DOCSLIB.ORG

Phylogeny of Poaceae Inferred from Matk Sequences Khidir W. Hilu; Lawrence A. Alice; Hongping Liang Annals of the Missouri Botan

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogeny of Poaceae Inferred from Matk Sequences Khidir W. Hilu; Lawrence A. Alice; Hongping Liang Annals of the Missouri Botan Phylogeny of Poaceae Inferred from matK Sequences Khidir W. Hilu; Lawrence A. Alice; Hongping Liang Annals of the Missouri Botanical Garden, Vol. 86, No. 4. (Autumn, 1999), pp. 835-851. Stable URL: http://links.jstor.org/sici?sici=0026-6493%28199923%2986%3A4%3C835%3APOPIFM%3E2.0.CO%3B2-D Annals of the Missouri Botanical Garden is currently published by Missouri Botanical Garden Press. Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at http://www.jstor.org/about/terms.html. JSTOR's Terms and Conditions of Use provides, in part, that unless you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you may use content in the JSTOR archive only for your personal, non-commercial use. Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at http://www.jstor.org/journals/mobot.html. Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed page of such transmission. The JSTOR Archive is a trusted digital repository providing for long-term preservation and access to leading academic journals and scholarly literature from around the world. The Archive is supported by libraries, scholarly societies, publishers, and foundations. It is an initiative of JSTOR, a not-for-profit organization with a mission to help the scholarly community take advantage of advances in technology. For more information regarding JSTOR, please contact [email protected]. http://www.jstor.org Mon Jul 23 11:25:41 2007 PHYLOGENY OF POACEAE Khidir K Hilu2, Lazcrence A. Ali~e~.~, INFERRED FROM matK and Hongping Liang' SEQUENCES1 Complete sequences of the plastic1 gene mcrtK \+-eredetermined for 62 species of Poaceae from 60 genera. 26 tribes. and nine iul~fanliliesto infer phylogenetic relatiollsllips. Rrsfio tetr-upli~llus(Restionaceae) ant1 .loinl illea ascendens (Joi~l\illeacrae)were used as outgroups. Clatlistic. analysis using PAUP )ieltletl 39 most parsimo~lioustrees \+-it11several well-supl~orteclmajor lineages. Tlle strict conse~lsusLree she\+-s S~reptocl~cre~aand 4~iomochlocrforming the two most basal lineages in grasses. follo~+-ecl11) I'licrl-us 11eing sister to the remaining species. The other grasses divide into three clades: (1) sul~fanlil) Banll~~~soitleae(exclucli~lgRrcrchje!,~r7c~ii) plus Pooideae: (2) Oryzoicleae: and (3) s~ll~fanlilies Panicoideae. Ar~lntli~loitleae.Cento~hecoideae. ancl Chloridoideae (termed PACC). EacepL for A~~~~~~clinoicleae.monopllyly of each P.1CC subfamily is generally well supported; ho~\e\enrelationships among subfamilies are unresolved or weakly supportetl. Results ol~tai~leclusing 117crtK sequences are largely consistent wit11 other phylogenies l~aseclon molecular ancl s~ructuraldata. particularly in that relationsllips among subfamilies remain ~~nclear. Interest in the evolutio~lof grasses began early standing of grass evolution at the subfamilial level in this century with proposed hypotheses based on ancl, to a certain degree, at the tribal level, major assessment of existing knowledge of the family questions remain to be resolved. Although the basal (e.g., Bew, 1929: H~lhbarcl,1948; Stebbins, 1956, positions of Anornochloeae, Phareae, and Strepto- 1982; Prat, 1960; Clayton, 1981; Tsvelev, 1983). chaeteae have been established, their relative Eln~iricalapproaches to phylogenetic reconstruc- placement ancl taxonomic status are debatable. Un- tion of the Poaceae followed those initial hypothe- certainties also concerning the phylogenetic ses, starting with cladistic analyses of morphologi- affinities alnong sullfamilies the taxonomic cal ancl anatomical characters (Baum, 1987; rank of others such as the ~ ~ ~ ~ i ~ l ~ ~ ~ . Kellogg Campbe11, 1987; Kellogg S- Watson, In this study, the chloroplast mcltK gene was cho- 1993). lnolecular data have provided the sen to acldress these and other questions pertaining grounds for phylogenetic in grasses at to higher-level grass systematics, The nliLtK gene is the subfamilial ancl tribal levels. These studies -1515 base pairs (hp) in most angiosperms, locat- were based on information from chloroplast DN.4 ecl within the trnK intron, and functionally may be (cpDNA) restriction sites and DNA sequencing of involved in splicing group I1 introns (Neuhaus S- the rbcL, ndhF, rps4, rpoC2, mi~tK,nuclear riho- Link, 1987; Ems et al., 1995; Hilu & -Alice, in soma1 DNA (nrDNA) 18s and 26S, phytochrome, press a). The effective application of this gene in ancl granule-bound starch synthase genes, as well as the noncocling n r ~~~~~~~l~ ~ ~~ ~ plant~ systematics~ ~ ~(e.g., iJohnsonb S-~ Soltis,d 1994, spacer(ITS) region ( ~ 8. zimrner,~ 1988;~ D~~-b 1995:~ Hilu S- Liang, 1997: Kron, 1997) and grasses bley et al,, 1990; Davis & Soreng, 1993; CLlmmings (Liang S- Hilu, 1996: Hilu & in Press a, 11) et al., 1994; ~~i~~ et al., 1994; ~ ~et al,,~ 1994;l has~ alreadyt been documented. mi~tKis known to ~~~k~~et al,, 1995, 1999; clark et al,, 1995; D~-have relatively high rates of substitution compared & Morton, 1996; Liang 8. Hilu, 1996; Mathews to other chloroplast genes (see Olmstead & Palmer, & Sharrock, 1996; Mason-Gamer et al., 1998; So- 1994; Johnson & Soltis, 1995). This gene exhibits reng S- Davis, 1998; Hsiao et al., 1999). a relatively high proportion of transversions, and -Although these studies have refined our under- the 3' region of its open reading fiarne (ORF) has I W-e hank Nigel Barker. Lynn Clark. Travis Columbus. Jerr! Davis. Tarciso Filgueiras. Gal? Fleming, Surrey Jac.ol)s. Davicl Kneppet A. Nishiwaki. John Randall, Thomas W'iebolclt, the Botallical Garden at Bo~ill.ant1 the hlissouri Botanical Garden for supplying DNA or plant samples. Seecl material for some accessions was kindl) provided 11) the U.S. Department of Agriculture, Agriculture Research Service-National Plant Ger~nplasmSystem. Re also tllank Ger- asimo Borneo. Thomas Borsch. Gemit Davidse. John MacDougal. and Christoph Neinliuis for their assista11c.e. This work was supported 11y NSF grant #DEB-9634231 and Sigma Xi. Department of Biology. Virginia Pol!techllic Instilule and State Uni\ersit). Blacksburg. Virginia 24061-0406, U.S.A. 'Current address: Department of Biolog). A'estern Kentuck) U~liversit).Bo~\li~igGreen. Kentucky 42101, U.S.A. Annals of the Missouri Botanical Garden MGL S5-1% --+W 7% trnK 5' matK trnK 3' + + + 1210R 9R MG15 Figure 1. Diagram of he trrzK region including the rnntK gene. PCR ancl sequellcitlg primers are inclicatecl ~vith arrons. Primer sequences are: MG1 = CTACTGC.AGAACTAGTCGGATGGA.\GTT4GC4T:hZG1S = ATCTGGGTTGCTA- ACTCAATG: 55-1F = ACCCTGTTCTGACCATATTG: 1210R = GTAGTTGAGAAIGAATCGC: K = TACCCTATCC- TATCCAT: 7R = GATTTATCAIGGATTGGGAT: a~lcl9R = TACGAGCTAAAGTTCTAGC. trnK evons ant1 primers are nol dra~vnto scale. been deinonstratecl to he quite useful in resolving- ples were electrophoresed in an ABI 373L4 aauto- subfamilial, ancl to a certain degree, tribal relation- mated DN.4 sequencer with a stretch gel or in an ships in Poaceae (Liang & Hilu, 1996). ABI 310 Genetic Analyzer (Applied Biosystems, Inc., Foster City, California). Resulting chromato- grams were manually edited using Sequence Nav- igator 1.0 software (-AppliedBiosystems Inc., Foster PLANT SAhIPLES City, California). Sequences were deposited in We sequenced the entire matK gene of 62 Po- GenBank (see Appendix 1). aceae species representing 60 genera, 26 tribes, and nine subfamilies (Appendix.. 1).Suhfamilial and SEQUENCE ALIGNMENT AND PHI-LOGENETIC .ANALYSIS tribal classification generally follows Clayton ancl Alignment of complete matK sequences was un- Renvoize (1986). Restio tetraphyllus (Restionaceae) ambiguous ancl, thus, done manually. Twelve gaps ancl Joznvilleu ascendens (Joinvilleaceae) were used varying in length from 1 to 9 hp were required to as outgroups because recent studies have clemon- align sequences (Table 1). Non-random structure in stratecl that these two families are closely related the data was tested by using the random trees op- to grasses (Doyle et al., 1992; Kellogg 8. Lincler, tion in PL4UP*4.0b2a(Swofforcl, 1998). The g,val- 1995; Soreng & Davis, 1998, and references there- ue for the distribution of tree lengths of 100,000 in). random trees was coinpared using the critical value (at a = 0.05) for 500 variable characters ancl 25 DNA ISOL.kT1ON. POLYMERASE CH.AIN REACTION (PCR) taxa. Beyond 15 taxa, g,critical values change only A?lPLIFIC.kTION. AND SEQUENCING slightly, allowing them to be used in a conservative Leaf tissue was harvested from either green- test with more taxa (Hillis & Huelsenheck, 1992). house-grown plants, field-collected plants, or her- Phylogenies were generated using Fitch parsi- barium specimens. Total cellular DNA was isolated mony as implemented in PAUP, employing heuris- follo~vingM'Ribu and Hilu (1996). Because the tic searches consisting of 1000 replicates of random nmtK gene is part of the trnK intron, we used two stepwise addition of taxa with MULPL4RSon and primers (MG1 or tmK3914 and MG15), located in tree-bisection-reconnection (TBR) branch swap- the trnK 5' and 3' exons, respectively, for PCR ping. Gaps were treated as missing data. Sets of amplification. For sequencing, trnK region PCR equally parsimonious trees were summarized by products were electrophoresed in 0.8% agarose gels strict consensus. Parsimony-informative gaps are and DN.4 fragments of appropriate size excised and mapped onto the strict consensus cladogram
Load more

Recommended publications
  • GENETICS, GENOMICS and BREEDING of FORAGE CROPS Genetics, Genomics and Breeding of Crop Plants
    Genetics, Genomics and Breeding of Genetics, Genomics and Breeding of About the Series Genetics, Genomics and Breeding of AboutAbout the the Series Series SeriesSeries on on BasicBasic and and advanced advanced concepts, concepts, strategies, strategies, tools tools and and achievements achievements of of Series on Basicgenetics, and advanced genomics concepts, and breeding strategies, of crops tools haveand beenachievements comprehensively of Genetics,Genetics, Genomics Genomics and and Breeding Breeding of of Crop Crop Plants Plants genetics,genetics, genomics genomics and and breeding breeding of ofcrops crops have have been been comprehensively comprehensively Genetics, Genomics and Breeding of Crop Plants deliberateddeliberated in in30 30volumes volumes each each dedicated dedicated to toan an individual individual crop crop or orcrop crop Series Editor deliberatedgroup. in 30 volumes each dedicated to an individual crop or crop Series Series Editor Editor group.group. Chittaranjan Chittaranjan Kole, Kole, Vice-Chancellor, Vice-Chancellor, BC BC Agricultural Agricultural University, University, India India The series editor and one of the editors of this volume, Prof. Chittaranjan Chittaranjan Kole, Vice-Chancellor, BC Agricultural University, India TheThe series series editor editor and and one one of theof the editors editors of thisof this volume, volume, Prof. Prof. Chittaranjan Chittaranjan Kole,Kole, is globallyis globally renowned renowned for for his his pioneering pioneering contributions contributions in inteaching teaching and and Kole,research is globally for renowned nearly three for decades his pioneering on plant contributions genetics, genomics, in teaching breeding and and researchresearch for for nearly nearly three three decades decades on onplant plant genetics, genetics, genomics, genomics, breeding breeding and and biotechnology.biotechnology.
    [Show full text]
  • Poaceae: Bambusoideae) Christopher Dean Tyrrell Iowa State University
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2008 Systematics of the neotropical woody bamboo genus Rhipidocladum (Poaceae: Bambusoideae) Christopher Dean Tyrrell Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Botany Commons Recommended Citation Tyrrell, Christopher Dean, "Systematics of the neotropical woody bamboo genus Rhipidocladum (Poaceae: Bambusoideae)" (2008). Retrospective Theses and Dissertations. 15419. https://lib.dr.iastate.edu/rtd/15419 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Systematics of the neotropical woody bamboo genus Rhipidocladum (Poaceae: Bambusoideae) by Christopher Dean Tyrrell A thesis submitted to the graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Ecology and Evolutionary Biology Program of Study Committee: Lynn G. Clark, Major Professor Dennis V. Lavrov Robert S. Wallace Iowa State University Ames, Iowa 2008 Copyright © Christopher Dean Tyrrell, 2008. All rights reserved. 1457571 1457571 2008 ii In memory of Thomas D. Tyrrell Festum Asinorum iii TABLE OF CONTENTS ABSTRACT iv CHAPTER 1. GENERAL INTRODUCTION 1 Background and Significance 1 Research Objectives 5 Thesis Organization 6 Literature Cited 6 CHAPTER 2. PHYLOGENY OF THE BAMBOO SUBTRIBE 9 ARTHROSTYLIDIINAE WITH EMPHASIS ON RHIPIDOCLADUM Abstract 9 Introduction 10 Methods and Materials 13 Results 19 Discussion 25 Taxonomic Treatment 26 Literature Cited 31 CHAPTER 3.
    [Show full text]
  • Types of American Grasses
    z LIBRARY OF Si AS-HITCHCOCK AND AGNES'CHASE 4: SMITHSONIAN INSTITUTION UNITED STATES NATIONAL MUSEUM oL TiiC. CONTRIBUTIONS FROM THE United States National Herbarium Volume XII, Part 3 TXE&3 OF AMERICAN GRASSES . / A STUDY OF THE AMERICAN SPECIES OF GRASSES DESCRIBED BY LINNAEUS, GRONOVIUS, SLOANE, SWARTZ, AND MICHAUX By A. S. HITCHCOCK z rit erV ^-C?^ 1 " WASHINGTON GOVERNMENT PRINTING OFFICE 1908 BULLETIN OF THE UNITED STATES NATIONAL MUSEUM Issued June 18, 1908 ii PREFACE The accompanying paper, by Prof. A. S. Hitchcock, Systematic Agrostologist of the United States Department of Agriculture, u entitled Types of American grasses: a study of the American species of grasses described by Linnaeus, Gronovius, Sloane, Swartz, and Michaux," is an important contribution to our knowledge of American grasses. It is regarded as of fundamental importance in the critical sys- tematic investigation of any group of plants that the identity of the species described by earlier authors be determined with certainty. Often this identification can be made only by examining the type specimen, the original description being inconclusive. Under the American code of botanical nomenclature, which has been followed by the author of this paper, "the nomenclatorial t}rpe of a species or subspecies is the specimen to which the describer originally applied the name in publication." The procedure indicated by the American code, namely, to appeal to the type specimen when the original description is insufficient to identify the species, has been much misunderstood by European botanists. It has been taken to mean, in the case of the Linnsean herbarium, for example, that a specimen in that herbarium bearing the same name as a species described by Linnaeus in his Species Plantarum must be taken as the type of that species regardless of all other considerations.
    [Show full text]
  • Natural Communities of Michigan: Classification and Description
    Natural Communities of Michigan: Classification and Description Prepared by: Michael A. Kost, Dennis A. Albert, Joshua G. Cohen, Bradford S. Slaughter, Rebecca K. Schillo, Christopher R. Weber, and Kim A. Chapman Michigan Natural Features Inventory P.O. Box 13036 Lansing, MI 48901-3036 For: Michigan Department of Natural Resources Wildlife Division and Forest, Mineral and Fire Management Division September 30, 2007 Report Number 2007-21 Version 1.2 Last Updated: July 9, 2010 Suggested Citation: Kost, M.A., D.A. Albert, J.G. Cohen, B.S. Slaughter, R.K. Schillo, C.R. Weber, and K.A. Chapman. 2007. Natural Communities of Michigan: Classification and Description. Michigan Natural Features Inventory, Report Number 2007-21, Lansing, MI. 314 pp. Copyright 2007 Michigan State University Board of Trustees. Michigan State University Extension programs and materials are open to all without regard to race, color, national origin, gender, religion, age, disability, political beliefs, sexual orientation, marital status or family status. Cover photos: Top left, Dry Sand Prairie at Indian Lake, Newaygo County (M. Kost); top right, Limestone Bedrock Lakeshore, Summer Island, Delta County (J. Cohen); lower left, Muskeg, Luce County (J. Cohen); and lower right, Mesic Northern Forest as a matrix natural community, Porcupine Mountains Wilderness State Park, Ontonagon County (M. Kost). Acknowledgements We thank the Michigan Department of Natural Resources Wildlife Division and Forest, Mineral, and Fire Management Division for funding this effort to classify and describe the natural communities of Michigan. This work relied heavily on data collected by many present and former Michigan Natural Features Inventory (MNFI) field scientists and collaborators, including members of the Michigan Natural Areas Council.
    [Show full text]
  • Grass Genera in Townsville
    Grass Genera in Townsville Nanette B. Hooker Photographs by Chris Gardiner SCHOOL OF MARINE and TROPICAL BIOLOGY JAMES COOK UNIVERSITY TOWNSVILLE QUEENSLAND James Cook University 2012 GRASSES OF THE TOWNSVILLE AREA Welcome to the grasses of the Townsville area. The genera covered in this treatment are those found in the lowland areas around Townsville as far north as Bluewater, south to Alligator Creek and west to the base of Hervey’s Range. Most of these genera will also be found in neighbouring areas although some genera not included may occur in specific habitats. The aim of this book is to provide a description of the grass genera as well as a list of species. The grasses belong to a very widespread and large family called the Poaceae. The original family name Gramineae is used in some publications, in Australia the preferred family name is Poaceae. It is one of the largest flowering plant families of the world, comprising more than 700 genera, and more than 10,000 species. In Australia there are over 1300 species including non-native grasses. In the Townsville area there are more than 220 grass species. The grasses have highly modified flowers arranged in a variety of ways. Because they are highly modified and specialized, there are also many new terms used to describe the various features. Hence there is a lot of terminology that chiefly applies to grasses, but some terms are used also in the sedge family. The basic unit of the grass inflorescence (The flowering part) is the spikelet. The spikelet consists of 1-2 basal glumes (bracts at the base) that subtend 1-many florets or flowers.
    [Show full text]
  • Major Vegetation Types of the Soutpansberg Conservancy and the Blouberg Nature Reserve, South Africa
    Original Research MAJOR VEGETATION TYPES OF THE SOUTPANSBERG CONSERVANCY AND THE BLOUBERG NATURE RESERVE, SOUTH AFRICA THEO H.C. MOSTERT GEORGE J. BREDENKAMP HANNES L. KLOPPER CORNIE VERWEy 1African Vegetation and Plant Diversity Research Centre Department of Botany University of Pretoria South Africa RACHEL E. MOSTERT Directorate Nature Conservation Gauteng Department of Agriculture Conservation and Environment South Africa NORBERT HAHN1 Correspondence to: Theo Mostert e-mail: [email protected] Postal Address: African Vegetation and Plant Diversity Research Centre, Department of Botany, University of Pretoria, Pretoria, 0002 ABSTRACT The Major Megetation Types (MVT) and plant communities of the Soutpansberg Centre of Endemism are described in detail, with special reference to the Soutpansberg Conservancy and the Blouberg Nature Reserve. Phytosociological data from 442 sample plots were ordinated using a DEtrended CORrespondence ANAlysis (DECORANA) and classified using TWo-Way INdicator SPecies ANalysis (TWINSPAN). The resulting classification was further refined with table-sorting procedures based on the Braun–Blanquet floristic–sociological approach of vegetation classification using MEGATAB. Eight MVT’s were identified and described asEragrostis lehmanniana var. lehmanniana–Sclerocarya birrea subsp. caffra Blouberg Northern Plains Bushveld, Euclea divinorum–Acacia tortilis Blouberg Southern Plains Bushveld, Englerophytum magalismontanum–Combretum molle Blouberg Mountain Bushveld, Adansonia digitata–Acacia nigrescens Soutpansberg
    [Show full text]
  • Arundinelleae; Panicoideae; Poaceae)
    Bothalia 19, 1:45-52(1989) Kranz distinctive cells in the culm of ArundineUa (Arundinelleae; Panicoideae; Poaceae) EVANGELINA SANCHEZ*, MIRTA O. ARRIAGA* and ROGER P. ELLIS** Keywords: anatomy, Arundinella, C4, culm, distinctive cells, double bundle sheath, NADP-me ABSTRACT The transectional anatomy of photosynthetic flowering culms of Arundinella berteroniana (Schult.) Hitchc. & Chase and A. hispida (Willd.) Kuntze from South America and A. nepalensis Trin. from Africa is described and illustrated. The vascular bundles are arranged in three distinct rings, the outermost being external to a continuous sclerenchymatous band. Each of these peripheral bundles is surrounded by two bundle sheaths, a complete mestome sheath and an incomplete, outer, parenchymatous Kranz sheath, the cells of which contain large, specialized chloroplasts. Kranz bundle sheath extensions are also present. The chlorenchyma tissue is also located in this narrow peripheral zone and is interrupted by the vascular bundles and their associated sclerenchyma. Dispersed throughout the chlorenchyma are small groups of Kranz distinctive cells, identical in structure to the outer bundle sheath cells. No chlorenchyma cell is. therefore, more than two cells distant from a Kranz cell. The structure of the chlorenchyma and bundle sheaths indicates that the C4 photosynthetic pathway is operative in these culms. This study clearly demonstrates the presence of the peculiar distinctive cells in the culms as well as in the leaves of Arundinella. Also of interest is the presence of an inner bundle sheath in the vascular bundles of the culm whereas the bundles of the leaves possess only a single sheath. It has already been shown that Arundinella is a NADP-me C4 type and the anatomical predictor of a single Kranz sheath for NADP-me species, therefore, either does not hold in the culms of this genus or the culms are not NADP-me.
    [Show full text]
  • Phylogeny and Subfamilial Classification of the Grasses (Poaceae) Author(S): Grass Phylogeny Working Group, Nigel P
    Phylogeny and Subfamilial Classification of the Grasses (Poaceae) Author(s): Grass Phylogeny Working Group, Nigel P. Barker, Lynn G. Clark, Jerrold I. Davis, Melvin R. Duvall, Gerald F. Guala, Catherine Hsiao, Elizabeth A. Kellogg, H. Peter Linder Source: Annals of the Missouri Botanical Garden, Vol. 88, No. 3 (Summer, 2001), pp. 373-457 Published by: Missouri Botanical Garden Press Stable URL: http://www.jstor.org/stable/3298585 Accessed: 06/10/2008 11:05 Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at http://www.jstor.org/page/info/about/policies/terms.jsp. JSTOR's Terms and Conditions of Use provides, in part, that unless you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you may use content in the JSTOR archive only for your personal, non-commercial use. Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at http://www.jstor.org/action/showPublisher?publisherCode=mobot. Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed page of such transmission. JSTOR is a not-for-profit organization founded in 1995 to build trusted digital archives for scholarship. We work with the scholarly community to preserve their work and the materials they rely upon, and to build a common research platform that promotes the discovery and use of these resources. For more information about JSTOR, please contact [email protected].
    [Show full text]
  • Morphological, Anatomical, and Taxonomic Studies in Anomochloa and Streptochaeta (Poaceae: Bambusoideae)
    SMITHSONIAN CONTRIBUTIONS TO BOTANY NUMBER 68 Morphological, Anatomical, and Taxonomic Studies in Anomochloa and Streptochaeta (Poaceae: Bambusoideae) Emmet J. Judziewicz and Thomas R. Soderstrom SMITHSONIAN INSTITUTION PRESS Washington, D.C. 1989 ABSTRACT Judziewicz, Emmet J., and Thomas R. Soderstrom. Morphological, Anatomical, and Taxonomic Studies in Anomochloa and Streptochaeta (Poaceae: Bambusoideae). Smithsonian Contributions to Botany, number 68,52 pages, 24 figures, 1 table, 1989.-Although resembling the core group of the bambusoid grasses in many features of leaf anatomy, the Neotropical rainforest grass genera Anomochloa and Streptochaeta share characters that are unusual in the subfamily: lack of ligules, exceptionally long microhairs with an unusual morphology, a distinctive leaf blade midrib structure, and 5-nerved coleoptiles. Both genera also possess inflorescences that are difficult to interpret in conventional agrostological terms. Anomochloa is monotypic, and A. marantoidea, described in 1851 by Adolphe Brongniart from cultivated material of uncertain provenance, was rediscovered in 1976 in the wet forests of coastal Bahia, Brazil. The inflorescence terminates in a spikelet and bears along its rachis several scorpioid cyme-like partial inflorescences. Each axis of a partial inflorescence is subtended by a keeled bract and bears as its first appendages two tiny, unvascularized bracteoles attached at slightly different levels. The spikelets are composed of an axis that bears two bracts and terminates in a flower. The lower, chlorophyllous, deciduous spikelet bract is separated from the coriaceous, persistent, corniculate upper bract by a cylindrical, indurate internode. The flower consists of a low membrane surmounted by a dense ring of brown cilia (perigonate annulus) surrounding the andrecium of four stamens, and an ovary bearing a single hispid stigma.
    [Show full text]
  • Chapter 5 Phylogeny of Poaceae Based on Matk Gene Sequences
    Chapter 5 Phylogeny of Poaceae Based on matK Gene Sequences 5.1 Introduction Phylogenetic reconstruction in the Poaceae began early in this century with proposed evolutionary hypotheses based on assessment of existing knowledge of grasses (e.g., Bew, 1929; Hubbard 1948; Prat, 1960; Stebbins, 1956, 1982; Clayton, 1981; Tsvelev, 1983). Imperical approaches to phylogenetic reconstruction of the Poaceae followed those initial hypotheses, starting with cladistic analyses of morphological and anatomical characters (Kellogg and Campbell, 1987; Baum, 1987; Kellogg and Watson, 1993). More recently, molecular information has provided the basis for phylogenetic hypotheses in grasses at the subfamily and tribe levels (Table 5.1). These molecular studies were based on information from chloroplast DNA (cpDNA) restriction sites and DNA sequencing of the rbcL, ndhF, rps4, 18S and 26S ribosomal DNA (rDNA), phytochrome genes, and the ITS region (Hamby and Zimmer, 1988; Doebley et al., 1990; Davis and Soreng, 1993; Cummings, King, and Kellogg, 1994; Hsiao et al., 1994; Nadot, Bajon, and Lejeune, 1994; Barker, Linder, and Harley, 1995; Clark, Zhang, and Wendel, 1995; Duvall and Morton, 1996; Liang and Hilu, 1996; Mathews and Sharrock, 1996). Although these studies have refined our concept of grass evolution at the subfamily level and, to a certain degree, at the tribal level, major disagreements and questions remain to be addressed. Outstanding discrepancies at the subfamily level include: 1) Are the pooids, bambusoids senso lato, or herbaceous bamboos the
    [Show full text]
  • Who's Related to Whom?
    149 Who’s related to whom? Recent results from molecular systematic studies Elizabeth A Kellogg Similarities among model systems can lead to generalizations systematist’s question-why are there so many different about plants, but understanding the differences requires kinds of organisms? Studies of the evolution of develop- systematic data. Molecular phylogenetic analyses produce ment demand that the investigator go beyond the model results similar to traditional classifications in the grasses system and learn the pattern of variation in its relatives (Poaceae), and relationships among the cereal crops [3*]. This requires a reasonable assessment of the relatives’ are quite clear. Chloroplast-based phylogenies for the identity. Solanaceae show that tomato is best considered as a species of Solarium, closely related to potatoes. Traditional Knowledge of plant relationships has increased rapidly classifications in the Brassicaceae are misleading with in the past decade, reflecting partly the development regard to true phylogenetic relationships and data are only of molecular systematics. It has been known for some now beginning to clarify the situation. Molecular data are time that plant classifications do not reflect phylogeny also being used to revise our view of relationships among accurately, even though both phylogeny and classification flowering plant families. Phylogenetic data are critical for are hierarchical. The hierarchy of classification was interpreting hypotheses of the evolution of development. imposed in the late 18th century, well before ideas of descent with modification (evolution) were prevalent [4]. These pre-evolutionary groups were then re-interpreted in Address an evolutionary context, and were assumed to be products Harvard University Herbaria, 22 Divinity Avenue Cambridge, MA of evolution, rather than man-made artefacts.
    [Show full text]
  • Phylogenetic Analyses Reveal the Shady History of C4 Grasses Erika J
    Phylogenetic analyses reveal the shady history of C4 grasses Erika J. Edwardsa,1 and Stephen A. Smithb aDepartment of Ecology and Evolutionary Biology, Brown University, Providence, RI 02912; and bNational Evolutionary Synthesis Center, Durham, NC 27705 Edited by Michael J. Donoghue, Yale University, New Haven, CT, and approved December 31, 2009 (received for review August 24, 2009) Grasslands cover more than 20% of the Earth's terrestrial surface, has provided a strong selection pressure for C4 evolution in and their rise to dominance is one of the most dramatic events of eudicots (4). Grasses have long been viewed as an interesting biome evolution in Earth history. Grasses possess two main photo- exception to this pattern (9). Significant positive correlations synthetic pathways: the C3 pathway that is typical of most plants between C4 grass abundance and growing season temperature and a specialized C4 pathway that minimizes photorespiration and have been documented at both continental and regional scales thus increases photosynthetic performance in high-temperature (10–13); C4 grasses dominate tropical grasslands and savannas and/or low-CO2 environments. C4 grasses dominate tropical and but are virtually absent from cool-temperate grasslands and subtropical grasslands and savannas, and C3 grasses dominate the steppes. Furthermore, both experimental measurements of world's cooler temperate grassland regions. This striking pattern photosynthetic light use efficiency (termed “quantum yield”), has been attributed to C4 physiology, with the implication that the and predictions of leaf models of C3 and C4 photosynthesis evolution of the pathway enabled C4 grasses to persist in warmer provide strong evidence that C4 grasses outperform C3 grasses at climates than their C3 relatives.
    [Show full text]