A Proteomic Study for the Discovery of Beef Tenderness Biomarkers And
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Mechanical Forces Induce an Asthma Gene Signature in Healthy Airway Epithelial Cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T
www.nature.com/scientificreports OPEN Mechanical forces induce an asthma gene signature in healthy airway epithelial cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T. Kho4, Kelan Tantisira1, Marc Santolini 1,5, Feixiong Cheng6,7,8, Jennifer A. Mitchel3, Maureen McGill3, Michael J. O’Sullivan3, Margherita De Marzio1,3, Amitabh Sharma1, Scott H. Randell9, Jefrey M. Drazen3, Jefrey J. Fredberg3 & Scott T. Weiss1,3* Bronchospasm compresses the bronchial epithelium, and this compressive stress has been implicated in asthma pathogenesis. However, the molecular mechanisms by which this compressive stress alters pathways relevant to disease are not well understood. Using air-liquid interface cultures of primary human bronchial epithelial cells derived from non-asthmatic donors and asthmatic donors, we applied a compressive stress and then used a network approach to map resulting changes in the molecular interactome. In cells from non-asthmatic donors, compression by itself was sufcient to induce infammatory, late repair, and fbrotic pathways. Remarkably, this molecular profle of non-asthmatic cells after compression recapitulated the profle of asthmatic cells before compression. Together, these results show that even in the absence of any infammatory stimulus, mechanical compression alone is sufcient to induce an asthma-like molecular signature. Bronchial epithelial cells (BECs) form a physical barrier that protects pulmonary airways from inhaled irritants and invading pathogens1,2. Moreover, environmental stimuli such as allergens, pollutants and viruses can induce constriction of the airways3 and thereby expose the bronchial epithelium to compressive mechanical stress. In BECs, this compressive stress induces structural, biophysical, as well as molecular changes4,5, that interact with nearby mesenchyme6 to cause epithelial layer unjamming1, shedding of soluble factors, production of matrix proteins, and activation matrix modifying enzymes, which then act to coordinate infammatory and remodeling processes4,7–10. -
Omics Technology: Foodomics
Article Title: OMICS TECHNOLOGY: FOODOMICS Authors: Gerardo Alvarez‐Rivera Laboratory of Foodomics Institute of Food Science Research (CIAL‐CSIC) Nicolás Cabrera 9, Campus UAM Cantoblanco 28049 Madrid ‐ Spain email: [email protected] Phone: +34 910017819 Said Toro Uribe Laboratory of Foodomics Institute of Food Science Research (CIAL‐CSIC) Nicolás Cabrera 9, Campus UAM Cantoblanco 28049 Madrid ‐ Spain email: [email protected] Elena Ibañez Laboratory of Foodomics Institute of Food Science Research (CIAL‐CSIC) Nicolás Cabrera 9, Campus UAM Cantoblanco 28049 Madrid ‐ Spain email: [email protected] Phone: +34‐91‐0017956 Alejandro Cifuentes Laboratory of Foodomics Institute of Food Science Research (CIAL‐CSIC) Nicolás Cabrera 9, Campus UAM Cantoblanco 28049 Madrid ‐ Spain email: [email protected] Phone: +34‐91‐0017955 Monica Bueno Laboratory of Foodomics Institute of Food Science Research (CIAL‐CSIC) Nicolás Cabrera 9, Campus UAM Cantoblanco 28049 Madrid ‐ Spain email: [email protected] Phone: 34‐91‐0017900 Abstract: Foodomics is playing an essential role and is increasingly becoming a relevant multi‐omic platform able to deal with traditional and new food challenges such as food safety, quality, traceability and health‐diet interaction. In this context, innovative and high‐throughput omic studies combined with bioinformatic tools are being developed for rapid identification of pathogens and multi‐residue determination of contaminants, for understanding the interaction of bioactive compounds from diet, as well as for guaranteeing authenticity, traceability and quality of food products. This chapter aims to provide the reader with a general overview of the different areas of research covered by Foodomics, through the revision of state‐of‐the‐art research works dealing with the application of the Foodomic approach to different aspects of Food Science including food safety, quality, traceability and health‐diet interaction. -
Searching the Genomes of Inbred Mouse Strains for Incompatibilities That Reproductively Isolate Their Wild Relatives
Journal of Heredity 2007:98(2):115–122 ª The American Genetic Association. 2007. All rights reserved. doi:10.1093/jhered/esl064 For permissions, please email: [email protected]. Advance Access publication January 5, 2007 Searching the Genomes of Inbred Mouse Strains for Incompatibilities That Reproductively Isolate Their Wild Relatives BRET A. PAYSEUR AND MICHAEL PLACE From the Laboratory of Genetics, University of Wisconsin, Madison, WI 53706. Address correspondence to the author at the address above, or e-mail: [email protected]. Abstract Identification of the genes that underlie reproductive isolation provides important insights into the process of speciation. According to the Dobzhansky–Muller model, these genes suffer disrupted interactions in hybrids due to independent di- vergence in separate populations. In hybrid populations, natural selection acts to remove the deleterious heterospecific com- binations that cause these functional disruptions. When selection is strong, this process can maintain multilocus associations, primarily between conspecific alleles, providing a signature that can be used to locate incompatibilities. We applied this logic to populations of house mice that were formed by hybridization involving two species that show partial reproductive isolation, Mus domesticus and Mus musculus. Using molecular markers likely to be informative about species ancestry, we scanned the genomes of 1) classical inbred strains and 2) recombinant inbred lines for pairs of loci that showed extreme linkage disequi- libria. By using the same set of markers, we identified a list of locus pairs that displayed similar patterns in both scans. These genomic regions may contain genes that contribute to reproductive isolation between M. domesticus and M. -
Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest. -
Bioinformatics Analyses of Genomic Imprinting
Bioinformatics Analyses of Genomic Imprinting Dissertation zur Erlangung des Grades des Doktors der Naturwissenschaften der Naturwissenschaftlich-Technischen Fakultät III Chemie, Pharmazie, Bio- und Werkstoffwissenschaften der Universität des Saarlandes von Barbara Hutter Saarbrücken 2009 Tag des Kolloquiums: 08.12.2009 Dekan: Prof. Dr.-Ing. Stefan Diebels Berichterstatter: Prof. Dr. Volkhard Helms Priv.-Doz. Dr. Martina Paulsen Vorsitz: Prof. Dr. Jörn Walter Akad. Mitarbeiter: Dr. Tihamér Geyer Table of contents Summary________________________________________________________________ I Zusammenfassung ________________________________________________________ I Acknowledgements _______________________________________________________II Abbreviations ___________________________________________________________ III Chapter 1 – Introduction __________________________________________________ 1 1.1 Important terms and concepts related to genomic imprinting __________________________ 2 1.2 CpG islands as regulatory elements ______________________________________________ 3 1.3 Differentially methylated regions and imprinting clusters_____________________________ 6 1.4 Reading the imprint __________________________________________________________ 8 1.5 Chromatin marks at imprinted regions___________________________________________ 10 1.6 Roles of repetitive elements ___________________________________________________ 12 1.7 Functional implications of imprinted genes _______________________________________ 14 1.8 Evolution and parental conflict ________________________________________________ -
Phenotypic Modulation of Smooth Muscle Cells in Atherosclerosis Is Associated with Downregulation of LMOD1, SYNPO2, PDLIM7, PLN and SYNM
Markers of smooth muscle cells Perisic et al. Phenotypic modulation of smooth muscle cells in atherosclerosis is associated with downregulation of LMOD1, SYNPO2, PDLIM7, PLN and SYNM Perisic L1, Rykaczewska U1, Razuvaev A1, Sabater-Lleal M2, Lengquist M1, Miller CL3, Ericsson I1, Röhl S1, Kronqvist M1, Aldi S1, Magné J2, Vesterlund M4, Li Y2, Yin H2, Gonzalez Diez M2, Roy J1, Baldassarre D5,6, Veglia F6, Humphries SE7, de Faire U8,9, Tremoli E5,6, on behalf of the IMPROVE study group, Odeberg J10, Vukojević V11, Lehtiö J4, Maegdefessel L2, Ehrenborg E2, Paulsson-Berne G2, Hansson GK2, Lindeman JHN12, Eriksson P2, Quertermous T3, Hamsten A2, Hedin U1 1Department of Molecular Medicine and Surgery, Karolinska Institutet, Sweden, 2Department of Medicine, Karolinska Institutet, Sweden, 3Division of Vascular Surgery, Stanford University, USA, 4Science for Life Laboratory, Sweden, 5Dipartimento di Scienze Farmacologiche e Biomolecolari, Università di Milano, Milan, Italy, 6Centro Cardiologico Monzino, IRCCS, Milan, Italy, 7British Heart Foundation Laboratories, University College of London, Department of Medicine, Rayne Building, London, United Kingdom, 8Division of Cardiovascular Epidemiology, Institute of Environmental Medicine, Karolinska Institutet, 9Department of Cardiology, Karolinska University Hospital Solna, Karolinska Institutet, Stockholm, Sweden, 10Science for Life Laboratory, Department of Proteomics, Sweden, 11Department of Clinical Neuroscience, Center for Molecular Medicine, Karolinska Institutet, Sweden, 12Department of Vascular -
Original Article Prognostic Value of the PDLIM Family in Acute Myeloid Leukemia
Am J Transl Res 2019;11(9):6124-6131 www.ajtr.org /ISSN:1943-8141/AJTR0096980 Original Article Prognostic value of the PDLIM family in acute myeloid leukemia Longzhen Cui1,2,3,4*, Zhiheng Cheng5*, Kai Hu6*, Yifan Pang7, Yan Liu3, Tingting Qian1,2, Liang Quan1,2, Yifeng Dai8, Ying Pang1, Xu Ye1, Jinlong Shi9, Lin Fu1,2,4 1Department of Hematology, 2Translational Medicine Center, The Second Affiliated Hospital of Guangzhou Medical University, Guangzhou 510260, Guangdong, China; 3Translational Medicine Center, 4Department of Hematology, Huaihe Hospital of Henan University, Kaifeng 475000, Henan, China; 5Department of Pathology and Medical Biology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands; 6Department of Hematology and Lymphoma Research Center, Peking University, Third Hospital, Beijing 100191, China; 7Department of Medicine, William Beaumont Hospital, Royal Oak, MI 48073, USA; 8Immunoendocrinology, Division of Medical Biology, Department of Pathology and Medical Biology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands; 9Department of Medical Big Data, Chinese PLA General Hospital, Beijing 100853, China. *Equal contributors. Received April 22, 2019; Accepted June 26, 2019; Epub September 15, 2019; Published September 30, 2019 Abstract: Acute myeloid leukemia (AML) is a genetically complex, highly aggressive hematological malignancy. Prognosis is usually with grim. PDZ and LIM domain proteins (PDLIM) are involved in the regulation of a variety of biological processes, including cytoskeletal organization, cell differentiation, organ development, neural signaling or tumorigenesis. The clinical and prognostic value of the PDLIM family in AML is unclear. To understand the role of PDLIM expression in AML, The Cancer Genome Atlas (TCGA) database was screened and 155 de novo AML pa- tients with complete clinical information and the expression data of the PDLIM family were included in the study. -
PDLIM7 (NM 005451) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC111943 PDLIM7 (NM_005451) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: PDLIM7 (NM_005451) Human Untagged Clone Tag: Tag Free Symbol: PDLIM7 Synonyms: LMP1; LMP3 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_005451, the custom clone sequence may differ by one or more nucleotides ATGGATTCCTTCAAAGTAGTGCTGGAGGGGCCAGCACCTTGGGGCTTCCGGCTGCAAGGGGGCAAGGACT TCAATGTGCCCCTCTCCATTTCCCGGCTCACTCCTGGGGGCAAAGCGGCGCAGGCCGGAGTGGCCGTGGG TGACTGGGTGCTGAGCATCGATGGCGAGAATGCGGGTAGCCTCACACACATCGAAGCTCAGAACAAGATC CGGGCCTGCGGGGAGCGCCTCAGCCTGGGCCTCAGCAGGGCCCAGCCGGTTCAGAGCAAACCGCAGAAGG CCTCCGCCCCCGCCGCGGACCCTCCGCGGTACACCTTTGCACCCAGCGTCTCCCTCAACAAGACGGCCCG GCCCTTTGGGGCGCCCCCGCCCGCTGACAGCGCCCCGCAGCAGAATGGACAGCCGCTCCGACCGCTGGTC CCAGATGCCAGCAAGCAGCGGCTGATGGAGAACACAGAGGACTGGCGGCCGCGGCCGGGGACAGGCCAGT CGCGTTCCTTCCGCATCCTTGCCCACCTCACAGGCACCGAGTTCATGCAAGACCCGGATGAGGAGCACCT GAAGAAATCAAGCCAGGTGCCCAGGACAGAAGCCCCAGCCCCAGCCTCATCTACACCCCAGGAGCCCTGG CCTGGCCCTACCGCCCCCAGCCCTACCAGCCGCCCGCCCTGGGCTGTGGACCCTGCGTTTGCCGAGCGCT ATGCCCCGGACAAAACGAGCACAGTGCTGACCCGGCACAGCCAGCCGGCCACGCCCACGCCGCTGCAGAG CCGCACCTCCATTGTGCAGGCAGCTGCCGGAGGGGTGCCAGGAGGGGGCAGCAACAACGGCAAGACTCCC GTGTGTCACCAGTGCCACAAGGTCATCCGGGGCCGCTACCTGGTGGCGCTGGGCCACGCGTACCACCCGG AGGAGTTTGTGTGTAGCCAGTGTGGGAAGGTCCTGGAAGAGGGTGGCTTCTTTGAGGAGAAGGGCGCCAT -
Gene Expression During Normal and FSHD Myogenesis Tsumagari Et Al
Gene expression during normal and FSHD myogenesis Tsumagari et al. Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 (27 September 2011) Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 RESEARCHARTICLE Open Access Gene expression during normal and FSHD myogenesis Koji Tsumagari1, Shao-Chi Chang1, Michelle Lacey2,3, Carl Baribault2,3, Sridar V Chittur4, Janet Sowden5, Rabi Tawil5, Gregory E Crawford6 and Melanie Ehrlich1,3* Abstract Background: Facioscapulohumeral muscular dystrophy (FSHD) is a dominant disease linked to contraction of an array of tandem 3.3-kb repeats (D4Z4) at 4q35. Within each repeat unit is a gene, DUX4, that can encode a protein containing two homeodomains. A DUX4 transcript derived from the last repeat unit in a contracted array is associated with pathogenesis but it is unclear how. Methods: Using exon-based microarrays, the expression profiles of myogenic precursor cells were determined. Both undifferentiated myoblasts and myoblasts differentiated to myotubes derived from FSHD patients and controls were studied after immunocytochemical verification of the quality of the cultures. To further our understanding of FSHD and normal myogenesis, the expression profiles obtained were compared to those of 19 non-muscle cell types analyzed by identical methods. Results: Many of the ~17,000 examined genes were differentially expressed (> 2-fold, p < 0.01) in control myoblasts or myotubes vs. non-muscle cells (2185 and 3006, respectively) or in FSHD vs. control myoblasts or myotubes (295 and 797, respectively). Surprisingly, despite the morphologically normal differentiation of FSHD myoblasts to myotubes, most of the disease-related dysregulation was seen as dampening of normal myogenesis- specific expression changes, including in genes for muscle structure, mitochondrial function, stress responses, and signal transduction. -
Current Trends in Food Analysis and Also Provide Some Concrete Advice for Preparing Food Samples for Analysis
AUGUST 2016 CURRENT TRENDS IN FOOD ANALYSIS Thermo Fisher Scientific IntrODUCTION ood analysis today is a much broader and more complex field than it was in the past. Food safety continues to be a major focus of food analysis. But in recent years, other areas of food research have blossomed, and many analytical chemists are Fnow investigating a wide array of questions on topics ranging from authenticating the origin of foods and beverages to investigating the nutritional aspects of natural food compounds. In this new e-book, we explore some current trends in food analysis and also provide some concrete advice for preparing food samples for analysis. We open the issue with an interview with Sastia Prama Putri of Osaka University about the role of metabolomics in food analysis. She and her colleagues have done a range of food studies, on products such as soy sauce, cheese, sake, coffee, and cocoa, using metabolomics to predict sensory attributes of food—identifying the metabolites responsible for flavor, aroma, and other characteristics— and also conducting studies on food authentication. Next, Elena Ibañez of the Institute of Food Science Research in Madrid, Spain, talks about an extension of the ‘omics approach to the concept of “foodomics”— a framework to address the full range of challenges in food science today. She then discusses “green foodomics,” an approach to applying the concepts of green chemistry to food science. She explains what is involved in making food analysis methods green, including both the challenges and the benefits, to both the laboratory and the environment. We close the e-book with a look at selectivity in extractions, from our regular LCGC contributor Doug Raynie. -
Advances in Research on Diabetes by Human Nutriomics
International Journal of Molecular Sciences Review Advances in Research on Diabetes by Human Nutriomics Xinmin Ren 1,2 and Xiangdong Li 1,2,* 1 Beijing Advanced Innovation Center for Food Nutrition and Human Health, China Agricultural University, Beijing 100193, China; [email protected] 2 State Key Laboratory of Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193, China * Correspondence: [email protected] Received: 24 August 2019; Accepted: 16 October 2019; Published: 29 October 2019 Abstract: The incidence and prevalence of diabetes mellitus (DM) have increased rapidly worldwide over the last two decades. Because the pathogenic factors of DM are heterogeneous, determining clinically effective treatments for DM patients is difficult. Applying various nutrient analyses has yielded new insight and potential treatments for DM patients. In this review, we summarized the omics analysis methods, including nutrigenomics, nutritional-metabolomics, and foodomics. The list of the new targets of SNPs, genes, proteins, and gut microbiota associated with DM has been obtained by the analysis of nutrigenomics and microbiomics within last few years, which provides a reference for the diagnosis of DM. The use of nutrient metabolomics analysis can obtain new targets of amino acids, lipids, and metal elements, which provides a reference for the treatment of DM. Foodomics analysis can provide targeted dietary strategies for DM patients. This review summarizes the DM-associated molecular biomarkers in current applied omics analyses and may provide guidance for diagnosing and treating DM. Keywords: diabetes mellitus (DM), nutrigenomics; nutritional-metabolomics; foodomics; molecular biomarkers 1. Background Diabetes mellitus (DM) is a metabolic disorder characterized by prolonged periods of hyperglycemia [1], which includes frequent urination, thirst, and hunger [2]. -
Visualization and Exploration of Transcriptomics Data Nils Gehlenborg
Visualization and Exploration of Transcriptomics Data 05 The identifier 800 year identifier Nils Gehlenborg Sidney Sussex College To celebrate our 800 year history an adaptation of the core identifier has been commissioned. This should be used on communications in the time period up to and including 2009. The 800 year identifier consists of three elements: the shield, the University of Cambridge logotype and the 800 years wording. It should not be redrawn, digitally manipulated or altered. The elements should not be A dissertation submitted to the University of Cambridge used independently and their relationship should for the degree of Doctor of Philosophy remain consistent. The 800 year identifier must always be reproduced from a digital master reference. This is available in eps, jpeg and gif format. Please ensure the appropriate artwork format is used. File formats European Molecular Biology Laboratory, eps: all professionally printed applications European Bioinformatics Institute, jpeg: Microsoft programmes Wellcome Trust Genome Campus, gif: online usage Hinxton, Cambridge, CB10 1SD, Colour United Kingdom. The 800 year identifier only appears in the five colour variants shown on this page. Email: [email protected] Black, Red Pantone 032, Yellow Pantone 109 and white October 12, 2010 shield with black (or white name). Single colour black or white. Please try to avoid any other colour combinations. Pantone 032 R237 G41 B57 Pantone 109 R254 G209 B0 To Maureen. This dissertation is my own work and contains nothing which is the outcome of work done in collaboration with others, except as specified in the text and acknowledgements. This dissertation is not substantially the same as any I have submit- ted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification.