ABSTRACT PARNSEN, WANPUECH. Use of Supplemental Amino Acids

ABSTRACT

PARNSEN, WANPUECH. Use of Supplemental Amino Acids in Low Protein Diets on Growth Performance and Intestinal Health of Pigs. (Under the direction of Dr. Sung Woo Kim).

The objectives of this research are: (1) evaluate the effects of supplemental amino acids (AA) in low crude protein (CP) diet with varying tryptophan (Trp) levels on growth performance, gut health, and AA transporters when compared to conventional high CP diets,

(2) evaluate bioefficacy of liquid L-Lys in comparison to crystalline L-Lys HCl on growth performance of growing pigs, and (3) evaluate functional difference of liquid based L-Lys and crystalline L-Lys HCl on the growth performance, intestinal health, and intestinal integrity in newly weaned pigs.

Experiment 1 (Chapter 2) investigated effects of supplemental AA on growing pigs fed low protein diets with varying Trp levels. Tryptophan is an essential amino acid and is considered as 4th limiting amino acids in swine diets. However, tryptophan to lysine ratio in low crude protein diets have been suggested differently. A total of 90 pigs were allotted into

3 dietary treatments. Treatments were (1) negative control diet (NC: diet containing 18% CP with supplemental Lys, Met, and Thr), (2) positive control diet (PC: diet containing 16% CP supplemental Lys, Met, Thr and Trp), and (3) positive control diet supplemented with extra tryptophan (PCT: PC + 0.05% Trp). Collectively, use of supplemental amino acids (Lys,

Met, Thr, and Trp) in low CP diet and 0.05% additional Trp increased BW after wean, intestinal development and AA transporters in jejunum. Moreover, additional 0.05% Trp exceeding the NRC 2012 requirements enhanced intestinal tight junction proteins. Experiment 2 (Chapter 3) evaluated the effects of liquid L-Lys supplementation on growth performance in growing-finishing pigs compared with crystalline L-Lys HCl. Liquid

L-Lys contains free form of lysine; however, it contains lower lysine content based on the product specification. Hence, these L-Lys products probably have different bioefficacy when they are supplemented in pig diets. In Exp. 1, A total of hundred and twenty six pigs were randomly allotted to 7 dietary treatments which were, CON: a control diet without supplemental Lys meeting 75% of SID Lys requirement, Level 1 diets with crystalline L-Lys

HCl (C1) or liquid L-Lys (L1) meeting 82% of SID Lys requirement, Level 2 (C2 or L2) diets meeting 89% of SID-Lys requirement and Level 3 (C3 or L3) diets meeting 96% of SID

Lys requirement. In Exp. 2, seventy two pigs in L2, L3, C2, and C3 were fed diets with 0.9%

SID lysine and 6.75 mg/kg of ractopamine (Elanco, IN., USA) for 3 weeks. Collectively, these studies indicated that both L-Lys HCl and liquid L-Lys successfully provided needed lysine as shown in improve growth performance and there were no difference in bioefficacy between two sources of supplemental L-Lys.

Experiment 3 (Chapter 4) evaluated functional difference of liquid based L-Lys and crystalline L-Lys HCl on the growth performance, intestinal health, and intestinal integrity in newly weaned pigs. Twenty four newly weaned pigs were randomly allotted to 2 dietary treatments. Two treatments were, (1) a diet supplemented with crystalline L-Lys HCl or (2) a diet supplemented with liquid based L-Lys. Collectively, this study indicates that liquid L-

Lys supplementation improved intestinal health potentially by decreasing of systemic inflammatory status and improving jejunal morphology compared with the use of crystalline

L-Lys HCl in newly weaned pigs.

by Wanpuech Parnsen

A dissertation submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

Animal Science & Poultry Science

Raleigh, North Carolina

2018

APPROVED BY:

______Dr. Sung Woo Kim Dr. Terry Coffey Committee Chair

______Dr. Eric van Heugten Dr. Peter Ferket

DEDICATION

This dissertation is dedicated to my parent, Boorana Parnsen and Arporn Parnsen for their love and inspiration. I would like to express my special thankfulness to my family,

Mallika Parnsen, for her love, support, and her patience throughout the entire period of my study, and my son Possawi Parnsen for his encouragement. Lastly, all brothers and sisters, for their unconditional support and best wishes.

BIOGRAPHY

Wanpuech Parnsen, son of Boorana Parnsen and Arporn Parnsen was born in Bangkok,

Thailand on May 8, 1972 and he grew up in Nonthaburi, Thailand. He completed his elementary education at Anuban Nonthaburi School, Nonthaburi, Thailand in 1984 and completed his high school education at Surasakmontree School, Bangkok, Thailand in 1990.

In May 1990, Wanpuech started his undergraduate education at Khon Kaen University

(KKU), majoring in Animal Science and received his Bachelor of Science (Agriculture) in

1994. In 1997, Wanpuech was accepted by Graduate School of Kasetsart University (KU),

Bangkok, Thailand. He obtained a Master of Animal Science in 1999. From 1999 to 2004,

Wanpuech worked in the Feed Technology Office of Charoen Pokphand Group (Thailand) as

Feed Technician. From 2005 to 2013, Wanpuech worked in the Charoen Pokphand Group

(Malaysia) as General Manager, Feed Technology Department. In 2014, Wanpuech received a scholarship from the company to pursue his graduate education and was accepted by the

Department of Animal Science of North Carolina State University under the direction of Dr.

Sung Woo Kim.

iii

ACKNOWLEDGMENTS

There are many people who have supported me during these years, and I could not success without their kindly support.

First of all, I would like to express my gratitude to K. Phatanee Leksrisompong for her support and encouragement throughout the entire period of my graduate program. In addition, I would like to express my special thankfulness to my family and friends in

Thailand and U.S.A for their support and encouragement. Especially, Pilailuk Thongprapai and her family members for their kindly support and advice since the first day I have studied in USA.

To Dr. Sung Woo Kim, I am very grateful for his support and guidance during my program. You gave me the opportunity of studying in Animal Science, NCSU, guided me to work and think deliberately, and encouraged me at the moment when I had depression. In addition, taught me how to success in academic life and professional career. I also would like to thank my committee members: Dr. Eric van Heugten, Dr. Peter Ferket, Dr. Terry Coffey, and Dr. Min Kang for their supports and contributions to my research as well as their advice and share their experiences on my future career.

I am grateful to all my colleagues in Dr. Kim’s Laboratory for their friendship, assistance, and encouragement during the last four years: Adsos Adami Dos Passos, Ana

Sevarolli, Hongyu Chen, Inkyung Park, Jennifer Lee, Jiyao Guo, Lan Zheng, Leanne Brooks,

Marissa Herchler, Yawang Sun, and Young Ihn Kim. Special thanks to Fabricio Castelini,

Gang Liu, Jun Wang, Marcos Duarte, Naiana Manzke, Shihai Zhang, Steven Gregory, and

Yinghui Li.

I would like to thank Clay Byrd and Charles Salmon at the Swine Education Unit, Alma

Terpening, Charles Carson, and Morris Dunston at the North Carolina Swine Evaluation

Station, Tabatha Wilson at the Metabolism Education Unit and Shawn Bradshaw at the Feed

Education Unit for their great support to my graduate program. I would also like to appreciate Jayne Yoder, Jennifer Knoll, Marian Correll, Whitney Wilson-Botts Dr. Mark

Knauer and Dr. Ramon Malheiros for their kind help and support on my research.

TABLE OF CONTENTS

LIST OF TABLES ………………………………………………………………….... viii

LIST OF FIGURES ………………………………………………………………….. x

CHAPTER 1: LITERATURE REVIEW …………………………………………….. 1

Introduction …………………………………………………………………….. 2 Nitrogen excretion from excessive dietary protein …………………………….. 3 Formulating low protein diet with supplemental amino acids …………………. 8 Supplemental amino acids used in feed industry and their biological functions………………………………………………………………………… 10 Scope of the current research …………………………………………………... 23 References ……………………………………………………………………… 24

CHAPTER 2: EFFECTS OF SUPPLEMENTAL AMINO ACIDS IN LOW CP DIETS WITH VARYING TRYPTOPHAN LEVELS ON GROWTH PERFORMANCE AND GUT HEALTH IN GROWING PIGS …………………….. 38

Abstract ………………………………………………………………………… 39 Introduction …………………………………………………………………….. 41 Materials and Methods …………………………………………………………. 43 Results ………………………………………………………………………….. 47 Discussion ……………………………………………………………………… 49 References ……………………………………………………………………… 54

CHAPTER 3: EFFICACY OF SUPPLEMENTAL LIQUID L-LYSINE FOR PIGS IN COMPARISON TO CRYSTALLINE L-LYSINE HCl …………………… 69

Abstract ………………………………………………………………………… 70 Introduction …………………………………………………………………….. 72 Materials and Methods …………………………………………………………. 73 Results ………………………………………………………………………….. 76 Discussion ……………………………………………………………………… 77

References ……………………………………………………………………… 81

CHAPTER 4: FUNCTIONAL DIFFERENCE OF LIQUID L-LYSINE AND CRYSTALLINE L-LYSINE HCl ON GROWTH PERFORMANCE, INTESTINAL HEALTH, AND INTESTINAL INTEGRITY IN NEWLY WEANED PIGS ……………………………………………………………………... 102

Abstract ………………………………………………………………………… 103 Introduction …………………………………………………………………….. 105 Materials and Methods …………………………………………………………. 107 Results ………………………………………………………………………….. 112 Discussion ……………………………………………………………………… 113 References ……………………………………………………………………… 117

CHAPTER 5: GENERAL CONCLUSION ………………………………………….. 129

vii

LIST OF TABLES

CHAPTER 1

Table 1 Effects of supplemental AA on growth performance, feed efficiency, and nitrogen excretion in pigs compared to control diets ………………….. 36

CHAPTER 2

Table 1 Composition of experimental diets for growing pigs ……………………… 60

Table 2 Growth performance of pigs fed a negative control diet (NC), a positive control diet (PC), or a positive control diet with extra tryptophan (PCT) …. 61

Table 3 Intestinal tumor necrosis factor-α (TNF-α) and protein carbonyls in growing pigs fed a negative control diet (NC), a positive control diet (PC), or a positive control diet with extra tryptophan (PCT) ……………… 62

Table 4 Intestinal morphology in growing pigs fed a negative control diet (NC), a positive control diet (PC), or a positive control diet with extra tryptophan (PCT) …………………………………………………………... 63

Table 5 Primers used for real-time PCR ……………………………………………. 64

CHAPTER 3

Table 1 Composition of experimental diets (Phase 4: 30 to 45 kg BW) for Exp. 1 ………………………………………………………………………. 84

Table 2 Composition of experimental diets (Phase 5: 45 to 75 kg BW) for Exp. 1 ………………………………………………………………………. 86

Table 3 Composition of experimental diets (Phase 6: 75 to 90 kg BW) for Exp. 1 ………………………………………………………………………. 88

Table 4 Composition of experimental diets (Phase 7: 90 to 120 kg BW) for Exp. 2 ………………………………………………………………………. 90

viii

Table 5 Growth performance of pigs fed diets for Exp. 1 ………………………….. 92

Table 6 Growth performance of pigs fed diets for Exp. 2 ………………………….. 94

Table 7 Carcass characteristics of pigs for Exp. 2 ………………………………….. 95

CHAPTER 4

Table 1 Composition of experimental diets for nursery pigs ……………………….. 122

Table 2 Growth performance of pigs fed diets with either L-Lys HCl or liquid L-Lys ……………………………………………………………………….. 124

Table 3 Tumor necrosis factor-α (TNF-α), malondialdehyde (MDA), protein carbonyl, 8-hydroxydeoxyguanosine (8-OHdG), and total antioxidant capacity (TAC) levels of plasma, duodenum, and jejunum samples in nursery pigs ………………………………………………………………… 125

Table 4 Villus height, villus width, crypt depth and the ratio of villus height to crypt depth (VH/CD), and proliferate rate of crypt cells of duodenum and jejunum in nursery pigs with either L-Lys HCl or liquid L-Lys …………... 126

LIST OF FIGURES CHAPTER 1

Figure 1 Nitrogen flow in poultry and swine ……………………………………….. 37

CHAPTER 2

Figure 1 Effect of NC (supplemental Lys, Met, and Thr at 18% CP), PC (supplemental Lys, Met, Thr and Trp at 16% CP), and PCT (PC + 0.05% Trp) diets on CAT-1, bo,+AT, rBAT, y+LAT, 4F2hc and BoAT mRNA expression in jejunum of growing pigs …………………………………… 66

Figure 2 Immunoblot analysis of Occludin-1, Claudin-1, and ZO-1 protein abundances in duodenum of growing pigs ………………………………... 67

Figure 3 Immunoblot analysis of Occludin-1, Claudin-1, and ZO-1 protein abundances in jejunum of growing pigs …………………………………... 68

CHAPTER 3

Figure 1 Daily gain of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 45 kg BW …………….. 96

Figure 2 Gain:feed ratio of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 45 kg BW …………………………………………………………………. 97

Figure 3 Daily gain of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 75 kg BW …………….. 98

Figure 4 Gain:feed ratio of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 75 kg BW …………………………………………………………………. 99

Figure 5 Daily gain of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 90 kg BW …………….. 100

Figure 6 Gain:feed ratio of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 90 kg BW …………………………………………………………………. 101

CHAPTER 4

Figure 1 Immunoblot analysis of duodenal tight junction proteins in nursery pigs supplemented with different sources of L-Lys. The concentrations of claudin, occludin, and ZO-1 were measured using immunoblotting ……... 127

Figure 2 Immunoblot analysis of jejunal tight junction proteins in nursery pigs supplemented with different sources of L-Lys. The concentrations of claudin, occludin, and ZO-1 were measured using immunoblotting ……... 128

CHAPTER 1

LITERATURE REVIEW

INTRODUCTION

The swine feed industry has developed continuously due to the advancement of scientific research on swine nutrition and modern feed manufacturing technology. These developments benefit the swine industry by reducing pig production cost and maximize pig performance. From a swine nutrition point of view, swine nutritional research helps to understand more about nutrient requirements; as a consequence, swine diets are formulated more accurately to meet nutrient requirements of pigs. Therefore, pig producers are able to produce diets with an optimal feed cost. Moreover, pigs themselves not only spend less energy to excrete excess nutrients, especially nitrogen (N), but they also have higher nutrient utilization and retention, which ultimate benefits to the environment.

In conventional swine feed formulation, protein-rich feed ingredients are selected to use in diets until requirement for first limiting amino acids (AA) is met. Lysine is recognized as the first limiting AA in swine feed formulation because it is the most deficient AA in most commercial diets based on cereal grains (Lewis, 2001; NRC, 2012; Ball et al., 2013). Hence, when the Lys content in the diets meets the requirement, it means that other essential AA are expected to be met or exceeded in simple corn-soybean meal based diets. Generally, the inclusion of other essential AA, nonessential AA, and crude protein (CP) except Lys are exceeded the requirements when diets are formulated without crystalline L-Lys and other supplemental AA. Consequently, diets have a high cost without necessity, and excess nutrients have to be excreted to the environment by animals. Practically, low CP diets with supplemental synthetic AA have been implemented as an effective method to reduce these problems. In addition, several studies of amino acids supplementation not only benefit

growth performance of animals, but also provide benefits on other perspectives, such as gut integrity and immunity of pigs. (Goodband et al., 2014; Ren et al., 2015; Ruth and Field,

2013)

Globally, feed grade synthetic AA were estimated to have a total value of USD 3,860 million in 2015, where L-Lys was the most widely used supplemental AA which accounts for around 55 to 60% of the total feed grade AA market volume, followed by DL-Met, L-Thr, and L-Trp, respectively. Additionally, other supplemental AA, such as isoleucine (Ile), valine

(Val), and arginine (Arg), are also available in the market (Speedy, 2002).

This literature review describes benefits of low CP diets with synthetic AA supplementation used by the swine feed industry, and some possible problems existing in conventional swine feed formulation. The review also discusses other benefits of dietary supplementation of feed grade AA used in swine diets, and also how these AA are involved in other metabolic functions, such as their benefits on gut health. Lastly, this review indicates that some questions and concepts have not been clearly stated by previous studies, and it also proposes some hypotheses which require scientific validation.

Nitrogen excretion from excessive dietary protein

Currently, intensive pig production systems generate large amounts of waste to the environment; therefore, a new challenge for pig producers is a great concern on the improvement of pig productivity and prevention of environmental contamination with the waste produced by pig farms (Toledo et al., 2014). On the average, finishing pigs excrete 4.5 liters of manure per pig per day. This amount equals a total of 9.5 kg of nitrogen and 6.8 kg of phosphorus per pig per year (Han et al., 2001).

The efficiency of dietary nitrogen utilization varies among species, and it depends on several factors, such as the degree of protein digestibility, AA absorption, metabolic nitrogen demands, and dietary AA balance (Ferket et al., 2002). In addition, other factors, such as nutrient availability of feedstuffs, feed processing, and anti-nutritional factors, also affect nutrient utilization of animals (Cromwell, 1992; NRC, 1998). Protein and amino acids are not accumulated in the body once animals receive excess dietary proteins, unlike carbohydrate or fat. Pigs retain a relatively low percentage of dietary protein when compared to their intake.

Approximately, 15% and 50% of dietary nitrogen consumed by non-ruminants is excreted via the feces and the urine, respectively (Ferket et al., 2002). Urinary N losses can be minimized by optimizing the balance between dietary AA and the AA requirements for maintenance and production. In general, fecal and urinary nitrogen excreted by nonruminants is considered about 65% of dietary nitrogen consumption (van Heugten and van

Kempen, 2000). Some studies observed that nitrogen excretion depends on dietary nitrogen input which is related to production stages of domestic animals; particularly, nitrogen excretion were observed around 38% for weaner pigs, 63% for finishing pigs, and 75% for sows respectively (Van der Peet-Schwering et al., 1999). Nitrogen excretion and ammonia emission can be seen in figure 1.

Sources of nitrogen entering the process of nutrient metabolism are in the form of dietary protein and AA. Dietary protein digestion to peptides is started in the stomach by the chemical digestion of hydrochloric acid and pepsin. Consequently, large and small peptides which are initially digested in the stomach are completely digested by pancreatic proteases such as trypsin, chymotrypsin, elastase, and other enzymes in the small intestine. These

enzymes in addition to mucin proteins, sloughed cells, serum albumin, amides, and ingested hair which have not been digested and reabsorbed before reaching the distal ileum are considered as ileal endogenous AA losses (Tamminga et al., 1995; Nyachoti et al., 1997;

Adeola et al, 2016). There is also secretion of nitrogen containing compounds from blood circulation such as glutamine, urea, and ammonia into the small and upper large intestine.

This mechanism is called “N recycling process”. In the lumen of the large intestine, undigested proteins, peptides, and AA entering the hindgut (colon and caecum) of pigs are utilized by microbial fermentation (Brachier et al., 2013). Ultimately, these compounds undergo extensive fermentation to produce other metabolites, such as ammonia, new AA, methane, hydrogen sulfide, and short chain fatty acids before their release in feces (Wu,

2013). The reasons that animal species release ammonia in different forms are possibly related to the living environment of animals, the solubility of the end products of nitrogen, and physiological adaptation of animal species.

Products of dietary protein hydrolysis are small peptides and free AA. Eventually, they are absorbed into intestinal mucosa. Some of products from protein digestion are further utilized by the mucosa, whereas, other AA are transported by the blood circulation system for their utilization in the body (Wu, 2013). Amino acids are considered as building blocks for protein synthesis. Additionally, AA are also used as precursors to synthesize several biological compounds which are necessary for various physiological functions. (Kim et al.,

2007; Li et al., 2007; Wu et al., 2007; Liao et al., 2015).

Nitrogen derived from AA oxidation or excess dietary AA is excreted through the process of deamination and released by different pathways depending on animal species. On

the other hand, carbon structures from those AA are used to other metabolic pathways because these carbon skeletons, especially, from essential AA (EAA) are not synthesized by those animals (Rezaei et al., 2013). Domestic animals have various pathways to excrete generated ammonia from their bodies. Poultry are uricotelic animals which means they excrete ammonia as uric acid. On the other hand, mammals which are ureotelic species synthesize urea from bicarbonate and ammonia, then excrete generated urea through their urine (Wu, 2013). Pigs are categorized as mammals; therefore, ammonia derived from their

N metabolism process is released as urea. The major pathway to remove ammonia produced by pigs is the hepatic urea cycle.

The reasons that animals have to excrete ammonia from their bodies because it is a toxic substrate of N metabolism. In mammals, ammonia is considered a central nervous system

(CNS) toxin. Although ammonia can be detoxified in the brain by converting it to glutamine

(Gln), this enzymatic reaction is limited (Dimski, 1994). The urea cycle helps animals to convert synthesized ammonia into urea in the mitochondria of liver cells. The urea is synthesized by the liver; subsequently, it is delivered by the blood circulation to kidneys.

Finally, it is filtered by the kidneys and is ultimately excreted in the urine. The first step in the urea cycle is carbamoyl phosphate synthesis from bicarbonate and ammonia. Phosphate used by this step derived from ATPs. Bicarbonate is obtained by the hydration of carbon dioxide which is catalyzed by carbonic anhydrase (Dodgson et al., 1986; Wu, 2013).

Ammonia used in this step is either obtained from the blood circulation or generated by mitochondrial production. Glutamine located in mitochondria is catalyzed by glutaminase to generate ammonia (Dimski, 1994). The formation of carbamoyl phosphate depends on a

significant amount of ammonia. Therefore, glutaminase plays an important role to elevate ammonia concentrations for this process in mitochondria. The synthesis of carbamoyl phosphate occurs in mitochondria which is activated by carbamoyl phosphate synthetase I

(CPS I). The next step is the formation of citrulline (Cit) from the combination of carbamoyl phosphate and ornithine which is activated by ornithine transcarbamoylase, another mitochondria1 enzyme (Visek, 1979). The next steps of the urea cycle occurs in the cytosol.

The urea cycle in the cytosol starts with the activity of the enzyme arginosuccinate synthetase. This enzyme catalyzes the combination of two substrates which are Cit and aspartate (Asp) to form arginosuccinate. Aspartate is obtained from oxaloacetate (a substrate in citric acid cycle) and nitrogen donated by glutamate (Glu). In the next step,

Arginosuccinate is cleaved into two substrates which are Arg and fumarate by the arginosuccinate lyase enzyme (Demski, 1994). In the final step, Arg is cleaved by arginase to generate urea and ornithine, urea is released into blood circulation, and ornithine re-enters the urea cycle to process Cit synthesis (Meijer et al., 1990).

Nitrogen losses of animals are mainly related to their ability to digest and absorb dietary protein. Several studies indicated that a large portion of N losses is affected by excess dietary

N intake. In addition, total N excretion via feces and urine are estimated around 65% of N intake. Therefore, the excretion of nitrogen in feces and urine may be influenced by dietary manipulation (Han et al., 2001). Numerous studies indicated that the use of supplemental AA with 2 to 4 % reduction of dietary CP in pig diets can reduce dramatically nitrogen excretion by 7 to 34 % (Lenis, 1989; Carter et al., 1996; Jin et al., 1998)

Formulating low protein diets with synthetic AA supplementation

Nutritional management to minimize N excretion could be achieved by several strategies such as the development of feeding programs for different production stages, sex, and genetics of animals. Other options, such as, using high digestible feed ingredients, formulating diets based on nutrient digestibility instead of total nutrient content, and using feed additives to improve nutrient digestibility are also viable (Ferket et al., 2002; Aarnink and Verstegen, 2007). Practically, implementing low CP diets with supplemental AA is accepted as one effective strategy which can be applied to minimize N excretion in swine industry. Several studies indicated that dietary CP reduction in pig diets and supplementing with supplemental AA can reduce N excretion in manure by 28 to 79% and it can be calculated that nitrogen excretion can be reduced by an average of 8% per unit of dietary CP reduction (Hobbs et al., 1996; Ndegwa et al., 2008). Similarly with studies in fattening pigs,

N excretion was reduced by 35% after improving the dietary AA profile without any negative effects on feed consumption, ADG, feed efficiency and carcass composition (Dourmad et al.,

1993). The effects of AA supplementation in low CP diets on growth performance and N excretion can be seen in Table 1.

Swine nutrition research has focused on low CP diets for the past three decades and provided important information regarding benefits of low CP diets, especially, diets that are consumed in high proportion such as growing and fattening pig diets. This implementation provides several advantages on reduction of nitrogen excretion and ammonia generation from manure, it also help to reduce water intake by the pigs, which benefits to reduce manure volume. Furthermore, pigs have several benefits from low CP diets because they spend less

energy for deamination of excess AA; therefore, the net energy (NE) of diets has been increased and less diarrhea due to less excess proteins or AA used by hind gut pathogenic bacteria (Goranson et al., 1995; Htoo et al., 2007).

There was a concern that low CP diets could have adverse effects on growth performance of pigs, especially, it may result in a deficiency of non-essential AA when applied at extremes. However, numerous studies have shown that low CP diets did not show any negative effects on feed consumption or growth performance of pigs when ideal AA profiles in diets are appropriately achieved the nutrient requirements.

Low CP diet implementation in swine feed formulation can be achieved by the concept of ideal protein. The concept of supplying dietary AA to meet the AA requirements of animals was developed as the ideal protein concept. Since ratios of AA for pig diets was suggested by ARC (1981), this concept has been received considerable attentions from swine nutrition researchers. In addition, several AA profiles have been studied to evaluate AA requirements for different stages of swine production. (Easter and Baker, 1980; Chung and

Baker, 1992b).

Ideal protein concepts ratios of AA to Lys in US were first published by NRC, (1988), followed by NRC, (1998), and the latest version of NRC, (2012). NRC nutrient requirements have added some of AA such as histidine (His), Arg and all synthesizable AA which were not included in ARC, (1981). Currently, swine nutritionists have several comparable references of ideal protein recommendations and nutrient specifications to formulate low CP diets with supplemental AA appropriately. Several studies suggested that low CP diets can be used without any negative effects on growth performance. (Han et al., 1995; Jin et al., 1998).

One of the most expensive nutrients in swine feed formulation is protein; therefore, swine nutritionists have to realize that their feed cost depends on the price of their protein sources. Theoretically, maximizing the efficiency of protein utilization can be achieved by optimizing AA balance in swine diets. Practically, improving dietary AA balance also helps to replace some of the expensive protein sources such as soybean meal or animal proteins by using supplemental AA. If these diets are properly formulated and produced, they should support the same levels of animal performance as compared to conventional corn-soybean meal based diets (Tuitoek et al., 1997).

Supplemental amino acids used in feed industry and their biological functions

The use of commercial supplemental AA in animal feeds is globally accepted by the feed industry. Feed grade AA supplementation in the livestock feed industry has at least a 50 years history. DL-methionine (DL-Met) has been produced by chemical synthesis in the

1950s and followed by 1960s for poultry feeds usage. L-Lys production by fermentation technology started in the 1960s in Japan, followed by L-Thr and L-Trp in the late 1980s.

Lately, many research studies were focused on AA supplementation in different animal species. (Hansen and Lewis, 1993; Han et al., 1995; Keshavarz and Jackson, 1992; Kidd and

Kerr, 1996; Tuitoek et al, 1997). The advancement of modern biotechnology has transformed the biosynthesis process, and has significantly reduced the production costs of supplemental

AA. The utilization of genetically modified microbial strains has considerably increased competitiveness in the AA market (Speedy, 2002). In addition, the technologies of AA production has been significantly changed, providing much greater opportunities for supplemental AA to be used by the feed industry. Recently, there are arguments that protein

sources should be used appropriately in animal feeds to prevent its shortage; especially, in the situation of substantial growth in global demand for animal protein supplements. The increased substitution of supplemental AA for plant based protein supplements could provide greater efficiency and effectiveness of protein source utilization. However, the cost effectiveness of supplemental AA usage has to be accurately assessed. It is suggested that the utilization of one metric ton (t) of L-Lys HCl could replace the use of 33 t of soybean meal.

Therefore, if 550,000 t of L-Lys HCl is used globally, it could reduce 18 million tons of soybean meal usage, which represents about half of the USA annual soybean meal production (Speedy, 2002). In addition, the combination of several supplemental AAs can reduce greater amounts of soybean meal used in pig diets. The utilization of 3.2 kg/t feed of

L-Lys HCl (plus L-Thr and DL-Met) in early growing pig diets, and transitioning down to

2.0 kg/t feed during late finishing pig diets could reduce the use of soybean meal levels by approximately 90 and 50 kg/t feed respectively (Funderburke, 2008). Future developments of supplemental AA production could apparently include supplemental Val, Ile and Arg in the market. Thus, extending the range of feed grade AA is available to be used in the feed industry. The degree of AA use would be mainly determined by the global economics and other feed ingredient prices.

In the area of nutritional research on dietary protein and AA requirements. Many researchers have studied the protein sparing effect of using supplemental AA to optimize CP levels in diets of monogastric animals (Russell et al., 1986; Hansen et al., 1993: Han and Lee,

2000). In addition, other studies have focused on specific benefits of feed grade AA supplementation such as specific functions of those AA (Han et al., 1995; Jin et al., 1998).

Lysine in swine diets

Feed cost is a major expense in swine production, representing 50 to 70 % of total cost.

In conventional swine feed formulation, protein supplements are selected to be used in diets until the first limiting amino acid is meets the pig’s requirements. Therefore, in conventional corn-soybean meal diets, a major protein-rich feed ingredient, which is soybean meal, is added until the requirement of Lys is met. Nevertheless, conventional feed formulation based on crude protein without crystalline L-Lys supplementation faced several problems such as excess dietary protein, imbalance of EAA, and high feed cost. In the past decades, swine nutrition research and feed production technologies have been developed. Knowledge of ideal protein concepts and swine nutrient requirements studied by several researchers (ARC,

1981; Wang and Fuller, 1989; Chung and Baker, 1992b; NRC, 1998) helps swine producers and nutritionists to lower their cost of production. In addition, the availability of supplemental AA not only supports producers to formulate diets appropriately, but also minimizes nitrogen excretion into the environment.

Use of supplemental L-Lys has been implemented in the livestock feed industry for decades. Several topics related to Lys used in swine diets have been studied such as Lys requirements in different stages of pig production, Lys to energy ratios, sources of L-Lys and other benefits of Lys supplementations. (De la Llata et al., 2002; Nam and Aherne, 1994;

Smiricky-Tjardes et al., 2004)

L-lysine supplementation and protein sparing effects

Global pork production has been increased by 19.8% since 2005 (USDA, 2017).

Improved swine productivity by genetic selection and improved management requires more

understanding on nutrient requirement to meet genetic potential and optimum growth of pigs with optimum cost of production. Since feed grade crystalline L-Lys HCl has been introduced to feed industry in 1960s, it has dramatically impacted on several aspects, especially, cost of pig production. Lysine is the first limiting AA in cereal grains based swine diets; therefore, L-Lys supplementation plays important role in controlling feed cost and reducing CP levels in diets.

Several studies on L-Lys supplementation indicated that adding 0.1 to 0.2% of supplemental L-Lys can reduce dietary CP levels by at least 2 percentage units (Han et al.,

1995). In addition, the protein sparing effects of supplemental AA have been widely studied for decades to optimize CP levels in pig diets by using L-Lys supplementation.

Easter and Baker (1980) suggested that crystalline L-Lys spared 1 to 2 percentage units of CP in growing-finishing pigs without negative effects on growth performance. In addition, diets supplemented with L-Lys plus L-Thr, DL-Met, and L-Trp were able to reduce up to 4% of CP in growing pig diets (Russell et al., 1986; Tuitoek et al., 1997). In weanling pigs, diets supplemented with 0.2% of L-Lys in 16% CP diets had similar growth performance with

18% CP diets. Similarly, diets supplemented with L-Lys plus L-Thr, DL-Met, and L-Trp were able to spare up to 3 to 4% of CP in weanling pig diets (Hansen et al., 1993; Yen and

Veum, 1982).

Lysine supplementation on growth performance and N excretion

Several studies indicated that L-Lys supplementation not only plays an important role in reducing CP content of diets but other swine nutrition studies also focused on benefits of L-

Lys supplementation on growth performance and N excretion.

Experiment in pigs of 25 to 30 kg BW conducted by Coma et al. (1995) indicated that increased levels of L-Lys supplementation from 0.15 to 0.45% in 14% CP diets improved

ADG by 14.5 to 42.3%, and helped to reduced N excretion from 31.8 to 38.5% when compared to Lys deficient diet (Table 1). In weanling pigs, increased levels of L-Lys from

0.10 to 0.40% improved ADG by 1.5 to 2.8%, improved feed efficiency by 1.0 to 1.5%, and

N excretion was reduced by 4.0 to 10.6%, respectively, when compared to control diet (Han et al., 1995).

Threonine in swine diets

The concept of ideal protein provides the AA supply accurately matches the AA requirement of pigs due to the requirements of AA in this concept are expressed relative to the Lys content. It helps pig producers to have better pig performance by improving the utilization of dietary AA. Discovery of feed grade supplemental AA made easier to formulate pig diets by using this concept. Since threonine was discovered by McCoy et al., 1935. it has been an option of supplemental AA to be selected in low CP diets with balanced AA profiles

(Han and Lee, 2000). Threonine is the second limiting AA after Lys in pigs, and the third after sulfur AA and Lys in broilers (Aw-Yong and Beames, 1975).

Focus on Thr requirements has been increased since L-Thr has been commercially available in feed industry. This availability helps pig producers and swine nutritionists to reduce CP in diets and achieve Thr requirements in different stages of pig production.

Several studies have suggested SID Thr:SID Lys requirements in different phases of the pig production to maximize ADG and feed efficiency of pigs. Baker, (2000) suggested SID

Thr:Lys ratio for 5 to 20 kg, 20 to 50 kg, and 50 to 110 kg are 65, 67, and 70%, respectively.

An increase of the SID Thr:Lys ratio was observed as the pig is getting heavier, therefore, this increase could be related to an increase of the Thr utilization for maintenance of heavier pigs. Whereas the latest reference from NRC (2012) suggested SID Thr:Lys ratio for 5 to 25 kg, 25 to 50 kg, and 50 to 135 kg are 59, 61, and 63%, respectively. These requirements were calculated differently based on the AA requirements for maintenance and also different statistical growth models, unit of expression, and age of pigs.

Numerous studies focused on SID Thr:SID Lys ratio for gestation and lactation sows.

During pregnancy, sows require nutrients for building up their body reserves and to support the growth of their conceptus. Dourmad and Etienne (2002) used the nitrogen balance technique during gestation to determine threonine requirement of gestating sows. They observed that N retention was increased when increasing SID Thr:Lys ratio form 61 to 84%; however, the best N retention was optimized at 77% SID Thr:Lys ratio.

Amino acid metabolism is mainly required for milk protein synthesis during lactation.

In lactating sow studies, Cooper et al., (2001) suggested an optimal SID Thr:Lys ratio at

65%. Interestingly, this study observed sows gained BW during lactation which does not commonly occur. However, Kim et al. (2001) studied high lean sows, which generally have low feed consumption during lactation; these sows have to mobilize their body reserve to achieve their nutrient requirements. Therefore, levels of tissue mobilization should be considered for Thr requirements. This study suggested SID Thr:SID Lys ratio at 59, 63, 69, and 75% for no, low, medium, and high tissue mobilization, respectively.

Biological functions of threonine in swine research

Most of dietary AA are absorbed in the upper part of the small intestine. Similar to other essential AA, Thr is mainly utilized for protein synthesis. Besides protein synthesis, Thr is also used for other physiological functions.

Threonine supplementation has shown its benefits on immunoglobulin production and gut protection. Several references indicated that about 30 to 50% of dietary Thr is used in first pass metabolism. This portion of Thr is utilized for gut functions; 90% of Thr used by the intestine was either secreted as mucosal protein or catabolized (Stoll et al., 1998). High concentration of Thr is generally found in gastrointestinal secretions which are used for gut protection. The mucous gel layer along the gut villi, which is secreted by goblet cells, is an important component of the gut barrier that helps to protect the gut mucosa from digestive enzymes. Mucous is derived from a combination of water and mucins. Mucins are Thr enriched glycoproteins (Cortfield et al., 2001).

Other benefits of Thr supplementation were studied in swine breeders. Numerous studies in sows show that gamma immunoglobulin (IgG) in plasma and milk were increased when dietary Thr was increased in low CP diet with Thr deficiency (Cuaron et al., 1984; Hsu et al., 2001).

Methionine

Methionine is the second or third limiting dietary AA in corn-soybean meal based swine diets (Moehn et al., 2008). DL-Met was one of the first synthetic AA produced by chemical synthesis in the 1950s and followed by 1960s for inclusion in poultry and swine feeds.

Recently, the dietary requirements of Met for optimal growth performance and protein

accumulation have been studied in various swine experiments (Chung and Baker, 1992a;

Moehn et al., 2008). Generally, the range of dietary levels of Met and total sulfur AA

(TSAA) are recommended at 28 to 30% and 55 to 59% of Lys for growing pigs, respectively.

The NRC (2012) recommendation for SID TSAA:Lys ratio of pig are 55, 56, and 59% for 5 to 25 kg, 25 to 100, and 100 to 135 kg, respectively.

Biological functions of methionine and cysteine in swine research

Methionine and Cysteine (Cys) are considered as the major sulfur containing AA (SAA) in animals. Similar to Lys and other EAA, Met is dietary required AA, where, Cys is considered as a conditional EAA because it can be synthesized from Met by transsulfuration pathway which can be viewed as a part of methionine or homocysteine degradation (Stipanuk and Ueki, 2011).

Recently, there is not clear evidence demonstrating that these SAA play important roles in immune functions. However, they are indirectly supported by scientific research that their metabolites which are taurine, glutathione (GSH), and homocysteine, have immunomodulatory properties (Ruth and Field, 2013). GSH plays an important role in reducing intestinal oxidation damage and inflammation (Thomas et al., 2008). Shen et al.

(2014) indicated that different sources of supplemental Met are utilized differently by pigs.

The results from this study indicated that L-Met supplementation enhanced duodenal villus development in associated with reduced oxidative stress and improve GSH in nursery pigs when compared with conventional DL-methionine.

Tryptophan in swine diets

Tryptophan is considered as an EAA used by animals. Interestingly, Trp reprents the lowest amount of EAA which is incorporated in body components of pigs when compared to other EAA (Mahan and Shields, 1998). Tryptophan is required through dietary supply because of its limitation in raw materials which are used as ingredients for feed formulation

(Shen, 2013). Growing pigs require Trp for protein deposition and various metabolic functions. Recently, the dietary requirements of Trp to optimize growth performance and protein accumulation has been studied in various swine experiments (Eder et al., 2003;

Burgoon et al., 1992; Henry et al., 1992). Generally, the range of dietary levels of Trp is recommended at 16 to 22% of Lys for growing pigs. The NRC (2012) recommendation for

SID Trp:Lys ratios of pig are 16%, 17%, and 18% for 5 to 25 kg, 25 to 100, and 100 to 135 kg, respectively. However, other recommendations suggest differently. For example, the

Netherlands and Brazil nutrient recommendations, SID Trp were recommended by Central

Bureau for Livestock Feeding (CVB, 2008) and Brazilian Tables for Poultry and Swine

(Rostagno, 2012) at 0.20% and 0.19% respectively, which are 0.03 and 0.02 higher than

NRC, 2012. In addition, a study from Denmark indicated that 0.20% of SID Trp in 4 to17 kg pigs was demonstrated to meet optimal growth performance which was 0.04% higher than

0.16% SID Trp which is recommended by NRC 2012 (Nørgaard et al., 2015). Similarly,

Chinese research found that after comparing SID Trp to SID Lys ratio ranging from 0.13 to

0.25, the optimal SID Trp to Lys ratio is required at least 0.22% for 25 to 50 kg growing pigs fed low CP diets, which are 0.05% higher than NRC, 2012 (Zhang et al., 2012).

Biological functions of tryptophan in swine research

Tryptophan not only plays important roles in growth and protein accretion in pigs.

Various studies indicated that Trp is required in various metabolic pathways such as the biosynthesis of the neurotransmitter serotonin and melatonin which are involved in appetite and mood regulations (Koopmans et al., 2006; Seve, 1999; Shen et al., 2012). Additionally,

Trp metabolism is also involved with the immune response (Koopmans et al., 2012). These differences of Trp metabolic pathways deserve research attentions in assessing the Trp requirements on growth performance and other functions.

Several studies focused on the effect of Trp supplementation on feed intake of weaning pigs because newly weaned pigs face several stressors which consequently affect their post weaning performance. Zhang et al. (2007) indicated that Trp deficiency reduced ghrelin mRNA expression in the gut and its secretion in plasma, which influences appetite of pigs and feeding behavior. Trevisi et al., (2009) stated that Trp supplementation allowed

Escherichia coli K88 infected pigs to partially compensate from this challenge by increasing feed consumption and maintain an adequate BW in newly weaned pigs. In a fattening pig study, Henry et al., (1992) indicated that in the situation of suboptimal condition of Trp in the diet (0.09%), increasing protein content severely decreased daily feed intake and growth compared with optimal 0.13% Trp content of fattening pig diets. In addition, an extremely low concentration of serotonin in the hypothalamus was caused by a Trp:LNAA (large neutral AA) imbalance in which reduction of voluntary feed intake could be observed.

Numerous studies indicated that Trp has a potential function to facilitate stress adaptation of pigs by increasing hypothalamic serotonin (5-hydroxytryptamine, 5-HT)

(Kroopmans et al., 2012; Shen et al., 2012). On the other hand, about 95% of dietary Try absorbed is metabolized through the kynurenine pathway, whereas less than 5% is metabolized through the methoxyindole pathway to generate 5-HT (Shen, 2013). Although, supplementation of Trp in pig diets has shown increasing levels of hypothalamic 5-HT and reducing of stress hormone concentrations in nursery pigs. Shen et al. (2012) indicated that high levels of additional L-Trp range from 0.2 to 1.0% in corn-soybean meal based diets

(0.19% SID Trp) linearly improved growth performance which were associated with increasing of hypothalamic 5-HT and reducing of stress hormone in nursery pigs.

Valine in swine diets

In cereal based pig diets, Val is considered as the fifth limiting amino acid after Trp.

Using feed grade L-Val supplementation in least cost feed formulation depends on several factors such as source of ingredients used in feed formulation, cost effectiveness of L-Val, and the price of other ingredients. Valine is categorized as a branched chain amino acid

(BCAA) which other AA in this group, leucine (Leu) and isoleucine (Ile). Generally, the range of dietary levels of Val is recommended at 63 to 67% of Lys for growing pigs. The

NRC (2012) recommendation for SID Val:Lys ratios of pig are 63%, 65%, and 67% for 5 to

25 kg, 25 to 100, and 100 to 135 kg, respectively. However, several studies suggested a different for SID Val:Lys ratio in nursery pigs. Soumeh et al. (2015) recommended that the minimum SID Val:Lys required to maximize ADFI, ADG, and G:F was estimated at 67% of

SID Lys by a broken line model, and at 71% of SID Lys by a curvilinear plateau model, and concluded that 70% of SID Lys is suggested as the Val requirement for 8 to14 kg pigs. In

addition, numerous experiments conducted by Gaines et al. (2011) recommended that a SID

Val:Lys of 65% seems adequate for maintaining performance for pigs from 13 to 32 kg.

Valine has been proposed as the second limiting AA in practical corn-soybean meal diets for sows (Touchette et al., 1998). Val becomes the second limiting amino acid when sows have a low rate of body tissue mobilization during lactation. However, Val is the third limiting AA after Thr and Lys, when sows have a high rate of body tissue mobilization during lactation (Kim et al., 2001). The NRC (2012) recommendation for the SID Val:Lys ratios of lactating sow is 85%. Strathe et al. (2016) evaluated total dietary Val:Lys ratios of

0.84, 0.86, 0.88, 0.90, 0.95, or 0.99:1, and concluded that there was no effect of increasing the total dietary Val:Lys above 0.84:1 on sow metabolism, milk production and litter performance of lactating sows weaning more than 12 piglets. Similarly, Gaines et al. (2006) recommended that a Val:Lys ratio in excess of 0.86 did not conserve maternal tissue losses or improve a piglet growth rate, but a Val:Lys ratio of 0.73 may compromise litter growth rate.

In addition, increasing the dietary Val:Lys ration beyond 0.90 did not improve the number of weaned pigs, survival rate, or piglet growth rate.

Biological functions of valine in swine research

Numerous studies were conducted to evaluate the specific biological functions of supplemental AA such as Gln, Thr, or Trp on several biological function pathways.

However, roles of Val on specific biological functions were questioned. Generally, Val is categorized in BCAA group together with Leu and Ile. Most of studies of supplemental

BCAA focused on Leu supplementation on specific functions, especially, the effect of Leu in

muscle protein synthesis via the mammalian target of rapamycin (mTOR) pathway in different mammal species (Anthony et al., 2000; Escobar et al, 2005).

Other studies focused on the group of BCAA supplementation in pigs. Study results indicate positive effects of supplemental BCAA in low CP diets, especially, when BCAA deficiency or imbalance were observed. Supplementation of 0.34% L-Val, 0.19% L-Ile, and

0.1% L-Leu in 17% CP diet (BCAA deficient diet) maintained intestinal health and expression of AA transporters of weanling pigs (Zhang et al., 2013). In addition, supplementation of 0.34% L-Val, 0.19% L-Ile, and 0.1% L-Leu in 17% CP diet (BCAA deficient diet) improved growth performance. Besides, it also increased BCAA concentrations in plasma, intestinal villus height, and intestinal immunoglobulins levels when compared to 17% CP diet without BCAA supplementation in weaned pigs (Ren et al., 2015).

Scope of current research

It is truly understood that the swine industry is sustainably growing and really important to serve food demands of a growing human population. Sustainability of swine production not only depends on the cost of production and pork market, but also the impact of pig farms to the environment. Supplemental AA play an important role in the swine feed industry by reducing feed cost and minimizing environmental problems created by pig farms. Recently, the application of feed grade supplemental AA in swine diets seems more promising in the swine industry. Although numerous research studies have been conducted to evaluate effects of supplemental AA in low CP diets based on dietary requirements and pig performance.

However, there is still room to study AA supplementation and its biological functions to maximize the benefits of dietary AA supplementation. Therefore, the objective of this dissertation is to evaluate effects of supplemental AA on specific purposes, and significantly, to investigate how AA supplementation affects growth performance and gut health of pigs, in order to provide more accurate information on the utilization of synthetic AA in the swine industry. The first study (chapter 2) investigated effects of additional Trp in low CP diets on growth performance, gut morphology, and amino acid transporters of growing pigs. The second study (chapter 3) included two experiments, and evaluated effects of different sources of supplemental L-Lys on its relative bioavailability, growth performance, and carcass characteristics of growing-fattening pigs. The third study (chapter 4) explored effects of different sources of L-Lys on growth performance and gut health of newly weaned pigs.

REFERENCES

Aarnink, A. J. .A., and M. W. A. Verstegen. 2007. Nutrition, key factor to reduce

environmental load from pig production. Livest. Sci. 109:194-203.

Adeola, O., P. C. Xue, A. J. Cowieson, and K. M. Ajuwon. 2016. Basal endogenous losses of

amino acids in protein nutrition research for swine and poultry. Anim. Feed Sci.

Technol. 221:274-283.

Anthony, J. C., F. Yoshisawa, T. G. Anthony, T. C. Vary, L. S. Jefferson, and S. R. Kimball.

2000. Leucine stimulates translation initiation in skeleton muscle of postabsorptive rats

via a rapamycin-sensitive pathway. J. Nutr. 130(10):2413-2419.

ARC. 1981. The Nutrient Requirements of Pigs. Agriculture Research Council.

Commonwealth Agriculture Bureaux, Slough, U.K.

Aw-Yong, L. M., and R. M. Beames. 1975. Threonine as the second limiting amino acid in

Peace River barley for growing-finishing pigs and growing rats. Can. J. Anim. Sci.

55:765-783.

Ball, M. E. E., E. Magowan, K. J. McCracken, V. E. Beattie, R. Bradford, F. J. Gordon, M. J.

Robinson, S. Smyth, and W. Henry. 2013. The effect of level of crude protein and

available lysine on finishing pig performance, nitrogen balance and nutrient

digestibility. Asian-Aust. J. Anim. Sci. Vol. 26, No.4:564-572.

Baker, D. H. 2000. Recent advances in use of the ideal protein concept for swine feed

formuation. Asian-Aust. J. Anim. Sci. 13:294-301.

Blachier, F., G. Wu, Y. Yin, Y. Hou, and M. Andriamihaja. 2013. Developmental amino acid

metabolism in the pig small and large intestine epithelial cells, In: Blachier, F., Wu, G.,

Yin, Y. (eds) Nutritional and Physiological functions of amino acids in pigs, Springer-

Verlag, Wien Heidelberg, New York, Dordrecht, London, pp. 59-74.

Burgoon, K., D. Knabe, and E. Gregg. 1992. Digestible tryptophan requirements of starting,

growing, and finishing pigs. J Anim. Sci. 70:2493-2500.

Carter, S. D., G. L. Cromwell, M. D. Lindemann, and L. W. Turner. 1996. Reducing N and P

excretion by dietary manipulation in growing and finishing pigs. J. Anim. Sci. 74(Suppl

1):59.

Chung, T. K., and D. H. Baker. 1992a. Methionine requirement of pigs between 5 and 20

kilograms body weight. J. Anim. Sci. 70(6):1857-1863.

Chung, T. K., and D. H. Baker. 1992b. Ideal amino acid pattern for 10 kilogram pigs. J.

Anim. Sci. 70(10):3102-3111.

Coma, J., D. Carrion, and D. R. Zimmerman. 1995. Use of plasma urea nitrogen as a rapid

response criterion to determine the lysine requirement of pigs. J. Anim. Sci. 73:472-481.

Cooper, D. R., J. F. Patience, R. T. Zijlstra, and M. Rademacher. 2001. Effect of nutrient

intake in lactation on sow performance: determining the threonine requirement of the

high producing lactating sow. J. Anim. Sci. 79:2378-2387.

Corfield, A., D. Caroll, N. Myerscough, and C. Probert. 2001. Mucins in the gastrointestinal

tract in health and disease. Frontiers in Bioscience. 6:1321-1357.

Cromwell, G. L. 1992. The bioligical availability of phosphorus in feedstuffs for pigs. Pigs

News Info. 13(2):75N-79N.

Cuaron, J. A., R. P. Chapple, and R. A. Easter. 1984. Effect of lysine and threonine

supplementation of sorghum gestation diets on nitrogen balance and plasma constituents

in first-litter gilts. J. Anim. Sci. 58:631-637.

CVB. 2008. CVB Table Booklet Feeding of Pigs. CVB series no. 44. Centraal

Veevoederbureau, Lelystad, the Netherlands.

De la Llata, M., S. S. Dritz, M. D. Tokach, R. D. Goodband, and J. L. Nelssen. 2002. Effects

of increasing L-lysine HCl in corn- or sorghum-soybean meal-based diets on growth

performance and carcass characteristics of growing-finishing pigs. J. Anim. Sci.

80(9):2420-2432.

Dimski, D. S. 1994. Ammonia metabolism and the uea cycle: Function and clinical

imlpications. J. Vet. Intern. Med. 8:73-78.

Dodgson, S. J., and R. E. Forster, 1986. Carbonic anhydrase: inhibition results in decreased

urea production by hepatocytes. J. Appl. Physiol. 60:646-652.

Dourmad, J. Y., and M. Etienne. 2002. Dietary lysine and threonine requirements of the

pregnant sow estimated by nitrogen balance. J. Anim. Sci. 80:2144-2150.

Dourmad, J. Y., Y. Henry, D. Bourdon, N. Quiniou, and D. Guillou. 1993. Effect of growth

potential and dietary protein input on growth performance, carcass chatacteristics and

nitrogen output in growing-finishing pigs. In: Verstegen, M. W. A., den Hartog, L. A.,

van Kempen, G. J. M., Metz, J. H. M. (Eds), Nitrogen flow in pig production and

environmental consequenses. EAAP Publication no 69. Pudoc Scientific Publishers,

Wagenningen, (NLD). pp. 206-211.

Easter, R. A. and D. H. Baker. 1980. Lysine and protein level in corn-soybeal meal diets for

growing-finishing pigs. J. Anim. Sci. 50(3):467-471.

Eder, K., H. Nonn, H. Kluge, and S. Peganova. 2003. Tryptophan requirement of growing

pigs at various body weights. J. Anim. Physiol. and Anim. Nutr. 87:336-346.

Escobar, J., J. W. Frank, A. Suryawan, H. V. Nguyen, S. R. Kimball, L. S. Jefferson, and T. A.

Davis. 2005. Physiological rise in plasma leucine stimulates muscle protein synthesis in

neonatal pigs by enhancing translation initiation factor activation. Am. J. Physiol.

Endocrinol. Metab. 288:E914-E921.

Ferket, P. R., E. van Heugten, T. A. T. G. van Kempen, and R. Angel. 2002. Nutritional

strategies to reduce environment emissions from nonruminants. J. Anim. Sci. 80(E.

Suppl. 2):E168-E182.

Funderburke, D. 2008. Aggressive amino acid use helps offset hight feed costs: National Hog

Farmer, Cape Fear Consulting, LLC Warsaw, NC. 15 Mar 2008.

Gaines, A. M., R. D. Boyd, M. E. Johnston, J. L. Usry, K. J. Touchette, and G. L. Allee. 2006.

The dietary valine requirement for prolific lactating sows does not exceed the National

Research Council estimate. J. Anim. Sci. 84:1415-1421.

Gaines, A. M., D. C. Kendall, G. L. Allee, J. L. Usry, and B. J. Kerr. 2011. Estimate of the

standardized ileal digestible valine-to-lysine ratio in 13- to 32-kilogram pigs. J. Anim.

Sci. 89:736-742.

Goodband, B., M. Tokach, S. Dritz, J. DeRouchey, and J. Woodworth. 2014. Practical starter

pig amino acid requirements in relation to immunity, gut health and growth

performance. J. Anim. Sci. Biotechnol. 5(1):12.

Goransson, L., S. Lange, and I. Lonroth. 1995. Post-weaning diarrhea: Focus on diet. Pigs

News Info. 16:3, 89N-91N.

Han, In K., K. H. Heo, I. S. Shin, and H. Lee. 1995. Protein sparing effect and amino acid

digestibility of supplemental lysine and methionine in weanling pigs. Asian-Aust. J.

Anim. Sci. 8:393-402.

Han, In. K., and J. H. Lee. 2000. The role of synthetic amino acids in monogastric animal

production. A review, Asian-Aust. J. Anim. Sci. Vol. 13, No. 4:543-560.

Han, In. K., J. H. Lee, X. S. Piao, and D. Li. 2001. Feeding and management system to

reduce environmental pollution in swine production. A review, Asian-Aust. J. Anim. Sci.

Vol. 14, No. 3:432-444.

Hansen, B. C. and A. J. Lewis. 1993. Effects of dietary protein concentration (corn:soybean

meal ratio) and body weight on nitrogen balance of growing boars, barrows, and gilts:

mathematical descriptions. J. Anim. Sci. 71(8):2110-2121.

Hansen, J. A., D. A. Knabe, and K. G. Burgoon. 1993. Amino acid supplementation of low-

protein sorghum-soybean meal diets for 5- to 20-kilogram swine. J. Anim. Sci. 71:452-

458.

Henry, Y., B. Steve, Y. Colleaux, P. Ganier, C. Saligaut, and P. Jego. 1992. Interactive effects

of dietary levels of tryptophan and protein on voluntary feed intake and growth

performance in pigs in relation to plasma free amino acids and hypothalamic serotonin.

J. Anim. Sci. 70:1873-1887.

Henry, Y., B. Steve, A. Mounier, and P. Ganier. 1996. Growth performance and brain

neurotransmitters in pigs as affected by tryptophan, protein, and sex. J. Anim. Sci.

74:2700-2710.

Hobbs, P. J., B. F. Pain, R. M. Kay, and P. A. Lee. 1996. Reduction of odorous compounds in

fresh pig slurry by dietary control of crude protein. J. Sci. Food Agric. 71:508-514.

Hsu, C. B., S. P. Cheng, J. C. Hsu, and H. T. Yen. 2001. Effect of threonine addition to a low

protein diet on IgG levels in body fluid of first-litter sows and their piglets. J. Anim. Sci.

14:1157-1163.

Htoo, J. K., B. A. Araiza, W. C. Sauer, M. Rademacher, Y. Zhang, M. Cervantes, and R. T.

Zijlstra. 2007. Effect of dietary protein content on ileal amino acid digestibility, growth

performance, and formation of microbial metabolites in ileal and cecal digesta of early-

weaned pigs. J. Anim. Sci. 85(12):3303-3312.

Jin, C. F., J. H. Kim, I. K. Han, and S. H. Bae. 1998. Effects of supplemental synthetic amino

acids to the low protein diets on the performance of growing pigs. Asian-Aust. J. Anim.

Sci. 11:1.

Keshavarz, K., and M. E. Jackson. 1992. Performance of growing pullets and laying hens fed

low-protein, amino acid-supplemented diets. Poult. Sci. 71(5):905-918.

Kidd, M. T., and B. J. Kerr. 1996. L-threonine for poultry. A review, J. Appl. Poultry Res.

5:358-367.

Kim, S. W., D. H. Baker, and R. A. Easter. 2001. Dynamic ideal protein and limiting amino

acids for lactating sow: the impact of amino acid mobilization. J. Anim. Sci. 79:2356-

2366.

Kim, S. W., R. D. Mateo, Y. L. Yin, and G. Wu. 2007. Functional amino acids and fatty acids

for enhancing production performance of sows and piglets. Asian-Aust. J. Anim. Sci.

20(2):295-306.

Koopmans, S. J., A. C. Guzik, J. van der Meulen, R. Dekker, J. Kogut, B. J. Kerr, and L. L.

Southern. 2006. Effects of supplemental L-tryptophan on serotonin, cortisol, intestinal

integrity, and behavior in weanling piglets. J. Anim. Sci. 84:963-971.

Koopmans, S. J., F. J. van der Staay, N. Le Floc’h, R. Dekker, J. Th. M. van Diepen, and A. J.

M. Jansman. 2012. Effects of surplus dietary L-tryptophan on stress, immunology,

behavior, and nitrogen retention in endotoxemic pigs. J. Anim. Sci. 90:241-251.

Lee, J. H., J. H. Kim, J. D. Kim, S. W. Kim, and In K. Han, 2001. Effects of low crude

protein diets supplemented with synthetic amino acids on performance, nutrient

utilization and carcass characteristics in finishing pigs reared using phase feeding

regimen. Asian-Aust. J. Anim. Sci. 14(5):655-667.

Lenis, N. P. 1989. Lower nitrogen excretion in pig husbandry by feeding: Current and future

possibilities. Neth. J. Agric. Sci. 37:61-70.

Lewis, A. J. 2001. Amino acids in swine nutrition. In: Lewis, A. J., Southern, L.L. (eds).

Swine nutrition, CRC Press, Boca Ration, Florida. pp. 131-150.

Li, P., Y. L. Yin, D. Li, S. W. Kim, and G. Wu. 2007. Amino acids and immune function. Br.

J. Nutr. 98(2):237-252.

Liao, S. F., T. Wang, and N. Regmi. 2015. Lysine nutrition in swine and the related

monogastric animals: muscle protein biosynthesis and beyond. SpringerPlus. 4:147.

Mahan, D. C., and R. G. Shields, Jr. 1998. Essential and nonessential amino acid composition

of pigs from birth to 145 kilograms of body weight, and comparison to other studies. J.

Anim. Sci. 76:513-521.

Meijer, A. J., W. H. Lamers, and R. A. Chamuleau. 1990. Nirogen metabolism and ornithine

cycle function. Physiol. Rev. 70:701-748.

Moehn, S., A. K. Shoveller, M. Rademacher and R. O. Ball. 2008. An estimate of the

methionine requirement and its variability in growing pigs using the indicator amino

acid oxidation technique. J. Anim. Sci. 86:364-369.

Nam, D. S., and F. X. Aherne. 1994. The effects of lysine:energy ratio on the performance of

weanling pigs. J. Anim. Sci. 72(5):1247-1256.

Ndegwa, P. M., A. N. Hristov, J. Arogo, and R. E. Sheffield. 2008. A review of ammonis

emission mitigation techniques for concentrated animal feeding operations. Biosyst.

Eng. 100:453-469.

NRC. 1998. Nutrient Requirements of Swine. 10th rev. ed. Natl. Acad. Press, Washington,

DC.

NRC. 2012. Nutrient Requirements of Swine. 11th rev. ed. Natl. Acad. Press, Washington,

DC.

Nyachoti, C. M., C. F. M. de Lange, B. W. McBride and H. Schulze. 1997. Significance of

endogenous gut nitrogen losses in the nutrition of growing pigs: A review. Can. J. Anim.

Sci. 77:149-163.

Ren, M., S. H. Zhang, X. F. Zeng, H. Liu, and S. Y. Qiao. 2015. Branched-chain amino acids

are beneficial to maintain growth performance and intestinal immune-related function in

weaned piglets fed protein restricted diet. Asian-Aust. J. Anim. Sci. 28(12):1742-1750.

Rezaei, R., W. Wang, Z. Wu, Z. Dai, J. Wang, and G. Wu. 2013. Bochemical and

physioological bases for utilization of dietary amino acids by young pigs. J. Anim. Sci.

Biotechnol. 4:7.

Rostagno H. S., L. F. T. Albino, J. L. Donzele, P. C. Gomes, R. F. Oliveira, D. C. Lopes, A. S.

Ferreira, S. L. T. Barreto, and R. F. Euclides. 2012. Brazillian Tables for Poultry and

Swine: Comparison of Feedstuffs and Nutrition Requirements. Federal University of

Vicosa, Vicosa, State of Minas Gerais, Brazil.

Russell, L. E., R. A. Easter, V. Gomez-Rojas, G. L. Cromwell, and T. S. Stahly. 1986. A note

on the supplementation of low-protein maize-soya-bean meal diets with lysine,

tryptophan, threonine and methionine for growing pigs. Anim. Prod. 42:291-295.

Ruth, M. R., and C. J. Field. 2013. The immune modifying effects of amino acids on gut-

associated lymphoid tissue. J. Anim. Sci. Biotechnol. 4:27.

Seve, B. 1999. Physiological roles of tryptophan in pig nutrition. Adv. Exp. Med. Biol.

467:729-741.

Shen, Y. B., G. Voilque, J. D. Kim, J. Odle, and S. W. Kim. 2012. Effects of increasing

tryptophan intake on growth and physiological changes in nursery pigs. J. Anim. Sci.

90:2264-2275.

Shen, Y. B., A. C. Weaver, and S. W. Kim. 2014. Effect of feed grade L-methionine on

growth performance and gut health in nursery pigs compared with conventional DL-

methionine. J. Anim. Sci. 92:5530-5539.

Smiricly-Tjardes, M. R., I. Mavromichalis, D. M. Albin, J. E. Wubben, M. Rademacher, and

V. M. Gabert. 2004. Bioefficacy of L-lysine sulfate compared with feed-grade L-lysine

HCl in young pigs. J. Anim. Sci. 82(9):2610-2614.

Soumeh, E. A., J. van Milgen, N. M. Sloth, E. Corrent, H. D. Poulsen, and J. V. Norgaad.

2015. Requirement of standardized ileal digestible valine to lysine ratio for 8- to 14-kg

pigs. Animal. 9(8):1312-1318.

Speedy, A. W. 2002. Overview of world feed protein needs and supply. In Protein sources for

the animal feed industry: FAO Expert Consultation and Workshop, Bangkok, Thailand,

29 April-3 May 2002.

Stipanuk, M. H., and I. Ueki. 2011. Dealing with methionine/homocysteine sulfur: cysteine

metabolism to taurine and inorganic sulfur. J. Inherit Metab. Dis. 34(1):17-32.

Stoll, B., J. Henry, P. J. Reeds, Y. Hung, F. Jahoor and D. G. Burrin. 1998. Catabolism

dominates the first-pass intestinal metabolism of dietary essential amino acids in milk

protein-fed piglets. J. Nutr. 128:606-614.

Strathe, A. V., T. S. Bruun, J. E. Zerrahn, A. H. Tauson, and C. F. Hansen. 2016. The effect of

increasing the dietary valine-to-lysine ratio on sow metabolism, milk production, and

litter growth. J. Anim. Sci. 94:155-164.

Tamminga, S., H. Schulze, J. van Bruchem, and J. Huisman. 1995. The nutritional

significance of endogenous N-losses along the gastro-intestinal tract of farm animals.

Arch. Anim. Nutr. 48:9-22.

Thomas, B., L. L. Gruca, C. Bennett, P. S. Parimi, R. W. Hanson, and S. C. Kalhan. 2008.

Metabolism of methionine in newborn infant: response to the parenteral and enteral

administration of nutrients. Pediatr. Res. 64:381-386.

Toledo, B. J., A. C. Furlan, P. C. Pozza, J. Carraro, G. Moresco, S. L. Ferreira, and A. G.

Gallego. 2014. Reduction of the crude protein content of diets supplemented with

essential amino acids for piglets weighing 15 to 30 kilograms. R. Bras. Zootec.

43(6):301-309.

Trevisi, P., D. Melchior, M. Mazzoni, L. Casini, S. De Filippi, L. Minieri, G. Lalatta-

Costerbosa and P. Bosi. 1998. A tryptophan-enriched diet improves feed intake and

growth performance of susceptible weanling pigs orally challenged with Escherichia

coli K88. J. Anim. Sci. 87:148-156.

Touchette, K. J., G. L. Allee, M. D. Newcomb, and R. D. Boyd. 1998. The use of synthetic

lysine in the diet of lactating sows. J. Anim. Sci. 76:1437-1442.

Tuitoek, K., L. G. Young, C. F. M. de Lange, and B. J. Kerr. 1997. The effect of reducing

excess dietary amino acids on growing-finishing pig performance: An evaluation of the

ideal protein concept. J. Anim. Sci. 75:1575-1583.

USDA (U.S Department of Agriculture). 2017. Livestock and Poultry Supply: World Markets and

Trade. Washington D.C. van Heugten, E., and T. van Kempen. 2000. Understanding and applying nutrition concepts

to reduce nutrient excretion in swine. AG-608. North Carolina Coop. Ext. Serv., North

Carolina State Univ., Raleigh. van de Peet-Schwering, C. M. C., A. J. A. Aarnink, H. B. Rom, and J. Y. Doumad. 1999.

Ammonia emissions from pig houses in the Netherlands, Denmark and France. Livest.

Prod. Sci. 58:265-269.

Visek, W. J. 1979. Ammonia metabolism, urea cycle capacity, and their biochemical

assessment. Nutr. Rev. 37:273-281.

Wu, G., F. W. Bazer, T. A. Davis, G. A. Johnson, S. W. Kim, D. A. Knabe, T. E. Spencer, and

Y. L. Yin. 2007. Important roles for arginine-family amino acids in swine nutrition and

production. Livest. Sci. 122:8-22.

Wu, G. 2013. Protein digestion and absorption of peptides and amino acids, In: Wu, G. (eds)

Amino Acids, Biochemistry and Nutrition, CRC Press, Boca Raton, FL. p. 33-60.

Yen, J. T., and T. L. Veum. 1982. Effect of lysine, tryptophan and (or) carbadox additions to

low protein corn-soybean meal diets for young pigs. J. Anim. Sci. 55:1099-1108.

Zhang, H., Y. Jingdong, L. Defa, Z. Xuan, and L. Xilong. 2007. Tryptophan enhances ghrelin

expression and secretion associated with increased food intake and weight gain in

weanling pigs. Domest. Anim. Endocrinol. 33:47-61.

Zhang, S., S. Qiao, M. Ren, X. Zeng, X. Ma, and Z. Wu. 2013. Supplementation with

branced-chain amino acids to a low-protein diet regulates intestinal expression of amino

acid and peptide transporters in weanling pigs. Amino Acids. 45:1191-1205.

Zhang, G., Q. Song, C. Xie, L. Chu, P. Thacker, J. Htoo, and S. Qiao. 2012. Estimation of the

ideal standardized ileal digestible tryptophan to lysine ratio for growing pigs fed low

crude protein diets supplemented with crystalline amino acids. Livest. Sci. 149:269-266.

Table 1. Effect of supplemental AA on growth performance, feed efficiency, and nitrogen excretion in pigs compared to control diets. CP (%) Supplemented AA (%) Results2 Nitrogen ADG G:F BW (kg) CON LCP1 Lys Met Thr Trp Excretion Ref. (%) (%) (%) 9 to 25 18.0 16.0 0.10 - - - +2.8 +1.5 -10.6 13 9 to 25 18.0 16.0 0.20 - - - -1.3 - -17.7 1 9 to 25 18.0 16.0 0.40 - - - +1.5 +1.0 -4.0 1 14 to 26 18.0 15.0 0.28 0.04 - - -7.1 -6.2 -7.6 24 14 to 26 18.0 15.0 0.28 0.04 0.12 - +0.2 -1.0 -17.2 2 14 to 26 18.0 15.0 0.28 0.04 0.12 0.02 +0.6 -1.0 -17.7 2 25 to 30 14.0 14.0 0.15 - - - +14.5 - -33.7 35 25 to 30 14.0 14.0 0.30 - - - +36.0 - -31.7 3 25 to 30 14.0 14.0 0.45 - - - +42.3 - -38.5 3 55 to 72 16.0 15.0 0.23 0.05 0.05 - -1.1 +1.8 -5.9 46 55 to 72 16.0 14.0 0.33 0.12 0.22 - -3.3 +2.5 -16.0 4 55 to 72 16.0 13.0 0.44 0.15 0.33 0.50 -2.2 +1.1 -20.8 4 72 to 90 14.0 13.0 0.26 0.03 0.06 - -5.7 +1.3 -12.3 4 72 to 90 14.0 12.0 0.33 0.10 0.25 - -11.5 +6.2 -12.7 4 72 to 90 14.0 11.0 0.46 0.13 0.35 0.50 -13.8 +7.0 -16.5 4 90 to 105 12.0 11.0 0.26 - 0.04 - +1.4 -2.2 -18.3 4 90 to 105 12.0 10.0 0.36 0.07 0.24 - - -0.3 -24.9 4 90 to 105 12.0 9.0 0.46 0.11 0.34 0.50 - +1.6 -25.9 4

1LCP = Low crude protein diets supplemented with supplemental AA. 2Results = Results compared with control diets. 3Data summarized from Han et al. (1995). 4Data summarized from Jin et al (1998). 5Data summarized from Coma et al (1995). 6Data summarized from Lee et al (2001).

Figure 1. Nitrogen flow in swine. Data source: Ferket et al., (2002)

CHAPTER 2

EFFECTS OF SUPPLEMENTAL AMINO ACIDS IN LOW CRUDE PROTEIN DIETS

WITH VARYING TRYPTOPHAN LEVELS ON GROWTH PERFORMANCE AND GUT

HEALTH IN GROWING PIGS

Abstract: This study was conducted to determine the effects of supplemental AA in low CP diets with varying Trp levels on growth performance, gut health status, tight junction and AA transporters in the small intestine of growing pigs. Ninety pigs (19.7 ± 1.1 kg, 45 barrows and 45 gilts) were allotted into 3 treatments with 10 pens each treatment based on sex and body weight (3 pigs per pen, 5 barrow pens and 5 gilt pens). Treatments were (1) negative control diet (NC: diet containing 18% CP with supplemental Lys, Met, and Thr), (2) positive control diet (PC: diet containing 16% CP with supplemental Lys, Met, Thr and Trp), and (3) positive control diet supplemented with extra tryptophan (PCT: PC + 0.05% Trp). The NC and PC diets had AA concentrations to meet the NRC 2012 requirements (0.98% Lys, 0.55%

Met + Cys, 0.59% Thr and 0.17% Trp, respectively) whereas PCT diet had additional 0.05%

Trp exceeding the requirement. After 4 wk feeding, 24 pigs (1 pig per pen with median BW) were euthanized to obtain duodenum and jejunum to measure intestinal morphology, TNF-α, protein carbonyls, tight junction proteins (claudin-1, occludin-1, and ZO-1) and jejunal AA transporters (CAT-1, b0,+AT, rBAT, y+LAT, 4F2hc, and B0AT). Data were analyzed using the MIXED procedure of SAS with pen as the experimental unit. Overall, PC and PCT increased (P < 0.05) wk1 BW (24.3 and 24.2 vs. 23.4 kg), wk2 BW (28.9 and 29.2 vs. 28.0 kg) and wk1 ADG (0.656 and 0.641 vs. 0.543 kg/d). In addition, Pigs fed PCT had increased

(P < 0.05) claudin-1 in duodenum and jejunum compared with pigs in NC and PC. ZO-1 in duodenum and jejunum was not affected by treatments. Pigs fed PC had decreased (P < 0.05,

39.3%) occludin-1 in duodenum compared with pigs in NC. There was no difference in occludin-1 between PC and PCT. Pigs in PC and PCT had increased (P < 0.05) mRNA concentrations of CAT-1 (2.29 and 1.92 times), 4F2hc (2.76 and 2.45 times), and B0AT (2.12

and 2.26 times), respectively compared with pigs in NC. Collectively, the use of supplemental AA (Lys, Met, Thr, and Trp) in low protein diet and 0.05% supplemental Trp increased BW after wean, intestinal development, and AA transporters in jejunum and additional 0.05% Trp exceeding the NRC 2012 requirements enhanced intestinal tight junction proteins.

Key words: AA transporters, growth performance, low protein diets, growing pi

INTRODUCTION

Several studies on supplemental AA in low CP diets did not observe any adverse effects on growth performance of pigs, especially, when AA requirements were met by feed grade

AA supplementation. Moreover, low CP diets not only shown reduction of feed cost but also a strategic way to decrease the diarrhea induced by protein fermentation in the distal gastrointestinal tract and reduce the environmental pollution caused by nitrogen excretion and ammonia emission (Canh et al., 1998, Heo et al., 2009). Feed grade AA have been discovered and introduced in animal feed industry since 1950s, and they are accepted to be used in livestock industry. Supplementation of limiting EAA (first four limiting AA: Lys,

Met, Thr, and Trp ) to low CP diet was demonstrated to help maintaining the growth performance of growing pigs (Le Bellego et al., 2002, Yue and Qiao, 2008). Moreover, supplemental Trp in swine diets showed additional benefits such as improved appetite by increasing the expression of ghrelin, increase immune response due to increased level of aromatic AA, and reduce stress of pigs, especially newly weaned pigs due to an increase of hypothalamic serotonin synthesis (Jansman et al., 2002, Koopmans et al., 2006, Zhang et al.,

2007, Shen et al., 2012)

In NRC (1998) and NRC (2012), the recommendation of SID Trp for 20 to 50 kg pigs are 0.18% and 0.17% respectively. On the other hand, in other countries and regions of the world, the recommendations of SID Trp were suggested at higher levels than NRC 1998 and

NRC 2012. For example, in The Netherlands and Brazil, SID Trp were recommended by the

Central Bureau for Livestock Feeding (CVB, 2008) and Brazilian Tables for Poultry and

Swine (Rostagno, 2012) at 0.20% and 0.19% respectively, which is 0.03 and 0.02 higher than

NRC, 2012. Recently, a study from Denmark shown that 0.20% of SID Trp in 4 to17 kg pigs was demonstrated meet the optimum growth performance which was 0.03% higher than

0.17% SID Trp which is recommended by NRC 2012 (Nørgaard et al., 2015). Similarly, a

Chinese research found that after comparing SID Trp to SID Lys ratio ranging from 0.13 to

0.25, the optimum SID Trp to SID Lys ratio required at least 0.22 for 25 to 50 kg growing pigs fed low protein diets (Zhang et al., 2012). Therefore, the recommendation of SID Trp from NRC (2012) could be insufficient for maintaining optimum growth performance.

Exogenous protein and AA are not only the principal source for luminal and plasma AA concentrations, but also provide AA for the intestinal mucosa (Adibi and Mercer, 1973).

Unlike protein-bound AA, requiring physical and chemical digestion before absorption, free form of dietary AA can be absorbed directly in the upper gut, which means that free AA could provide more benefits to the upper gut.

The gut is a complex organ that performs different biological functions and one of its vital role is to separate the mammalian host from the external environment by specialized epithelial cells (Peterson and Artis, 2014). The other important function of the gut is that it is an important organ for digestion and absorption of nutrients (like: protein, lipid and glucose)

(Wijtten et al., 2011; Brenchley and Douek, 2012). Also, the gut plays an important role to support the immune system for swine by secreting intestinal IgA and IgG (Mestecky et al.,

1999).

The hypothesis of this study was conducted to determine if feeding pigs a low CP diet with increased supplemental AA would improve pig performance, expression of AA transporters, enhance the integrity of enterocytes and regulate immune and inflammatory

responses in the upper gut compared with feeding conventional diets, and whether feeding pigs with increased Trp from 0.17% to 0.22% SID Trp would further improve growth performance and regulate these gut functions in the upper gut.

MATERIALS AND METHODS

The experimental protocol was approved by the North Carolina State University Animal

Care and Use Committee (Raleigh, NC).

Animals and experimental design

Ninety barrows and gilts (19.6 ± 1.1 kg) at 56 d of age were allotted to 3 dietary treatments based on a randomized complete block design with 10 replicate pens (3 pigs per pen, 5 barrow and 5 gilt pens) per treatment, and fed experimental diets for 4 wk. The treatments were 1) Treatment 1, negative control diet (NC) containing 18% CP with L-Lys

HCl, DL-Met and L-Thr supplementation without L-Trp due to surplus tryptophan content in the diet compared with NRC, 2012: 2) Treatment 2, positive control diet (PC) containing

16% CP with supplement of crystalline AA included L-Trp to meet NRC, 2012 requirement.

3) Treatment 3 (PCT), 16% CP of treatment 2 diet plus 0.05% of L-Trp to meet 0.22% SID

Trp. Pigs were fed experimental diets for 4 weeks based on their assigned treatment groups.

Experimental diets were batched at the North Carolina State University Feed mill (Raleigh,

NC). Concentrations of essential nutrients met requirements suggested by the National

Research Council (2012). The dietary composition was summarized in Table 1. Pens (4.0 ×

1.4 m) with solid concrete floor were equipped with a nipple drinker and a 1-hole self-feeder.

Pigs had free access to feed and water. The experiment period was 28 d. Body weight and

feed intake were recorded weekly on d 0, 7, 14, 21 and 28. Data were obtained to calculate growth performance (ADG, ADFI, and G:F)

Sample collection

On d 28, 24 pigs (1 pig per pen, 8 pens per treatment) representing a median BW of each pen were euthanized by using captive bolt. Mucosa samples from duodenum and jejunum were stored in -80°C for measurements of TNF-α and protein carbonyls. Tissue samples from duodenum and jejunum were stored in -80°C for measurements of tight junction proteins (claudin-1, occludin-1, and ZO-1) and tissue samples from jejunum were used to analyze mRNA of AA transporters (CAT-1, b0,+AT, rBAT, y+LAT, 4F2hc, and

B0AT). Tissue sample from duodenum and jejunum were stored in 10% formalin buffer at room temperature for histology evaluation.

Immune parameters

Mucosa samples were homogenized (Tissuemiser, Thermo Fisher Scientific Inc.,

Rockford, IL) on ice. The homogenate was centrifuged at 14,000 × g at 4°C for 10 min to collect supernatant. The supernatant was used to determine concentrations of total protein,

TNF-α, and protein carbonyls.

Total protein of mucosa samples were analyzed with Pierce BCA Protein Assay Kit

(23225#, Thermo Fisher Scientific Inc. Rockford, IL). Concentrations of TNF-α in mucosa from duodenum and jejunum were analyzed using Porcine TNF-α Immunoassay ELISA Kit

(R&D System Inc. Minneapolis, MN). The detection limit range for TNF-α ELISA was 2.8 to

5.0 pg/mL. Concentrations of TNF-α in mucosa samples were expressed as ng/mg protein.

Concentrations of protein carbonyls in mucosa samples from duodenum and jejunum were

analyzed using Protein Carbonyl ELISA Kit (Cell Biolabs, Inc. San Diego, CA) following the instruction of Weaver et al. (2014). The detection limit range for protein carbonyls was

0.0 to 7.5 nmol/mg. Concentrations of protein carbonyls in mucosa samples were expressed as nmol/mg.

Histology

Tissue samples from duodenum and jejunum were fixed in formalin buffer and sent to

North Carolina State University histology laboratory (Raleigh, NC) for dehydration, embedment and staining according to their internal standard protocol. Staining was done using hematoxylin and eosin dyes. Villus height and crypt depth were measured under an

Infinity 2-2 digital CCD camera attached to an Olympus CX31 microscope (Lumenera

Corporation, Ottawa, Canada). Then, the ratio of villus height to crypt depth was calculated.

Lengths of 10 well-oriented intact villi and their associated crypt were measured in each slide. One person executed all the analysis of intestinal morphology.

Western blot analysis

The total protein of the duodenum and jejunum were extracted by using RIPA Lysis and

Extraction Buffer (content: 25mM Tris•HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) (Thermo scientific, Grand Island, NY, Cat: 89900), with the supplementation of Halt Protease Inhibitor Cocktail (100X) (Thermo scientific, Grand Island,

NY, Cat: 87786). Thermo Scientific Pierce BCA Protein Assay Kit (Thermo scientific,

Grand Island, NY, Cat: 23227) was used to evaluate protein concentrations. In the next step, individual sample was diluted to obtain 30 μg of protein concentration, then they were mixed with 4x Laemmli Sample Buffer (Bio-rad, Hercules, CA, Cat: 161-0747) at the ratio of 4:1 in

volume, then cooking at 95°C water for 5 min to get denatured protein before loading on

SDS-PAGE gels. Samples were run in the SDS-PAGE gels accompanied with the Precision

Plus Protein™ WesternC™ Standards (Bio-rad, Hercules, CA, Cat: 161-0376). After gel running, proteins were electrontransferred to Immun-Blot PVDF Membrane (Bio-rad,

Hercules, CA, Cat: 162-0175) and incubated with 5 % nonfat dry milk overnight at 4°C.

Membrane was incubated with primary antibody (occludin-1, ZO-1, claudin-1 and β-actin) at a dilution of 1:1000 for 2 h at room temperature (occludin-1: Abcam, Cambridge, MA, Cat: ab31721; claudin-1: Abcam, Cambridge, MA, Cat: ab129119; ZO-1: Santa cruz, Paso

Robles, CA, Cat: SC-10804 and β-actin Santa cruz, Paso Robles, CA, Cat: SC-47778). Then after washing with tween-20 diluted buffer, the membrane was incubated with different corresponding secondary antibody according to the host of the primary antibody at the dilution of 1:5000 for 45 mins at room temperature (Goat Anti-Rabbit IgG H&L: Abcam,

Cambridge, MA, Cat: ab6721 and Rabbit Anti-Mouse IgG H&L: Abcam, Cambridge, MA,

Cat: ab6728). Protein band densities were detected by DAB Substrate Kit (Thermo scientific,

Grand Island, NY, Cat: 34002) and quantified with AlphaImager 2200 (Alpha Innotech, San

Leandro, CA, USA).

RNA isolation and RT-PCR analysis

Total RNA of the jejunum was isolated from jejunal tissues (entire alimentary canal) by

TRIzol® Reagent (Thermo scientific, Grand Island, NY, Cat: 15596). RNA was synthesized to first strand cDNA according to the instruction of SuperScript® III First-Strand Synthesis

System (Life technology, Grand Island, NY, Cat: 18080-051). Primers for amino acid transporters were designed using Oligo 7.0 (Table 2). Real-time PCR was performed using

iQ™5 Optical System (Bio-rad, Hercules, CA) with a total volume of 20 μL mixture containing 1 ng synthesized cDNA, appropriate primers and SYBR® Green Supermix (Bio- rad, Hercules, CA, Cat: 170-8882). β-actin was used as the housekeeping gene to normalize relative gene expression. The PCR amplification was initiated at 95°C for 3 min, followed by

40 cycles of 95°C for 10 s, 59°C for 30 s, and 72°C for 30 s. Fold changes and relative gene expression levels were calculated using the comparative CT (2−ΔΔCT) method.

Statistical analysis

Data were analyzed using the Mixed procedure of SAS (SAS Inst. Inc., Cary, NC). The experiment was a randomized complete block design using initial BW and sex as blocking factors. The experimental unit was the pen for growth performance, while the individual pig for other measurements. Initial BW was considered as random effect. Statistical differences were considered significant with P < 0.05. Probabilities less than 0.10 and equal or greater than 0.05 were considered as a tendency.

RESULTS

Growth performance

The average initial BW of each treatments were not significant different from each other

(Table 2). PC and PCT diets increased BW (P < 0.05, 24.3 and 24.2 vs. 23.4 kg), ADG (P <

0.05, 0.656 and 0.641 vs. 0.543 kg/d) and gain to feed ratio (P < 0.05, 0.543 and 0.545 vs.

0.498) of growing pigs in wk 1 when compared with NC diet. Similarly, in wk 2, PC and

PCT diets also increased BW (P < 0.05, 28.9 and 29.2 vs. 28.0 kg). Feed consumption was affected by 0.05% addition of supplemental Trp in the PC diet; therefore, PCT diet increased the ADFI (P < 0.05, 1.444 vs. 1.302 and 1.369 kg/d) in wk 2 when compared with NC and

PC treatments. However, at the end of experiment, there were no significant difference on final BW, final ADG, final ADFI and gain to feed ratio among treatments.

Immune parameter

Concentrations of duodenal and jejunal TNF-α and protein carbonyls were presented in

Table 4. PC and PCT diets had tendency to enhance gut health as measured by deceased

TNF-α in both duodenum (P = 0.072, 9.82 and 9.54 vs. 11.36 pg/mg) and jejunum (P =

0.063, 6.42, 5.79 vs. 5.33 pg/mg, respectively), compared with the NC diet. However, duodenal and jejunal protein carbonyls were not affected by dietary treatments.

Histology

The results of duodenal and jejunal villus height, villus width, crypt depth and villus height to crypt depth ratio were presented in table 5. PC and PCT diets significantly increased (P < 0.05, 491 and 492 vs. 480 μm) duodenal villus height compared with NC diet.

In addition, PC and PCT diets also improved jejunal villus height (P < 0.05, 372 and 380 vs.

368 μm) and crypt depth (P < 0.05, 372 and 380 vs. 368 μm) compared to NC diet. PC and

PCT diets also increased jejunal crypt depth (P < 0.05, 256 and 257 vs. 252 μm) compared with NC diet. Moreover, pigs fed PCT diets tended to improve jejunal villus height to crypt depth ratio (P < 0.10, 1.48 vs. 1.46 and 1.45) compared with NC and PC diets. However, villus width in both duodenum and jejunum were not affected by treatments mRNA levels of AA transporters in jejunum

The abundance of CAT-1, b0,+AT, rBAT, y+LAT, 4F2hc and B0AT mRNA levels in jejunum of growing pigs was shown in Fig 1. PC and PCT diets increased mRNA concentrations of CAT-1 (P < 0.05, 2.29 and 1.92 times), 4F2hc (P < 0.05, 2.76 and 2.45

times), and B0AT (P < 0.05, 2.12 and 2.26 times) compared with NC diet. No significant difference in mRNA concentrations of b0,+AT, rBAT and y+LAT were observed between dietary treatments.

Tight junction proteins

The western blot results which were analyzed for protein abundance of occludin-1, claudin-1 and ZO-1 in duodenum and jejunum were presented by Fig 2 and Fig 3, respectively. PCT diet increased (P < 0.05, 44.3 % and 34.2 %) claudin-1 concentration in duodenum compared with NC and PC diets respectively, and also upregulated claudin-1 (P <

0.05, 28.9 % and 21.0 %) in jejunum compared with NC and PC diets respectively. PC diet decreased (P < 0.05, 39.3%) occludin-1 in duodenum compared with NC diet. Concentration of ZO-1 in duodenum and jejunum were not affected by dietary treatments.

DISCUSSION

A higher level of SID Trp to Lys ratio exceeding NRC 2012 has been recommended by some other countries and published papers in the past few years (CVB, 2009; Rostagno et al.,

2012; Nørgaard et al., 2015). In the present study, the level of SID Trp to Lys ratio was increased from 0.17 to 0.22% in PCT diet. However, the result indicated that no further growth performance was improved for 40 kg pigs when 0.05 extra Trp was supplemented in the low CP diets. However, ADG and G:F were improved at the end of Wk 1 and BW was improved in Wk 1 and Wk 2 when pigs fed diets with low CP diet and 0.05% extra Trp. This results indicated that benefits of high level of SID Trp to Lys ratio exceeding NRC 2012 could be observed in nursey pigs up to 30 kg BW. For 30 to 60 kg pigs, Apolonio et al.

(2011) suggested that digestible Trp:Lys ratio of 19% provided to the greatest ADG of pigs.

As an important role as a functional AA, Trp has been widely recognized for its special role on feed intake regulation by up-regulation of brain serotonin concentration in pigs

(Kroopmans et al., 2006; Pastuszewska et al., 2007). Although previous studies stated that L-

Trp supplementation improved growth performance due to increased hypothalamic 5-HT production and reduced stress hormone concentrations. High levels of supplemental L-Trp up to 0.2 to 1.0% which were higher than commercially used levels was studied to improve growth performance of nursery pigs in association with increasing hypothalamic serotonin

(Shen et al., 2012). In addition, some studies also demonstrated that supplementation of Trp in pig diets enhanced gut physiological functions. For example, it has been reported that the addition of 0.1% Trp in the diet tends to increase the relative weight of the small intestine and increase the intestine density (Trevisi et al., 2009). Another study reported that 0.5% supplemental dietary Trp to piglet diets increased the intestinal villus height to crypt depth ratio (Koopmans et al., 2006). The results from previous studies also implicated the potential functions of Trp in gut health regulation. Similarly, our study found that extra supplementation of Trp increased the jejunal villus height. In this research, we also studied more detail about the effects of Trp on gut health parameters including intestinal barrier, transportation and immune functions.

As an important part of the intestinal barrier, tight junction proteins (TJPs) are multifunctional protein complexes that form between adjacent epithelial cells (Farquhar and

Palade, 1963). They prevent paracellular diffusion of microorganisms and other antigens across the epithelium by sealing the paracellular space between epithelial cells (Mitic et al.,

2000). Recent advances in the understanding of barrier, immune and absorption functions of

tight junction were reviewed, with a particular focus on gut health (Wijtten et al., 2011).

Occludin, zonula occluden-1 (ZO-1) and claudin-1 are considered the most vital components in structural and functional organization of the TJPs (Anderson et al., 1988, Furuse et al.,

1993, Furuse et al., 1998). Commensal bacteria and probiotics were demonstrated to enhance intestinal barrier integrity (Ulluwishewa et al., 2011). Recently, some AA, such as Gln and

Arg have been proved to modulate the intestinal permeability through TJPs (Beutheu et al.,

2013; Wang et al., 2015). Several studies indicated that AA levels in the diet might have a major role in TJPs expression regulators. Feeding weaning piglets with extra 1% of Gln in diets increased the jejunal expression of occludin, claudin-1, ZO-2, and ZO-3 (Wang et al.,

2015). Arg and Cit increased the trans-epithelial electrical resistance (TEER) in IPECJ-2 via an increased level of ZO-1 protein expression (Chapman et al., 2012). Recently, it is still unknown about the mechanism of these nonessential AA (Gln, Arg or cirtrulline) as regulators on the expression or function of tight junction proteins, but the functions of nonessential AA are undeniable.

In the present study, supplementation of Lys, Met and Thr in 16% protein diets (PC) without non-essential AA supplementation was found to decrease the occludin-1 in the duodenum which could be due to the limitation of some AA in the diet to serve protein synthesis, especially, NEAA. Although these NEAA can be synthesized from other EAA in many organs of pigs. However, the biological functions of dietary NEAA and in vivo synthesized AA could be different. An isotopic experiment in pigs suggested that pigs prefer to use dietary Gln as a mucosal GSH source through intestinal first pass metabolism instead of newly synthesized Gln from other AA, indicating that the NEAA levels in the diets are

necessary to maintain gut functions (Reeds et al., 1996). Low levels of NEAA in low CP diet could partially alter the function of tight junction proteins in pigs. In this study, only 2% of crude protein content was reduced. Therefore, most of the tight junction proteins maintained their expressions and functions.

Tryptophan is usually considered as second or third limiting AA in low CP diet

(Burgoon et al., 1992). Several studies focused on high levels of Trp supplementation on gut health. Similarly to this study, we aimed to demonstrate whether increased supplementation of Trp to Lys ratio from 0.17 to 0.22% which is 0.05% higher than NRC 2012 recommendation could improve growth performance and enhance the intestinal biological functions through expression of tight junction proteins. The results of TJPs in this study indicated that supplementation of 0.05% Trp in the PCT diet increased claudin-1 concentrations in duodenum and jejunum of nursery pigs.

Besides the role of physical barrier, the small intestine was demonstrated to play a vital role in AA absorption and this area appeared as the place where the dietary-induced practice changes in AA transporters (Erickson et al., 1995). After digestion, released AA were absorbed mainly in proximal jejunum by neutral (for example: B0AT1 and ASCT2), cationic

(for example: rBAT/b0,+AT, CAT-1 and 4F2hc/y+LAT1) or anionic AA transporters (for example: EAAT2 and EAAT3), which depend on their physical and chemical characteristics of those AA (Bröer, 2008). Recently, numerous research studies demonstrated that dietary

AA are involved in AA transporter regulation. It has been reported that BCAA upregulated

AA transporter such as rBAT and small peptide transporter PepT-1 in weaning pigs fed with low CP diet (Zhang et al., 2013). Dietary supplementation with 1% arginine enhances

expression of jejunal AA transporters such as CAT-1 and 4F2hc in growing pigs (Yin et al.,

2014). Therefore, dietary AA levels could play an important role as one of factors to modulate the AA uptake levels.

In the current study, we reduced the dietary CP levels from 18% to 16% with supplementation of three or four commercial AA in the diet and found that supplementation of Lys, Met, and Thr in the low CP diet increased CAT-1, 4F2hc, and B0AT expression.

Lysine is categorized as a cationic AA; therefore, it could be transportered by CAT-1 in the small intestine (Bröer, 2008). Neutral AA transporter B0AT was recognized to transport neutral AA such as Met and Thr (Bröer, 2008). 4F2hc acting as a critical component of the y+ system also particates in Na+-independent transport of LNAA (Pfeiffer et al., 1999). All of feed grade AA supplementation in diets are considered as free forms AA; therefore, physical and chemical digestion is not required in digestive tracts. Hence, these supplemental

AA seem to require more AA transporters due to their comparatively high concentations in the gut. In the current study, 0.05% extra supplementation of Trp did not futher regulate the

AA transporters expression which is probably due to low level of Trp supplementation.

Overall, during 20 to 40 kg growing pigs, using supplemental AA (Lys, Met, Thr, and

Trp) in 16% crude protein diet to meet the NRC 2012 requirements did not show negative effects on growth performance. However, low CP diets potentially increased AA transporters in jejunum when compared to pigs fed 18% crude protein diets. Additional 0.05% Trp exceeding the NRC 2012 requirements did not further increase growth performance or amino acid transporters expression, but increased intestinal tight junction claudin-1 in duodenum and jejunum which could enhance gut integrity.

REFERENCES

Adibi, S. A., and D. W. Mercer. 1973. Protein digestion in human intestine as reflected in

luminal, mucosal, and plasma amino acid concentration after meals. Journal of Clinical

Investigation. 52:1586.

Anderson, J. M., B. R. Stevenson, L. A. Jesaitis, D. A. Goodenough, and M. S. Mooseker.

1988. Characterization of ZO-1, a protein component of the tight junction from mouse

liver and Madin-Darby canine kidney cells. The Journal of cell biology. 106:1141-1149.

Apolonio, L. R., J. L. Donzele, R. F. Miranda de Oliveira, A. Saraiva, F. Carlos de Oliveira

Silva, A. S. Ferreira, J. L. Kill, and D. Haese. 2011. Digestible tryptophan levels for 30

to 60 kg pigs. R. Bras. Zootec. 40 (11):2388-2393.

Beutheu, S., I. Ghouzali, L. Galas, P. Dechelotte, and M. Coeffier. 2013. Glutamine and

arginine improve permeability and tight junction protein expression in methotrexate-

treated Caco-2 cells. Clinical Nutrition. 32: 863-869.

Bröer, S. 2008. Amino acid transport across mammalian intestinal and renal epithelia.

Physiological Reviews. 88: 249-286.

Brenchley, J. M., and D. C. Douek. 2012. Microbial translocation across the GI tract. Annual

review of immunology. 30: 149.

Burgoon, K., D. Knabe, and E. Gregg. 1992. Digestible tryptophan requirements of starting,

growing, and finishing pigs. J Anim. Sci. 70:2493-2500.

Cahn, T. T., A. J. A. Aarnink, J. B. Schutte, A. Sutton, D. J. Langhout, and M. W. A.

Verstegen. 1998. Dietary protein affects nitrogen excretion and ammonia emission from

slurry of growing-finishing pigs. Livest. Prod. Sci. 56:181-191.

Chapman J. C., Y. Liu, L. Zhu, and J. M. Rhoads. 2012. Arginine and citrulline protect

intestinal cell monolayer tight junctions from hypoxia-induced injury in piglets.

Pediatric Research. 72:576-582.

CVB. 2008. CVB Table Booklet Feeding of Pigs. CVB series no. 44. Centraal

Veevoederbureau, Lelystad, the Netherlands.

Erickson, R. H., J. Gum, M. M. Lindstrom, D. McKean, and Y. S. Kim. 1995. Regional

expression and dietary regulation of rat small intestinal peptide and amino acid

transporter mRNAs. Biochemical and biophysical research communications. 216:249-

257.

Farquhar, M. G., and G. E. Palade. 1963. Junctional complexes in various epithelia. J. Cell

Biol. 17:375-412.

FASS. 2010. Guide for the care and use of agricultural animals in research and teaching.

Federation of Animal Science Societies, Champaign, IL.

Furuse, M., K. Fujita, T. Hiiragi, K. Fujimoto, and S. Tsukita. 1998. Claudin-1 and -2: novel

integral membrane protein localizing at tight junctions with no sequense similarity to

occludin. J. Cell Biol. 141: 1539-1550.

Furuse, M., T. Hirase, M. Itoh, A. Nagafuchi, S. Yonemura, and S. Tsukita. 1993. Occludin: a

novel integral membrane protein localizing at tight junctions. J. Cell Biol. 123: 1777-

1788.

Heo, J. M., J. C. Kim, C. F. Hansen, B. P. Mullan, D. J. Hampson, and J. R. Pluske. 2009.

Feeding a diet with decreased protein content reduce indices of fermentation and the

incidence of post weaning diarrhea in weaned pigs challenged with an enterotoxigenic

strain of Escherichia coli. J. Anim. Sci. 87:2833-2843.

Jansman, A. J. M., W. Smink, P. van Leeuwen, and M. Rademacher. 2002. Evaluation

through literature data of the amout and amino acid composition of basal endogenous

crude protein at the terminal ileum of pigs. Anim. Feed Sci. Technol. 98:49-60.

Koopmans, S. J., A. C. Guzik, J. van der Meulen, R. Dekker, J. Kogut, B. J. Kerr, and L. L.

Southern. 2006. Effects of supplemental L-tryptophan on serotonin, cortisol, intestinal

integrity, and behavior in weanling piglets. J. Anim. Sci. 84:963-971.

Le Bellego, L., J. van Milgen, and J. Noblet. 2002. Effect of high temperature and low-

protein diets on the performance of growing-finishing pigs. J. Anim. Sci. 80:691-701.

Mestecky, J., M. Russell, and C. Elson. 1999. Intestinal IgA: novel views on its function in

the defence of the largest mucosal surface. Gut. 44:2-5.

Mitic, L. L., C. M. van Itallie, and J. M. Anderson. 2000. Molecular physiology and

pathophysiology of tight junctions I. Tight junction structure and function; lessons from

mutant animals and proteins. American Journal of Physiology-Gastrointestinal and Liver

Physiology. 279:G250-G254.

Nørgaard, J. V. , T. F. Pedersen, E. Assadi Soumeh, K. Blaabjerk, N. Canibe, B. B. Jensen, and

H. D. Poulsen. 2015. Optimum standardized ileal digestible tryptophan to lysine ratio

for pigs weighing 7-14 kg. J. Livest. Sci. 175:90-95.

NRC. 1998. Nutrient Requirements of Swine. 10th rev. ed. Natl. Acad. Press, Washington,

DC.

NRC. 2012. Nutrient Requirements of Swine. 11th rev. ed. Natl. Acad. Press, Washington,

DC.

Pastuszewska, B., D. Tomaszewska-Zaemba, L. Buraczewska, E. Swiech, and M. Taciak.

2007. Effects of supplementing pigs diets with tryptophan and acidifier on protein

digestion and deposition, and on brain serotonin concentration in young pigs. Anim.

Feed Sci. Technol. 132:49-65.

Peterson, L. W., and D. Artis. 2014. Intestinal epithelial cells: regulators of barrier function

abd immune homeostasis. Nature Reviews Immunology. 14: 141-153.

Pfeiffer R., G. Rossier, B. Spindler, C. Meier, L. Kuhn, and F. Verrey. 1999. Amino acid

transport of y+L-type by heterodimers of 4F2hc/CD98 and members of the glycoprotein-

associated amino acid transporter family. The EMBO Journal. 18:49-57.

Reeds P. J., D. G. Burrin, F. Jahoor, L. Wykes, J. Henry and E. M. Frazer. 1996. Enteral

glutamate is almost completely metabolized in first pass by the gastrointestinal tract of

infant pigs. Am. J. Physiol. Endocrinol. Metab. 270:E413-E418.

Rostagno H. S., L. F. T. Albino, J. L. Donzele, P. C. Gomes, R. F. Oliveira, D. C. Lopes, A. S.

Ferreira, S. L. T. Barreto, and R. F. Euclides. 2012. Brazillian Tables for Poultry and

Swine: Comparison of Feedstuffs and Nutrition Requirements. Federal University of

Vicosa, Vicosa, State of Minas Gerais, Brazil.

Shen, Y. B., G. Voilque, J. D. Kim, J. Odle and S. W. Kim. 2012. Efeects of increasing

tryptophan intake on growth and physiological changes in nursery pigs. J. Anim. Sci.

90:2264-2275.

Trevisi, P., D. Melchior, M. Mazzoni, L. Casini, S. De Filippi, L. Minieri, G. Lalatta-

Costerbosa, and P. Bosi. 2009. A tryptophan-enriched diet improves feed intake and

growth performance of susceptible weanling pigs orally challenged with Escherichia

coli K88. J. Anim. Sci. 87:148-156.

Ulluwishewa, D., R. C. Anderson, W. C. McNabb, P. J. Moughan, J. M. Wells, and N. C.

Roy. 2011. Regulation of tight junction permeability by intestinal bacteria and dietary

components. J. Nutr. 141:769-776.

Wang, H., C. Zhang, G. Wu, Y. Sun, B. Wang, B. He, Z. Dai, and Z. Wu. 2015. Glutamine

enhances tight junction protein expression and modulates corticotropin-releasing factor

signaling in the jejunum of weanling piglets. J. Nutr. 145:25-31.

Weaver, A. C., J. M. Campbell, J. D. Crenshaw, J. Polo, and S. W. Kim. 2014. Efficacy of

dietary spray plasma protein to mitigate the negative effects on performance of pigs fed

diets with corn naturally contaminated with multiple mycotoxins. J. Anim. Sci. 92:3878-

3886.

Wijtten, P. J., J. van der Meulen, and M.W. Verstegen. 2011. Intestinal barrier function and

absorption in pigs after weaning: a review. Br. J. Nutr. 105:967-981.

Yin, J., W. Ren, J. Duan, L. Wu, S. Chen, T. Li, Y. Yin, and G. Wu. 2014. Dietary arginine

supplementation enhance intesinal expression of SLC7A7 and SLC7A1 and ameliorates

growth depression in mycotoxin-challenged pigs. Amino Acids. 46:883-892.

Yue, L. Y., and S. Y. Qiao. 2008. Effects of low-protein diets supplemented with crystalline

amino acids on performance and intestinal development in piglets over the first 2 weeks

after weaning. Livest. Sci. 115:144-152.

Zhang, H., J. Yin, D. Li, X. Zhou, and X. Li. 2007. Tryptophan enhances ghrelin expression

and secretion associated with increased food intake and weight gain in weanling pigs.

Domest. Amim. Endocrinol. 33:47-61.

Zhang, G., Q. Song, C. Xie, L. Chu, P. Thacker, J. Htoo, and S. Qiao. 2012. Estimation of the

ideal standardized ileal digestible tryptophan to lysine ratio for growing pigs fed low

crude protein diets supplemented with crystalline amino acids. Livest. Sci. 149:269-266.

Zhang, S., S. Qiao, M. Ren, X. Zeng, X. Ma, Z. Wu, P. Thacker, and G. Wu. 2013.

Supplementation with branched-chain amino acids to a low-protein diet regulates

intestinal expression of amino acid and peptide transporters in weanling pigs. Amino

Acids. 45:1191-1205.

Table 1. Composition of experimental diets for growing pigs Items NC PC PCT4 Ingredients, % Yellow corn 71.40 76.92 76.87 Dehulled soybean meal 25.00 19.00 19.00 Poultry fat 1.00 1.00 1.00 L-Lys HCl 0.24 0.43 0.43 DL-Met 0.04 0.09 0.09 L-Thr 0.04 0.13 0.13 L-Trp 0.00 0.02 0.07 L-Val 0.00 0.03 0.03 Dicalcium phosphate 1.05 1.20 1.20 Limestone 0.85 0.80 0.80 Vitamin premix1 0.03 0.03 0.03 Mineral premix2 0.15 0.15 0.15 Salt 0.20 0.20 0.20 Total 100.00 100.00 100.00 Calculated composition DM, % 89.14 89.06 89.07 ME, Mcal/kg 3.34 3.35 3.35 CP, % 18.00 16.00 16.00 SID3 Lys 0.98 0.98 0.98 SID Met+Cys 0.55 0.55 0.55 SID Trp 0.18 0.17 0.224 SID Thr 0.59 0.59 0.59 Ca, % 0.66 0.66 0.66 P available, % 0.32 0.32 0.32 P total, % 0.56 0.56 0.56 1The vitamin premix provided the following per kilogram of a complete diet: 6,613.8 IU of vitamin A; 992.0 IU of vitamin D3; 19.8 IU of vitamin E; 2.64 mg of vitamin K; 0.03 mg of vitamin B12; 4.63 mg of riboflavin; 18.52 mg of pantothenic acid; 24.96 mg of niacin; and 0.07 mg of biotin. 2The trace mineral premix provided the following per kilogram of a complete diet: 4.0 mg of Mn as manganous oxide; 165 mg of Fe as ferrous sulfate; 165 mg of Zn as zinc sulfate; 16.5 mg of Cu as copper sulfate; 0.30 mg of I as ethylenediamine dihydroiodide; and 0.30 mg of Se as sodium selenite. 3SID = Standardized ileal digestability. 40.05% additional Trp above NRC requirement.

Table 2. Growth performance of growing pigs fed a negative control diet (NC), a positive control diet (PC), or a positive control diet with extra tryptophan (PCT) for 28 days1. Diets SEM2 P value NC PC PCT Body weight, kg Initial body weight 19.63 19.67 19.66 1.138 0.930 Wk 1 23.44 b 24.26 a 24.16 a 1.342 0.005 Wk 2 28.01 b 28.85 a 29.15 a 1.527 0.011 Wk 3 33.24 34.01 34.34 1.712 0.099 Final body weight 40.20 40.57 41.22 1.844 0.350 ADG, kg/d Wk 1 0.543 b 0.656 a 0.641a 0.038 0.003 Wk 2 0.652 0.656 0.714 0.042 0.149 Wk 3 0.748 0.738 0.741 0.043 0.828 Wk 4 0.994 0.937 0.984 0.036 0.480 All 0.734 0.748 0.769 0.030 0.393 ADFI, kg/d Wk 1 1.09 1.21 1.19 0.071 0.075 Wk 2 1.30 b 1.37 ab 1.44 a 0.075 0.018 Wk 3 1.48 1.49 1.47 0.074 0.989 Wk 4 1.92 1.88 1.91 0.080 0.947 All 1.45 1.49 1.51 0.068 0.463 G:F Wk 1 0.498 b 0.543 a 0.545 a 0.013 0.012 Wk 2 0.502 0.479 0.496 0.018 0.495 Wk 3 0.501 0.496 0.505 0.017 0.560 Wk 4 0.519 0.502 0.514 0.011 0.248 All 0.507 0.504 0.515 0.008 0.385 1Values are means of 10 pens per treatments (3 pigs per pen) (n = 10). 2Standard error of mean.

Table 3.Intestinal TNF-α and protein carbonyls in growing piglets fed a negative control diet (NC), a positive control diet (PC), or a positive control diet with extra tryptophan (PCT) for 28 days1.

Diets SEM2 P value NC PC PCT Tissue TNF-α, pg/mg/mL Duodenum 11.36 B 9.82 A 9.54 A 0.516 0.072 Jejunum 7.60 B 6.42 AB 5.79 A 0.711 0.063 Tissue protein carbonyl, nmol/mg Duodenum 3.87 3.82 3.54 0.163 0.488 Jejunum 3.95 3.92 3.69 0.183 0.664 1Values are means of eight pigs per diet with one median pig chosen from each pen (n = 8). 2Standard error of mean. A,B Means within a row with different superscripts was considered as a tendency (0.05 < P < 0.10).

Table 4. Intestinal morphology in growing piglets fed a negative control diet (NC), a positive control (PC) diet, or a positive control diet supplemented with tryptophan (PCT) for 28 days1. Diets SEM2 P value NC PC PCT Duodenum Villus height, μm 480 b 491 a 492 a 2.468 0.004 Villus width, μm 169 170 172 1.056 0.352 Crypt depth, μm 371 373 374 2.940 0.324 VH:CD ratio 1.29 1.31 1.32 0.009 0.107 Jejunum Villus height, μm 368 c 372 b 380 a 1.340 < 0.001 Villus width, μm 120 123 123 0.660 0.273 Crypt depth, μm 252 b 256 a 257 a 1.041 0.008 VH:CD ratio 1.46 1.45 1.48 0.007 0.088 1Values are means of eight pigs per diet with one pig chosen from each pen (n = 8). 2Standard error of mean. a,b Means within a row with different superscripts were significant different (P < 0.05).

Table 5. Primers used for real-time PCR. Gene Primer Sequence (5’-3’) Size Tm Accession no. (bp) (oC) ASCT21 Forward GCCAGCAAGATTGTGGAGAT 206 bp 60 DQ231578 Reverse GAGCTGGATGAGGTTCCAAA B0AT12 Forward CACAACAACTGCGAGAAGGA 155 bp 60 DQ231579 Reverse CCGTTGATAAGCGTCAGGAT CAT-13 Forward TGCCCATACTTCCCGTCC 192 bp 59 NM_001012613 Reverse GGTCCAGGTTACCGTCAG b0,+AT4 Forward ATCGGTCTGGCGTTTTAT 144 bp 59 NM_001110171 Reverse GGATGTAGCACCCTGTCA y+LAT15 Forward GCCCATTGTCACCATCATC 216 bp 59 NM_001110421 Reverse GAGCCCACAAAGAAAAGC 4F2hc6 Forward CTCGAACCCACCAAGGAC 174 bp 59 XM_003361818 Reverse GAGGTGAGACGGCACAGAG Pept-17 Forward CCCAGGCTTGCTACCCAC 144 bp 60 NM_214347 Reverse ACCCGATGCACTTGACGA rBAT8 Forward TTTCCGCAATCCTGATGTTC 146 bp 59 NM_001123042 Reverse GGGTCTTATTCACTTGGGTC β-actin Forward TGCGGGACATCAAGGAGAAG 216 bp 60 XM_003357928 Reverse AGTTGAAGGTGGTCTCGTGG

Table 5 Continued

1ASCT2: Na+-neutral AA exchanger; 2B0AT1: system B0 neutral AA transporter; 3CAT-1: cationic amino acid transporter 1; 4b0,+AT: related to b0,+ amino acid transporter; 5y+LAT1: y+ L amino acid transporter-1; 64F2hc: 4F2 heavy chain;7 Pept-1: intestinal peptide transporter; and 8 rBAT: basic amino acid transport

Figure 1. Effect of NC (supplemental Lys, Met, and Thr at 18% CP), PC (supplemental Lys, Met, Thr and Trp at 16% CP), and PCT (PC + 0.05% Trp) diets on CAT-1, bo,+AT, rBAT, y+LAT, 4F2hc and BoAT mRNA expression in jejunum of growing pigs. β-Actin was used as an internal standard to normalize the signal. Means without a common letter differ (P < 0.05)

Figure 2. Concentration of tight junction proteins in duodenal tissues of growing pigs fed NC (supplemental Lys, Met, Thr and Trp at 18% CP), PC (supplemental Lys, Met, and Thr at 16% CP) or PCT (LP + 0.05% Trp) diets. The concentrations of Occludin-1, Claudin-1 and zonula occludens (ZO) -1 was measured by immunoblotting analysis. Data are represented as mean ± SEM, n = 8. *P < 0.05

Figure 3. Concentration of tight junction proteins in jejunal tissues of growing pigs fed NC (supplemental Lys, Met, Thr and Trp at 18% CP), PC (supplemental Lys, Met, and Thr at 16% CP) or PCT (LP + 0.05% Trp) diets. The concentrations of Occludin-1, Claudin-1 and zonula occludens (ZO) -1 was measured by immunoblotting analysis. Data are represented as mean ± SEM, n = 8. *P < 0.05

CHAPTER 3

EFFICACY OF SUPPLEMENTAL LIQUID L-LYSINE FOR PIGS IN COMPARISON TO

CRYSTALLINE L-LYSINE HCl

Abstract: The objective of these experiments was to test the effects of liquid L-Lys supplementation on growth performance in growing-finishing pigs compared with crystalline

L-Lys HCl. In Exp. 1, A total of 126 pigs at 70 d of age (29.5 + 2.27 kg BW) in 42 pens were randomly allotted to 7 dietary treatments which were, CON: a control diet without supplemental Lys meeting 75% of SID Lys requirement, Level 1 diets with crystalline L-Lys

HCl (C1) or liquid L-Lys (L1) meeting 82% of SID Lys requirement, Level 2 (C2 or L2) diets meeting 89% of SID-Lys requirement and Level 3 (C3 or L3) diets meeting 96% of SID

Lys requirement. Each treatment had 6 pens (3 barrow and 3 gilt pens) with 3 pigs/pen. All 7 diets were formulated to contain nutrients meeting the requirements suggested by NRC

(2012) except for SID Lys. Pigs were fed experimental diets for 9 wk based on 3 phases until

90 kg BW (30 to 45, 45 to 75, and 75 to 90 kg BW, respectively). All experimental diets were pelleted. Body weight and feed disappearance were measured to calculate ADG, ADFI, and G:F. Data were analyzed using the MIXED procedure in SAS. A multilinear regression analysis was used to evaluate the relative bioavailability of liquid L-Lys to crystalline L-Lys

HCl. Increasing Lys from 75 to 96% of SID Lys requirement improved (P < 0.05) ADG from

0.83 to 1.00 kg/d and G:F from 0.384 to 0.430 without affecting ADFI. Forms of Lys

(crystalline vs. liquid) did not affect performance of pigs. Rates of increases in ADG and G:F of pigs fed diets with liquid L-Lys was not different (P = 0.764 and 0.398) from that of pigs

(39.4 vs. 37.0 g/g daily intake of supplemental Lys and 0.00828 vs. 0.00696 g/g daily intake of supplemental Lys) fed diets with crystalline L-Lys HCl. This study demonstrates that the efficacy of liquid L-Lys was not different from that of crystalline L-Lys HCl for performance of pigs from 30 to 90 kg. In Exp. 2, all pigs in L2, L3, C2, and C3 were fed diets with 0.9%

SID lysine and 6.75 mg/kg of ractopamine (Paylean, Elanco, IN., USA) for 3 weeks. Body weight and feed disappearance were measured to calculate ADG, ADFI, and G:F ratio. At the end of 3 wk feeding with ractopamine, all pigs were processed at a local abattoir to evaluate dressing percentage. For dressing percentage, individual pig was considered the experimental unit. Overall, source of Lys did not affect growth performance of pigs when fed ractopamine diets. Carcass characteristics were not affected by the source of Lys. Collectively, these studies indicated that both Lys HCl and liquid L-Lys successfully provided needed lysine as shown by improved growth performance and there were no difference in bioefficacy between the two sources.

Key words: growth performance, liquid L-lysine, L-lysine HCl

INTRODUCTION

In the swine industry, Lys is accepted as the first limiting AA in swine diets with corn and soybean meal as the major ingredients (Mavromichalis, 1998; Smiricky-Tjardes et al.,

2004). Therefore, L-lysine supplementation is a common practice to achieve lysine requirements with appropriate contents of other amino acids. Since the 1960s, there are different forms of supplemental L-lysine have been widely used in feed industry such as crystalline L-Lys HCl which is the major supplemental L-Lys used by livestock feed industry

(Jackson, 2001). The results from several studies indicated no suppression in growth performance in pigs weighing from 30 to 120 kg BW when diets contained feed grade crystalline L-Lys up to 1.4 kg/t. In addition, it could be added up to 3.2 kg/t in pig diets weighing 25 to 80 kg BW when other feed grade supplemental amino acids are supplemented

(Ratliff, 2005). Recently, there are different sources of feed grade supplemental L-Lys that have been developed by amino acid producers such as L-Lys sulfate, concentrated liquid L-

Lys HCl, and liquid L-Lys.

Liquid L-Lys is derived from bacteria fermentation process as well as crystalline L-Lys

HCl, however, the drying process is omitted for this product. Hence, liquid L-Lys contains 50 to 60% dry matter and 50% minimum L-Lys content when compared with L-Lys HCl, which contains a minimum of 78.8% lysine content and 98.5% dry matter. Although liquid L-Lys has a lower lysine content, however, it contains unbound L-Lys whereas crystalline L-Lys is associated with hydrochloric acid salt. In addition, this alternative source of L-Lys is not anticipated to differ from the crystalline L-lysine HCl if users formulate their feeds based on

Lys content of this product. However, differences in Lys absorption and its utilization between these products which influences pig performance could be observed.

There are several techniques that have been used to evaluate a different form of synthetic amino acids in swine research. Unfortunately, there is no direct measure of AA bioavailability. Traditionally, estimates of relative bioavailability (RBV) of AA have been obtained using slope ratio assays (Kim et al., 2006; Smiricky-Tjardes et al., 2004). Therefore, the objective of this study was to compare the relative bioavailability of liquid L-Lys with a crystalline L-Lys HCl in grower pigs. In addition, growth performance and carcass characteristics were compared between diets supplemented with different sources of commercial L-Lys.

MATERIALS AND METHODS

These experimental protocols were approved by North Carolina State University Animal

Care and Use Committee (Raleigh, NC).

Animals and experimental design

Exp. 1 This experiment was conducted at the North Carolina Swine Evaluation Station

(Clayton, NC). One hundred and twenty six barrows and gilts (29.5 ± 2.3 kg) at 70 d of age were allotted into 7 dietary treatments in a randomized complete block design based on initial

BW and sex. Dietary treatments were, CON: a control diet without supplemental Lys meeting 75% of SID Lys requirement, Level 1 diets with crystalline L-Lys HCl (C1) or liquid L-Lys (L1) meeting 82% of SID Lys requirement, Level 2 (C2 or L2) diets meeting

89% of SID-Lys requirement and Level 3 (C3 or L3) diets meeting 96% of SID Lys requirement. The experimental diets were pelleted at 82°C. The diet composition was summarized in Table 1. Each treatment had 6 replicate pens (3 barrow and 3 gilt pens) with 3 pigs/pen. Pens (4.0 × 1.4 m) with solid concrete floor were equipped with one nipple drinker and a 1-hole self-feeder. The experiment period was 9 wk, and was divided into 3 phases until pigs reach 90 kg BW. The 3 phases were: phase 4 (30 to 45 kg BW), phase 5 (45 to 75 kg BW), and phase 6 (75 to 90 kg BW) respectively.

Exp. 2, the experiment was conducted at the North Carolina Swine Evaluation Station

(Clayton, NC) and was a continuation of Exp. 1. All pigs in L2 and L3 (liquid L-Lys treatments), and pigs in C2 and C3 (crystalline L-Lys treatments) were fed diets with 0.9%

SID lysine and 6.75 mg/kg of ractopamine (Paylean, Elanco, IN., USA) for 3 wk. Seventy two crossbred barrows and gilts (90.0 ± 3.2 kg) at 19 wk of age from previous study were continuously assigned into 2 dietary treatments to compare the effects of supplemental L-Lys source on growth performance and carcass characteristics of pigs fed diets with supplemented ractopamine. Pigs had free access to water and feed. All essential nutrients in the experimental diets were adequate (NRC, 2012). The diet composition was summarized in

Table 4. The experimental period was 3 wk. Each treatment has 12 pens with 3 pig per pen.

Pens (4.00 × 1.40 m) with solid concrete floor were equipped with a nipple drinker and a 1- hole self-feeder. Body weight and feed disappearance were measured to calculate ADG,

ADFI, and G:F ratio. At the end of 3 wk feeding with Paylean, all pigs were processed at a local abattoir to evaluate dressing percentage. For dressing percentage, individual pig was considered as the experimental unit.

Growth performance

Body weight and feed disappearance were recorded weekly to calculate growth performance which are ADG, ADFI, and feed efficiency as G:F ratio.

Handling and slaughtering

At the end of experiment, body weight of pigs were measured individually before all pigs were delivered and slaughtered at local commercial abattoir (Villary Food Group,

Warsaw, NC). Pig were slaughtered using percussive stunning and exsanguination, and marked by their respective identification numbers. Slaughter technique complied with national regulations (FSIS, 2013).

Carcass characteristics

Hot carcass weight (HCW) were collected to measure dressing percentage after pigs were slaughtered and eviscerated. Dressing percentage was calculated by the ratio of HCW to final body weight.

Hot carcass weight Dressing percentage, % = × 100% Final body weight

Pig carcasses were chilled for 24 hr at 4°C, then, cold carcasses weight (CCW) were obtained to calculate cold carcass percentage (CCP) by the ratio of CCW to final body weight and cooling loss (CL) by the ratio of CCW to HCW.

Cold carcass weight Chilling loss, % = × 100% Hot carcass weight

By using a ruler, dorsal subcutaneous adipose tissue was measured in millimeters at the tenth and last rib positions following the instruction of USDA. (1985). Carcass characteristics are presented in Table 7.

Statistical analysis

Data were analyzed using the Mixed procedure of SAS (SAS Inst. Inc., Cary, NC). In

Exp. 1, the experiment unit for growth performance is the pen, whereas for other responses in

Exp. 2, the individual pig was the experimental unit. Initial BW block was considered a random effect. In Exp. 1, source of L-Lys and sex block were considered fixed effects. In addition, multiple contrasts were used to evaluate the effects of L-Lys sources. A multilinear regression analysis was used to evaluate the relative bioavailability of liquid L-Lys to crystalline L-Lys HCl by using ADG and F:G as measurements. In Exp. 2, source of L-Lys and sex were fixed effects. Statistical differences were considered significant with P < 0.05.

Probability that is less than 0.10 and equal or greater than 0.05 was considered as a tendency.

RESULTS

Growth Performance and Carcass Characteristics

In Exp. 1, increasing Lys from 75 to 96% of SID Lys requirement improved (P < 0.05)

ADG from 0.74 to 0.84 kg/d, 0.92 to 1.07 kg/d, 0.81 to 1.12 kg/d, and 0.83 to 1.00 kg/d during Phase 4, 5, 6 and entire period, respectively. In addition, it improved (P < 0.05) G:F from 0.432 to 0.477, 0.382 to 0.428, 0.335 to 0.388, and 0.384 to 0.430 during Phase 4, 5, 6 and entire period without affecting ADFI (Table 5). Forms of Lys (crystalline vs. liquid) did

not affect performance of pigs. This study demonstrates that the bioefficacy of liquid L-Lys was not difference from that of crystalline L-Lys HCl for performance of pigs from 30 to 90 kg BW.

In Exp. 2, sources of supplemental L-Lys either liquid and crystalline forms with supplementation of 6.75 mg/kg of ractopamine in fattening pig diets did not affect ADG,

ADFI, G:F (Table 6). In addition, carcass characteristics and back fat thickness of pig from

90 to 120 kg were not affected by sources of supplemental L-Lys. (Table 7).

DISCUSSION

It has been known that the growth and development of muscle in pigs essentially requires dietary supply of proteins, or its small subunits, which are AA. There are 20 AA that serve as building blocks for protein biosynthesis, but not all AA are EAA required from diets because pigs can de novo synthesize 10 of them. (Liao et al., 2015). In addition, the EAA are defined as those AA that are required to be supplied in diets exogenously because pigs cannot synthesize them at all or in sufficient amounts for their metabolic requirements (Wang et al.,

2014). Among these EAA, Lys is considered as the first limiting AA in swine diets because it is the most deficient AA in nearly all typical swine diets based on cereal grains (Lewis, 2001;

NRC, 2012). Practically, supplementation of crystalline L-Lys has become a common practice in the swine feed industry. L-Lys HCl is a major source of feed grade Lys supplemented in swine diets, and it is produced by bacteria fermentation of carbohydrates and other ingredients (Smiricly-Tjardes et al., 2004). During L-Lys production, the fermentation process is followed by cell separation and then biomass removal. The chloride ion is added to the Lys via ion exchange, followed by evaporation, and ammonia is released.

During the crystallization process, the hydrochloric salt is added to form L-lysine HCl. Then, it is sent to the drying process as the last step. (Schutte and Pack, 1994).

Liquid L-Lys is produced via the same bacteria fermentation process. However, after fermentation, crystallization by hydrochloric salt product is not required. Hence, liquid L-Lys contains 50 to 60% dry matter and 50% minimum L-Lys content respectively when compared with L-Lys HCl, which contains a minimum of 78.8% Lys content and 98.5% of dry matter, respectively.

In this study, experimental diets were formulated to contain similar content of SID Lys based on active ingredients in L-Lys products. Therefore, the effect of source did not influence Lys content in the diets.

Although all of supplemental AA are expected to be 100% utilized (Liu et al., 2007), differences in terms of production processes potentially affect its bioefficacy. Huyghebaert

(1993) stated that the bioefficacy of two nutrient sources should only be compared when the basal diet is clearly deficient in the nutrient of interest. Baker (1986) suggested that the basal diet should provide approximately 30 to 70% of target nutrient required by animals. Some studies supplied only 58% of the lysine requirement of 10 to 20 kg pigs based on NRC 1998

(Liu et al., 2007), or only 55% of the lysine requirement of 10 to 20 kg pigs based on NRC

1998 (Smiricly-Tjardes et al., 2004), whereas this study supplied 75% of SID lysine requirement in the basal diet for 30 to 90 kg pigs based on NRC 2012.

Several studies indicated that increasing Lys levels from Lys deficient basal diets improved ADG, feed efficiency, and nitrogen retention (Kirchgessner and Roth, 1996; Liu et al., 2007). However, when alternative sources of L-Lys are considered to replace L-Lys HCl,

the bioefficacy evaluation of alternative products should be tested because it will guarantee that accurate nutrient contents of those products are supplied correctly in the feed formulation.

The bioefficacy of supplemental L-Lys has been evaluated by comparisons with standard L-Lys HCl in different livestock species. In the present study, over the 9 wk experimental period, there were no significant differences in ADG, feed consumption, and feed efficiency for growing pigs when comparing L-Lys HCl and liquid L-Lys. These results are similar with previous studies in broilers. According to Emmert et al., (1999), the result indicated that supplemental Lys from liquid lysine product (LLP) is fully bioavailable when compared to crystalline L-Lys HCl, and could therefore be used as an alternative source of

Lys in practical poultry diets. Moreover, broiler diets supplemented with L-Lys sulfate did not show any differences on body weight gain, feed:gain, mortality, carcass weight, breast and thigh yield, and abdominal fat when compared with diets supplemented with L-Lys HCl

(Armad et al., 2007).

In swine research, this study had similar results with numerous studies which evaluated bioefficacy of Lys from L-Lys sulfate and L-Lys HCl. Several studies indicated that ADG, feed intake, and nitrogen retention were not affected by sources of L-Lys. Therefore, L-Lys sulfate can be used as alternative source of L-lysine HCl (van Heugten and Frederick, 2000;

Smiricly-Tjardes et al., 2004; Liu et al., 2007).

The primary objective of this experiment was to compare the growth response of liquid

L-Lys to crystalline L-Lys HCl to confirm that liquid L-Lys was equally utilized in growing pigs when compared to L-Lys HCl. The relative bioavailability of liquid L-Lys to L-Lys HCl

was calculated as 110 and 119% for the overall ADG and feed efficiency, respectively.

However, there were no statistically different between these two sources of supplemental L-

Lys. Therefore, it appears that liquid L-Lys was equally utilized as L-Lys HCl and not different in the functional role to support growth of growing pigs.

The overall results from this study indicate that the bioefficacy of supplemental Lys either from L-Lys HCl or liquid L-Lys were not significantly different. The results indicated that the relative biological values from different sources of L-lysine determined by comparing regression coefficients did not differ. In this study, ADG and feed efficiency were regressed on absolute lysine intake (Baker, 1986) to minimize variation in feed intake which could have potentially affected the bioefficacy results. Therefore, liquid L-Lys is considered to be used equally to L-Lys HCl when these two sources are available to growing-fattening pigs.

REFERENCES

Ahmad, G., T. Mushtaq, M. Aslam Mirza, and Z. Armed. 2007. Comparative bioefficacy of

lysine from L-lysine hydrochloride or L-lysine sulfate in basal diets containing graded

levels of canola meal for female broiler chickens. Poult. Sci. 86:525-530.

Baker, D. H. 1986. Problems and pitfalls in animal experiments designed to establish dietary

requirements for essential nutrients. J. Nutr. 116:2339-2349.

Emmert, J. L., M. W. Douglas, S. D. Boling, C. M. Parsons, and D. H. Baker. 1999.

Bioavailability of lysine from a liquid lysine source in chicks. Poult. Sci. 78:383-386.

FSIS. 2013. FSIS compliance guide for systematic approach to humane handling of

livestock. Humane methods of livestock slaughter.

http://www.fsis.usda.gov/wps/wcm/connect/da6cb63d-5818-4999-84f1-

72e6dabb9501/Comp-Guide-Systematic-Approach-Humane-Handling-

Livestock.pdf?MOD=AJPERES. (Accessed February 2015).

Huyghebaert, G. 1993. Comparison of DL-methionine and methionine hydroxyl analologue-

free acid in broilers by using multi-exponential regression models. Br. Poult. Sci.

34:351-359.

Jackson, M. 2001. A closer look at lysine sources: L-lysine sulfate plus fermentation co-

products. Feed Int. 22:18-20.

Kim, B. G., M. D. Lindermann, M. Rademacher, J. J. Brennan, and G. L. Cromwell. 2006.

Efficacy of DL-methionine hydroxyl analog free acids and DL-methionine as

methionine sources for pigs. J. Anim. Sci. 84:104-111.

Kirchgessner, M., and F. X. Roth. 1996. Comparison of Biolys 60 vs. L-lysine HCl in piglet

diets. Tech. Bull. No. 1. Degussa-Huls, Hanau, Germany.

Lewis, A. J. 2001. Amino acids in swine nutrition, In: Lewis, A. J., Southern L. L. (2nd eds)

Swine nutrition, CRC Press, Boca Raton, Florida, pp. 131-150.

Liao, S. F., T. Wang, and N. Regmi. 2015. Lysine nutrition in swine and the related

monogastric animals: muscle protein biosynthesis and beyond. SpringerPlus. 4:147.

Liu, M., S. Y. Qiao, X. Wang, J. M. You and X. S. Piao. 2007. Bioefficacy of lysine from L-

lysine sulfate and L-lysine HCl for 10 to 20 kg pigs. Asian-Aust. J. Anim. Sci. Vol. 20,

No. 10:1580-1586.

Mavromichalis, I., D. M. Webel, J. L. Emmert, R. L. Moser, and D. H. Baker. 1998. Limiting

order of amino acids in low-protein corn-soybean meal-whey-based diet for nursery

pigs. J. Anim. Sci. 76:2833-2837.

NRC. 1998. Nutrient Requirements of Swine. 10th rev. ed. Natl. Acad. Press, Washington,

DC.

NRC. 2012. Nutrient Requirements of Swine. 11th rev. ed. Natl. Acad. Press, Washington,

DC.

Ratliff, B. W., A. M. Gaines, P. Srichana, G. L. Allee, and J. L. Usry. 2005. Evaluation of

high synthetic amino acid inclusion and supplemental arginine in starter diets. J. Anim.

Sci. 83(Suppl. 2):69. (Abstr.)

Schutte, J. B., and M. Pack. 1994. Biological efficacy of L-lysine preparations containing

biomass compared to L-lysine HCl. Anim. Nutr. 46:261-268.

Stein, H. H., B. Seve, M. F. Fuller, P. J. Moughan, and C. F. M. de Lange. 2007. Invited

review: Amino acid bioavailability and digestibility in pig feed ingredients: terminology

and application. J. Anim. Sci. 85:172-180.

Smiricky-Tjardes, M. R., I. Mavromichalis, D. M. Albin, J. E. Wubben, M. Rademacher, and

V. M. Gabert. 2004. Bioefficacy of L-lysine sulfate compared with feed-grade L-lysine

HCl in young pigs. J. Anim. Sci. 82:2610-2614.

USDA. 1985. Official United States Standards for Grades of Pork Carcass. AMS, USDA,

Washington, D.C. van Heugten, E. and B. Frederick. 2000. The effect of Biolys 60 on performance of weanling

pigs. Department of Animal Science, North Carolina State University, Raleigh, North

Carolina, USA. Trial Report: 04.63.01001.

Wang, W., Z. Dai, Z. Wu, G. Lin, S. Jia, S. Hu, S. Dahanayaka, and G. Wu. 2014. Glycine is

a nutritionally essential amino acid for maximize growth of milk-fed young pigs. Amino

Acids. 46:2037-2045.

Table 1. Composition of experimental diets (Phase 4: 30 to 45 kg BW) for Exp. 1. Item CON C 1 L1 C2 L2 C3 L3 Ingredients,% Yellow corn 56.44 56.36 56.36 56.27 56.27 56.18 56.18 Dehulled soybean meal 19.78 19.78 19.78 19.78 19.78 19.78 19.78 DDGS1 20.00 20.00 20.00 20.00 20.00 20.00 20.00 Poultry fat 1.50 1.50 1.50 1.50 1.50 1.50 1.50 L-Lys HCl 0.00 0.08 0.00 0.17 0.00 0.26 0.00 L-Lys (Liquid) 0.00 0.00 0.13 0.00 0.27 0.00 0.41 L-Thr 0.02 0.02 0.02 0.02 0.02 0.02 0.02 Dicalcium phosphate 0.78 0.78 0.78 0.78 0.78 0.78 0.78 Limestone 1.05 1.05 1.05 1.05 1.05 1.05 1.05 Salt 0.20 0.20 0.20 0.20 0.20 0.20 0.20 Vitamin premix2 0.03 0.03 0.03 0.03 0.03 0.03 0.03 Mineral premix3 0.15 0.15 0.15 0.15 0.15 0.15 0.15 Tylan 40 0.05 0.05 0.05 0.05 0.05 0.05 0.05 Calculated composition ME, kcal/kg 3,373 3,374 3,374 3,375 3,375 3,376 3,376 CP, % 19.57 19.65 19.65 19.72 19.72 19.80 19.80 SID4 Lys 0.74 0.80 0.80 0.87 0.87 0.94 0.94 SID Met+Cys 0.56 0.56 0.56 0.56 0.56 0.56 0.56 SID Trp 0.17 0.17 0.17 0.17 0.17 0.17 0.17 SID Thr 0.59 0.59 0.59 0.59 0.59 0.59 0.59 Calcium, % 0.66 0.66 0.66 0.66 0.66 0.66 0.66 Available phosphorus, % 0.31 0.31 0.31 0.31 0.31 0.31 0.31 Analyzed composition: CP,% 17.78 19.56 18.43 19.16 21.38 18.73 22.05 Total Lys, % 0.842 0.865 0.853 1.182 1.175 1.775 1.783 Free Lys, % 0.019 0.078 0.070 0.164 0.163 0.214 0.218

Table 1 Continued

1DDGS: distiller’s dried grains with solubles 2The vitamin premix provided the following per kilogram of a complete diet: 6,613.8 IU of vitamin A; 992.0 IU of vitamin D3; 19.8 IU of vitamin E; 2.64 mg of vitamin K; 0.03 mg of vitamin B12; 4.63 mg of riboflavin; 18.52 mg of pantothenic acid; 24.96 mg of niacin; and 0.07 mg of biotin. 3The trace mineral premix provided the following per kilogram of a complete diet: 4.0 mg of Mn as manganese oxide; 165 mg of Fe as ferrous sulfate; 165 mg of Zn as zinc sulfate; 16.5 mg of Cu as copper sulfate; 0.30 mg of I as ethylenediamine dihydroiodide; and 0.30 mg of Se as sodium selenite. 4Standardized ileal digestible

Table 2. Composition of experimental diets (Phase 5: 45 to 75 kg BW) for Exp. 1. Item CON C 1 L1 C2 L2 C3 L3 Ingredients,% Yellow corn 60.68 60.60 60.60 60.53 60.53 60.45 60.45 Dehulled soybean meal 15.80 15.80 15.80 15.80 15.80 15.80 15.80 DDGS1 20.00 20.00 20.00 20.00 20.00 20.00 20.00 Poultry fat 1.50 1.50 1.50 1.50 1.50 1.50 1.50 L-Lys HCl 0.00 0.08 0.00 0.15 0.00 0.23 0.00 L-Lys (Liquid) 0.00 0.00 0.13 0.00 0.24 0.00 0.36 L-Thr 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Dicalcium phosphate 0.58 0.58 0.58 0.58 0.58 0.58 0.58 Limestone 1.01 1.01 1.01 1.01 1.01 1.01 1.01 Salt 0.20 0.20 0.20 0.20 0.20 0.20 0.20 Vitamin premix2 0.03 0.03 0.03 0.03 0.03 0.03 0.03 Mineral premix3 0.15 0.15 0.15 0.15 0.15 0.15 0.15 Tylan 40 0.05 0.05 0.05 0.05 0.05 0.05 0.05 Calculated composition ME, kcal/kg 3,385 3,386 3,386 3,387 3,387 3,388 3,388 CP, % 18.01 18.08 18.08 18.14 18.14 18.21 18.21 SID4 Lys 0.64 0.70 0.70 0.76 0.76 0.82 0.82 SID Met+Cys 0.53 0.53 0.53 0.53 0.53 0.53 0.53 SID Trp 0.15 0.15 0.15 0.15 0.15 0.15 0.15 SID Thr 0.52 0.52 0.52 0.52 0.52 0.52 0.52 Calcium, % 0.59 0.59 0.59 0.59 0.59 0.59 0.59 Available phosphorus, % 0.27 0.27 0.27 0.27 0.27 0.27 0.27 Analyzed composition CP,% 16.57 17.01 17.40 16.85 16.91 17.01 16.82 Total Lys, % 0.766 0.818 0.813 0.833 0.854 0.918 0.906 Free Lys, % 0.018 0.077 0.068 0.122 0.111 0.177 0.171

Table 2 Continued

1DDGS: distiller’s dried grains with solubles 2The vitamin premix provided the following per kilogram of a complete diet: 6,613.8 IU of vitamin A; 992.0 IU of vitamin D3; 19.8 IU of vitamin E; 2.64 mg of vitamin K; 0.03 mg of vitamin B12; 4.63 mg of riboflavin; 18.52 mg of pantothenic acid; 24.96 mg of niacin; and 0.07 mg of biotin. 3The trace mineral premix provided the following per kilogram of a complete diet: 4.0 mg of Mn as manganous oxide; 165 mg of Fe as ferrous sulfate; 165 mg of Zn as zinc sulfate; 16.5 mg of Cu as copper sulfate; 0.30 mg of I as ethylenediamine dihydroiodide; and 0.30 mg of Se as sodium selenite. 4Standardized ileal digestible

Table 3. Composition of experimental diets (Phase 6: 75 to 90 kg BW) for Exp. 1. Item CON C 1 L1 C2 L2 C3 L3 Ingredients,% Yellow corn 65.14 65.08 65.08 65.01 65.01 64.95 64.95 Dehulled soybean meal 12.05 12.05 12.05 12.05 12.05 12.05 12.05 DDGS1 20.00 20.00 20.00 20.00 20.00 20.00 20.00 Poultry fat 1.00 1.00 1.00 1.00 1.00 1.00 1.00 L-Lys HCl 0.00 0.06 0.00 0.13 0.00 0.19 0.00 L-Lys (Liquid) 0.00 0.00 0.09 0.00 0.20 0.00 0.30 L-Thr 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Dicalcium phosphate 0.43 0.43 0.43 0.43 0.43 0.43 0.43 Limestone 0.95 0.95 0.95 0.95 0.95 0.95 0.95 Salt 0.20 0.20 0.20 0.20 0.20 0.20 0.20 Vitamin premix2 0.03 0.03 0.03 0.03 0.03 0.03 0.03 Mineral premix3 0.15 0.15 0.15 0.15 0.15 0.15 0.15 Tylan 40 0.05 0.05 0.05 0.05 0.05 0.05 0.05 Calculated composition ME, kcal/kg 3,371 3,372 3,372 3,373 3,373 3,374 3,374 CP, % 16.59 16.65 16.65 16.70 16.70 16.76 16.76 SID4 Lys 0.55 0.60 0.60 0.65 0.65 0.70 0.70 SID Met+Cys 0.50 0.50 0.50 0.50 0.50 0.50 0.50 SID Trp 0.13 0.13 0.13 0.13 0.13 0.13 0.13 SID Thr 0.47 0.47 0.47 0.47 0.47 0.47 0.47 Calcium, % 0.52 0.52 0.52 0.52 0.52 0.52 0.52 Available phosphorus, % 0.24 0.24 0.24 0.24 0.24 0.24 0.24 Analyzed composition CP, % 15.96 15.65 15.58 15.50 15.51 15.55 15.21 Total Lys, % 0.652 0.686 0.679 0.727 0.706 0.740 0.733 Free Lys, % 0.023 0.061 0.060 0.110 0.101 0.125 0.120

Table 3 Continued

1DDGS: distiller’s dried grains with solubles 2The vitamin premix provided the following per kilogram of a complete diet: 6,613.8 IU of vitamin A; 992.0 IU of vitamin D3; 19.8 IU of vitamin E; 2.64 mg of vitamin K; 0.03 mg of vitamin B12; 4.63 mg of riboflavin; 18.52 mg of pantothenic acid; 24.96 mg of niacin; and 0.07 mg of biotin. 3The trace mineral premix provided the following per kilogram of a complete diet: 4.0 mg of Mn as manganous oxide; 165 mg of Fe as ferrous sulfate; 165 mg of Zn as zinc sulfate; 16.5 mg of Cu as copper sulfate; 0.30 mg of I as ethylenediamine dihydroiodide; and 0.30 mg of Se as sodium selenite. 4Standardized ileal digestible

Table 4. Composition of experimental diets (Phase 7: 90 to 120 kg BW) for Exp. 2. Item (%) Crystalline L-Lys Liquid L-Lys Yellow corn 60.83 60.83 Dehulled soybean meal 16.00 16.00 DDGS1 20.00 20.00 Poultry fat 1.00 1.00 L-Lys HCl 0.33 0.00 L-Lys (Liquid) 0.00 0.52 L-Thr 0.07 0.07 L-Trp 0.01 0.01 Dicalcium phosphate 0.38 0.38 Limestone 0.95 0.95 Salt 0.20 0.20 Vitamin premix2 0.03 0.03 Mineral premix3 0.15 0.15 Tylan 40 0.05 0.05 Paylean 95 (6.75 ppm) 0.0338 0.0338 Calculated composition ME, kcal/kg 3,373 3,373 CP, % 18.49 18.49 SID4 Lys 0.90 0.90 SID Met+Cys 0.53 0.53 SID Trp 0.16 0.16 SID Thr 0.59 0.59 Calcium, % 0.52 0.52 Available phosphorus, % 0.24 0.24 Analyzed composition CP, % 17.14 17.23 Total Lys, % 1.017 1.025 Free Lys, % 0.242 0.245

Table 4 Continued

1DDGS: distiller’s dried grains with solubles 2The vitamin premix provided the following per kilogram of a complete diet: 6,613.8 IU of vitamin A; 992.0 IU of vitamin D3; 19.8 IU of vitamin E; 2.64 mg of vitamin K; 0.03 mg of vitamin B12; 4.63 mg of riboflavin; 18.52 mg of pantothenic acid; 24.96 mg of niacin; and 0.07 mg of biotin. 3The trace mineral premix provided the following per kilogram of a complete diet: 4.0 mg of Mn as manganous oxide; 165 mg of Fe as ferrous sulfate; 165 mg of Zn as zinc sulfate; 16.5 mg of Cu as copper sulfate; 0.30 mg of I as ethylenediamine dihydroiodide; and 0.30 mg of Se as sodium selenite. 4Standardized ileal digestible 5Ractopamine Hydrochloride (Eli Lilly and Company, U.S.A)

Table 5. Growth performance of pigs fed diets for Exp. 1. Item Basal1 Crystalline L-Lys Liquid L-Lys SEM P value Basal Basal Crystalline 75% 82% 89% 96% 82% 89% 96% vs vs vs Crystalline Liquid Liquid Body weight (kg) Int. 29.33 29.53 29.45 29.58 29.57 29.50 29.65 2.272 0.612 0.521 0.848 BW Phase 4

(wk 10-13) BW 44.79 45.97 46.08 47.02 45.76 46.63 47.39 2.605 < 0.05 < 0.05 0.659 ADG2 0.736 0.783 0.792 0.830 0.771 0.816 0.845 0.031 < 0.05 < 0.05 0.658 ADFI3 1.705 1.697 1.705 1.764 1.726 1.754 1.753 0.083 0.722 0.419 0.522 G:F4 0.432 0.461 0.465 0.471 0.446 0.465 0.482 0.013 < 0.05 < 0.05 0.994 Phase 5

(wk 14-17) BW 70.48 72.02 74.11 77.51 73.59 76.42 76.82 3.744 < 0.05 < 0.05 0.299 ADG 0.918 0.930 1.001 1.089 0.994 1.064 1.051 0.053 0.061 < 0.05 0.377 ADFI 2.404 2.291 2.436 2.542 2.352 2.533 2.456 0.123 0.855 0.679 0.745 G:F 0.382 0.406 0.411 0.428 0.423 0.420 0.428 0.006 < 0.05 < 0.05 0.119 Phase 6

(wk 18-19) Bw 81.00 84.03 87.39 91.83 85.70 89.21 91.68 4.540 < 0.05 < 0.05 0.456 ADG 0.809 0.924 1.002 1.101 0.931 0.983 1.143 0.075 < 0.05 < 0.05 0.940 ADFI 2.417 2.474 2.659 2.939 2.541 2.711 2.856 0.197 0.088 0.076 0.919

Table 5 Continued

Item Basal1 Crystalline L-Lys Liquid L-Lys SEM P value Basal Basal Crystalline 75% 82% 89% 96% 82% 89% 96% vs vs vs Crystalline Liquid Liquid G:F 0.335 0.373 0.384 0.375 0.366 0.363 0.400 0.007 < 0.05 < 0.05 0.736 Overall

(wk 10-19) ADG 0.833 0.879 0.935 1.004 0.905 0.963 1.001 0.043 < 0.05 < 0.05 0.496 ADFI 2.170 2.128 2.235 2.362 2.180 2.306 2.302 0.113 0.364 0.243 0.709 G:F 0.384 0.413 0.418 0.425 0.415 0.418 0.435 0.005 < 0.05 < 0.05 0.274

1Basal diet contains 75% requirement of SID Lys. 2ADG : Average Daily Gain (kg/d). 3ADFI : Average Daily Feed Intake (kg/d). 4G:F : Gain:Feed.

Table 6. Growth performance of pigs fed diets1 for Exp. 2. Item Treatments2 SEM P value Crystalline L-Lys Liquid L-Lys Phase 7

(Wk 20-22) Initial BW, kg 89.61 90.44 3.172 0.763 Final BW, kg 118.29 117.86 3.985 0.916 ADG, kg 1.434 1.371 0.048 0.363 ADFI, kg 3.331 3.089 0.127 0.196 G:F, kg/day 0.431 0.444 0.007 0.249

1Diets contain 6.75 ppm of ractopamine hydrochloride (Paylean 9, ELANCO) 2Treatments contain equal SID Lys at 0.9%.

Table 7. Carcass characteristics of pigs for Exp. 21. Item Treatment SEM P value Crystalline L-Lys Liquid L-Lys HCW2, kg 84.97 83.90 0.470 0.129 Dressing % 73.87 72.95 0.405 0.130 CCW3, kg 83.16 82.29 0.454 0.204 CCP4, %2 72.29 71.55 0.393 0.209 CL5, %2 1.58 1.40 0.095 0.190 Back fat thickness, mm 10th rib 22.46 24.18 1.108 0.294 Last rib 24.89 24.54 1.456 0.871

1Body weight was used as a covariate. 2HCW : Hot carcass weight. 3CCW : Cold carcass weight. 4CCP : Cold carcass percentage. 5CL : Chilling loss.

y = 0.7406 + (0.0235x + 0.0197x ) 0.86 1 2 R2 = 0.969, P < 0.01 0.84 Relative bioavailability (%) RBV = 0.0235/0.0197 0.82 RBV = 119%, P = 0.136 0.80

0.78

ADG, ADG, kg/d Crystalline L-Lys Liquid L-Lys 0.76 Linear (Crystalline L-Lys) 0.74 Linear (Liquid L-Lys)

0.72 0.00 1.00 2.00 3.00 4.00 5.00 6.00 Supplemental Lys intake, g/d

Figure 1. Daily gain of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 45 kg BW

y = 0.436 + (0.0098x + 0.0089x ) 0.49 1 2 R2 = 0.889, P < 0.01

0.48 Relative bioavailability (%) RBV = 0.0098/0.0089 0.47 RBV = 110%, P = 0.636

0.46 G:F Crystalline L-Lys 0.45 Liquid L-Lys Linear (Crystalline L-Lys) 0.44 Linear (Liquid L-Lys)

0.43 0.00 1.00 2.00 3.00 4.00 5.00 6.00 Supplemental Lys intake, g/d

Figure 2. Gain:feed ratio of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 45 kg BW

y = 0.8417 + (0.0266x + 0.0234x ) 1.00 1 2 R2 = 0.936, P < 0.01 0.98 Relative bioavailability (%) 0.96 RBV = 0.0266/0.0234 0.94 RBV = 114%, P = 0.416

0.92

0.90

ADG, ADG, kg/d Crystalline L-Lys 0.88 Liquid L-Lys 0.86 Linear (Crystalline L-Lys) Linear (Liquid L-Lys) 0.84

0.82 0.00 1.00 2.00 3.00 4.00 5.00 6.00 Supplemental Lys intake, g/d

Figure 3. Daily gain of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 75 kg BW

y = 0.406 + (0.0085x + 0.0073x ) 0.46 1 2 R2 = 0.868, P < 0.01 Relative bioavailability (%) 0.45 RBV = 0.0085/0.0073

0.44 RBV = 116%, P = 0.500

0.43 G:F

Crystalline L-Lys 0.42 Liquid L-Lys Linear (Crystalline L-Lys) 0.41 Linear (Liquid L-Lys)

0.40 0.00 1.00 2.00 3.00 4.00 5.00 6.00 Supplemental Lys intake, g/d

Figure 4. Gain:feed ratio of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 75 kg BW

y = 0.8371 + (0.0335x + 0.0304x ) 1.05 1 2 R2 = 0.984, P < 0.01 Relative bioavailability (%) 1.00 RBV = 0.0335/0.0304 RBV = 110%, P = 0.225 0.95

ADG, ADG, kg/d 0.90 Cyrstalline L-Lys Liquid L-Lys Linear (Cyrstalline L-Lys) 0.85 Linear (Liquid L-Lys)

0.80 0.00 1.00 2.00 3.00 4.00 5.00 6.00 Supplemental Lys intake, g/d

Figure 5. Daily gain of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 90 kg BW

100

y = 0.391 + (0.0086x + 0.0072x ) 0.46 1 2 R2 = 0.847, P < 0.01 Relative bioavailability (%) 0.44 RBV = 0.0086/0.0072 RBV = 119%, P = 0.481

0.42 G:F 0.40 Crystalline L-Lys Liquid L-Lys

0.38 Linear (Crystalline L-Lys) Linear (Liquid L-Lys)

0.36 0.00 1.00 2.00 3.00 4.00 5.00 6.00 Supplemental Lys intake, g/d

Figure 6. Gain:feed ratio of pigs with increasing intake levels of either supplemental liquid L-Lys or crystalline L-Lys HCl from 30 to 90 kg BW

101

CHAPTER 4

FUNCTIONAL DIFFERENCE OF LIQUID L-LYSINE AND L-LYSINE HCl ON

GROWTH PERFORMANCE, INTESTINAL HEALTH, AND INTESTINAL INTEGRITY

IN NEWLY WEANED PIGS

102

Abstract: This study was conducted to evaluate functional differences of liquid L-Lys and crystalline L-Lys HCl on the growth performances, intestinal health, and intestinal integrity in newly weaned pigs. Twenty four newly weaned pigs at 21 d of age (5.9 ± 0.1 kg BW), were randomly allotted to 2 treatments with 12 pens (1 pigs per pen, 6 barrow and 6 gilt pens) per treatment, and fed experimental diets for 3 wk based on 2 phases (phase 1 for 10 d; and phase 2 for 11 d). Two treatments were, (1) a diet supplemented with crystalline L-Lys

HCl (0.45%, Daesang Corp., Seoul, Korea) or (2) a diet supplemented with liquid L-Lys

(0.71%, Daesang Corp., Seoul, Korea). These 2 diets were formulated to have equal SID Lys content and nutrients meeting the NRC requirements (2012). Body weight and feed disappearance were measured on d 7, 10, and 21 to calculate ADG, ADFI, and G:F ratio.

Blood samples were taken on d 20 to obtain plasma. At the end of wk 3, all pigs were euthanized to obtain gut tissues and mucosal tissues from duodenum and jejunum. Plasma and mucosal tissues were used to measure tumor necrosis factor alpha (TNF-α), protein carbonyls, malondialdehyde (MDA), 8-OHdG, and total antioxidant capacity (TAC). Gut tissues were fixed for histological evaluation of gut morphology, for immunohistochemistry of Ki-67 protein to measure enterocyte proliferation, and for Western blot to quantify tight junction proteins (ZO-1, claudin-1, and occludin). Data were analyzed using PROC MIXED procedure in SAS with pen as the experimental unit and P values < 0.05 considered significant and < 0.10 considered tendency. Overall, source of Lys (free L-Lys vs. crystalline

L-Lys HCl) did not affect ADG (0.319 and 0.319 kg/d), ADFI (0.384 and 0.397 kg/d), and

G:F (0.828 and 0.804) of pigs. Pigs fed diet supplemented with liquid L-Lys had lower (P <

0.05) concentrations of jejunal TNF-α (1.05 to 0.81 pg/mg protein), and plasma TNF-α (130

103

to 110 pg/mg protein) without affecting concentrations of protein carbonyl, malondialdehyde, and TAC. Pigs fed diet supplemented with liquid L-Lys had greater (P < 0.05) villus height

(346 to 386 µm) and villus height:crypt depth ratio (1.21 to 1.37 μm) in the jejunum, and lower (P < 0.05) proliferation rate (25.5 to 22.8 %) in the jejunum. Concentrations of ZO-1 in duodenum and claudin in jejunum were increased (P < 0.05) respectively, in pigs fed diet supplemented with liquid L-Lys. Collectively, this study indicates that liquid L-Lys supplementation improves intestinal health potentially by decreasing systemic inflammatory status and improving jejunal morphology compared with the use of L-Lys HCl in newly weaned pigs.

Key words: growth performance, intestinal health, lysine, newly weaned pigs

104

INTRODUCTION

Early weaned piglets experience physiological, environmental, and social challenges when they are weaned from their sows. During weaning period, pigs face a number of stressors including sudden separation from their sows, transportation and handling stress, environmental stress, consumption of different food sources, social hierarchy stress, increased exposure to pathogens, and dietary or environmental antigens (Campbell et al.,

2013; Lalles et al., 2007). There are several techniques used by pig producers to minimize these stressors of newly weaned piglets by both farm management and dietary practices.

Generally, there are several dietary management strategies to minimize stressors of weaned piglets such as feeding management to optimize the intake of required nutrients and balance of these nutrients in diets (Forbes, 1999). Improving feed palatability could be achieved by reducing the activity of anti-nutritional factors (van Heugten, 2001) or selecting innovative highly digestible protein sources such as spray dried animal plasma (Coffey and

Cromwell, 1995; Thacker, 1999; Torrallardona, 2010). In addition, using low CP diets with supplemental AA has been widely used to improve feed digestibility of piglets and minimize diarrhea during the post-weaning period because newly weaned pigs usually secrete less hydrochloric acid and enzymes than older pigs and also their ability to digest protein is impaired. Consequently, undigested protein provides substrates for pathogenic bacteria in the hindgut. Thus, feeding a low CP diets potentially reduces protein fermentation in the distal gastrointestinal tract which intestinal health of pigs could be improved (Heo et al., 2009;

Stein et al., 2006).

105

Moreover, improving feed efficiency of pigs by using dietary AA supplementation is becoming increasingly important because this practice can not only secure the plasma AA supply for muscle growth but also protect the environment from nitrogen excretion (Liao et al., 2015). Lysine is the first limiting AA in swine diets, and is EAA used in the process for synthesizing body proteins, peptides, and non-peptide molecules. From a regulatory standpoint, Lys is at the top level in controlling other AA metabolism, and it can also affect the metabolism of other nutrients (Kerr el al., 1995; Liao et al., 2015). The principal AA limiting the performance of early weaned pigs is Lys. Numerous studies have indicated that pigs will respond with higher growth rates and improved feed efficiency as Lys levels are increased (Owen et al., 1995c). Crude protein can be reduced when crystalline L-Lys is supplemented in swine diets, and the usage of some protein supplement ingredients such as soybean meal and other soy products can be reduced. Li et al. (1991) indicated that pigs fed diets containing soybean meal in starter diets had lower villus height but high serum anti soy

IgG titers compared with other processed soy products or dairy products. Therefore, the use of a high level of supplemental L-Lys with a lower level of soybean meal used in the newly weaned pig diets not only provides available free form of Lys to be utilized for functional protein activities and protein synthesis but also improves gut health due to less antigenic proteins for newly weaned pigs.

There are different forms of supplemental L-lysine have been widely used in feed industry such as crystalline L-Lys HCl which is the major source of supplemental L-Lys

(Jackson, 2001). In addition, alternative sources of feed grade supplemental L-Lys have been developed by amino acid producers such as L-Lys sulfate, concentrated liquid L-Lys HCl,

106

and liquid L-Lys. As with other dietary AA, the small intestinal absorption of unbound dietary L-Lys is generally more rapid than the absorption of protein-bound Lys. Moreover, the rates of absorption of protein-bound AA have been shown to vary and may be influenced by the dietary protein sources. In pig studies, the absorption of dietary Lys is expected to complete by the end of the ileum, and the concentration of plasma Lys reaches its peak 1 to 2 hours after feeding (Leibholz et al., 1986). Different forms of supplemental L-Lys could have different rates and sites of absorption in the gut. There are several studies that determined the relative bioavailability of alternative sources of L-Lys. Nevertheless, comparison of liquid L-Lys which contains unbound Lys to standard crystalline L-Lys which is bound to hydrochloric salt has never been studied. Liquid L-Lys as possibly be absorbed effectively in duodenum whereas L-Lys in crystalline form is rather absorbed in jejunum, due to its dissociation to free Lys could be partially done in duodenum. Therefore, it will affect health and integrity of duodenal and jejunal enterocytes by enhancing the gut use of supplemental AA. Thus, this study was conducted to compare the functional differences of liquid L-Lys and crystalline L-Lys HCl on the growth performance, intestinal health, and intestinal integrity in newly weaned pigs.

MATERIALS AND METHODS

The experimental protocol was approved by North Carolina State University Animal

Care and Use Committee (Raleigh, NC).

Animal and experimental design

The experiment was conducted at the Metabolism Educational Unit at North Carolina

State University (Raleigh, NC). Twenty four newly weaned pigs at 21 d of age (5.9 ± 0.1 kg

107

BW), were randomly allotted to 2 treatments with 12 pens (1 pigs per pen, 6 barrow and 6 gilt pens) per treatment, and fed experimental diets for 3 wk based on 2 phases (phase 1 for

10 d; and phase 2 for 11 d). Two treatments were, (1) a diet supplemented with crystalline L-

Lys HCl (0.45%, Daesang Corp., Seoul, Korea) or (2) a diet supplemented with liquid L-Lys

(0.71%, Daesang Corp., Seoul, Korea). The diet composition was summarized in Table 1.

These 2 diets were formulated to have equal SID Lys content and nutrients meeting the NRC requirements (2012). Pens (1.50 × 0.74 m) with slatted floor were equipped with 1 nipple drinker and 1 self-feeder. Pigs had free access to water and feed. Body weight and feed disappearance were measured on d 7, 10, and 21 to calculate ADG, ADFI, and Feed efficiency was calculated as G:F ratio.

Sample collection and preparation

On d 20, blood samples of all pigs were collected from jugular vein with BD sterile vacutainer (BD, Franklin Lakes, NJ) for plasma. Blood samples were centrifuged at 14,000 × g for 10 min at 4°C. Plasma samples were stored in -80°C until analysis. Plasma samples were used to measure tumor necrosis factor-alpha (TNF-α), malondialdehyde (MDA), protein carbonyl, 8-hydroxydeoxyguanosine (8-OHdG), and total antioxidant capacity (TAC)

On d 21, all pigs were euthanized to collect mucosal tissue samples from duodenum and jejunum for determining concentrations of TNF-α, MDA, protein carbonyl, and TAC. Tissue samples from duodenum and jejunum were collected for western blot of tight junction proteins. These samples were stored in -80°C. Tissue samples from duodenum and jejunum were stored in 10% formalin buffer at room temperature for morphology and Ki-67.

Immune parameters

108

Mucosal samples (500 mg) of duodenum and jejunum were weighed, and suspended into

1.0 mL PBS solution (MP Biomedicals, LLC. Solon, OH). Samples were homogenized on ice. The homogenate was centrifuged at 14,000 × g for 10 minute at 4°C. The supernatant was divided into five aliquot tubes to determine concentrations of total protein, TNF-α,

MDA, protein carbonyl, 8-OHdG, and TAC. Total protein of plasma and mucosal tissue samples were analyzed with Pierce BCA Protein Assay Kit (23225#, Thermo Fisher

Scientific Inc. Rockford, IL).

As a mediator of inflammatory responses, TNF-α level in plasma and mucosa samples was measured by Porcine Immunoassay ELISA Kit (PTA00; R&D System Inc. Minneapolis,

MN) as described by Weaver et al. (2014). The detection limit range for TNF-α ELISA was

2.8 to 5.0 pg/mL. Concentrations of TNF-α in mucosa and plasma samples were expressed as pg/mg protein and pg/mL, respectively.

As an oxidative stress indicator (lipid peroxidation), samples were analyzed for MDA by using thiobarbituric acid reactive substance Assay Kit (STA-330, Cell Biolabs, San Diego,

CA) following the instruction of Weaver et al. (2014). The detection range for this ELISA was 5 to 130 μM. Concentrations of MDA in mucosa and plasma samples were expressed as

μmol/g protein and μM, respectively.

Protein carbonyl content was measured using the ELISA kit (STA-310, Cell Biolabs,

San Diego, CA) following the instruction of Shen et al. (2015), as another biomarker of oxidative stress (protein oxidation). Concentrations of protein carbonyl in mucosa and plasma were expressed as umol/g protein.

109

Oxidative damage to biomolecules caused by free radicals was measured by 8- hydroxydeoxyguanosine (8-OHdG), 8-OHdG content was measured using the ELISA kit

(STA-320, Cell Biolabs, San Diego, CA) following the instruction of Weaver et al. (2014).

Concentrations of 8-OHdG in plasma was expressed as ng/mL.

Indirect biomarker of oxidative stress condition was measured by total antioxidant capacity (TAC). Antioxidants commonly neutralize radicals was analyzed by single electron transfer (SET) mechanism. In this study, TAC was measured using the ELISA kit (STA-360,

Cell Biolabs, San Diego, CA) following the instruction of Shen et al. (2015). Concentrations of protein carbonyl in mucosa and plasma were expressed as umol copper reducing equivalents (umol CRE).

Morphology and Immunohistochemistry for Ki-67

The segments of duodenum and middle part of jejunum were embedded in parafﬁn, cut cross the section to a 5-m thick slides, and mounted on a polylysine-coated slide. Then slides were stained (hematoxylin and eosin) and examined under an Infinity 2-2 digital CCD camera attached to an Olympus CX31 microscope (Lumenera Corporation, Ottawa, Canada).

Villus height (from the tip of the villi to the villous-crypt junction), villus width (width of the villus at one-half of the villus height), and crypt depth (from this junction to the base of the crypt) were determined. Ratio of villus height to crypt depth was also calculated. Lengths of

10 well-oriented intact villi and their associated crypt were measured in each slide. The same person executed all the analysis of intestinal morphology.

The segment of duodenum and middle part jejunum was fixed in the 10% formalin buffer for 3 wks, transferred into 70% ethanol solution and immediately sent to North

110

Carolina State University Histology Lab (Raleigh, NC) for Ki-67 labeling. The intact crypt was cropped and Image JS software was used for calculating the ratio of Ki-67 positive cells to total cells in jejunal crypt (Almeida et al., 2012).

Ki-67 positive cells Crypt cell proliferation, % = × 100% Total cells

Tight junction proteins

Six samples of duodenum and jejunum tissue in each treatment were used to measure tight junction protein as described by Yang et al. (2015). Tissue samples (100 mg) of duodenum and jejunum were weighed and suspended into 0.5 mL RIPA lysis and extraction buffer containing 5 µL protease inhibitor cocktail. Tissue samples were homogenized

(Tissuemiser; Thermo Fisher Scientific Inc., Rockford, IL) on ice. The homogenate was centrifuged at 10,000 × g at 4oC for 10 min to collect supernatant. Protein concentration of the supernatant was adjusted to 8 µg/µL by using a BCA protein assay as mentioned above.

The adjusted supernatant was denatured at 100oC for 5 min in the water bath, and was loaded in each well for SDS-PAGE. After SDS-PAGE, the gel was moved on polyvinylidene difluoride (PVDF) membrane for transferring a target protein to membrane. Protein was electrophoretically transferred at 90 mV for 1 hour. These was then blocked in 5% skim milk, and incubated (overnight at 4oC) with primary antibodies against claudin, occludin, zonula occludens (ZO-1), and β-actin which was used as housekeeping gene. The membrane was subsequently washed and incubated (1 h at room temperature) with horseradish- conjugated secondary antibodies. The immunoblot was developed with the DAB substrate kit

111

(34002; Pierce, Rockford, IL). Density of bands was identified by using image analyzer software (LI-COR Biosciences, Lincoln, NE).

Statistical Analysis

Data were analyzed using the Mixed procedure of SAS (SAS Inst. Inc., Cary, NC). This statistical analysis based on a randomized complete block design, and the experimental unit was considered as individual pig. Initial BW was a random effect. Source of L-Lys and sex were considered as fixed effects. Statistical differences were considered significant with P <

0.05. Probability that is less than 0.10 and equal to or greater than 0.05 was considered as a tendency.

RESULTS

Growth Performance

During Phase 1 (d 0 to 10), Phase 2 (d 11 to 21), and the entire period (d 0 to 21), ADG,

ADFI and feed efficiency were not affected by diets supplemented with difference sources of supplemental L-lysine. (Table 2).

Immune Parameter

Pig fed diets supplemented with liquid L-Lys had lower concentrations of TNF-α level in jejunum and plasma compared with pigs fed a diets supplemented with crystalline L-Lys

HCl. However, MDA, Protein carbonyl, and TAC concentrations in mucosal samples or plasma were not affected by different sources of supplemental L-Lys. In addition, 8-OHdG concentrations in plasma were not affected by different sources of L-Lys. (Table 3).

Morphology and Immunohistochemistry for Ki-67

112

Pig fed diets supplemented with liquid L-Lys increased (P < 0.05) villus height, villus width, and VH/CD ratio in jejunum. In the other hand, pig fed diets supplemented with liquid

L-Lys decreased (P < 0.05) proliferation rate in the jejunal crypt, when compared with pigs fed diets with crystalline L-Lys HCl (Table 4).

Tight junction proteins

The results from immunoblot analysis of tight junction proteins indicated that pig fed diets supplemented with liquid L-Lys increased (P < 0.05) concentration of ZO-1 in duodenum (Figure 1) and increased (P < 0.05) concentration of claudin in jejunum, when compared with pigs fed diets with crystalline L-Lys HCl (Figure 2).

DISCUSSION

In this study, overall growth performance was not affected by diets supplemented with different sources of L-Lys. These results are similar to results from another study in a different species. Emmert et al. (1999) reported that growth performance of broiler fed diets with supplemental liquid L-Lys did not differ when compared with diets supplemented with

L-Lys HCl. In addition, other studies suggested that forms of supplemental L-Lys did not affect growth performance and nitrogen retention in newly weaned pigs. Moreover, alternative source of L-Lys such as L-Lys sulfate had equal relative bioavailability when compared to standard crystalline L-Lys HCl. (Smiricky-Tjardes et al., 2004; Liu et al., 2007;

Ju et al., 2008).

For the intestinal protein synthesis, dietary AA utilization by the gut has direct effects on their systemic availability and possibly limits animal growth. The portal-drained viscera

(PDV) contributes between 20 to 35% of whole-body energy expenditure and protein

113

synthesis, even though they contribute less than 6% of body weight (van Goudoever et al.,

2000). Dietary AA utilized by the intestine could have a potential effect on their systemic availability and consequently affect whole body protein deposition. Numerous studies in mammalian species indicated that dietary EAA are directly used by the intestine for protein synthesis and other biosynthetic pathways (Stoll et al., 1998; van Goudoever et al., 2000).

Although, Lys is less catabolized which is indicated by isolated enterocytes of the small intestine (Chen et al., 2009). However, in some highly digestible protein sources such as milk protein fed piglets, 35% of dietary Lys was utilized by first pass metabolism. (Stoll et al.,

1998). In addition, only 18% of what is used in the first pass metabolism is reutilized in intestinal mucosal protein (Blachier et al., 2013). It was demonstrated that dietary Lys utilized by the PDV is driven by luminal bioavailability of dietary Lys, and this Lys utilization is immediately stimulated after meal ingestion (Bos et al., 2003). Therefore, several factors such as CP content in diets and also forms of supplemental L-Lys which are different in terms of absorption rate, could potentially show differences of dietary Lys utilization and intestinal mucosal protein synthesis.

In this study, pigs fed diets with supplemental liquid L-Lys showed a reduction in proliferation in jejunal crypts and lower concentrations of TNF-α in jejunum compared with pigs fed diets with supplemental crystalline L-Lys HCl. In newly weaned pigs, villi atrophy and crypts commonly undergo hyperplasia due to several stressors. When the villi are destroyed, the cells associated with the crypts attempt to rebuild the villi. This is appropriate because the cells residing on the periphery of the villi originate from the crypts (Kitt et al.,

2001). Nevertheless, healthy weaned pigs or germ-free pigs usually have a lower

114

proliferation rate, whereas, infected pigs have large numbers of Ki-67 positive cells and high proliferation of intestinal crypts due to efforts to improve the intestinal epithelium cells (Jung et al., 2015).

When pigs are weaned from the sow, they experience significant physiological, environmental, and social challenges. These challenges predispose the pigs to subsequent infectious diseases and other production losses (Campbell et al., 2013). A Number of stressors, such as, separation from the sow, transportation and handling stress, different forms of food and feedstuffs, social hierarchy stress, mixture of pigs from other litters, a different physical environment from lactating pens, increased exposure to pathogens, and dietary or environmental antigens caused lower post weaning feed consumption. Consequently, the lower feed intake immediately after weaning is responsible for villus atrophy and growth rate in newly weaned pigs (Dong and Pluske, 2007). Therefore, several techniques such as farm and nutritional managements are applied to overcome these problems. Using low CP diets with supplemental AA has been suggested to improve nutrient digestibility in piglets and minimize diarrhea during the post-weaning period which directly benefits gut health.

Furthermore, protein synthesis and utilization of other AA were affected by availability of dietary Lys.

The results from this study indicated that pigs fed diets with supplemented liquid L-Lys had greater villus height, villus width, and VH/CD ratio in jejunum compared to pigs fed diets with supplemented L-Lys HCl. However, villus morphology in duodenum was not affected by sources of L-Lys. The reasons that liquid L-Lys supplementation potentially improved jejunal morphology could be due to greater Lys utilization in jejunum and a

115

decrease in systemic inflammatory status compared with the use of L-Lys HCl in newly weaned pigs. In the protein regulations in the gut, the tight junction proteins are the belt like structural proteins which are located at the space between the apical and the basolateral membrane in epithelial and endothelial cell of enterocytes. These complex proteins regulate the permeability of ions, molecules, and different kinds of cells through the paracellular pathway (Gonzales-Mariscal et al., 2003). TNF-α causes some changes in modulation of intestinal tight junction permeability through myosin light chain kinase (MLCK)-mediated pathway (Shen, 2012). In addition, several studies indicated that TNF-α disrupted tight junction protein assembly and its permeability (Ma et al., 2004; Porilz et al., 2004).

Therefore, tight junction proteins including occludin-1 and claudin-1, and other scaffolding proteins like ZO-1 could be regulated by TNF-α levels. In this study, supplementation of liquid L-Lys decreased the levels of TNF-α level in mucosal tissue and plasma samples.

Hence, it could help to increase the concentrations of tight junction proteins, such as ZO-1 in duodenum, and claudin in jejunum which it affects the gut integrity of pigs.

Collectively, sources of supplemental L-Lys in pig diets did not affect the overall performance during the 21 d. However, liquid L-Lys supplementation improves intestinal health potentially by decreasing systemic inflammatory status and improving jejunal morphology compared with the use of L-Lys HCl in newly weaned pigs.

116

REFERENCES

Almeida, J. S., E. E. Iriabho, V. L. Gorrepati, S. R. Wilkinson, A. Grüneberg, D. E. Robbins,

and J. R. Hackney. 2012. ImageJS: personalized, participated, pervasive, and

reproducible image bioinformatics in the web browser. J. Pathol. Inform. 3:25.

Blachier, F., G. Wu, Y. Yin, Y. Hou, and M. Andriamihaja. 2013. Developmental amino acid

metabolism in the pig small and large intestine epithelial cells, In: Blachier, F., Wu, G.,

Yin, Y. (eds) Nutritional and Physiological functions of amino acids in pigs, Springer-

Verlag, Wien Heidelberg, New York, Dordrecht, London, pp. 59-74.

Bos, C., B. Stoll, H. Fouillet, C. Gaudichon, X. Guan, M. A. Grusak, P. J. Reeds, D. Tome,

and D. G. Burrin. 2003. Intestinal lysine metabolism is driven by the enteral availability

of dietary lysine in piglets fed a bolus meal. Am. J. Physiol. Metab. 285(6):E1246-

E1257.

Campbell, J. M., J. D. Crenshaw, and J. Polo. 2013. The biological stress of early weaned

piglets. J. Anim. Sci. Biotechnol. 4:19.

Chen, L., P. Li, J. Wang, X. Li, H. Gao, Y. Yin, Y, Hou, and G. Wu. 2009. Catabolism of

nutritionally essential amino acids in developing porcine enterocytes. Amino Acids.

37(1):143-152.

Coffey, M. T. and G. L. Cromwell. 1995. The impact of environment and antimicrobial

agents on the growth response of early-weaned pigs to spray dried porcine plasma. J.

Anim. Sci. 73:2532-2539.

Dong, G. Z., and J. R. Pluske. 2007. The low feed intake in newly-weaned pigs: Problems

and possible solutions. Asian-Aust. J. Anim. Sci. Vol. 20, No. 3:440-452.

117

Emmert, J. L., M. W. Douglas, S. D. Boling, C. M. Parsons, and D. H. Baker. 1999.

Bioavailability of lysine from a liquid lysine source in chicks. Poult. Sci. 78:383-386.

Emmert, J. L. and H. R. Pope. 2000. Comparing Biolys 60 vs. L-lysine HCl in broiler

chickens up to 49 days of age. University of Akansas, USA. Trial Report: 04.53.98003.

Forbes, J. M. 1999. Natural feeding behavior and feed selection. In Regulation of Food

Intake (Ed. D. van der Heide, E. A. Huisman, E. Kanis, J. W. M. Osse and M. W. A.

Verstegen). CAB Internaitonal, Wallingford, pp. 3-12.

Gonzalez-Mariscal, L., A. Betanzos, P. Nava, and B. E. Jaramillo. 2003. Tight junction

proteins. Prog. Biophys. Mol. Biol. 81(1):1-44.

Heo, J. M., J. C. Kim, C. F. Hansen, B. P. Mullan, D. J. Hampson, and J. R. Pluske. 2009.

Feeding a diet with decreased protein content reduces indices of protein fermentation

and the incidence of post-weaning diarrhea in weaned pigs challenged with an

enterotoxigenic strain of Escherichia coli. J. Anim. Sci. 87:2833-2843.

Jackson, M. 2001. A closer look at lysine sources: L-lysine sulfate plus fermentation co-

products. Feed Int. 22:18-20.

Ju, W. S., M. S. Yun, Y. D. Jang, H. B. Choi, J. S. Chang, H. cB. Lee, H. K. Oh, and Y. Y.

Kim. 2008. Comparison of synthetic lysine sources on growth performance, nutrient

digestibility and nitrogen retention in weaning pigs. Asian-Aust. J. Anim. Sci. Vol. 21,

No. 1:90-96.

Jung, K., T. Annamalai, Z. Lu, and L. J. Saif. 2015. Comparative pathogenesis of US porcine

epidemic diarrhea virus (PEDV) strain PC21A in conventional 9-day-old nursing piglets

vs. 26-day-old weaned pigs. Vet. Microbiol. 178(1-2):31-40.

118

Kerr, B. J., F. K. McKeith, and R. A. Easter. 1995. Effect on performance and carcass

characteristics of nursery to finisher pigs fed reduced crude protein, amino acid-

supplemented diets. J. Anim. Sci. 73:433-440.

Kitt, S. J., P. S. Miller, and A. Lewis. 2001 Factors affecting small intestine development in

weanling pigs. Nebraska Swine Reports Paper, 99:33-35.

Lalles, J. P., P. Bosi, H. Smidt, and C. R. Stokes. 2007. Nutritional management of gut health

in pigs around weaning. Proceeding of the Nutritional Society. 66:260-268.

Leibholz, J., R.J. Love, Y. Mollah, and R.R. Carter. 1986. The absorption of dietary L-lysine

and extruded L-lysine in pigs. Anim. Feed Sci. Tech. 15:141-148.

Li, D. F., J. L. Nelssen, P. G. Reddy, F. Bleccha, R. D. Klemm, G. W. Giesting, J. D.

Hancock, G. L. Allee, and R. D. Goodband. 1991. Measuring suitability of soybean

products for early-weaned pigs with immunological criteria. J. Anim. Sci. 69:3299-

3307.

Liao, S. F., T. Wang, and N. Regmi. 2015. Lysine nutrition in swine and the related

monogastric animals: muscle protein biosynthesis and beyond. SpringerPlus. 4:147.

Liu, M., S. Y. Qiao, X. Wang, J. M. You and X. S. Piao. 2007. Bioefficacy of lysine from L-

lysine sulfate and L-lysine HCl for 10 to 20 kg pigs. Asian-Aust. J. Anim. Sci. Vol. 20,

No. 10:1580-1586.

Ma, T. Y., G. K. Iwamoto, N. T. Hoa, V. Akotia, A. Pedram, M. A. Boivin, and H. M. Said.

2004. TNF-alpha-induced increase in intestinal epithelial tight junction permeability

requires NF-kappa B activation. Am. J. Physiol. Gastrointest. Liver Physiol.

286(3):G367-376.

119

NRC. 2012. Nutrient Requirements of Swine. 11th rev. ed. Natl. Acad. Press, Washington, DC.

Owen, K. Q., J. L. Nelssen, R. D. Goodband, M. D. Tokach, B. T. Richert, K. G. Friesen, J.

W. Smith, J. R. Bergstrom, and S. S. Dritz. 1995c. Dietary lysine requirements of

segregated early weaned pigs. J. Anim. Sci. 73 (Supp. 1):68 (Abstr.)

Porilz, L. S., K. I. Garver, A. F. Tilberg, and W. A. Koltun. 2004. Tumor necrosis factor

alpha disrupts tight junction assembly. J. Surg. Res. 116(1):14-18.

Shen, L. 2012. Tight junctions on the move: molecular mechanisms for epithelial barrier

regulation. Ann. N. Y. Acad. Sci. 1258:9-18.

Shen, Y. B., P. Ferket, I. Park, R. D. Malheiros, and S. W. Kim. 2015. Effects of feed grade

L-methionine on intestinal redox status, intestinal development, and growth

performance of young chickens compared with conventional DL-methionine. J. Anim.

Sci. 93:2977-2986.

Smiricky-Tjardes, M. R., I. Mavromichalis, D. M. Albin, J. E. Wubben, M. Rademacher, and

V. M. Gabert. 2004. Bioefficacy of L-lysine sulfate compared with feed-grade L-lysine

HCl in young pigs. J. Anim. Sci. 82:2610-2614.

Stein, H. H. and D. Y. Kil. 2006. Reduced use of antibiotic growth promoters in diets fed to

weanling pigs: Dietary tools. Part 2. Anim. Biotechnol. 17:217-231.

Stoll, B., J. Henry, P. J. Reeds, H. Yu, F. Jahoor, and D. G. Burrin. 1998. Catabolism

dominates the first-pass intestinal metabolism of dietary essential amino acids in milk

protein-fed piglets. J. Nutr. 128(3):606-614.

Thacker, P. A. 1999. Nutritional requirements of early weaned pigs. A review, Asian-Aust. J.

Anim. Sci. Vol. 12, No. 6:976-987.

120

Torrallardona, D. 2010. Spray dried animal plasma as an alternative to antibiotics in

weanling pigs. A review, Asian-Aust. J. Anim. Sci. Vol. 23, No. 1:131-148. van Goudoever, J. B., B. Stoll, J. F. Henry, D. G. Burrin, and P. J. Reeds. 2000. Adaptive

regulation of intestinal lysine metabolism. PNAS. Vol. 97, No. 21:11620-11625. van Heugten, E. 2001. Mycotoxins and other antinutritional factors in swine feeds. In Swine

Nutrition, 2nd (Ed. A. J. Lewis and L. L. Southern). CRC Press LLC, Boca Raton,

Florida, pp. 563-583.

Weaver, A. C., J. M. Campbell, J. D. Crenshaw, J. Polo, and S. W. Kim. 2014. Efficacy of

dietary spray dried plasma protein to mitigate the negative effects on performance of

pigs fed diets with corn naturally contaminated with multiple mycotoxins. J. Anim. Sci.

92:3878-3886.

Yang, F., A. Wang, X. Zeng, C. Hou, H. Liu, and S. Qiao. 2015. Lactobacillus reuteri I5007

modulates tight junction protein expression in IPEC-J2 cells with LPS stimulation and

in newborn piglets under normal conditions. BMC Microbiol. 15:32.

121

Table 1. Composition of experimental diets for nursery pigs1. Phase 1 (d 0 to 10) Phase 2 (wk 11 to 21) Item, % L-Lys HCl liquid L-Lys L-Lys HCl liquid L-Lys Ingredient, Yellow corn 42.36 42.36 49.01 49.01 Dehulled soybean meal 20.06 20.06 22.50 22.50 Whey permeate 20.00 20.00 15.00 15.00 Animal plasma 7.00 7.00 3.50 3.50 Poultry meal 5.00 5.00 5.00 5.00 Poultry fat 2.00 2.00 2.00 2.00 L-Lys HCl 0.45 0.00 0.45 0.00 L-Lys (liquid) 0.00 0.71 0.00 0.71 DL-Met 0.20 0.20 0.18 0.18 L-Thr 0.13 0.13 0.12 0.12 L-Val 0.10 0.10 0.11 0.11 Limestone 0.95 0.95 0.88 0.88 Dicalcium phosphate 0.56 0.56 0.60 0.60 Vitamin premix2 0.03 0.03 0.03 0.03 Mineral premix3 0.15 0.15 0.15 0.15 Salt 0.22 0.22 0.22 0.22 Zinc oxide 0.25 0.25 0.25 0.25 Total 100.00 100.26 100.00 100.26 Calculated composition DM, % 90.64 90.77 90.35 90.48 ME, kcal/kg 3,417 3,417 3,407 3,407 Lys4, % 1.50 1.50 1.35 1.35 Met + Cys4, % 0.82 0.82 0.74 0.74 Trp4, % 0.26 0.26 0.23 0.23 Thr4, %4 0.88 0.88 0.79 0.79 Val4, % 0.95 0.95 0.86 0.86 Ca, % 0.85 0.85 0.80 0.80 STTD5 P, % 0.45 0.45 0.40 0.40 Total P, % 0.67 0.67 0.63 0.63

122

Table 1 Continued

1L-Lys HCl: control diet supplemented with L-lysine HCl; liquid L-Lys: diet supplemented with liquid L-lysine. 2The vitamin premix provided the following per kilogram of a complete diet: 6,613.8 IU of vitamin A; 992.0 IU of vitamin D3; 19.8 IU of vitamin E; 2.64 mg of vitamin K; 0.03 mg of vitamin B12; 4.63 mg of riboflavin; 18.52 mg of pantothenic acid; 24.96 mg of niacin; and 0.07 mg of biotin. 3The trace mineral premix provided the following per kilogram of a complete diet: 4.0 mg of Mn as manganese oxide; 165 mg of Fe as ferrous sulfate; 165 mg of Zn as zinc sulfate; 16.5 mg of Cu as copper sulfate; 0.30 mg of I as ethylenediamine dihydroiodide; and 0.30 mg of Se as sodium selenite. 4Standardized ileal digestible 5Standardized total tract digestible

123

Table 2. Growth performance of nursery pigs with either L-Lys HCl or liquid L-Lys. Item Treatment SEM P-value L-Lys HCl liquid L-Lys Initial BW (kg) 5.94 5.94 0.074 0.965 Phase 1 (d 0-10) BW, kg 7.48 7.47 0.284 0.959 ADG, kg/d 0.155 0.153 0.026 0.964 ADFI, kg/d 0.203 0.195 0.020 0.678 G:F 0.722 0.781 0.071 0.418 Phase 2 (d 11-21) BW, kg 12.64 12.63 0.572 0.979 ADG, kg/d 0.469 0.469 0.036 0.998 ADFI, kg/d 0.574 0.557 0.037 0.642 G:F 0.825 0.841 0.038 0.666 Overall (d 0-21) ADG, kg/d 0.319 0.319 0.026 0.982 ADFI, kg/d 0.397 0.384 0.026 0.615 G:F 0.804 0.828 0.034 0.488

124

Table 3. Tumor necrosis factor-α (TNF- α), Malondialdehyde (MDA), protein carbonyl, 8-hydroxydeoxyguanine (8-OHdG), and total antioxidant capacity (TAC) levels of plasma, duodenum, and jejunum tissue samples in pigs. Item Treatment SEM P-value L-Lys HCl liquid L-Lys TNF-a Duodenum 2.375 1.881 0.419 0.256 (pg/mg protein) Jejunum 1.047 0.808 0.062 0.001 (pg/mg protein) Plasma 130.40 110.08 6.942 0.001 (pg/mL) Malondialdehyde

(MDA) Duodenum 0.948 0.881 0.099 0.508 (umol/g protein) Jejunum 0.476 0.469 0.058 0.916 (umol/g protein) Plasma 14.63 13.88 0.457 0.122 (uM) Protein carbonyls Duodenum 5.613 5.564 0.611 0.937 (nmol/mg) Jejunum 4.653 4.451 0.776 0.799 (nmol/mg) Plasma 7.177 6.806 0.927 0.695 (nmol/mg) 8-OHdG Plasma 2.787 2.785 0.320 0.994 (ng/mL) TAC, (µM CRE) Duodenum 1823.10 1793.37 65.927 0.658 Jejunum 1708.24 1792.59 93.669 0.381 Plasma 44.88 45.79 3.531 0.799

125

Table 4. Villus height, villus width, crypt depth, the ratio of villus height to crypt depth (VH/CD), and proliferation rate of crypt cells of duodenum and jejunum in nursery pigs with either L-Lys HCl or liquid L-Lys. Item Treatment SEM P value L-Lys HCl liquid L-Lys Duodenum (µm) Villus height 462.46 482.45 12.772 0.137 Villus width (top) 96.75 97.82 4.927 0.832 Villus width 153.59 147.15 4.121 0.137 (middle) Villus width 163.69 158.34 3.692 0.166 (bottom) Crypt depth 362.01 368.79 11.584 0.566 VH/CD 1.29 1.38 0.073 0.261 Jejunum (μm) Villus height 346.33 386.48 17.384 0.035 Villus width (top) 72.87 69.77 2.196 0.177 Villus width 115.65 107.25 3.183 0.018 (middle) Villus width 127.54 125.00 4.004 0.536 (bottom) Crypt depth 290.62 285.26 10.814 0.627 VH/CD 1.21 1.37 0.049 0.004 Proliferation, (%) Duodenum 0.238 0.232 0.005 0.249 Jejenum 0.255 0.228 0.007 0.001

126

Figure 1. Immunoblot analysis of duodenal tight junction proteins in nursery pigs supplemented with different sources of L-Lys. The concentrations of claudin, occludin, and

ZO-1 were measured using immunoblotting. Data are represented as mean ± SEM, n = 6.

*P < 0.05 compared with control piglets (L-Lys HCl).

127

Figure 2. Immunoblot analysis of jejunal tight junction proteins in nursery pigs supplemented with different sources of L-Lys. The concentration of claudin, occludin, and

ZO-1 were measured using immunoblotting. Data are represented as mean ± SEM, n = 6.

*P < 0.05 compared with control piglets (L-Lys HCl).

128

CHAPTER 5

GENERAL CONCLUSION

129

The literature review has pinpointed benefits of the ideal protein concept and the application of low CP diets with supplemental AA in swine diets. Currently, several problems exist in the feed industry and swine production. For example, the major problems are inconsistent supply and price fluctuation of major protein sources such as soybean meal or fish meal. Moreover, soybean meal and other alternative products are limited due to high demand from growing food and aquaculture industries. These problems could be solved by implementation of the ideal protein concept and formulattion of low CP diets with AA supplementation. Although low CP diets can be used in swine production, the balance of

EAA profiles has to be concerned to avoid exceed of some limitting AA which might affect the digestion, absorption, and utilization of other AA. Especially, in the situation that few feed grade AA such as L-Lys, DL-Met, L-Thr, L-Trp, or L-Val are available in the market.

Nutritional research on low CP diets with supplemental AA provides several benefits to pig producers such as reducing overall production cost without compromising pig performance, and it also minimize excess nutrient excretions to the environment. Protein and AA are expensive nutrients which are mainly used as building blocks for protein synthesis. In addition, several AA have their functional roles in the animal body. Thus, if these AA are utilized efficiently to serve their functional roles, these AA excretions are minimized.

Therefore, this knowledge will directly provide benefits to global swine industry.

Numerous studies focused on AA supplementation in low CP diets on growth performance and other biological functions. Additionally, other AA studies also focused on high levels of particular AA supplementation such as Lys, Trp, and Thr on their specific functional roles. Several studies observed benefits of these AA supplementation, especially,

130

when high levels of these AA were supplemented. Unfortunately, high levels of these AA supplementation and its outcome might not reasonable to be implemented commercially when aditional costs are observed.

Among these research studies, Trp supplementation is an important topic to be considered because Trp have serveal biological functions which provide benefits to swine industry. Trp is an EAA which is used for protein synthesis and other functional proteins such as serotonin and melatonin. These functional proteins derived from Trp have positive effects on appetite, behavior, and immunological functions which are benefits to pigs, particularly, newly weaned pigs. In this study, we hypothesized that Trp supplementation exceed NRC

2012 recommendation could provide positive effects on growth performance and gut health of nursery pigs. Therefore, Trp was added by 0.05% which was not considered extremely high supplementation for the commercial usage. In the current studies, use of supplemental

AA (Lys, Met, Thr, and Trp) in low CP diets and 0.05% supplemental Trp increased BW, intestinal development, and AA transporters; especially, in the jejunum. Moreover, additional

0.05% Trp exceeding NRC 2012 requirement enhanced intestional tight junction protein concentrations in nursery pigs.

Supplemental AA products have been discovered and developed since the 1950s. Lately, several products are accepted by the commercial feed industry. Furthermore, these supplemental AA proved that these products could reduce feed cost without adverse effects on animal performance. For supplemental L-Lys, there are different products used in swine industry, such as L-Lys HCl and L-Lys sulfate. Numerous studies were conducted to evaluate relative biological value between these products. However, liquid L-Lys has not been

131

investigated in depth in swine. Liquid L-Lys provides free from of L-Lys and is cheaper when compared to standard L-Lys HCl due to the fact that a drying process is not required. In these studies, liquid L-Lys was used to compare with crystalline L-Lys HCl on growth performance and relative biological value for growing pigs. Furthermore we hypothesized that liquid L-Lys supplementation in newly weaned piglets could provide functional differces on growth performance and gut health due to free form of Lys could be utilized rapidly compared to L-Lys HCl.

The growing pig study demonstrates that the bioefficacy of liquid L-Lys was not difference from crystalline L-Lys HCl. In addition, growth performance of pigs from 30 to 90 kg and carcass charateristics of 120 kg pigs were not effected by different sources of supplemental L-Lys. In addition, the study in nursery pigs indicated that liquid L-Lys supplementation improved intestinal health potentially by decreasing of systemic inflammatory status and improved jejunal morphology compared with the use of L-Lys HCl in newly weaned pigs.

Overall, alternative sources of L-Lys can replace crystalline L-Lys HCl. However, the active ingredient contents of those alternative products and their relative biological values should be tested with the standard crystalline L-Lys HCl to guarantee that these products can be used equally as L-Lys HCl. In addition, availability of these products in the local markets, price of products, and other costs shoud be accounted for to ensure that feed costs will be reduced when these alternative products are used. With the development of fermentation and transgenic technologies for AA production, the decreasing cost of feed grade AA and the diversity of these products might greatly expand their utilization in the feed industry.

132