resistance may not be ideal for use as a selectable marker for intracellular bacteria as it is not very cell permeable (21, 22). Thus, alternative antibiotic selection markers should be developed for use with Rickettsia.

The difficulty in transforming Rickettsia with the shuttle vector pRAM18dSGA-[RbSca2] also led me to consider the possibility that expressing R. bellii sca2 from a high copy number plasmid may affect Rickettsia viability. Because little is known about Rickettsial promoters and regulation, it is difficult for us to be able to control or titrate expression of sca2. However, utilizing the R. parkeri sca2 promoter sequence with the R. bellii sca2 coding sequence may help with at least some aspects of gene expression regulation in future experiments. Though sca2 does not appear to be part of an operon, there may also be contributions of the flanking genomic regions to the successful expression of sca2. Further experimentation with different promoter sequences or extended flanking genomic regions may assist in successful expression from the shuttle vector.

New technologies such as the CRISPR/Cas9 gene editing system may also be employed in future genetic manipulations of Rickettsia. Most Rickettsia species, like other obligate intracellular bacteria, may have inefficient recombination machinery, limiting our ability to use homologous recombination as a consistent tool for making directed knockouts or for introducing mutations. If the CRISPR/Cas9 system can be successfully implemented in Rickettsia, it could allow us to introduce specific mutations at specific locations in the bacterial chromosome, bypassing many of the limitations mentioned previously.

Final Concluding Remarks

Future work to uncover the mechanism of actin assembly by Sca2 orthologs, coupled with advances in the methods for genetic manipulation of Rickettsia species, will shed light on the connection between actin assembly mechanisms and actin-based motility in cells. These experiments will provide a clearer picture of the diverse ways that intracellular pathogens have evolved to enable actin-based motility, and how these changes influence pathogenicity and virulence of different Rickettsia species. These bacterial models of actin assembly will also continue to illuminate our understanding of the molecular underpinnings of actin cytoskeleton regulation in eukaryotic cells.

References

1. Footer MJ, Lyo JK, Theriot JA. 2008. Close Packing of Listeria monocytogenes ActA, a Natively Unfolded Protein, Enhances F-actin Assembly without Dimerization. Journal of Biological Chemistry 283:23852. 2. May KL, Grabowicz M, Polyak SW, Morona R. 2012. Self-association of the Shigella flexneri IcsA autotransporter protein. Microbiology 158:1874. 3. Van Kirk LS, Hayes SF, Heinzen RA. 2000. Ultrastructure of Rickettsia rickettsii actin tails and localization of cytoskeletal proteins. Infection and Immunity 68:4706–13. 4. McLeod MP, Qin X, Karpathy SE, Gioia J, Highlander SK, Fox GE, McNeill TZ, Jiang H, Muzny D, Jacob LS, Hawes AC, Sodergren E, Gill R, Hume J, Morgan M, Fan G, Amin AG, Gibbs RA, Hong C, Yu X-J, Walker DH, Weinstock GM. 2004. Complete genome sequence of Rickettsia typhi and comparison with sequences of other rickettsiae. Journal of Bacteriology 186:5842–55. 5. Teysseire N, Chiche-Portiche C, Raoult D. 1992. Intracellular movements of Rickettsia conorii and R. typhi based on actin polymerization. Research in Microbiology 143:821–829. 6. Courtemanche N, Pollard TD. 2012. Determinants of Formin Homology 1 (FH1) Domain Function in Actin Filament Elongation by Formins. Journal of Biological Chemistry 287:7812. 7. Auerbuch V, Loureiro JJ, Gertler FB, Theriot JA, Portnoy DA. 2003. Ena/VASP proteins contribute to Listeria monocytogenes pathogenesis by controlling temporal and spatial persistence of bacterial actin-based motility. Molecular Microbiology 49:1361. 8. Andersson SG, Sharp PM. 1996. Codon usage and base composition in Rickettsia prowazekii. J Mol Evol 42:525–36. 9. Merhej V, Raoult D. 2010. Rickettsial evolution in the light of comparative genomics. Biological Reviews 86:379. 10. Haglund CM, Choe JE, Skau CT, Kovar DR, Welch MD. 2010. Rickettsia Sca2 is a bacterial formin-like mediator of actin-based motility. Nature Cell Biology 12:1057. 11. Serio AW, Jeng RL, Haglund CM, Reed SC, Welch MD. 2010. Defining a Core Set of Actin Cytoskeletal Proteins Critical for Actin-Based Motility of Rickettsia. Cell Host & Microbe 7:388. 12. Morgan AA, Rubenstein E. 2013. Proline: The Distribution, Frequency, Positioning, and Common Functional Roles of Proline and Polyproline Sequences in the Human Proteome. PLoS ONE 8:e53785. 13. Urbanek AN, Smith AP, Allwood EG, Booth WI, Ayscough KR. 2013. Article A Novel Actin- Binding Motif in Las17/WASP Nucleates Actin Filaments Independently of Arp2/3. Current Biology 23:196. 14. Lamason RL, Risca VI, Abernathy E, Welch MD. 2014. Rickettsia Actin-Based Motility Occurs in Distinct Phases Mediated by Different Actin Nucleators. Current Biology 24:98. 15. Driskell LO, Yu XJ, Zhang L, Liu Y, Popov VL, Walker DH, Tucker AM, Wood DO. 2009. Directed Mutagenesis of the Rickettsia prowazekii pld Gene Encoding Phospholipase D. Infection and Immunity 77:3244.

16. Burkhardt NY, Baldridge GD, Williamson PC, Billingsley PM, Heu CC, Felsheim RF, Kurtti TJ, Munderloh UG. 2011. Development of Shuttle Vectors for Transformation of Diverse Rickettsia Species. PLoS ONE 6:e29511. 17. Liu ZM, Tucker AM, Driskell LO, Wood DO. 2007. mariner-Based Transposon Mutagenesis of Rickettsia prowazekii. Applied and Environmental Microbiology 73:6644. 18. Welch MD, Lamason RL, Serio AW. 2012. Expression of an Epitope-Tagged Virulence Protein in Rickettsia parkeri Using Transposon Insertion. PLoS ONE 7:e37310. 19. Clark TR, Ellison DW, Kleba B, Hackstadt T. 2011. Complementation of Rickettsia rickettsii RelA/SpoT Restores a Nonlytic Plaque Phenotype. Infection and Immunity 79:1631. 20. Oliver JD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG. 2013. Motility Characteristics Are Altered for Rickettsia bellii Transformed To Overexpress a Heterologous rickA Gene. Applied and Environmental Microbiology 80:1170. 21. Maurin M, Raoult D. 2001. Use of aminoglycosides in treatment of infections due to intracellular bacteria. Antimicrobial Agents and Chemotherapy 45:2977–2986. 22. Rolain JM, Maurin M, Vestris G, Raoult D. 1998. In vitro susceptibilities of 27 rickettsiae to 13 antimicrobials. Antimicrobial Agents and Chemotherapy 42:1537–1541.